<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d3 20150301//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1d3" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">07540</article-id><article-id pub-id-type="doi">10.7554/eLife.07540</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Chromosomes and Gene Expression</subject></subj-group></article-categories><title-group><article-title>Circular RNA biogenesis can proceed through an exon-containing lariat precursor</article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes" id="author-30729"><name><surname>Barrett</surname><given-names>Steven P</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="other" rid="par-3"/><xref ref-type="other" rid="par-4"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-31538"><name><surname>Wang</surname><given-names>Peter L</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-31537"><name><surname>Salzman</surname><given-names>Julia</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="corresp" rid="cor2">*</xref><xref ref-type="other" rid="par-1"/><xref ref-type="other" rid="par-2"/><xref ref-type="other" rid="par-5"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution content-type="dept">Department of Biochemistry</institution>, <institution>Stanford University School of Medicine</institution>, <addr-line><named-content content-type="city">Stanford</named-content></addr-line>, <country>United States</country></aff><aff id="aff2"><label>2</label><institution content-type="dept">Stanford Cancer Institute</institution>, <institution>Stanford University School of Medicine</institution>, <addr-line><named-content content-type="city">Stanford</named-content></addr-line>, <country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor" id="author-2085"><name><surname>Black</surname><given-names>Douglas L</given-names></name><role>Reviewing editor</role><aff><institution>Howard Hughes Medical Institute, University of California, Los Angeles</institution>, <country>United States</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>sbarret1@stanford.edu</email> (SPB);</corresp><corresp id="cor2"><email>julia.salzman@stanford.edu</email> (JS)</corresp></author-notes><pub-date date-type="pub" publication-format="electronic"><day>09</day><month>06</month><year>2015</year></pub-date><pub-date pub-type="collection"><year>2015</year></pub-date><volume>4</volume><elocation-id>e07540</elocation-id><history><date date-type="received"><day>19</day><month>03</month><year>2015</year></date><date date-type="accepted"><day>08</day><month>06</month><year>2015</year></date></history><permissions><copyright-statement>© 2015, Barrett et al</copyright-statement><copyright-year>2015</copyright-year><copyright-holder>Barrett et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-07540-v2.pdf"/><abstract><object-id pub-id-type="doi">10.7554/eLife.07540.001</object-id><p>Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression programs, yet its function remains largely unknown. The presumed biogenesis of these RNAs involves a non-canonical ‘backsplicing’ event. Recent studies in mammalian cell culture posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s). Although such sequence elements are common in mammals, they are rare in lower eukaryotes, making current models insufficient to describe circularization. Through systematic splice site mutagenesis and the identification of splicing intermediates, we show that circular RNA in <italic>Schizosaccharomyces pombe</italic> is generated through an exon-containing lariat precursor. Furthermore, we have performed high-throughput and comprehensive mutagenesis of a circle-forming exon, which enabled us to discover a systematic effect of exon length on RNA circularization. Our results uncover a mechanism for circular RNA biogenesis that may account for circularization in genes that lack noticeable flanking intronic secondary structure.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.001">http://dx.doi.org/10.7554/eLife.07540.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.07540.002</object-id><title>eLife digest</title><p>DNA contains the instructions to make proteins. These instructions are first copied into a molecule of RNA, which often has sections that code for protein (called exons) interrupted by non-coding sections (called introns). A process called splicing removes the introns and joins the exons to form a mature RNA molecule that is then translated to make proteins.</p><p>The standard splicing process joins the first exon to the second, and the second to the third, and so on to produce a liner RNA molecule. Occasionally, one or more of the exons can be skipped in a process known as ‘alternative splicing’. In recent years, scientists have discovered that another type of alternative splicing, which creates circular RNA molecules, is common in animal cells. It was suggested that circular RNAs might form when the splicing machinery joins the two ends of the same exon via a process referred to as ‘backsplicing’.</p><p>Standard splicing first converts an intron into a looped structure called a ‘lariat’ (which resembles a lasso); the lariat is then removed by the splicing machinery and destroyed. When exons are skipped during alternative splicing, a large lariat containing the skipped exon is produced. Now, Barrett et al. have used yeast cells to investigate how circular RNAs are formed. Yeast is a good model to study this process because it can be manipulated easily in the laboratory and expresses circular RNAs. The experiments show that lariat structures containing exons (as would be expected from exon-skipping) are a common intermediate step before the production of a circular RNA. However, some exon-containing lariats do not go on to form circular RNAs, suggesting that additional factors are important for the production of circular RNAs.</p><p>Barrett et al. next investigated the reasons why certain exons formed circular RNAs while others did not and revealed that longer exons formed circular RNAs more readily than shorter exons. Further work is now required to understand the molecular basis of this result and identify other factors that contribute to the formation of circular RNAs.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.002">http://dx.doi.org/10.7554/eLife.07540.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>splicing</kwd><kwd>circular RNA</kwd><kwd>lariat</kwd><kwd>debranching</kwd><kwd>RNA-seq</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>S. pombe</italic></kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000054</institution-id><institution>National Cancer Institute (NCI)</institution></institution-wrap></funding-source><award-id>R00, CA168987-03</award-id><principal-award-recipient><name><surname>Salzman</surname><given-names>Julia</given-names></name></principal-award-recipient></award-group><award-group id="par-2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100007491</institution-id><institution>Donald E. and Delia B. Baxter Foundation</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Salzman</surname><given-names>Julia</given-names></name></principal-award-recipient></award-group><award-group id="par-3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100005492</institution-id><institution>Stanford University</institution></institution-wrap></funding-source><award-id>Stanford Graduate Fellowship</award-id><principal-award-recipient><name><surname>Barrett</surname><given-names>Steven P</given-names></name></principal-award-recipient></award-group><award-group id="par-4"><funding-source><institution-wrap><institution>Lucille P. Markey Charitable Trust</institution></institution-wrap></funding-source><award-id>Lucille P. Markey Biomedical Research Fellowship</award-id><principal-award-recipient><name><surname>Barrett</surname><given-names>Steven P</given-names></name></principal-award-recipient></award-group><award-group id="par-5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000879</institution-id><institution>Alfred P. Sloan Foundation</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Salzman</surname><given-names>Julia</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2.3</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Systematic splice site mutagenesis and the identification of splicing intermediates provides evidence that the dominant mechanism for the generation of circular RNA in fission yeast proceeds through an exon-containing lariat precursor.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression; these circular isoforms are ubiquitously expressed in humans and a number of highly diverged eukaryotic organisms and can exceed the level of the cognate mRNA (<xref ref-type="bibr" rid="bib28">Salzman et al., 2012</xref>; <xref ref-type="bibr" rid="bib21">Memczak et al., 2013</xref>; <xref ref-type="bibr" rid="bib27">Salzman et al., 2013</xref>; <xref ref-type="bibr" rid="bib34">Wang et al., 2014</xref>). Rare examples of circular RNA expression had been known to exist for decades, but with a handful of exceptions, only known to exist at levels suggesting they were transcriptional noise or in vitro artifacts (<xref ref-type="bibr" rid="bib23">Nigro et al., 1991</xref>; <xref ref-type="bibr" rid="bib8">Cocquerelle et al., 1992</xref>; <xref ref-type="bibr" rid="bib37">Zaphiropoulos, 1996</xref>). The basic mechanism responsible for the biogenesis of circular RNA involves a ‘backsplicing’ reaction in which a branch point upstream of a circularized exon attacks a downstream splice donor, positioning the 3′ end of the exon to attack its own 5′ end in the second step (<xref ref-type="fig" rid="fig1">Figure 1</xref>) (<xref ref-type="bibr" rid="bib5">Braun et al., 1996</xref>; <xref ref-type="bibr" rid="bib24">Pasman et al., 1996</xref>; <xref ref-type="bibr" rid="bib29">Schindewolf et al., 1996</xref>).<fig-group><fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.07540.003</object-id><label>Figure 1.</label><caption><title>Models for the production of circular RNA.</title><p>(<italic>Left)</italic> Complementary sequences facilitate the biogenesis of circular RNA. (<italic>Right)</italic> Circular RNA biogenesis proceeds through a lariat precursor.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.003">http://dx.doi.org/10.7554/eLife.07540.003</ext-link></p></caption><graphic xlink:href="elife-07540-fig1-v2.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.004</object-id><label>Figure 1—figure supplement 1.</label><caption><title><italic>mrps16</italic> pre-mRNA predicted pair probabilities.</title><p>Dot plot representation of the predicted minimum free energy (MFE) <italic>mrps16</italic> pre-mRNA secondary structure. This structure was predicted using the NUPACK web server. The area highlighted by the orange box represents the region where interactions between flanking sequences would be predicted. The nature of the nearby long-range interactions between exon 2 and intron 2/exon 3 is illustrated in the MFE structure of the <italic>mrps16</italic> pre-mRNA.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.004">http://dx.doi.org/10.7554/eLife.07540.004</ext-link></p></caption><graphic xlink:href="elife-07540-fig1-figsupp1-v2.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.005</object-id><label>Figure 1—figure supplement 2.</label><caption><title><italic>mrps16</italic> pre-mRNA predicted MFE structure.</title><p>Long-range interactions between exon 2 and intron 2/exon 3 are highlighted above. The blue line traces the path of exon 2, the orange line traces the path of intron 2, and the green line traces the path of the first 17 nucleotides of exon 3. The vertical lines demarcate the start and end of each segment. Note, these predicted long-range interactions do not extend to regions beyond exon 2 and thus, no extensive base-pairing interactions are predicted to form between the segments of the gene that flank the exon (also depicted in the dot plot shown in <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). The pink oval marks a highly structured region of exon 2, which is noted later in our discussion of exonic sequence deletions.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.005">http://dx.doi.org/10.7554/eLife.07540.005</ext-link></p></caption><graphic xlink:href="elife-07540-fig1-figsupp2-v2.tif"/></fig></fig-group></p><p>Until recently, one of the only known examples of an abundant circular RNA was discovered in the mouse sex-determining gene, SRY (<xref ref-type="bibr" rid="bib7">Capel et al., 1993</xref>). This exon is flanked by long (∼15 kb) inverted sequence whose complementarity is required for circularization (<xref ref-type="bibr" rid="bib12">Dubin et al., 1995</xref>). Early in vitro studies also demonstrated that complementary sequences flanking an exon can promote circularization, though they did not appear necessary (<xref ref-type="bibr" rid="bib24">Pasman et al., 1996</xref>). Modeled after work on SRY, recent studies in mammalian cell culture have found similar results in human genes (<xref ref-type="bibr" rid="bib19">Liang and Wilusz, 2014</xref>; <xref ref-type="bibr" rid="bib39">Zhang et al., 2014b</xref>), and additional genome-wide computational sequence analysis suggests this complementary sequence-mediated mechanism may be widespread and associated with Alu elements (<xref ref-type="bibr" rid="bib17">Jeck et al., 2013</xref>; <xref ref-type="bibr" rid="bib39">Zhang et al., 2014b</xref>; <xref ref-type="bibr" rid="bib15">Ivanov et al., 2015</xref>).</p><p>Although widespread in mammalian genomes, repeat sequences are far less common in the genomes of simple eukaryotes, indicating that an alternative mechanism may be at play in these organisms and in human genes that lack inverted repeats. In addition, a recently published study in <italic>Drosophila</italic> fails to find a remarkable relationship between secondary structure and circular RNA biogenesis, noting that there are no noticeable sequence motifs in the introns flanking circularized exons besides canonical splice site sequences (<xref ref-type="bibr" rid="bib35">Westholm et al., 2014</xref>).</p><p>An alternative mechanism that has long been proposed in the literature involves an exon-containing lariat, which can serve as a precursor to the circularized exon (<xref ref-type="fig" rid="fig1">Figure 1</xref>, right) (<xref ref-type="bibr" rid="bib37">Zaphiropoulos, 1996</xref>; <xref ref-type="bibr" rid="bib31">Surono et al., 1999</xref>; <xref ref-type="bibr" rid="bib6">Burd et al., 2010</xref>; <xref ref-type="bibr" rid="bib17">Jeck et al., 2013</xref>; <xref ref-type="bibr" rid="bib16">Jeck and Sharpless, 2014</xref>). An early study noted a correlation between exon-skipping events and circular RNA isoforms in the human cytochrome P450 2C18 gene, describing four alternative circularization events and their corresponding exon-skipped transcripts (<xref ref-type="bibr" rid="bib37">Zaphiropoulos, 1996</xref>); a similar correspondence was noted in the dystrophin gene (<xref ref-type="bibr" rid="bib31">Surono et al., 1999</xref>). Recently, a study in human cell culture posits a correlation between exon skipping and circular RNA biogenesis in a model gene, but treats the exon-skipping event as a byproduct rather than a precursor of the backsplicing event, regarding inverted sequences as the determinant of circularization (<xref ref-type="bibr" rid="bib39">Zhang et al., 2014b</xref>). Indeed, the only current evidence for this model is based on correlation between exon skipping and circular RNA production in a handful of genes. No biochemical evidence of the activity of this pathway has been provided, and no global relationship exists between exon skipping and circular RNA biogenesis.</p><p>Due to the large size of human genes, cell culture studies have been unable to ectopically express entire circle-forming genes on a plasmid and therefore have not been able to completely recapitulate splicing from the endogenous locus. Instead, expressed minigenes containing circle-forming exons and immediately flanking sequence have been used as surrogates (<xref ref-type="bibr" rid="bib1">Ashwal-Fluss et al., 2014</xref>; <xref ref-type="bibr" rid="bib19">Liang and Wilusz, 2014</xref>; <xref ref-type="bibr" rid="bib39">Zhang et al., 2014b</xref>; <xref ref-type="bibr" rid="bib30">Starke et al., 2015</xref>). These expression vectors may produce results that are due to characteristics of transcription in the minigene and, in some cases, generate large amounts of off-target splice products. The ability to recapitulate the splicing of an endogenous locus is a powerful tool for studying the mechanism of circular RNA production. For this reason, we turned to <italic>Schizosaccharomyces pombe</italic> as our model system for studying this process. With a simple and small gene structure and relatively high expression of some circular RNAs, <italic>S. pombe</italic> is an ideal system for studying circular RNA biogenesis. Because the second exon of <italic>mrps16</italic> is the most highly expressed circular RNA in this organism (<xref ref-type="bibr" rid="bib34">Wang et al., 2014</xref>), we have adopted <italic>mrps16</italic> as our model RNA for studying circular RNA production in the present work.</p><p>Utilizing the lariat debranching mutant (<italic>dbr1∆</italic>), we provide direct evidence of an exon-containing lariat precursor and the double lariat resulting from lariat re-splicing (<xref ref-type="fig" rid="fig1">Figure 1</xref>, right). Furthermore, by expressing <italic>mrps16</italic> on a plasmid, we completely recapitulate the quantitative relationship between circular and linear RNA expression in this gene, and through systematic splice site deletions of this plasmid, we demonstrate the necessity of a lariat precursor for circular RNA biogenesis. However, lariat production is not sufficient for circularization, as demonstrated by the existence of several exon-containing lariats that do not give rise to circular RNAs, indicating an additional parameter regulating their production. Overall, circularized exons are generally much larger than these skipped, uncircularized exons. To test if the length of circularized exons directly affects their circularization efficiency (CE), we utilized high-throughput and comprehensive mutagenesis of the <italic>mrps16</italic> exon, which revealed that exon size is a significant determinant of RNA circularization.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Direct biochemical detection of backsplicing intermediates supports the existence of an exon-containing lariat precursor</title><p>We considered two models for the production of circular RNA in <italic>mrps16</italic>: that circular RNA is generated by ‘direct backsplicing,’ perhaps facilitated by complementary sequence (<xref ref-type="fig" rid="fig1">Figure 1</xref>, left), or through a lariat precursor (<xref ref-type="fig" rid="fig1">Figure 1</xref>, right). Each model predicts a distinct set of biochemical intermediates and byproducts: a Y-shaped intermediate in the case of direct backsplicing; and a lariat precursor and double lariat in the case of the lariat model. These structurally distinct species discriminate the models, and we reasoned that determining which of these products exists could provide initial evidence for one or both of these models. Before performing biochemical identification of these intermediates, we computationally predicted the structure of the <italic>mrps16</italic> pre-mRNA to determine if there were any base-pairing interactions across the circularized exon. We found that <italic>mrps16</italic> lacks any apparent base pairing between the regions flanking the circularized exon (<xref ref-type="fig" rid="fig1s1 fig1s2">Figure 1—figure supplements 1, 2</xref>); thus, we hypothesized that the biogenesis of this circular RNA might proceed through a lariat precursor generated by exon skipping.</p><p>As canonical lariats are of low abundance and difficult to detect in wild-type fission yeast, we used a strain of yeast (<italic>dbr1∆</italic>) lacking the debranching enzyme, which catalyzes the hydrolysis of the branch point 2′–5′ linkage, the first step of lariat decay (<xref ref-type="bibr" rid="bib26">Ruskin and Green, 1985</xref>). In this mutant, branched species can reach a much higher steady state concentration (<xref ref-type="bibr" rid="bib22">Nam et al., 1997</xref>). We attempted to detect each of the products described above by reverse transcription-PCR (RT-PCR), Sanger sequencing all major products to determine their identities.</p><p>Using outward-facing primers, we detected the canonical lariat byproducts from linear splicing, formed by the introns of <italic>mrps16</italic> in <italic>dbr1∆</italic> yeast (<xref ref-type="fig" rid="fig2">Figure 2A</xref>, Lanes 3–6) along with the circularized form of exon 2 in both strains (<xref ref-type="fig" rid="fig2">Figure 2A</xref>, Lanes 7–8). Although <italic>mrps16</italic> is not known to have exon skipping, we easily detected the exon-containing lariat resulting from exon skipping (i.e., the lariat precursor) (<xref ref-type="fig" rid="fig2">Figure 2A</xref>, Lane 10) and verified the product's sequence through Sanger sequencing (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, top). Using inward-facing primers that would amplify a linear exon 1–3 splice, we did not detect an exon-skipped transcript in either strain (<xref ref-type="fig" rid="fig2">Figure 2A</xref>, Lanes 1–2). This result is in agreement with recent evidence from deep-sequencing experiments, which revealed that while exon skipping is quite pervasive in <italic>S. pombe</italic>, most exon-skipped transcripts are subject to nuclear decay and are thus detectable only in mutants deficient in decay (<xref ref-type="bibr" rid="bib3">Bitton et al., 2015</xref>). Specifically, exon-skipped transcripts for <italic>mrps16</italic> can compose up to 5% of all detected <italic>mrps16</italic> transcripts in <italic>S. pombe</italic> mutants deficient in Dis3, a nuclear exosome component (<xref ref-type="bibr" rid="bib3">Bitton et al., 2015</xref>; See Supp. Table S5)<italic>.</italic> This represents a &gt;30-fold increase over wild-type <italic>S. pombe</italic>.<fig-group><fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.07540.006</object-id><label>Figure 2.</label><caption><title>RT-PCR analysis of circular RNA biogenesis intermediates.</title><p>(<bold>A</bold>) reverse transcription-PCR (RT-PCR) of splice products and byproducts of <italic>mrps16 pre-mRNA</italic> in wild-type and <italic>dbr1∆ S. pombe</italic>. Primers used are indicated above each lane of the gel. Red dots represent the location of branch points. The observed products are shown below the gel. Laddering of bands in lanes 7 and 8 is due to rolling-circle reverse transcription of the 181 nt <italic>mrps16</italic> circular RNA. (<bold>B</bold>) Sequencing trace for product in <xref ref-type="fig" rid="fig2">Figure 2A</xref>, lane 10 (Top) and <xref ref-type="fig" rid="fig2">Figure 2D</xref> lane 12 (Bottom) (each marked with * on respective gels). Due to the 2′–5′ linkage at the branch point, there is base misincorporation or nucleotide skipping at the branch point by the reverse transcriptase (highlighted in trace). Note, the top trace is mirrored for consistency with the orientation in the graphic representation. (<bold>C</bold>) Strategy to enrich for the byproduct of circular RNA backsplicing event. Since the circularized exon of <italic>mrps16</italic> contains a <italic>Dra</italic>I restriction site, we can deplete PCR products containing the exon. (<bold>D</bold>) RT-PCR results after RNase R and/or <italic>Dra</italic>I treatment (treatment indicated above the gel).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.006">http://dx.doi.org/10.7554/eLife.07540.006</ext-link></p></caption><graphic xlink:href="elife-07540-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.007</object-id><label>Figure 2—figure supplement 1.</label><caption><title>qPCR analysis of <italic>mrps16</italic> splice isoforms.</title><p>The relative proportions of the species computed by subtracting mean Ct values from mean Ct values of the linear RNA. Error bars represent standard deviations from replicate experiments. Percentages are computed assuming perfect qPCR primer efficiency for all primers and are noted beneath the bars.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.007">http://dx.doi.org/10.7554/eLife.07540.007</ext-link></p></caption><graphic xlink:href="elife-07540-fig2-figsupp1-v2.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.008</object-id><label>Figure 2—figure supplement 2.</label><caption><title><xref ref-type="fig" rid="fig2">Figure 2D</xref>, Lane 12 cloning and sequencing results.</title><p>The products from <xref ref-type="fig" rid="fig2">Figure 2D</xref>, Lane 12 (reproduced above) were cloned, and 16 colonies were chosen for PCR analysis. Four distinct groups of products were observed, labeled A, B/C, D, and ‘undetected’. All products were sequenced and the results of each group of bands are described here. Products B/C correspond to the ‘doublet’ product observed in lane 12; the alignment of these sequences is shown in <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>. ‘Undetected’ refers to a PCR product that is not visible in the gel representing the original PCR reaction.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.008">http://dx.doi.org/10.7554/eLife.07540.008</ext-link></p></caption><graphic xlink:href="elife-07540-fig2-figsupp2-v2.tif"/></fig><fig id="fig2s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.009</object-id><label>Figure 2—figure supplement 3.</label><caption><title>Alignment of backsplice byproduct PCR products.</title><p>The group of products labeled B/C in the lower gel in <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref> was sequenced and aligned using ClustalW2. The lane numbers to the left of the sequences correspond to the lower gel shown in <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>. The length of each product is shown at the end of each sequence.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.009">http://dx.doi.org/10.7554/eLife.07540.009</ext-link></p></caption><graphic xlink:href="elife-07540-fig2-figsupp3-v2.tif"/></fig><fig id="fig2s4" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.010</object-id><label>Figure 2—figure supplement 4.</label><caption><title>Additional <italic>Dra</italic>I restriction digest PCR for Y-shaped intermediate product.</title><p>Panel 2D with additional lanes indicating attempted amplification of the Y-shaped intermediate. As in 2D, primers used are indicated above the gel and observed products are illustrated below. The off-target product is the higher molecular weight species (lane 13) and represents mispriming of the reverse primer to a downstream site in exon 3.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.010">http://dx.doi.org/10.7554/eLife.07540.010</ext-link></p></caption><graphic xlink:href="elife-07540-fig2-figsupp4-v2.tif"/></fig></fig-group></p><p>To quantify the relative abundance of the <italic>mprs16</italic> linear, circular, and exon-containing lariat species, we performed qPCR on RNA from both wild-type and <italic>dbr1∆</italic> yeast (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). We observed that the circular RNA is expressed at ∼one-eighth the expression of the linear mRNA, and in <italic>dbr1∆</italic> yeast, the exon-containing lariat is expressed at ∼1/30th the expression of the linear RNA.</p><p>To test for the branched sequence indicative of the double lariat and Y-shaped intermediate (see <xref ref-type="fig" rid="fig1">Figure 1</xref>), we performed a PCR using inward-facing primers in the introns of <italic>mrps16</italic> (<xref ref-type="fig" rid="fig2">Figure 2A</xref>, Lanes 11–12), but we were only able to recover an unspliced product containing exon 2, which could be derived from genomic DNA, pre-mRNA, and the exon 2-containing lariat; the high abundance of these species impedes the detection of the putative double lariat/Y-shaped intermediate products. To deplete these species prior to PCR amplification, we used the restriction enzyme <italic>Dra</italic>I, which cuts uniquely within exon 2 of <italic>mrps16</italic> (see schematic in <xref ref-type="fig" rid="fig2">Figure 2C</xref>). In parallel, prior to cDNA synthesis, we treated RNA with RNase R, a 3′–5′ exonuclease, which degrades linear species but cannot degrade circular RNA or lariats, or with a mock treatment not containing RNase.</p><p>We tested the sensitivity of the exon-containing lariat and linear mRNA to <italic>Dra</italic>I and RNase R treatment as controls: RNase R decreases the abundance of the mRNA only, while treatment with <italic>Dra</italic>I decreases the abundance of both mRNA and the exon-containing lariat (<xref ref-type="fig" rid="fig2">Figure 2D</xref>, Lanes 1–8). Because of its high expression, there was still a significant amount of linear mRNA after each of these treatments, and treating with both <italic>Dra</italic>I and RNase R had an additive effect on its depletion (<xref ref-type="fig" rid="fig2">Figure 2D</xref>, Lanes 1–4). Using this combined depletion, we again attempted to amplify the branched sequence indicative of the backsplicing event with inward-facing primers in the introns of <italic>mrps16</italic>. As before, we amplified a dominant product containing exon 2 after treating with <italic>Dra</italic>I or RNase R separately. However, after the combined treatment, we discovered a new product at the expected size (518 bp) for the branched byproduct diagnostic of backsplicing (<xref ref-type="fig" rid="fig2">Figure 2D</xref>, Lane 12); this product is also faintly visible in singly-treated lanes (<xref ref-type="fig" rid="fig2">Figure 2D</xref>, Lanes 10 and 11). Sanger sequencing revealed the expected sequence for the product with a misincorporation event at the branch point, which can arise during reverse transcription of lariats (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, bottom) (<xref ref-type="bibr" rid="bib33">Vogel et al., 1997</xref>). We noted the ‘doublet’ appearance of this product, and through thorough characterization by cloning and sequencing, we determined that the two bands do not represent distinct splice isoforms and are likely a technical artifact due to anomalous migration on our gel (<xref ref-type="fig" rid="fig2s2 fig2s3">Figure 2—figure supplements 2, 3</xref>).</p><p>The enrichment of this product after RNase R treatment is strong evidence that this PCR product was derived from the double lariat rather than the Y-shaped intermediate, as the latter would be degraded by RNase R. In addition, by moving the forward primer upstream by only ∼100 bp into exon 1, we were unable to detect a PCR product indicative of the Y-shaped intermediate (predicted size 634 bp) after treatment with <italic>Dra</italic>I, RNase R, or both (<xref ref-type="fig" rid="fig2s4">Figure 2—figure supplement 4</xref>, Lanes 13–16).</p></sec><sec id="s2-2"><title>Quantitative analysis of splice isoforms demonstrates that the dominant pathway for circular RNA biogenesis in <italic>mrps16</italic> is through an exon-containing lariat precursor</title><p>With evidence for the existence of the putative lariat precursor and double lariat, we performed genetic tests to determine if this model is the dominant pathway for circular RNA biogenesis in <italic>mrps16</italic>. We cloned the <italic>mrps16</italic> gene in its entirety, along with 1 kb upstream and downstream into a plasmid, which allows the gene to be expressed using its natural promoter and terminator. Because <italic>mrps16</italic> is an essential gene, we expressed the plasmid copy of the gene in addition to its genomic copy. In <italic>dbr1∆ S. pombe</italic>, the plasmid expression of the gene is roughly 10 fold higher than the expression from genomic copy, likely due to the high-copy number of the plasmid. The ratio of the dominant splice isoforms of <italic>mrps16</italic> (i.e., circular, linear, and lariat precursor) is consistent between the genomic and plasmid copy of the gene, indicating expression from the plasmid does not bias the splicing pattern in a significant way (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). In addition, the circular RNA produced from the plasmid is RNase R resistant and, notably, exhibits the same level of RNase R resistance as the genomic copy (<xref ref-type="fig" rid="fig3">Figure 3B</xref>), strong evidence that the plasmid generates a circle rather than a spliced linear concatamer of exons.<fig-group><fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.07540.011</object-id><label>Figure 3.</label><caption><title>Quantitative analysis of <italic>mrps16</italic> splice isoforms in <italic>dbr1∆ S</italic>. <italic>pombe</italic> reveals circular RNA can be produced through an exon-containing lariat precursor.</title><p>(<bold>A</bold>) qPCR quantification of splice isoforms produced by ectopically expressed <italic>mrps16</italic> relative to background expression of each isoform. (<bold>B</bold>) qPCR quantification of RNase R resistance of the endogenously and ectopically expressed <italic>mrps16</italic> circular and linear RNA isoforms. Positive values represent enrichment, while negative values represent depletion after RNase R treatment. (<bold>C</bold>–<bold>D</bold>) qPCR quantification of ectopically expressed <italic>mrps16</italic> circular RNA (<bold>C</bold>) and lariat precursor RNA (<bold>D</bold>) for splice site and branch point mutants relative to background. Cryptic splicing of the 3′ ss in intron 1 generates a circular RNA whose junction differs by 5 nt, and cryptic splicing of the 5′ ss in intron 1 generates a larger lariat precursor using a 5′ ss positioned 74 nt upstream of the original splice site. (<bold>E</bold>) Simplified kinetic framework for the production and decay of circular RNA. Under this model, the values presented in (<bold>F</bold>) represent log<sub>2</sub>(k<sub>2mut</sub>/k<sub>2wt</sub>). (<bold>F</bold>) Ratio of circular to lariat precursor RNA for splice site and branch point mutants relative to background ratios. Red (predicted value &lt; 0) and green (predicted value = 0) coloring represents predictions under the lariat model. These predictions neglect any effects due to cryptic splicing. In all cases, error bars represent standard deviations from replicate experiments.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.011">http://dx.doi.org/10.7554/eLife.07540.011</ext-link></p></caption><graphic xlink:href="elife-07540-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.012</object-id><label>Figure 3—figure supplement 1.</label><caption><title>Agarose gel electrophoresis of <italic>mrps16</italic> qPCR products.</title><p>Primers used are indicated above the gel, and the splice site mutants tested are indicated directly below the gel using a number key. Cryptic splicing of a large lariat precursor using a 5′ ss in exon 1 is responsible for the size shift observed in lane 11.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.012">http://dx.doi.org/10.7554/eLife.07540.012</ext-link></p></caption><graphic xlink:href="elife-07540-fig3-figsupp1-v2.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.013</object-id><label>Figure 3—figure supplement 2.</label><caption><title>Effect of 5′ ss and BP double deletion on <italic>mrps16</italic> circularization.</title><p>qPCR quantification of ectopically expressed <italic>mrps16</italic> circular RNA. Splice site and branch point mutations are noted as in 3C. Values for EV, <italic>wt mrps16</italic>, and 5′ ss deletion are repeated here for reference. In all cases, error bars represent standard deviations from replicate experiments.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.013">http://dx.doi.org/10.7554/eLife.07540.013</ext-link></p></caption><graphic xlink:href="elife-07540-fig3-figsupp2-v2.tif"/></fig><fig id="fig3s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.014</object-id><label>Figure 3—figure supplement 3.</label><caption><title>Analysis of <italic>S. pombe pub1</italic> circular RNA splicing.</title><p>(<bold>A</bold>) Architecture of the <italic>pub1</italic> gene along with sequencing traces for exon-skipped lariats. Traces were derived from Sanger sequencing of RT-PCR products from <italic>dbr1∆ S. pombe</italic>. (<bold>B</bold>) RT-PCR for <italic>pub1</italic> circular and linear RNA. Isoforms of the <italic>pub1</italic> (wt and ∆BP) are indicated below the gel. (<bold>C</bold>) qPCR quantification of circular RNA isoforms. Expressed form of <italic>pub1</italic> is indicated on the bars, and circular isoform tested is shown to the left. Experiments shown in (<bold>B</bold>) and (<bold>C</bold>) were both performed in a <italic>pub1∆</italic> background with <italic>pub1</italic> expressed ectopically on a plasmid. Error bars represent standard deviations from technical replicates.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.014">http://dx.doi.org/10.7554/eLife.07540.014</ext-link></p></caption><graphic xlink:href="elife-07540-fig3-figsupp3-v2.tif"/></fig></fig-group></p><p>Using the plasmid copy of <italic>mrps16</italic>, we systematically deleted each of the splice sites and branch points in the introns of the gene and transformed these mutants into <italic>dbr1∆ S. pombe</italic>. As predicted by both models (<xref ref-type="fig" rid="fig1">Figure 1</xref>), qPCR confirmed that the branch point upstream of the circularized exon and the 5′ ss in intron 2 are both necessary for circularization to occur (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). Some of our mutagenesis experiments were confounded by activation of cryptic splice sites in <italic>mrps16</italic>. For example, deletion of the 3′ ss upstream of the circularized exon has almost no impact on circular RNA production (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). This is due to cryptic splicing at a nearby 3′ ss located 5 nt downstream of the original splice site (determined by Sanger sequencing, data not shown).</p><p>Both the 5′ ss of intron 1 and branch point of intron 2 are uniquely necessary for circular RNA biogenesis under the lariat model, which predicts that deleting either of these sites should disrupt circularization. On the other hand, neither of these sites play necessary roles in the direct-backsplice model; if anything, their deletion might be expected to increase circularization by decreasing competition from linear splicing. As predicted by the lariat model, deletion of the downstream branch point abolishes circular RNA biogenesis from the plasmid (<xref ref-type="fig" rid="fig3">Figure 3C</xref>), and indeed this is the only mutant in which no lariat precursor is produced above background (<xref ref-type="fig" rid="fig3">Figure 3D</xref>). In contrast, deletion of the 5′ ss of intron 1 results in cryptic splicing of a larger lariat species (<xref ref-type="fig" rid="fig3">Figure 3D</xref>), containing 74 nt of the upstream exon (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>, Lane 11; product validated by sequencing) and also results in circular RNA production (<xref ref-type="fig" rid="fig3">Figure 3C</xref>).</p><p>Using steady state, first-order kinetics (<xref ref-type="fig" rid="fig3">Figure 3E</xref>) to model circular RNA production in each of the mutants, we tested whether our qPCR data were consistent with the kinetic predictions of the lariat model. This model predicts that the fold change in rate of the second round of splicing corresponding to a given splice site deletion (k<sub>2mut</sub>/k<sub>2wt</sub>) is equal to the relative circle:lariat ratio (plotted for each mutant in <xref ref-type="fig" rid="fig3">Figure 3F</xref>). Under this model, deletions which do not perturb the kinetics of the second round of splicing will have an unchanged circle:lariat ratio. Neglecting cryptic splicing, deletion of the 5′ ss of intron 1 and the branch point and 3′ ss of intron 2 should have a constant circle:lariat ratio, and generally this association holds (<xref ref-type="fig" rid="fig3">Figure 3F</xref>, green bars). Another prediction of the lariat model is that deletions that disrupt the second round of splicing should have a dramatically lower circle:lariat ratio. As predicted, deletions of the branch point in intron 1 and flanking splice sites drastically reduce the rate of circular RNA biogenesis from the lariat precursor, which accumulates relative to the circular RNA (<xref ref-type="fig" rid="fig3">Figure 3F</xref>, red bars).</p><p>We observed that both mutants impacting the first round of splicing in the lariat model produce slightly more circular RNA than would be predicted under this simple kinetic model. Notably, the 5′ ss deletion in intron 1 fails to behave as a naive model would predict due to cryptic splicing that generates a variant exon 2-containing lariat. To determine if the lariat precursor remains the major pathway for circular RNA biogenesis in this mutant, we created an <italic>mrps16</italic> mutant containing both deletion of the upstream 5′ ss and downstream branch point (to halt production of the lariat precursor), and, indeed, circular RNA production is strongly abated (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). Still, for this double mutant and the single downstream branch point mutation (both of which are unable to produce a lariat precursor), circular RNA production is slightly higher than predicted under a model relying <italic>exclusively</italic> on a lariat. Thus, we cannot rule out that there may be a small population of circular RNA generated via a direct backsplice mechanism, as previously reported in vitro (<xref ref-type="bibr" rid="bib24">Pasman et al., 1996</xref>; <xref ref-type="bibr" rid="bib29">Schindewolf et al., 1996</xref>).</p><p>To determine whether the lariat model is unique to <italic>mrps16</italic>, we mutagenized another circle-forming gene, <italic>pub1</italic>. <italic>pub1</italic> contains four exons and produces two alternative circular isoforms: one composed only of exon 3 (<xref ref-type="bibr" rid="bib34">Wang et al., 2014</xref>) and another, much less abundant isoform, consisting of exon 2 and exon 3 along with the intervening intron. From <italic>dbr1∆ S. pombe</italic>, we detected the corresponding lariat precursors to each circular RNA isoform by RT-PCR and sequenced the products to confirm (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3A</xref>). To test whether the lariat precursor is necessary for circularization in this gene, we created a plasmid containing the <italic>pub1</italic> gene, with and without a deletion in the downstream branch point. Because <italic>pub1</italic> is non-essential, we performed these experiments in a <italic>pub1∆</italic> strain to eliminate linear and circular RNA production from the genomic locus. RT-PCR and qPCR analysis revealed a large decrease in circular RNA expression after branch point deletion (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3B,C</xref>), but circular RNA and fully spliced mRNA could still be detected, as a weak cryptic branch point was activated in the intron as evidenced by expression of the fully spliced linear isoform (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3B</xref>, Lane 4).</p><p>Together, the existence of exon-containing lariats and their necessity for efficient circle production suggest that the dominant pathway for circular RNA biogenesis in <italic>S. pombe</italic> is through a lariat precursor.</p></sec><sec id="s2-3"><title>Exon skipping is not sufficient to generate circular RNA</title><p>Our findings raise the question: is production of an exon-containing lariat sufficient to produce circular RNA in <italic>S. pombe</italic>? There are only 14 reported examples of <italic>validated</italic>, stable exon-skipping events in wild-type <italic>S. pombe</italic> (<xref ref-type="bibr" rid="bib2">Awan et al., 2013</xref>), which would be predicted to produce such lariats. Stable exon skipping could be sufficient for circular RNA production, but it is not required; as is the case for <italic>mrps16</italic>, the exon-skipped transcripts may be quite unstable yet produce exon-containing lariats competent for circle formation. We have chosen to test genes with stable exon-skipped transcripts because they are known to produce exon-containing lariats.</p><p>To assess the sufficiency of exon-containing lariats for circular RNA production, we used RT-PCR to test for these lariats and their putative corresponding circular RNAs (except in two cases where the exons were under 40 nt long). With both pairs of outward-facing primers, we observed bands indicative of exon-containing lariats based on their predicted migration and, in some cases, we observed larger PCR products consistent with rolling-circle reverse transcription of these lariats (examples shown in <xref ref-type="fig" rid="fig4">Figure 4</xref>); however, no circular RNA from any of these loci in either wild-type or <italic>dbr1∆ S. pombe</italic> was detected (<xref ref-type="fig" rid="fig4">Figure 4</xref>, asterisks), demonstrating that exon skipping is not sufficient for detectable levels of circular RNA.<fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.07540.015</object-id><label>Figure 4.</label><caption><title>Production of exon-containing lariats is not sufficient to generate circular RNA.</title><p>RT-PCR analysis of a number of genes with validated exon-skipping events in <italic>S. pombe</italic>. The primers pairs used are indicated below the gel. Primer pair ‘C’ should amplify the circular RNA or the lariat precursor if the circle is absent, whereas primer pair ‘LP’ should specifically amplify the lariat precursor. For each gene, asterisks indicate the expected product size for the circular RNA. In each case, only exon-containing lariats from the exon-skipping events could be detected.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.015">http://dx.doi.org/10.7554/eLife.07540.015</ext-link></p></caption><graphic xlink:href="elife-07540-fig4-v2.tif"/></fig></p></sec><sec id="s2-4"><title>Unbiased, comprehensive exonic deletions reveal exon length strongly predicts circularization</title><p>We observed that skipped exons that did not produce circular RNA (<xref ref-type="fig" rid="fig4">Figure 4</xref>) were significantly shorter compared to the sizes of the predicted circularized exons in <italic>S. pombe</italic> (<xref ref-type="fig" rid="fig5">Figure 5A</xref>)<italic>.</italic> Previous genome-wide reports in human cells have demonstrated that large exons appear to be preferentially circularized in human cells (<xref ref-type="bibr" rid="bib39">Zhang et al., 2014b</xref>). However, these associations could be due to technical biases or confounding factors that are correlated with exon length (e.g., small, skipped exons may also contain exonic splicing silencers that promote exon skipping but restrict RNA circularization).<fig-group><fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.07540.016</object-id><label>Figure 5.</label><caption><title>Exon size predicts circular RNA production.</title><p>(<bold>A</bold>) Notched box plots depicting the sizes of internal exons (n = 2831), single exon circular RNAs predicted from RNA-seq (n = 86), and skipped uncircularized exons (n = 11) in <italic>S. pombe</italic>. The notches represent the 95% confidence interval of the median (specifically, ± 1.57 × IQR/√n, where IQR is interquartile range, and n is sample size). p-values, denoted above the plots, were calculated using a Wilcoxon rank sum test. Note only single exon circular RNAs were included in this analysis. (<bold>B</bold>) qPCR analysis of circular RNA production from an <italic>mrps16</italic> isoform lacking 90 nucleotides from the center of its second exon (<italic>mrps16</italic> ∆90). Total circular RNA was measured using outward-facing primers outside the bounds of the deletion and normalized to total circular RNA produced by the endogenous locus. Error bars represent standard deviations from replicate experiments. (<bold>C</bold>) Schematic outlining the production of <italic>mrps16</italic> exon plasmid deletion library and quantitative RNA-seq (qRNA-seq) method for determining isoform-specific circular RNA expression. (<bold>D</bold>) Circularization efficiency (CE) vs exon length as determined by qRNA-seq experiment. Outliers are noted on the plot using a parenthetical notation (x, y), where x and y represent the first and last nucleotide of deletion, respectively, with 1 representing the first nucleotide of the exon. Error bars represent two standard deviations from the mean (see ‘Materials and methods’ for derivation). Experiments shown in (<bold>B</bold>) and (<bold>D</bold>) were performed in wild-type <italic>S. pombe</italic>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.016">http://dx.doi.org/10.7554/eLife.07540.016</ext-link></p></caption><graphic xlink:href="elife-07540-fig5-v2.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.017</object-id><label>Figure 5—figure supplement 1.</label><caption><title>RT-PCR analysis of circular RNA produced by endogenous <italic>mrps16</italic> and <italic>mrps16</italic> ∆90.</title><p>Primer pairs are indicated above the gel. Primer pair <italic>wt</italic> is a set of primers specific to the <italic>wt mrps16</italic> circular RNA, while primer pair <italic>∆90</italic> is specific to the deleted form of the exon. Expressed form of <italic>mrps16</italic> is shown below the gel and is expressed in addition to the endogenous copy.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.017">http://dx.doi.org/10.7554/eLife.07540.017</ext-link></p></caption><graphic xlink:href="elife-07540-fig5-figsupp1-v2.tif"/></fig><fig id="fig5s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.018</object-id><label>Figure 5—figure supplement 2.</label><caption><title>Measurement of RNA extraction size bias by qPCR.</title><p>qPCR analysis of circular RNA production from <italic>mrps16</italic> ∆90. Total circular RNA was measured using outward-facing primers outside the bounds of the deletion, while ∆90 circular RNA was measured using primers specific to the deletion isoform (see <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). All bars are normalized to total circular RNA produced by endogenous circular RNA (first data point; empty vector). Error bars represent standard deviations from technical replicates.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.018">http://dx.doi.org/10.7554/eLife.07540.018</ext-link></p></caption><graphic xlink:href="elife-07540-fig5-figsupp2-v2.tif"/></fig><fig id="fig5s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.019</object-id><label>Figure 5—figure supplement 3.</label><caption><title>qPCR analysis of splice isoforms in <italic>mrps16 ∆</italic>90.</title><p>(<bold>A</bold>) qPCR quantification of <italic>mrps16</italic> linear junctions, measured for both wt <italic>mrps16</italic> and <italic>mrps16 ∆</italic>90 in wild-type <italic>S. pombe</italic>. (<bold>B</bold>) qPCR quantification of <italic>mrps16</italic> circular RNA and lariat precursor in <italic>dbr1∆ S. pombe</italic>. Error bars represent standard deviations from technical replicates.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.019">http://dx.doi.org/10.7554/eLife.07540.019</ext-link></p></caption><graphic xlink:href="elife-07540-fig5-figsupp3-v2.tif"/></fig><fig id="fig5s4" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.020</object-id><label>Figure 5—figure supplement 4.</label><caption><title>qPCR analysis of splice isoform representation in exonic deletion library.</title><p>(<bold>A</bold>) qPCR quantification of circular, linear, and lariat precursor abundance in exonic deletion library cDNA. Primers indicated above plot and relative contribution of each species to the library are shown as percentages below each bar. (<bold>B</bold>) Quantification of circular RNA biogenesis from a <italic>wt mrps16</italic> plasmid with three different primer pairs, each of which was used to construct a sequencing library. In the absence of RNase R, inward-facing primers lead to much higher levels of PCR amplification due to amplification from linear RNA. In contrast, with RNase R, the three primer pairs give essentially identical Ct values, indicating that the linear RNA is not largely contributing. Note, we chose not to perform this experiment with our actual exonic deletion library, as variations in Ct values between the libraries will likely only reflect variability in the deletion isoforms detected and the expression levels of those isoforms, rather than contributions of various <italic>splice</italic> isoforms under the given treatment.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.020">http://dx.doi.org/10.7554/eLife.07540.020</ext-link></p></caption><graphic xlink:href="elife-07540-fig5-figsupp4-v2.tif"/></fig><fig id="fig5s5" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.021</object-id><label>Figure 5—figure supplement 5.</label><caption><title>Primary sequence analysis of <italic>mrps16</italic> exonic deletion library.</title><p>CE is plotted with respect to the position of each exonic deletion, depicted as horizontal bars extending from the start to end of the deletion.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.021">http://dx.doi.org/10.7554/eLife.07540.021</ext-link></p></caption><graphic xlink:href="elife-07540-fig5-figsupp5-v2.tif"/></fig><fig id="fig5s6" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.07540.022</object-id><label>Figure 5—figure supplement 6.</label><caption><title><italic>mrps16</italic> exon 2 predicted structures.</title><p>Structures represent the predicted MFE secondary structures at 30°C. Deletion isoform is indicated above each structure along with its end-to-end length. These structures were predicted using the NUPACK web server. Parenthetical notation as in <xref ref-type="fig" rid="fig5">Figure 5D</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.022">http://dx.doi.org/10.7554/eLife.07540.022</ext-link></p></caption><graphic xlink:href="elife-07540-fig5-figsupp6-v2.tif"/></fig></fig-group></p><p>In order to test this directly, we made a 90 nt deletion in <italic>mrps16</italic> and found that this deletion had a dramatic effect on circular RNA abundance (total circular RNA does not differ significantly from background, <xref ref-type="fig" rid="fig5">Figure 5B</xref>). Due to the unique sequence of the deletion, we designed primers to specifically amplify the ∆90 nt <italic>mrps16</italic> circular species using a primer that spans the junction of the deletion (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). Using this primer, we quantified the levels of the ∆90 nt circle and showed the expression of this isoform was ∼eightfold below endogenous circular RNA (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>). Given the high-copy number of the plasmid (&gt;10 per genome), this represents a &gt;80 fold reduction in circular RNA produced by this deletion.</p><p>We reasoned that this large effect could be due to a bias against retaining small RNA in our RNA extraction procedure. To address this concern, we subjected the purified RNA to a second round of extraction and purification. If this procedure is biased against small RNAs, a second round of extraction would decrease the apparent ratio of ∆90 nt (ectopic) circle to full-length (endogenous) circle. However, there was no relative depletion of small species after the second purification, supporting the conclusion that this deletion has a biological underpinning rather than being a technical artifact (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>).</p><p>To determine whether this effect was simply caused by an increase in competitive splicing of linear mRNA in this mutant, we quantified the expression of both mRNA splice junctions but did not find a significant difference in their expression compared to <italic>wt mrps16</italic> (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3A</xref>). Another potential model is that this 90 nt deletion causes a decrease in the production of the lariat precursor, leading to a decrease in observed circular RNA. In order to test this, we quantified both the abundance of the circular RNA and the lariat precursor in <italic>dbr1∆ S. pombe</italic>. Contrary to this model, we observe an increase in the abundance of the lariat precursor relative to the circular RNA, consistent with this mutation causing a decrease in the rate of the second round of splicing (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3B</xref>).</p><p>Two non-mutually exclusive models could explain the decreased abundance of circular RNA from the 90 nt deletion: (1) small circles in <italic>mrps16</italic> do not efficiently circularize due to their size (e.g., physical constraints); (2) our deletion has removed a binding site for a <italic>trans-</italic>acting factor responsible for circularization. To achieve a rapid and high-throughput test of these models, we used a quantitative RNA-seq (‘qRNA-seq’) protocol (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). We generated a pooled library of varying length deletions within exon 2 of <italic>mrps16</italic> by combinatorial inverse PCR and blunt ligation, using the <italic>wt mrps16</italic> plasmid as a template, and transformed this pool of mutants into wild-type <italic>S. pombe</italic>.</p><p>Next, we extracted RNA and plasmid DNA from the population. The RNA was enriched for circular isoforms by DNase and RNase R treatment and then reverse transcribed. The cDNA and plasmid DNA were PCR amplified using the same pair of inward-facing primers and cycle numbers to control for any potential sequence-specific PCR biases; barcoded-sequencing adapters were further added by PCR. Separate sequencing libraries were created at different cycle numbers to allow analysis of biases introduced by PCR.</p><p>To ensure that circular RNA species generated the vast majority of RNA-seq reads, we performed qPCR and demonstrated that: (a) the linear RNA was represented ∼40 fold below the expression of the circular RNA due to RNase R treatment and (b) the lariat precursor was represented at ∼300,000 fold below circular RNA, as expected since this experiment was performed using wild-type yeast (<xref ref-type="fig" rid="fig5s4">Figure 5—figure supplement 4A</xref>). We also showed that inward- and outward-facing primer pairs gave very similar qPCR values when used on RNase R-treated RNA, indicating both quantitate mainly circular isoform (<xref ref-type="fig" rid="fig5s4">Figure 5—figure supplement 4B</xref>). As an additional control, we created RNA-seq libraries with outward-facing primers, which are unable to amplify linear species.</p><p>In our library, each plasmid with a deletion contains a unique sequence within exon 2 corresponding to the deletion junction (<xref ref-type="fig" rid="fig5">Figure 5C</xref>), allowing the abundance of each circular RNA isoform to be quantified (from the RNA-seq libraries) and normalized by the representation of each plasmid in the population (from the DNA-seq libraries). By quantifying the wild-type levels of circularization, we represented our quantitative results as relative circularization efficiency (CE) for each mutant (where the value 1 represents wild-type levels of circularization from the plasmid). We tested for an effect of deletion length on CE and found a strong systematic relationship between exon length and circularization (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). This trend was maintained across sequencing libraries, which vary in cycles of library amplification and primer pairs (data not shown). Note, this plot does not include the 90 nt deletion discussed above, which we analyzed separately by clonal analysis.</p><p>While exon length is significant in our model, it is not completely predictive of CE, indicating the existence of other factors that could potentially affect circularization. This library can contain multiple representatives for any given deletion size and for any given deletion of a primary sequence motif. This allows us to rapidly test first order predictions that efficient circle production relies on the presence of a trans-acting factor binding site. However, our data revealed no relationship between the location of a deletion (i.e., its inclusion of any primary sequence motif), and its representation in the library. Thus, we were unable identify a primary sequence required for circularization (see <xref ref-type="fig" rid="fig5s5">Figure 5—figure supplement 5</xref>).</p><p>Analysis of outliers in our <italic>mrps16</italic> mutagenesis data revealed that essentially all data points with higher-than-expected rates of circularization represented deletions in a region at the 3′ end of the exon that is predicted to be rich in secondary structure. A hairpin, spanning from 135 to 159, is predicted to form with high probability, and deletions that remove half of this hairpin are responsible for the most significant outliers (<xref ref-type="fig" rid="fig5s6">Figure 5—figure supplement 6</xref>). These outliers suggest a model in which secondary structures may limit the flexibility of the exon: removing pieces of these secondary structures can destabilize them, increasing the effective length of the circularized exon.</p><p>We predicted the minimum free energy (MFE) structures of exon 2 for several of these deletions and found that these deletions maintained the apparent, end-to-end length of the exon and in some cases actually increased the apparent length (<xref ref-type="fig" rid="fig5s6">Figure 5—figure supplement 6</xref>). We also found that deleting the entire hairpin (89,171) negated the enhancement in circularization (not shown), and in agreement, the predicted structure for this deletion contains far fewer free nucleotides in this case (17 vs 37 for wt) (<xref ref-type="fig" rid="fig5s6">Figure 5—figure supplement 6</xref>). This indicates that outliers marked in <xref ref-type="fig" rid="fig5">Figure 5D</xref> do not simply remove a repressor's-binding site.</p><p>Despite this suggestive data that exonic structure is important for circular RNA production in <italic>mrps16</italic>, we were unable to predict CE by computational structure prediction alone (not shown). This may reflect an inability of structure prediction methods to accurately predict in vivo RNA secondary structure or, instead, may reflect additional yet-to-be discovered regulatory features.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Circular RNA is a pervasive aspect of eukaryotic gene expression, and recent work has begun to shed light on the regulation and biogenesis of these still largely mysterious RNAs (<xref ref-type="bibr" rid="bib1">Ashwal-Fluss et al., 2014</xref>; <xref ref-type="bibr" rid="bib19">Liang and Wilusz, 2014</xref>; <xref ref-type="bibr" rid="bib39">Zhang et al., 2014b</xref>; <xref ref-type="bibr" rid="bib9">Conn et al., 2015</xref>). Current models for the production of circular RNAs posit that RNA secondary structures formed by inverted sequences in flanking introns are necessary elements for circularization, but this model lacks completeness, as circular RNAs can be found in genes that lack extensive complementary sequences. This is abundantly clear in lower eukaryotes whose genomes are almost devoid of repetitive sequences (<xref ref-type="bibr" rid="bib25">Richard et al., 2008</xref>).</p><p>Using <italic>S. pombe</italic> as a model system, we provide thorough mechanistic evidence that circular RNA can be generated through an exon-containing lariat precursor, a longstanding, yet unsubstantiated model in the field (<xref ref-type="bibr" rid="bib37">Zaphiropoulos, 1996</xref>; <xref ref-type="bibr" rid="bib31">Surono et al., 1999</xref>). Based on splice site mutagenesis experiments, we find that lariat production is important for detectable production of <italic>mrps16</italic> circular RNA. However, a lariat precursor may not be strictly necessary, as suggested by our data and in vitro work in mammalian and yeast splicing extracts that have shown it is possible to directly backsplice a circular RNA in the absence of competing splice sites (<xref ref-type="bibr" rid="bib24">Pasman et al., 1996</xref>; <xref ref-type="bibr" rid="bib29">Schindewolf et al., 1996</xref>). Rather, it is more likely that the lariat production contributes to backsplicing catalysis by positioning splice sites. In addition to this catalytic function, lariat production may also serve to prevent competing splice sites from operating. In other words, within the context of an exon-containing lariat, the only available splice sites are those bordering the circularized exon, and the upstream branch point, now ‘orphaned’ by lariat formation, must attack the downstream splice donor. In this way, the exon-containing lariat may provide a microenvironment for the splicing of circular RNA.</p><p>A hypothesis generated by a model in which circular RNA is spliced from an exon-containing lariat precursor is that inhibiting lariat degradation should lead to increases in circular RNA expression. Recently, Bähler and colleagues published a broad RNA-seq study of several whole transcriptome profiles of wild-type and <italic>dbr1∆ S. pombe</italic>, and the authors note a ∼3–4 fold global increase in circular RNA in <italic>dbr1∆ S. pombe</italic> (<xref ref-type="bibr" rid="bib3">Bitton et al., 2015</xref>). However, upon analyzing <italic>mrps16</italic> specifically, we observed significant variation in the <italic>mrps16</italic> circular:total splice isoform ratios within the wild-type RNA-Seq biological replicates due to the very low number of reads (<xref ref-type="bibr" rid="bib3">Bitton et al., 2015</xref>, Supp. Table S11). Thus, while there appears to be a modest increase in the <italic>global</italic> levels of circular RNA in the debranching mutant, the effects on particular genes fail to reach statistical significance.</p><p>We have also found that production of an exon-containing lariat is not sufficient for circularization, just as inverted repeats are not sufficient for circular RNA production in mammals (<xref ref-type="bibr" rid="bib39">Zhang et al., 2014b</xref>), suggesting other regulatory mechanisms responsible for its production. Supporting the idea that factors beyond the presence of an exon-containing lariat are required for circular RNA production, we have found that, in general, uncircularized skipped exons are much smaller than the circular exons, hinting that exon size may have a direct effect on the efficiency with which an exon circularizes. Using <italic>mrps16</italic> as a model gene, we tested this directly with a library of exonic deletions and found a systematic decrease in circularization with a decrease in exon size. Although there is a strong effect of exon size, circularization is presumably influenced by additional factors such as topological effects due to intronic sequence and combinatorial effects of RNA-binding proteins. Indeed, we have found that intronic deletions can have a pronounced effect on RNA circularization. None of these deletions (which range from 133 to 329 bp long) affect circularization as dramatically as deleting the branch point in either intron (SB + JS, unpublished data).</p><p>We have previously identified circular RNAs in genes in <italic>Saccharomyces cerevisiae</italic> (<xref ref-type="bibr" rid="bib34">Wang et al., 2014</xref>) that are known to generate exon-skipped linear isoforms (<xref ref-type="bibr" rid="bib14">Hossain et al., 2011</xref>; <xref ref-type="bibr" rid="bib13">Egecioglu et al., 2012</xref>), lending support to the possibility that this mechanism extends beyond <italic>S. pombe</italic> to other eukaryotes. As an example, the three exon gene <italic>SUS1</italic> has an exon-skipped linear transcript that is rapidly decayed (<xref ref-type="bibr" rid="bib13">Egecioglu et al., 2012</xref>). Substitution of the <italic>SUS1</italic> gene with a linear cDNA copy results in temperature sensitivity and histone H2B deubiquitination defects (<xref ref-type="bibr" rid="bib14">Hossain et al., 2011</xref>). This was suggested to be due to a functional role of an alternatively spliced linear isoform, but could be due to a circularized isoform derived from the seemingly non-functional and rapidly-decayed exon-skipping event. Indeed, it may be a general theme that short-lived exon-skipping events may give rise to long-lived circularized exons, which may play a productive role in cells.</p><p>As intron size increases, it may be that exon-containing lariats no longer have a strong topological effect. This may limit the utility of this mechanism in higher eukaryotes, which may have adopted inverted sequences in an effort to produce local topological changes. However, as alluded to earlier, lariat production may serve an additional function by isolating exons for circularization, implying that these mechanisms may work in tandem. The existence of the lariat precursor model in lower eukaryotes suggests a possible mechanism in which circular RNA arose as a byproduct of exon skipping and that, as intronic architecture changed, so did mechanisms for maintaining expression of these molecules.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Strains and media</title><p>The following <italic>S. pombe</italic> strains were obtained from Bioneer Inc. (Alameda, CA): ‘wild-type’ strain ED668 (<italic>h+ ade6-M216 ura4-D18 leu1–32</italic>) and its deletion derivatives <italic>dbr1∆</italic> and <italic>pub1∆.</italic> Strains were grown in yeast extract with supplements (YES) media when grown without selection. Selection was performed in Edinburgh Minimal Media (EMM) in the absence of leucine (EMM-Leu).</p></sec><sec id="s4-2"><title><italic>mrps16</italic> and <italic>pub1</italic> expression vectors and mutagenesis</title><p>The base vector pW1336 was created from pREP41/GFP-Osh2 (gift of Masayuki Onishi) by removal of the nmt1 promoter and insert gene by <italic>Sph</italic>I-<italic>Sac</italic>I digest and replacement with an oligonucleotide polylinker. It contains ARS1 from <italic>S. pombe</italic>, LEU2 from <italic>S. cerevisiae</italic>, and ampicillin-resistance. <italic>S. pombe</italic> genomic DNA was amplified using the primers TTTCGGCGCGCCCTCTTTTTTTAAGAAAATTTCGTTGCTTG and GACGTTAATTAAATCCAGGAATGTTTTTGATGAGCACTAG (for <italic>pub1</italic>), and TCTAGGCGCGCCTAATTCCGTATTGATGGAG and AGGATTAATTAAGCTCTCTTGGTTGTGCAATCAG (for <italic>mrps16</italic>), and cloned as <italic>Asc</italic>I-<italic>Pac</italic>I fragments into pW1336. The inserts were validated by Sanger sequencing.</p><p>Plasmid deletions were generated using QuikChange Lightning Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) according to the manufacturer's instructions (primers shown in <xref ref-type="supplementary-material" rid="SD1-data">Supplementary file 1</xref>). Mutations were validated by Sanger sequencing.</p><p>For generating the exonic deletion library, inverse PCR was performed using ∼1 ng of plasmid template per 50 μl PCR reaction using Phusion polymerase (New England Biolabs [NEB], Ipswich, MA) with high-fidelity buffer according to the manufacturer's instructions (primers shown in <xref ref-type="supplementary-material" rid="SD1-data">Supplementary file 1</xref>). Prior to PCR, the primers were phosphorylated using T4 polynucleotide kinase (PNK) (NEB) at 10 μM primer concentration in 1× T4 DNA ligase buffer. After PCR, these products were pooled, digested with <italic>Dpn</italic>1 for 4 hr at 37°C to remove vector template, and concentrated by isopropanol precipitation. The concentrated products were then run on a 1% agarose gel for size selection. The 12 kb was visualized using blue light and extracted using a clean razor blade. The product was purified using Qiagen Gel Extraction kit according to manufacturer's instructions. 50 ng of the purified products was self-ligated using 400 U T4 DNA ligase (NEB) to circularize the vectors in 20 μl at 16°C overnight. 4 μl of the reaction products were transformed into <italic>Escherichia coli</italic> TOP10 chemically competent cells (Life Technologies, Carlsbad, CA) according to manufacturer's instructions, and transformed cells were plated on LB + carbenicillin plates. After 17 hr of growth, 5 ml of LB was added to plates and colonies were pooled by scraping (∼1500 colonies obtained). The bacteria were pelleted and plasmids were isolated using the Qiaprep Spin Miniprep kit according to the manufacturer's instructions (Qiagen, Venlo, Netherlands).</p></sec><sec id="s4-3"><title>RNA isolation</title><p>Total RNA was isolated from log-phase yeast using an acid phenol-chloroform extraction. After extraction and ethanol precipitation, RNA was treated with TURBO DNase (Life Technologies) and purified and concentrated using the Purelink RNA-mini kit (Ambion, Austin, TX).</p></sec><sec id="s4-4"><title>RNase R treatment</title><p>1 μg of total RNA was treated with 5 U RNase R (Epicentre, Madison, WI) in 10 μl total reaction volume at 37°C for 30 min. The RNA was then reverse-transcribed without purification with the addition of 4 μl 5× supplement buffer (250 mM Tris pH 8, 125 mM KCl, 15 mM MgCl<sub>2</sub>) and 2 μl 0.1 M DTT to provide necessary conditions for the RT reaction.</p></sec><sec id="s4-5"><title>RT-PCR</title><p>In all cases, 1 μg of total RNA was reverse transcribed with random hexamers using 100 U Maxima H-minus reverse transcriptase (ThermoFisher Scientific, Waltham, MA) according to the manufacturer's instructions.</p><p>PCRs were performed using Platinum Taq hot-start polymerase (Life Technologies). For all PCR reactions, 1.5 μl of the unpurified RT-reaction was used per 50 μl reaction volume. All RT-PCR reactions were performed using the recommended cycling protocol for 35 cycles.</p><p>RT-<italic>Dra</italic>I-PCRs were assembled as normal RT-PCRs, but an initial PCR phase (3 cycles) was used to produce double-stranded cDNA. The samples were then removed from the thermocycler and placed on ice. 20 U of <italic>Dra</italic>I (NEB) was added directly to the 50 μl PCR reaction, and the reaction was allowed to incubate at 37°C for 1 hr. From there, the PCR was resumed for 35 additional cycles without purification.</p><p>qPCR reactions were assembled as 10 μl reactions using AccuPower 2X GreenStar qPCR Master Mix (Bioneer) and Power SYBR Green Master Mix (Life Technologies) with 0.3 μl of template used per reaction. We performed qPCRs on an ABI 7900HT using following cycling protocol: 50°C for 20 min, 95°C for 10 min, (95°C for 15 s and 60°C for 30–60 s) × 45 cycles, followed by a dissociation stage.</p></sec><sec id="s4-6"><title>RNA structure prediction</title><p>RNA structures and dotplots are the predicted MFE structures determined by NUPACK (<xref ref-type="bibr" rid="bib11">Dirks and Pierce, 2004</xref>; <xref ref-type="bibr" rid="bib10">Dirks et al., 2007</xref>; <xref ref-type="bibr" rid="bib36">Zadeh et al., 2011</xref>) with default RNA settings at a temperature of 30°C.</p></sec><sec id="s4-7"><title><italic>dbr1∆</italic> and wild-type RNA-seq analysis</title><p>Adapters were trimmed from reads using CutAdapt (<xref ref-type="bibr" rid="bib20">Martin, 2011</xref>). Using our custom pipeline (<xref ref-type="bibr" rid="bib32">Szabo et al., 2015</xref>), we aligned the reads from (<xref ref-type="bibr" rid="bib4">Bitton et al., 2014</xref>) (NCBI Gene Expression Omnibus accession number GSE50246) to the <italic>S. pombe</italic> transcriptome and determined the circular junctional reads derived from single exons (analysis shown in <xref ref-type="fig" rid="fig5">Figure 5A</xref>). Only junctions with a probability of greater than 0.7 were considered here.</p></sec><sec id="s4-8"><title>qRNA-seq sequencing library preparation</title><p>Wild-type <italic>S. pombe</italic> was transformed with the plasmid library (see ‘Expression vectors and mutagenesis’ for details on the creation of the plasmid library) according to standard protocol, and transformants were plated on EMM-Leu to select. ∼2000 colonies were obtained and scraped using 5 ml EMM-Leu. Cells were mixed to homogenize the sample and 2 ml of cells were used for RNA isolation and 2 ml for DNA isolation. RNA was isolated by acid-phenol chloroform extraction and was treated with both RNase R (Epicentre) and Turbo DNase (Ambion) prior to cDNA synthesis. Plasmid DNA was isolated using NucleoSpin Plasmid Miniprep Kit (Macherey–Nagel, Bethlehem, PA) using a published supplementary protocol for purification of plasmid DNA from yeast. To enrich for plasmid DNA in the sample, we also treated with Exonuclease V (NEB) to degrade linear DNA fragments.</p><p>Sequencing libraries were produced using a PCR approach based on a previously reported method (<xref ref-type="bibr" rid="bib38">Zhang et al., 2014a</xref>) with some key differences. In our protocol, PCRs were performed using Phusion polymerase (NEB) for 5 cycles in an initial amplification stage using tagged gene specific primers followed by n-5 cycles for the addition of the sequencing adapters and barcodes, where n = 25, 30, or 35 cycles (each library receiving a unique barcode in order to reference cycle number). Primers for the latter PCR stage were exactly as reported in Zhang et al., and the primers were obtained directly from the Li Lab (Sanford University; Stanford, CA). Libraries were pooled and spiked with PhiX to a concentration of 25%. Sequencing was performed on an Illumina MiSeq.</p></sec><sec id="s4-9"><title>qRNA-seq analysis</title><p>Reads were trimmed using CutAdapt (<xref ref-type="bibr" rid="bib20">Martin, 2011</xref>) and only reads greater than 40 nucleotides after trimming were used for analysis. We aligned reads, using Bowtie 1 (<xref ref-type="bibr" rid="bib18">Langmead et al., 2009</xref>), first to an index containing an unmutated <italic>mrps16</italic> sequence, and then the unaligned reads were aligned using a custom-built index containing all possible deletions of the <italic>mrps16</italic> exon that could be generated using our combinatorial, outward-facing PCR strategy. In both cases, we limited the alignments to at most 3 mismatches using the Bowtie ‘–v 3’ setting. Since the primers were not purified after synthesis or before our combinatorial PCR, incomplete primer synthesis could generate mutants in our plasmid library, and we accounted for this in generating our index. This leads to a number of variants differing by only a few nucleotides.</p><p>After aligning to these indexes, we determined the number of reads derived from each deletion isoform in each sequencing library, filtering out isoforms with less than 200 reads derived from the plasmid-based DNA-seq library. We converted these read counts to circularization efficiency (CE) using the following equation:<disp-formula id="equ1"><mml:math id="m1"><mml:mrow><mml:mi>C</mml:mi><mml:mi>E</mml:mi><mml:mo>=</mml:mo><mml:mfrac><mml:mrow><mml:mrow><mml:mrow><mml:msub><mml:mi>n</mml:mi><mml:mi>c</mml:mi></mml:msub></mml:mrow><mml:mo>/</mml:mo><mml:mrow><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:msub><mml:mi>n</mml:mi><mml:mrow><mml:mi>w</mml:mi><mml:mi>t</mml:mi></mml:mrow></mml:msub><mml:mo>×</mml:mo><mml:mi>s</mml:mi></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow></mml:mrow></mml:mrow><mml:mrow><mml:mrow><mml:mrow><mml:msub><mml:mi>n</mml:mi><mml:mi>v</mml:mi></mml:msub></mml:mrow><mml:mo>/</mml:mo><mml:mrow><mml:msub><mml:mi>n</mml:mi><mml:mrow><mml:msub><mml:mi>v</mml:mi><mml:mrow><mml:mi>t</mml:mi><mml:mi>o</mml:mi><mml:mi>t</mml:mi></mml:mrow></mml:msub></mml:mrow></mml:msub></mml:mrow></mml:mrow></mml:mrow></mml:mfrac><mml:mo>,</mml:mo></mml:mrow></mml:math></disp-formula>where n<sub>c</sub> is the number of reads derived from a given circular RNA isoform, n<sub>wt</sub> is the number of reads derived from wild-type circular RNA (from background genomic expression), and s is a scaling factor that corrects for the increased average copy number of the plasmid, which we assume is not altered by the exonic deletion. This value is determined from qPCR data from cells transformed with a <italic>wt mrps16</italic> plasmid (s = 19 in wild-type <italic>S. pombe</italic>). This value is then normalized by the representation of the given vector isoform in the plasmid library (n<sub>v</sub>/n<sub>vtot</sub>), where n<sub>v</sub> is the number of reads derived from a given plasmid isoform, and n<sub>vtot</sub> is the total number of reads in the plasmid-derived library (after removing reads that align to the wild-type sequence).</p><p>Error bars in <xref ref-type="fig" rid="fig5">Figure 5D</xref> were generated using the relationship that n<sub>wt</sub> and n<sub>c</sub> are independent Poisson random variables and therefore, X: = n<sub>c</sub>|(n<sub>wt</sub> + n<sub>c</sub>) is bionomial with parameters probability of success B:= n<sub>c</sub>/(n<sub>c</sub>+n<sub>w</sub>) and total trials n<sub>c</sub>+n<sub>w</sub>. Standard binomial confidence intervals were assigned to this quantity, and the 95% CI was propagated to A: = n<sub>v</sub>/n<sub>vtot</sub> (expression A) using the transformation f(A) = 1/A. Expression B can be converted to n<sub>c</sub>/(s * n<sub>wt</sub>) using the transformation g(B) = B/(1 − B)/s.</p><p>Note that, CE = f(A) * g(B).</p><p>The total variance of ln(CE) is obtained by combining a normal approximation for B (corresponding to <inline-formula><mml:math id="inf1"><mml:mrow><mml:mover accent="true"><mml:mi mathvariant="normal">p</mml:mi><mml:mo>^</mml:mo></mml:mover></mml:mrow></mml:math></inline-formula> in a binomial model) and the delta method, which states that for sufficiently regular functions h, var(h(x)) = var(x) h′(x)^2.</p><p>Therefore,<disp-formula id="equ2"><mml:math id="m2"><mml:mrow><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>CE</mml:mtext></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>=</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>f</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>A</mml:mtext><mml:mo>)</mml:mo></mml:mrow><mml:mtext>g</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>B</mml:mtext><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>=</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>f</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>A</mml:mtext><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>+</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>g</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>B</mml:mtext><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>,</mml:mo></mml:mrow></mml:math></disp-formula>and applying<disp-formula id="equ3"><mml:math id="m3"><mml:mrow><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>f</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>A</mml:mtext><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>=</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mn>1</mml:mn><mml:mtext>/A</mml:mtext></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>=</mml:mo><mml:mtext> var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>A</mml:mtext></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>=</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>A</mml:mtext><mml:mo>)</mml:mo></mml:mrow><mml:mtext>*</mml:mtext><mml:msup><mml:mrow><mml:mrow><mml:mo>[</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>A</mml:mtext><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>]</mml:mo></mml:mrow></mml:mrow><mml:mrow><mml:mn>2</mml:mn></mml:mrow></mml:msup><mml:mo>=</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>A</mml:mtext><mml:mo>)</mml:mo></mml:mrow><mml:msup><mml:mrow><mml:mtext>*</mml:mtext><mml:mn>1</mml:mn><mml:mo>/</mml:mo><mml:mtext>A</mml:mtext></mml:mrow><mml:mn>2</mml:mn></mml:msup><mml:mo>,</mml:mo></mml:mrow></mml:math></disp-formula>where var(A) is estimated as A(1−A)/n<sub>vtot</sub>.<disp-formula id="equ4"><mml:math id="m4"><mml:mrow><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>g</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>B</mml:mtext><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>=</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mrow><mml:mrow><mml:mrow><mml:mtext>B</mml:mtext><mml:mo>/</mml:mo><mml:mrow><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mn>1</mml:mn><mml:mo>−</mml:mo><mml:mtext>B</mml:mtext></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow></mml:mrow></mml:mrow><mml:mo>/</mml:mo><mml:mtext>s</mml:mtext></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow><mml:mo>=</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>B</mml:mtext><mml:mo>)</mml:mo></mml:mrow><mml:mtext>*</mml:mtext><mml:msup><mml:mrow><mml:mrow><mml:mo>[</mml:mo><mml:mrow><mml:mtext>ln</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mrow><mml:mrow><mml:mrow><mml:mtext>B</mml:mtext><mml:mo>/</mml:mo><mml:mrow><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mn>1</mml:mn><mml:mo>−</mml:mo><mml:mtext>B</mml:mtext></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow></mml:mrow></mml:mrow><mml:mo>/</mml:mo><mml:mtext>s</mml:mtext></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>]</mml:mo></mml:mrow></mml:mrow><mml:mrow><mml:mn>2</mml:mn></mml:mrow></mml:msup><mml:mo>=</mml:mo><mml:mtext>var</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mtext>B</mml:mtext><mml:mo>)</mml:mo></mml:mrow><mml:mtext>*</mml:mtext><mml:mrow><mml:mn>1</mml:mn><mml:mo>/</mml:mo><mml:mrow><mml:msup><mml:mrow><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mtext>B</mml:mtext><mml:mrow><mml:mo>(</mml:mo><mml:mrow><mml:mn>1</mml:mn><mml:mo>−</mml:mo><mml:mtext>B</mml:mtext></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mo>)</mml:mo></mml:mrow></mml:mrow><mml:mn>2</mml:mn></mml:msup></mml:mrow></mml:mrow><mml:mo>,</mml:mo></mml:mrow></mml:math></disp-formula>where var(B) is estimated as B(1−B)/(n<sub>wt</sub> + n<sub>c</sub>).</p><p>Using these relationships, we computed the sd = sqrt(var(ln(CE))).</p><p>Finally, we transformed the approximate 95% CI for ln(CE) (its point estimate plus or minus 2 sd) to the 95% CI for CE by exponentiating the upper and lower bounds of the confidence interval for ln(CE), resulting in the error bars on the plot.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Rui Zhang and Jin Billy Li (Stanford) for providing the PCR primers used for the generation of RNA-seq libraries. We also thank Linda Szabo for adapting her alignment pipeline for use with <italic>S. pombe</italic>.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>SPB, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con2"><p>PLW, Conception and design, Drafting or revising the article, Contributed unpublished essential data or reagents</p></fn><fn fn-type="con" id="con3"><p>JS, Conception and design, Analysis and interpretation of data, Drafting or revising the article</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="SD1-data"><object-id pub-id-type="doi">10.7554/eLife.07540.023</object-id><label>Supplementary file 1.</label><caption><p>List of primers used for cloning in this study.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.023">http://dx.doi.org/10.7554/eLife.07540.023</ext-link></p></caption><media mime-subtype="pdf" mimetype="application" xlink:href="elife-07540-supp1-v2.pdf"/></supplementary-material><sec id="s6-1" sec-type="datasets"><title>Major dataset</title><p>The following previously published dataset was used:</p><p><related-object content-type="existing-dataset" id="dataro1" source-id="http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE50246" source-id-type="uri"><collab collab-type="author">Bitton DA</collab>, <collab collab-type="author">Rallis C</collab>, <collab collab-type="author">Jeffares DC</collab>, <collab collab-type="author">Smith GC</collab>, <collab collab-type="author">Chen YY</collab>, <collab collab-type="author">Codlin S</collab>, <collab collab-type="author">Marguerat S</collab>, <collab collab-type="author">Bähler J</collab>, <year>2014</year><x>, </x><source>LaSSO, a strategy for genome-wide mapping of intronic lariats and branch-points using RNA-seq</source><x>, </x><ext-link ext-link-type="uri" xlink:href="http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE50246">http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE50246</ext-link><x>, </x><comment>Publicly available at NCBI Gene Expression Omnibus (Accession No: GSE50246).</comment></related-object></p></sec></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ashwal-Fluss</surname><given-names>R</given-names></name><name><surname>Meyer</surname><given-names>M</given-names></name><name><surname>Pamudurti</surname><given-names>NR</given-names></name><name><surname>Ivanov</surname><given-names>A</given-names></name><name><surname>Bartok</surname><given-names>O</given-names></name><name><surname>Hanan</surname><given-names>M</given-names></name><name><surname>Evantal</surname><given-names>N</given-names></name><name><surname>Memczak</surname><given-names>S</given-names></name><name><surname>Rajewsky</surname><given-names>N</given-names></name><name><surname>Kadener</surname><given-names>S</given-names></name></person-group><year>2014</year><article-title>circRNA biogenesis competes with pre-mRNA splicing</article-title><source>Molecular Cell</source><volume>56</volume><fpage>55</fpage><lpage>66</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2014.08.019</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Awan</surname><given-names>AR</given-names></name><name><surname>Manfredo</surname><given-names>A</given-names></name><name><surname>Pleiss</surname><given-names>JA</given-names></name></person-group><year>2013</year><article-title>Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>110</volume><fpage>12762</fpage><lpage>12767</lpage><pub-id pub-id-type="doi">10.1073/pnas.1218353110</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bitton</surname><given-names>DA</given-names></name><name><surname>Atkinson</surname><given-names>SR</given-names></name><name><surname>Rallis</surname><given-names>C</given-names></name><name><surname>Smith</surname><given-names>GC</given-names></name><name><surname>Ellis</surname><given-names>DA</given-names></name><name><surname>Chen</surname><given-names>YY</given-names></name><name><surname>Malecki</surname><given-names>M</given-names></name><name><surname>Codlin</surname><given-names>S</given-names></name><name><surname>Lemay</surname><given-names>JF</given-names></name><name><surname>Cotobal</surname><given-names>C</given-names></name><name><surname>Bachand</surname><given-names>F</given-names></name><name><surname>Marguerat</surname><given-names>S</given-names></name><name><surname>Mata</surname><given-names>J</given-names></name><name><surname>Bähler</surname><given-names>J</given-names></name></person-group><year>2015</year><article-title>Widespread exon skipping triggers degradation by nuclear RNA surveillance in fission yeast</article-title><source>Genome Research</source><volume>25</volume><fpage>884</fpage><lpage>896</lpage><pub-id pub-id-type="doi">10.1101/gr.185371.114</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bitton</surname><given-names>DA</given-names></name><name><surname>Rallis</surname><given-names>C</given-names></name><name><surname>Jeffares</surname><given-names>DC</given-names></name><name><surname>Smith</surname><given-names>GC</given-names></name><name><surname>Chen</surname><given-names>YY</given-names></name><name><surname>Codlin</surname><given-names>S</given-names></name><name><surname>Marguerat</surname><given-names>S</given-names></name><name><surname>Bähler</surname><given-names>J</given-names></name></person-group><year>2014</year><article-title>LaSSO, a strategy for genome-wide mapping of intronic lariats and branch points using RNA-seq</article-title><source>Genome Research</source><volume>24</volume><fpage>1169</fpage><lpage>1179</lpage><pub-id pub-id-type="doi">10.1101/gr.166819.113</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Braun</surname><given-names>S</given-names></name><name><surname>Domdey</surname><given-names>H</given-names></name><name><surname>Wiebauer</surname><given-names>K</given-names></name></person-group><year>1996</year><article-title>Inverse splicing of a discontinuous pre-mRNA intron generates a circular exon in a HeLa cell nuclear extract</article-title><source>Nucleic Acids Research</source><volume>24</volume><fpage>4152</fpage><lpage>4157</lpage><pub-id pub-id-type="doi">10.1093/nar/24.21.4152</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Burd</surname><given-names>CE</given-names></name><name><surname>Jeck</surname><given-names>WR</given-names></name><name><surname>Liu</surname><given-names>Y</given-names></name><name><surname>Sanoff</surname><given-names>HK</given-names></name><name><surname>Wang</surname><given-names>Z</given-names></name><name><surname>Sharpless</surname><given-names>NE</given-names></name></person-group><year>2010</year><article-title>Expression of linear and novel circular forms of an INK4/ARF-associated non-coding RNA correlates with atherosclerosis risk</article-title><source>PLOS Genetics</source><volume>6</volume><fpage>e1001233</fpage><pub-id pub-id-type="doi">10.1371/journal.pgen.1001233</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Capel</surname><given-names>B</given-names></name><name><surname>Swain</surname><given-names>A</given-names></name><name><surname>Nicolis</surname><given-names>S</given-names></name><name><surname>Hacker</surname><given-names>A</given-names></name><name><surname>Walter</surname><given-names>M</given-names></name><name><surname>Koopman</surname><given-names>P</given-names></name><name><surname>Goodfellow</surname><given-names>P</given-names></name><name><surname>Lovell-Badge</surname><given-names>R</given-names></name></person-group><year>1993</year><article-title>Circular transcripts of the testis-determining gene Sry in adult mouse testis</article-title><source>Cell</source><volume>73</volume><fpage>1019</fpage><lpage>1030</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(93)90279-Y</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cocquerelle</surname><given-names>C</given-names></name><name><surname>Daubersies</surname><given-names>P</given-names></name><name><surname>Majérus</surname><given-names>MA</given-names></name><name><surname>Kerckaert</surname><given-names>JP</given-names></name><name><surname>Bailleul</surname><given-names>B</given-names></name></person-group><year>1992</year><article-title>Splicing with inverted order of exons occurs proximal to large introns</article-title><source>The EMBO Journal</source><volume>11</volume><fpage>1095</fpage><lpage>1098</lpage></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Conn</surname><given-names>SJ</given-names></name><name><surname>Pillman</surname><given-names>KA</given-names></name><name><surname>Toubia</surname><given-names>J</given-names></name><name><surname>Conn</surname><given-names>VM</given-names></name><name><surname>Salmanidis</surname><given-names>M</given-names></name><name><surname>Phillips</surname><given-names>CA</given-names></name><name><surname>Roslan</surname><given-names>S</given-names></name><name><surname>Schreiber</surname><given-names>AW</given-names></name><name><surname>Gregory</surname><given-names>PA</given-names></name><name><surname>Goodall</surname><given-names>GJ</given-names></name></person-group><year>2015</year><article-title>The RNA binding protein quaking regulates formation of circRNAs</article-title><source>Cell</source><volume>160</volume><fpage>1125</fpage><lpage>1134</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2015.02.014</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dirks</surname><given-names>RM</given-names></name><name><surname>Bois</surname><given-names>JS</given-names></name><name><surname>Schaeffer</surname><given-names>JM</given-names></name><name><surname>Winfree</surname><given-names>E</given-names></name><name><surname>Pierce</surname><given-names>NA</given-names></name></person-group><year>2007</year><article-title>Thermodynamic analysis of interacting nucleic acid strands</article-title><source>SIAM Review</source><volume>49</volume><fpage>65</fpage><lpage>88</lpage><pub-id pub-id-type="doi">10.1137/060651100</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dirks</surname><given-names>RM</given-names></name><name><surname>Pierce</surname><given-names>NA</given-names></name></person-group><year>2004</year><article-title>An algorithm for computing nucleic acid base-pairing probabilities including pseudoknots</article-title><source>Journal of Computational Chemistry</source><volume>25</volume><fpage>1295</fpage><lpage>1304</lpage><pub-id pub-id-type="doi">10.1002/jcc.20057</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dubin</surname><given-names>RA</given-names></name><name><surname>Kazmi</surname><given-names>MA</given-names></name><name><surname>Ostrer</surname><given-names>H</given-names></name></person-group><year>1995</year><article-title>Inverted repeats are necessary for circularization of the mouse testis Sry transcript</article-title><source>Gene</source><volume>167</volume><fpage>245</fpage><lpage>248</lpage><pub-id pub-id-type="doi">10.1016/0378-1119(95)00639-7</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Egecioglu</surname><given-names>DE</given-names></name><name><surname>Kawashima</surname><given-names>TR</given-names></name><name><surname>Chanfreau</surname><given-names>GF</given-names></name></person-group><year>2012</year><article-title>Quality control of MATa1 splicing and exon skipping by nuclear RNA degradation</article-title><source>Nucleic Acids Research</source><volume>40</volume><fpage>1787</fpage><lpage>1796</lpage><pub-id pub-id-type="doi">10.1093/nar/gkr864</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hossain</surname><given-names>MA</given-names></name><name><surname>Rodriguez</surname><given-names>CM</given-names></name><name><surname>Johnson</surname><given-names>TL</given-names></name></person-group><year>2011</year><article-title>Key features of the two-intron <italic>Saccharomyces cerevisiae</italic> gene SUS1 contribute to its alternative splicing</article-title><source>Nucleic Acids Research</source><volume>39</volume><fpage>8612</fpage><lpage>8627</lpage><pub-id pub-id-type="doi">10.1093/nar/gkr497</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ivanov</surname><given-names>A</given-names></name><name><surname>Memczak</surname><given-names>S</given-names></name><name><surname>Wyler</surname><given-names>E</given-names></name><name><surname>Torti</surname><given-names>F</given-names></name><name><surname>Porath</surname><given-names>HT</given-names></name><name><surname>Orejuela</surname><given-names>MR</given-names></name><name><surname>Piechotta</surname><given-names>M</given-names></name><name><surname>Levanon</surname><given-names>EY</given-names></name><name><surname>Landthaler</surname><given-names>M</given-names></name><name><surname>Dieterich</surname><given-names>C</given-names></name><name><surname>Rajewsky</surname><given-names>N</given-names></name></person-group><year>2015</year><article-title>Analysis of intron sequences reveals hallmarks of circular RNA biogenesis in animals</article-title><source>Cell Reports</source><volume>10</volume><fpage>170</fpage><lpage>177</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2014.12.019</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jeck</surname><given-names>WR</given-names></name><name><surname>Sharpless</surname><given-names>NE</given-names></name></person-group><year>2014</year><article-title>Detecting and characterizing circular RNAs</article-title><source>Nature Biotechnology</source><volume>32</volume><fpage>453</fpage><lpage>461</lpage><pub-id pub-id-type="doi">10.1038/nbt.2890</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jeck</surname><given-names>WR</given-names></name><name><surname>Sorrentino</surname><given-names>JA</given-names></name><name><surname>Wang</surname><given-names>K</given-names></name><name><surname>Slevin</surname><given-names>MK</given-names></name><name><surname>Burd</surname><given-names>CE</given-names></name><name><surname>Liu</surname><given-names>J</given-names></name><name><surname>Marzluff</surname><given-names>WF</given-names></name><name><surname>Sharpless</surname><given-names>NE</given-names></name></person-group><year>2013</year><article-title>Circular RNAs are abundant, conserved, and associated with ALU repeats</article-title><source>RNA</source><volume>19</volume><fpage>141</fpage><lpage>157</lpage><pub-id pub-id-type="doi">10.1261/rna.035667.112</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Langmead</surname><given-names>B</given-names></name><name><surname>Trapnell</surname><given-names>C</given-names></name><name><surname>Pop</surname><given-names>M</given-names></name><name><surname>Salzberg</surname><given-names>SL</given-names></name></person-group><year>2009</year><article-title>Ultrafast and memory-efficient alignment of short DNA sequences to the human genome</article-title><source>Genome Biology</source><volume>10</volume><fpage>R25</fpage><pub-id pub-id-type="doi">10.1186/gb-2009-10-3-r25</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liang</surname><given-names>D</given-names></name><name><surname>Wilusz</surname><given-names>JE</given-names></name></person-group><year>2014</year><article-title>Short intronic repeat sequences facilitate circular RNA production</article-title><source>Genes &amp; Development</source><volume>28</volume><fpage>2233</fpage><lpage>2247</lpage><pub-id pub-id-type="doi">10.1101/gad.251926.114</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martin</surname><given-names>M</given-names></name></person-group><year>2011</year><article-title>Cutadapt removes adapter sequences from high-throughput sequencing reads</article-title><source>EMBnet</source><lpage>17</lpage></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Memczak</surname><given-names>S</given-names></name><name><surname>Jens</surname><given-names>M</given-names></name><name><surname>Elefsinioti</surname><given-names>A</given-names></name><name><surname>Torti</surname><given-names>F</given-names></name><name><surname>Krueger</surname><given-names>J</given-names></name><name><surname>Rybak</surname><given-names>A</given-names></name><name><surname>Maier</surname><given-names>L</given-names></name><name><surname>Mackowiak</surname><given-names>SD</given-names></name><name><surname>Gregersen</surname><given-names>LH</given-names></name><name><surname>Munschauer</surname><given-names>M</given-names></name><name><surname>Loewer</surname><given-names>A</given-names></name><name><surname>Ziebold</surname><given-names>U</given-names></name><name><surname>Landthaler</surname><given-names>M</given-names></name><name><surname>Kocks</surname><given-names>C</given-names></name><name><surname>le Noble</surname><given-names>F</given-names></name><name><surname>Rajewsky</surname><given-names>N</given-names></name></person-group><year>2013</year><article-title>Circular RNAs are a large class of animal RNAs with regulatory potency</article-title><source>Nature</source><volume>495</volume><fpage>333</fpage><lpage>338</lpage><pub-id pub-id-type="doi">10.1038/nature11928</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nam</surname><given-names>K</given-names></name><name><surname>Lee</surname><given-names>G</given-names></name><name><surname>Trambley</surname><given-names>J</given-names></name><name><surname>Devine</surname><given-names>SE</given-names></name><name><surname>Boeke</surname><given-names>JD</given-names></name></person-group><year>1997</year><article-title>Severe growth defect in a <italic>Schizosaccharomyces pombe</italic> mutant defective in intron lariat degradation</article-title><source>Molecular and Cellular Biology</source><volume>17</volume><fpage>809</fpage><lpage>818</lpage></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nigro</surname><given-names>JM</given-names></name><name><surname>Cho</surname><given-names>KR</given-names></name><name><surname>Fearon</surname><given-names>ER</given-names></name><name><surname>Kern</surname><given-names>SE</given-names></name><name><surname>Ruppert</surname><given-names>JM</given-names></name><name><surname>Oliner</surname><given-names>JD</given-names></name><name><surname>Kinzler</surname><given-names>KW</given-names></name><name><surname>Vogelstein</surname><given-names>B</given-names></name></person-group><year>1991</year><article-title>Scrambled exons</article-title><source>Cell</source><volume>64</volume><fpage>607</fpage><lpage>613</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(91)90244-S</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pasman</surname><given-names>Z</given-names></name><name><surname>Been</surname><given-names>MD</given-names></name><name><surname>Garcia-Blanco</surname><given-names>MA</given-names></name></person-group><year>1996</year><article-title>Exon circularization in mammalian nuclear extracts</article-title><source>RNA</source><volume>2</volume><fpage>603</fpage><lpage>610</lpage></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Richard</surname><given-names>GF</given-names></name><name><surname>Kerrest</surname><given-names>A</given-names></name><name><surname>Dujon</surname><given-names>B</given-names></name></person-group><year>2008</year><article-title>Comparative genomics and molecular dynamics of DNA repeats in eukaryotes</article-title><source>Microbiology and Molecular Biology Reviews</source><volume>72</volume><fpage>686</fpage><lpage>727</lpage><pub-id pub-id-type="doi">10.1128/mmbr.00011-08</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ruskin</surname><given-names>B</given-names></name><name><surname>Green</surname><given-names>MR</given-names></name></person-group><year>1985</year><article-title>An RNA processing activity that debranches RNA lariats</article-title><source>Science</source><volume>229</volume><fpage>135</fpage><lpage>140</lpage><pub-id pub-id-type="doi">10.1126/science.2990042</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Salzman</surname><given-names>J</given-names></name><name><surname>Chen</surname><given-names>RE</given-names></name><name><surname>Olsen</surname><given-names>MN</given-names></name><name><surname>Wang</surname><given-names>PL</given-names></name><name><surname>Brown</surname><given-names>PO</given-names></name></person-group><year>2013</year><article-title>Cell-type specific features of circular RNA expression</article-title><source>PLOS Genetics</source><volume>9</volume><fpage>e1003777</fpage><pub-id pub-id-type="doi">10.1371/journal.pgen.1003777</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Salzman</surname><given-names>J</given-names></name><name><surname>Gawad</surname><given-names>C</given-names></name><name><surname>Wang</surname><given-names>PL</given-names></name><name><surname>Lacayo</surname><given-names>N</given-names></name><name><surname>Brown</surname><given-names>PO</given-names></name></person-group><year>2012</year><article-title>Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types</article-title><source>PLOS ONE</source><volume>7</volume><fpage>e30733</fpage><pub-id pub-id-type="doi">10.1371/journal.pone.0030733</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schindewolf</surname><given-names>C</given-names></name><name><surname>Braun</surname><given-names>S</given-names></name><name><surname>Domdey</surname><given-names>H</given-names></name></person-group><year>1996</year><article-title>In vitro generation of a circular exon from a linear pre-mRNA transcript</article-title><source>Nucleic Acids Research</source><volume>24</volume><fpage>1260</fpage><lpage>1266</lpage><pub-id pub-id-type="doi">10.1093/nar/24.7.1260</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Starke</surname><given-names>S</given-names></name><name><surname>Jost</surname><given-names>I</given-names></name><name><surname>Rossbach</surname><given-names>O</given-names></name><name><surname>Schneider</surname><given-names>T</given-names></name><name><surname>Schreiner</surname><given-names>S</given-names></name><name><surname>Hung</surname><given-names>LH</given-names></name><name><surname>Bindereif</surname><given-names>A</given-names></name></person-group><year>2015</year><article-title>Exon circularization requires canonical splice signals</article-title><source>Cell Reports</source><volume>10</volume><fpage>103</fpage><lpage>111</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2014.12.002</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Surono</surname><given-names>A</given-names></name><name><surname>Takeshima</surname><given-names>Y</given-names></name><name><surname>Wibawa</surname><given-names>T</given-names></name><name><surname>Ikezawa</surname><given-names>M</given-names></name><name><surname>Nonaka</surname><given-names>I</given-names></name><name><surname>Matsuo</surname><given-names>M</given-names></name></person-group><year>1999</year><article-title>Circular dystrophin RNAs consisting of exons that were skipped by alternative splicing</article-title><source>Human Molecular Genetics</source><volume>8</volume><fpage>493</fpage><lpage>500</lpage><pub-id pub-id-type="doi">10.1093/hmg/8.3.493</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Szabo</surname><given-names>L</given-names></name><name><surname>Morey</surname><given-names>R</given-names></name><name><surname>Palpant</surname><given-names>NJ</given-names></name><name><surname>Wang</surname><given-names>PL</given-names></name><name><surname>Afari</surname><given-names>N</given-names></name><name><surname>Jiang</surname><given-names>C</given-names></name><name><surname>Parast</surname><given-names>MM</given-names></name><name><surname>Murry</surname><given-names>CE</given-names></name><name><surname>Laurent</surname><given-names>LC</given-names></name><name><surname>Salzman</surname><given-names>J</given-names></name></person-group><year>2015</year><article-title>Statistically based spicing detection reveals neural enrichment and tissue-specific induction of circular RNA during human fetal development</article-title><source>Genome Biology</source><volume>16</volume><lpage>126</lpage><pub-id pub-id-type="doi">10.1186/s13059-015-0690-5</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vogel</surname><given-names>J</given-names></name><name><surname>Hess</surname><given-names>WR</given-names></name><name><surname>Borner</surname><given-names>T</given-names></name></person-group><year>1997</year><article-title>Precise branch point mapping and quantification of splicing intermediates</article-title><source>Nucleic Acids Research</source><volume>25</volume><fpage>2030</fpage><lpage>2031</lpage><pub-id pub-id-type="doi">10.1093/nar/25.10.2030</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>PL</given-names></name><name><surname>Bao</surname><given-names>Y</given-names></name><name><surname>Yee</surname><given-names>MC</given-names></name><name><surname>Barrett</surname><given-names>SP</given-names></name><name><surname>Hogan</surname><given-names>GJ</given-names></name><name><surname>Olsen</surname><given-names>MN</given-names></name><name><surname>Dinneny</surname><given-names>JR</given-names></name><name><surname>Brown</surname><given-names>PO</given-names></name><name><surname>Salzman</surname><given-names>J</given-names></name></person-group><year>2014</year><article-title>Circular RNA is expressed across the eukaryotic tree of life</article-title><source>PLOS ONE</source><volume>9</volume><fpage>e90859</fpage><pub-id pub-id-type="doi">10.1371/journal.pone.0090859</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Westholm</surname><given-names>JO</given-names></name><name><surname>Miura</surname><given-names>P</given-names></name><name><surname>Olson</surname><given-names>S</given-names></name><name><surname>Shenker</surname><given-names>S</given-names></name><name><surname>Joseph</surname><given-names>B</given-names></name><name><surname>Sanfilippo</surname><given-names>P</given-names></name><name><surname>Celniker</surname><given-names>SE</given-names></name><name><surname>Graveley</surname><given-names>BR</given-names></name><name><surname>Lai</surname><given-names>EC</given-names></name></person-group><year>2014</year><article-title>Genome-wide analysis of drosophila circular RNAs reveals their structural and sequence properties and age-dependent neural accumulation</article-title><source>Cell Reports</source><volume>9</volume><fpage>1966</fpage><lpage>1980</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2014.10.062</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zadeh</surname><given-names>JN</given-names></name><name><surname>Steenberg</surname><given-names>CD</given-names></name><name><surname>Bois</surname><given-names>JS</given-names></name><name><surname>Wolfe</surname><given-names>BR</given-names></name><name><surname>Pierce</surname><given-names>MB</given-names></name><name><surname>Khan</surname><given-names>AR</given-names></name><name><surname>Dirks</surname><given-names>RM</given-names></name><name><surname>Pierce</surname><given-names>NA</given-names></name></person-group><year>2011</year><article-title>NUPACK: analysis and design of nucleic acid systems</article-title><source>Journal of Computational Chemistry</source><volume>32</volume><fpage>170</fpage><lpage>173</lpage><pub-id pub-id-type="doi">10.1002/jcc.21596</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zaphiropoulos</surname><given-names>PG</given-names></name></person-group><year>1996</year><article-title>Circular RNAs from transcripts of the rat cytochrome P450 2C24 gene: correlation with exon skipping</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>93</volume><fpage>6536</fpage><lpage>6541</lpage><pub-id pub-id-type="doi">10.1073/pnas.93.13.6536</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>R</given-names></name><name><surname>Li</surname><given-names>X</given-names></name><name><surname>Ramaswami</surname><given-names>G</given-names></name><name><surname>Smith</surname><given-names>KS</given-names></name><name><surname>Turecki</surname><given-names>G</given-names></name><name><surname>Montgomery</surname><given-names>SB</given-names></name><name><surname>Li</surname><given-names>JB</given-names></name></person-group><year>2014a</year><article-title>Quantifying RNA allelic ratios by microfluidic multiplex PCR and sequencing</article-title><source>Nature Methods</source><volume>11</volume><fpage>51</fpage><lpage>54</lpage><pub-id pub-id-type="doi">10.1038/nmeth.2736</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>XO</given-names></name><name><surname>Wang</surname><given-names>HB</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Lu</surname><given-names>X</given-names></name><name><surname>Chen</surname><given-names>LL</given-names></name><name><surname>Yang</surname><given-names>L</given-names></name></person-group><year>2014b</year><article-title>Complementary sequence-mediated exon circularization</article-title><source>Cell</source><volume>159</volume><fpage>134</fpage><lpage>147</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2014.09.001</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.07540.024</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Black</surname><given-names>Douglas L</given-names></name><role>Reviewing editor</role><aff><institution>Howard Hughes Medical Institute, University of California, Los Angeles</institution>, <country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled “Circular RNA biogenesis can proceed through a lariat intermediate and is dictated by exon size” for consideration at <italic>eLife</italic>. Your article has been overall favorably evaluated by James Manley (Senior editor) and three reviewers, one of whom, Douglas Black, is a member of our Board of Reviewing Editors. Based on these reviews, summarized below, we will be happy to consider a revised submission addressing the points raised.</p><p>Summary:</p><p>This study by Salzman and colleagues examines the biogenesis of circular exon RNAs. This area is very topical. Although back-splicing to generate exon circles has long been described, recent studies have shown that these circles are common and often abundant gene products of largely unknown function. The authors here examine structural features that give rise to a back-spliced exon circle in <italic>S. pombe</italic> derived from exon 2 of the <italic>mrps16</italic> transcript. Previous results with metazoan exons indicated that RNA base-pairing interactions between sequences flanking an exon can enhance circle formation. However, many exons including <italic>mrps16</italic> exon 2 do not appear to have such an intron pairing interaction. Instead, splicing of exon 1 to exon 3 leads to a lariat intron containing exon 2 and the authors show that this serves as the precursor for circle formation. This pathway predicts that back-splicing of exon 2 within the lariat will yield a doubly branched RNA product containing the two flanking introns. Using a series of RT/PCR reactions with primers diagnostic of different RNA structures, as well as assaying the sensitivity of the products to various nucleases, they define many of the expected RNA products of the <italic>mrps16</italic> gene. RT/PCR around the lariat loop in a debranching deficient strain indicates that the exon-skipped lariat is produced. The Exon 1-Exon 3 spliced product is not detected, presumably due to nuclear or cytoplasmic decay (although it would be nice to show this). A final pair of primers produces a product with both branchpoint-5' splice site junctions, indicating that the doubly branched RNA lacking exon 2 is indeed produced. Mutation of the branchpoint upstream from exon 3 greatly reduces formation of the exon 2 circle indicating that formation of a lariat this site is a prerequisite of circle formation. Mutation of some of the other sites is complicated by cryptic splice site activation. Experiments with another circle derived from the <italic>pub1</italic> gene indicate that it is also formed from a lariat intermediate. Analysis of a debranchase deficient strain indicates increased circle formation genomewide in the absence of the debranching enzyme, including from the <italic>mrps16</italic> locus. However, the authors show for several other cases in <italic>S. pombe</italic> that exon skipping does not always lead to circle formation. They find that the skipped exons that do not produce circles are shorter than circle generating exons. A 90 nucleotide deletion within exon 2 greatly reduced circle formation. To further test the effect of exon length, they make a library of deletions within exon 2 and measure circularization relative to deletion size, finding a very rough increase in circle formation with longer exons. From these data, they conclude that both the formation of an exon-containing lariat by exon skipping, and the exon length contribute to frequency of back-splicing to form an exon circle.</p><p>All the reviewers found these data very interesting and that the authors were judicious in their interpretation of them. The identification of a doubly branched product from exon circularization is a striking and new finding that will influence the interpretation of other studies of exon circles. These data serve as a nice counterpoint to a recent paper in Cell, reporting that base pairing interactions between flanking introns can contribute to exon circle formation. As the authors point out, the exon-containing lariat may be a relevant feature when the introns are short, and secondary structure may contribute in some cases where the introns are long. However, it is not ruled out that the base-pairing in introns leads to exon skipping and hence to a similar pathway to that described here. Neither a base pairing interaction nor an exon-containing lariat seem to be a universal requirement; There still seem to be many circles that don't have either one. The exon length data was much less convincing, with few solid conclusions. The demonstration of the exon containing lariat as the precursor to the exon circle and the identification of the double branch product after circularization are results of significant interest for RNA biology. There are a number of aspects of this study that the reviewers felt should be improved.</p><p>Essential revisions:</p><p>One concern is the use of quantitative terminology that is inappropriate in the absence of standard curves. For example, in the subsection headed “Direct biochemical detection of backsplicing intermediates supports the existence of a lariat intermediate”, the statement “remarkably high levels” appears to be solely based on a robust band observed after 35 cycles of PCR. As all other products on this gel are derived from different primer combinations, we cannot tell whether the level is “remarkably high” as we have no relevant comparison. While quantitative assessment may not be essential to support all of the conclusions, efforts should be made to report on the actual amounts of some of the products they describe. It would strengthen our understanding of these processes to know the relative amount of RNA produced by exon-skipping and circularization compared to the exon-inclusion pathway. Where measurement is not possible, quantitative language should be avoided.</p><p>Given the nature of the PCR assay it is important that the identity of each product is confirmed by sequencing. This has been done in some cases, but are all the band identities validated in this way? The bands in <xref ref-type="fig" rid="fig5">Figure 5</xref> are dismissed due to incorrect size, but what are these products? In several figures, bands are doublets (e.g. <xref ref-type="fig" rid="fig2">Figure 2D</xref>, lane 12), but there is no mention in the text of whether two different products were identified by sequencing. This could have implications for the mechanism and should be addressed at least for the double lariat.</p><p>The correlation of circle formation with deletion size within exon 2 seems very rough at best (Figure 6). Moreover, there are other possible effects of these mutations that do not seem to have been explored. First, it is not clear that circularization should vary continuously with length. Perhaps there is a minimum size below which an exon cannot be circularized. In fact looking at the plot, there might be such a discontinuity as their deletion reaches 100 bp. The authors also do not control for other effects that these deletions might have. One could imagine that a deletion simply removes a specific sequence required by the splicing machinery to successfully back-splice. This possibility might be controlled for by adding back different sequences to restore the length while maintaining the loss of elements specific to exon 2. Conversely, a deletion might eliminate exon skipping altogether. If the mutant exon 2 is very efficiently spliced, there may be no substrate for back splicing. This also could be examined.</p><p>Although the authors do a careful and thorough job of laying out their arguments, the paper is not an easy read. A number of choices of terminology and presentation are not standard usage and will confuse readers. These must be fixed both to adhere to the actual biochemical relationships of the molecules, and to avoid confusion with other previously established uses for the same terms. Major examples are listed here with others in the minor comments.</p><p>Figures:</p><p>In <xref ref-type="fig" rid="fig2">Figure 2A</xref>, the brackets showing the rolling circle RT-RCR products in lane 7 and 8 make lane 9 unreadable. Even though there is no signal in that lane, the reader should be able to see lane 9. Asterisks next to the bands in lanes 7 and 8 should work fine.</p><p><xref ref-type="fig" rid="fig2">Figure 2B</xref> has a mirror image presentation of one sequence. This is confusing to assess and violates conventions against using mirror image letters and reading sequence 5' to 3'. Same for <xref ref-type="fig" rid="fig3s3">Figure 3–figure supplement 3</xref>. One might justify not following these conventions if it clarified some aspect of the data, but in this case it would be clearer to follow them.</p><p>In <xref ref-type="fig" rid="fig5">Figure 5</xref>, it seems like the red dashed lines are covering the place in the gel where the reader is supposed to assess the absence of signal. This is not possible with the dashed lines. An asterisk next to the lane would suffice to mark the position while still allowing the reader to see that there is no band there.</p><p>Terminology:</p><p>In the splicing field it is standard usage that the lariat intron and the spliced exons are both products of splicing. Because there are two catalytic steps, there are also intermediates called the free 5' exon and the “lariat intermediate”, which is the lariat intron still joined to exon 2. The use of the term “lariat intermediate” throughout this paper is confusing on two counts. First, the term has a different meaning from standard usage in the field. Second, the authors work quite hard to establish this exon-skipped lariat product as the precursor molecule for exon circularization. Possible alternative language for heading of the second section in the Results: “Quantitative analysis of splice isoforms demonstrates that the dominant pathway for circular RNA biogenesis in <italic>mrps16</italic> uses the lariat product of exon skipping as a precursor in a second round of splicing”.</p><p>Finally what is a “terminated fork”? The direct backsplicing mechanism would involve a Y-shaped intermediate, similar to that produced by trans-splicing, instead of a lariat intermediate, and in the second step would produce a circle and a Y-shaped product instead of a lariat product.</p><p>Minor points:</p><p>1) In Figure 6–figure supplement 4, the authors show a secondary structure predicted for the exon. It would be interesting to know more about this. Do finer grained mutations that disrupt it affect circularization? As the authors state, a secondary structure would shorten the effective distance between the exon ends, but it may also possibly interfere with assembly of spliceosomal components or alter their bound conformation, which perhaps could positively affect the ability to back-splice. It would be helpful to resolve more clearly if the structure affected circle formation or not.</p><p>2) Is the ∆90 mutation plotted on Figure 6D?</p><p>3) It may be the exposure of the gel, but in <xref ref-type="fig" rid="fig3s3">Figure 3–figure supplement 3</xref> the bands in B don't seem to agree with the bar graph in C. It appears that there is more of the BP-mutated one-exon circle relative to wild type than of the BP-mutated two-exon circle relative to wild type. The bar graph shows the opposite.</p><p>4) In <xref ref-type="fig" rid="fig3s3">Figure 3–figure supplement 3</xref>, what do the two shades of gray mean in the bar graph?</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.07540.025</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p><italic>All the reviewers found these data very interesting and that the authors were judicious in their interpretation of them. The identification of a doubly branched product from exon circularization is a striking and new finding that will influence the interpretation of other studies of exon circles. These data serve as a nice counterpoint to a recent paper in Cell, reporting that base pairing interactions between flanking introns can contribute to exon circle formation. As the authors point out, the exon-containing lariat may be a relevant feature when the introns are short, and secondary structure may contribute in some cases where the introns are long. However, it is not ruled out that the base-pairing in introns leads to exon skipping and hence to a similar pathway to that described here. Neither a base pairing interaction nor an exon-containing lariat seem to be a universal requirement; There still seem to be many circles that don't have either one. The exon length data was much less convincing, with few solid conclusions. The demonstration of the exon containing lariat as the precursor to the exon circle and the identification of the double branch product after circularization are results of significant interest for RNA biology. There are a number of aspects of this study that the reviewers felt should be improved</italic>.</p><p>We appreciate the expert and insightful interpretation of our paper. We have attempted to clarify a very interesting point raised above: because of both nuclear and cytoplasmic surveillance mechanisms, exon-skipped products, from yeast to humans, can be highly unstable. Hence, the presence of an exon-skipped linear RNA is not a prerequisite for the existence of exon-containing lariat. We have revised the draft to include a discussion of this, because as you point out, it may be important for broader inference on mechanisms responsible for circular RNA biogenesis. Finally, as detailed below, we have clarified our interpretation of our mutation analyses leading us to find an effect of exon length on circular RNA abundance.</p><p><italic>Essential revisions</italic>:</p><p><italic>One concern is the use of quantitative terminology that is inappropriate in the absence of standard curves. For example, in the subsection headed “Direct biochemical detection of backsplicing intermediates supports the existence of a lariat intermediate”, the statement</italic> “<italic>remarkably high levels</italic>” <italic>appears to be solely based on a robust band observed after 35 cycles of PCR. As all other products on this gel are derived from different primer combinations, we cannot tell whether the level is</italic> “<italic>remarkably high</italic>” <italic>as we have no relevant comparison. While quantitative assessment may not be essential to support all of the conclusions, efforts should be made to report on the actual amounts of some of the products they describe. It would strengthen our understanding of these processes to know the relative amount of RNA produced by exon-skipping and circularization compared to the exon-inclusion pathway. Where measurement is not possible, quantitative language should be avoided</italic>.</p><p>Thank you for pointing this out. We have revised our language and added quantitation when possible, which includes qPCR quantification of the relative abundance of various <italic>mrps16</italic> splice isoforms (linear mRNA, circular RNA, and lariat precursor) in wild type and <italic>dbr1∆</italic> yeast (<xref ref-type="fig" rid="fig2s1">Figure 2–figure supplement 1</xref>).</p><p>Your request and a recent study by Bahler and colleagues (<xref ref-type="bibr" rid="bib3">Bitton et al.<italic>,</italic> 2015</xref>) that was published while our work was in review motivated us to examine the concordance between our RNA-Seq analysis and our qPCR studies of WT and debranching mutants. <xref ref-type="bibr" rid="bib3">Bitton et al., 2015</xref> includes a broad RNA-Seq study of several whole transcriptome RNA-seq profiles of WT <italic>S. pombe,</italic> as well as several splicing mutants. Like our analysis of the Bahler groups’ 2014 data which we discussed in our manuscript, <xref ref-type="bibr" rid="bib3">Bitton et al. (2015)</xref> find a global increase in expression of circular RNA in the same dataset of lariat debranching on circular RNAs (<xref ref-type="bibr" rid="bib4">Bitton et al., 2014</xref>).</p><p>We sought to confirm this result and our qPCR shows a slight (∼50%), but statistically non-significant increase in abundance of circular RNA compared to the linear isoform in the debranching mutant. In addition, by examining the recent analysis in <xref ref-type="bibr" rid="bib3">Bitton et al., 2015</xref>, we observed significant variation in the <italic>mrps16</italic> circle: total splice isoform ratio within the WT RNA-Seq biological replicates. For example, in one case, the <italic>mrps16</italic> circle:total splice ratio is actually higher in WT than in either of the debranching mutant replicates which varies from 0.13 to 0.18 (see <xref ref-type="bibr" rid="bib3">Bitton et al., 2015</xref>, Supplementary Table S11, line 8).</p><p>These findings are in contrast to our initial RNA-seq analysis which found a statistically significant 6-fold difference in this ratio between the two strains. We have repeated our qPCR to assess whether input RNA mass RNA into the RT step, different RT priming strategies, different reverse transcriptases, or different qPCR mixes are responsible for this effect. In none of these cases do we see a 6-fold effect.</p><p>Our RNA-seq analysis also found a <italic>global</italic> 6-fold increase in the circle:linear ratio in <italic>dbr</italic>∆ vs. wild type <italic>S. pombe</italic>. This result and its apparent discrepancy with our <italic>mrps16</italic> qPCR data could be explained by a) a real biological effect in which the splicing of <italic>mrps16</italic> circular RNA does not respond to increases in lariat abundance through inhibiting lariat debranching (e.g., the spliceosome is deposited co-transcriptionally, making a subset of lariats competent to splice; thus, preventing lariat degradation will not lead to increases in this pool) or b) technical differences between qPCR and RNA-Seq. In light of these findings, we believe that on average, there may be an increase in the <italic>mrps16</italic> circle:linear ratio in the debraching mutant; however, the experimental noise of both the RNA-seq and qPCR preclude us from making conclusions that belong in the Results section. Instead, we now comment on the results presented in <xref ref-type="bibr" rid="bib3">Bitton et al<italic>.,</italic> 2015</xref> in our Discussion.</p><p><italic>Given the nature of the PCR assay it is important that the identity of each product is confirmed by sequencing. This has been done in some cases, but are all the band identities validated in this way? The bands in</italic> <xref ref-type="fig" rid="fig5"><italic>Figure 5</italic></xref> <italic>are dismissed due to incorrect size, but what are these products? In several figures, bands are doublets (e.g.</italic> <xref ref-type="fig" rid="fig2"><italic>Figure 2D</italic></xref><italic>, lane 12), but there is no mention in the text of whether two different products were identified by sequencing. This could have implications for the mechanism and should be addressed at least for the double lariat</italic>.</p><p>We have confirmed all major products by sequencing, excepting the exon-containing lariats in <xref ref-type="fig" rid="fig4">Figure 4</xref> (previously, <xref ref-type="fig" rid="fig5">Figure 5</xref>), which were predicted to exist by <xref ref-type="bibr" rid="bib2">Awan et al.<italic>,</italic> 2013</xref> and are of the predicted size. Because RT across a 2’-5’ linkage introduces single nucleotide deletions and mutations, sequencing these products would require extensive cloning efforts. We have clarified our manuscript to make clear that our identification of the products in <xref ref-type="fig" rid="fig4">Figure 4</xref> were based on size rather than sequence.</p><p>As you point out we observe a number of ‘shadow’ bands or ‘doublets,’ especially on our gel in <xref ref-type="fig" rid="fig2">Figure 2D</xref>. In order to understand what these bands could be, we cloned the products in <xref ref-type="fig" rid="fig2">Figure 2D</xref>, Lane 12 (the double lariat). We chose this product for two main reasons: 1. As you suggest, it may contain other products relevant to the mechanism. 2. The doublets are approximately equal intensity in this product, so it should be straightforward to see the distinct products by cloning (i.e., they should appear in approximately a 1:1 ratio).</p><p>We randomly selected 16 clones and performed a colony PCR and sequenced these clones (<xref ref-type="fig" rid="fig2s2">Figure 2–figure supplement 2</xref>). 10/16 clones were of the appropriate size to arise from this doublet. However, sequencing reveals that these products only differ by at most 2 nt’s in size, and that the products do not appear to represent distinct splice isoforms (see ClustalW2 alignment, <xref ref-type="fig" rid="fig2s3">Figure 2–figure supplement 3</xref>). We hypothesize that the reason for the doublet could be that, after many cycles of PCR, if the primer concentrations are uneven and limiting, a single-stranded product may form along with the double-stranded product; this single-stranded product may have a slight anomalous migration on the gel, leading to the doublet appearance we observe.</p><p>We did a literature search to determine if this problem has been addressed in the literature. While others have clearly encountered this problem, we could not find a scholarly discussion (rather, it is addressed on internet forums, for example: <ext-link ext-link-type="uri" xlink:href="http://www.researchgate.net/post/Can_anyone_explain_the_secondary_DNA_bands_in_agarose_gel_besides_a-specific_amplification_in_PCR">http://www.researchgate.net/post/Can_anyone_explain_the_secondary_DNA_bands_in_agarose_gel_besides_a-specific_amplification_in_PCR</ext-link>).</p><p><italic>The correlation of circle formation with deletion size within exon 2 seems very rough at best (Figure 6). Moreover, there are other possible effects of these mutations that do not seem to have been explored. First, it is not clear that circularization should vary continuously with length. Perhaps there is a minimum size below which an exon cannot be circularized. In fact looking at the plot, there might be such a discontinuity as their deletion reaches 100 bp. The authors also do not control for other effects that these deletions might have. One could imagine that a deletion simply removes a specific sequence required by the splicing machinery to successfully back-splice. This possibility might be controlled for by adding back different sequences to restore the length while maintaining the loss of elements specific to exon 2. Conversely, a deletion might eliminate exon skipping altogether. If the mutant exon 2 is very efficiently spliced, there may be no substrate for back splicing. This also could be examined</italic>.</p><p>Thank you for raising this very interesting point. We agree that circularization efficiency should not vary continuously with length (we have removed our fitted curve so as not to imply this), but our data supports a general monotonic trend that larger deletions in <italic>mrps16</italic> exon 2 are less efficiently circularized. Both our analysis of endogenous circular RNA expression in other organisms (such as human, see <xref ref-type="bibr" rid="bib27">Salzman et al<italic>.</italic>, 2013</xref>) and mutations in <italic>mrps16</italic> support the idea that exons smaller than 100nt can circularize. For example, the ∆90 nt (total exon length=91 nt) <italic>mrps16</italic> exon 2 isoform we analyzed by clonal analysis does form a circle, although at a much lower efficiency. Also, to address your last point, for this clone, we have analyzed the abundance of the lariat precursor production as well as splicing of the linear products exon1–exon 2 and exon 2–exon 3 by qPCR, which we now discuss in the manuscript.</p><p>Finally, for our <italic>mrps16</italic> mutants, you note that we did not control for other effects these deletions might have, such as removing a specific sequence required for backsplicing. We have clarified this point in the manuscript: we have indeed considered the possibility that a simple sequence motif has a significant impact on circular RNA abundance. This model would suggest that all deletions which contain deletions of a particular sequence motif (the one facilitating backsplicing) would result in attenuation of circular RNA abundance. We have specifically tested this model, and found it failed to fit the data. We included a figure that demonstrates this (<xref ref-type="fig" rid="fig5s5">Figure 5–figure supplement 5</xref>). We have also considered impacts of sequence deletions on structural properties of the <italic>mrps16</italic> circular RNA, discussed in the last section of the paper. However, we believe that computational structure predictions are not accurate enough to allow us to draw firm conclusions about this analysis, and have chosen not to emphasize it in the draft.</p><p>To reiterate, thank you again for raising these key questions: we have added discussion of these points in the manuscript which we believe have improved its clarity.</p><p><italic>Although the authors do a careful and thorough job of laying out their arguments, the paper is not an easy read. A number of choices of terminology and presentation are not standard usage and will confuse readers. These must be fixed both to adhere to the actual biochemical relationships of the molecules, and to avoid confusion with other previously established uses for the same terms. Major examples are listed here with others in the minor comments</italic>.</p><p><italic>Figures</italic>:</p><p><italic>In</italic> <xref ref-type="fig" rid="fig2"><italic>Figure 2A</italic></xref><italic>, the brackets showing the rolling circle RT-RCR products in lane 7 and 8 make lane 9 unreadable. Even though there is no signal in that lane, the reader should be able to see lane 9. Asterisks next to the bands in lanes 7 and 8 should work fine</italic>.</p><p>Thank you for making this suggestion; we have indicated the rolling-circle products in 2A with ‘‡’.</p><p><xref ref-type="fig" rid="fig2"><italic>Figure 2B</italic></xref> <italic>has a mirror image presentation of one sequence. This is confusing to assess and violates conventions against using mirror image letters and reading sequence 5' to 3'. Same for</italic> <xref ref-type="fig" rid="fig3s3"><italic>Figure 3–figure supplement 3</italic></xref><italic>. One might justify not following these conventions if it clarified some aspect of the data, but in this case it would be clearer to follow them</italic>.</p><p>Thank you for making this suggestion; we have changed the manuscript according to your suggestion.</p><p><italic>In</italic> <xref ref-type="fig" rid="fig5"><italic>Figure 5</italic></xref><italic>, it seems like the red dashed lines are covering the place in the gel where the reader is supposed to assess the absence of signal. This is not possible with the dashed lines. An asterisk next to the lane would suffice to mark the position while still allowing the reader to see that there is no band there</italic>.</p><p>Thank you for making this suggestion; we have replaced the dashes with a small asterisk.</p><p><italic>Terminology</italic>:</p><p><italic>In the splicing field it is standard usage that the lariat intron and the spliced exons are both products of splicing. Because there are two catalytic steps, there are also intermediates called the free 5' exon and the</italic> “<italic>lariat intermediate</italic>”<italic>, which is the lariat intron still joined to exon 2. The use of the term</italic> “<italic>lariat intermediate</italic>” <italic>throughout this paper is confusing on two counts. First, the term has a different meaning from standard usage in the field. Second, the authors work quite hard to establish this exon-skipped lariat product as the precursor molecule for exon circularization. Possible alternative language for heading of the second section in the Results:</italic> “<italic>Quantitative analysis of splice isoforms demonstrates that the dominant pathway for circular RNA biogenesis in</italic> mrps16 <italic>uses the lariat product of exon skipping as a precursor in a second round of splicing</italic>”<italic>.</italic></p><p><italic>Finally what is a</italic> “<italic>terminated fork</italic>”<italic>? The direct backsplicing mechanism would involve a Y-shaped intermediate, similar to that produced by trans-splicing, instead of a lariat intermediate, and in the second step would produce a circle and a Y-shaped product instead of a lariat product</italic>.</p><p>Thank you for pointing out our use of language that is potentially confusing. We have clarified it using alternative language according to your suggestions. The use of the terminology “terminated fork” was introduced in <xref ref-type="bibr" rid="bib17">Jeck et al., 2013</xref>, and we adopted it for consistency. But as you point out, the splicing field has nomenclature for this product that precedes the use of the name “terminated fork,” and we have amended the manuscript to reflect this.</p><p>Minor points:</p><p><italic>1) In Figure 6–figure supplement 4, the authors show a secondary structure predicted for the exon. It would be interesting to know more about this. Do finer grained mutations that disrupt it affect circularization? As the authors state, a secondary structure would shorten the effective distance between the exon ends, but it may also possibly interfere with assembly of spliceosomal components or alter their bound conformation, which perhaps could positively affect the ability to back-splice. It would be helpful to resolve more clearly if the structure affected circle formation or not</italic>.</p><p>Thank you for raising this question. We unfortunately are limited in the number and size of the mutations that we observe in this particular region and unfortunately small deletions are not highly represented here. Based on the data we currently have, we believe this structure might somehow repress circularization, perhaps by restricting the flexibility of the exon.</p><p><italic>2) Is the ∆90 mutation plotted on Figure 6D?</italic></p><p>No, it is not. We have now clarified this in the text.</p><p><italic>3) It may be the exposure of the gel, but in</italic> <xref ref-type="fig" rid="fig3s3"><italic>Figure 3–figure supplement 3</italic></xref> <italic>the bands in B don't seem to agree with the bar graph in C. It appears that there is more of the BP-mutated one-exon circle relative to wild type than of the BP-mutated two-exon circle relative to wild type. The bar graph shows the opposite</italic>.</p><p>This is an interesting point, and we realize that it would be impossible to know why unless you were acquainted with the raw data.</p><p>The reason for this is that the exon3 circle is more abundant (qPCR Ct= 27) than the intron-retained circle (qPCR Ct= 32). Thus, after 35 cycles (the # of cycles of PCR prior to running on the gel), the PCR for the exon 3 circle is close to saturation in both wt and ∆BP <italic>pub1</italic>, whereas a more dramatic difference can be observed for the intron-retained circle. We have illustrated this effect in the <xref ref-type="fig" rid="fig6">Author response image 1</xref>.<fig id="fig6" position="float"><object-id pub-id-type="doi">10.7554/eLife.07540.026</object-id><label>Author response image 1.</label><caption><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.07540.026">http://dx.doi.org/10.7554/eLife.07540.026</ext-link></p></caption><graphic xlink:href="elife-07540-resp-fig1-v2.tif"/></fig></p><p>4) In <xref ref-type="fig" rid="fig3s3">Figure 3–figure supplement 3</xref>, what do the two shades of gray mean in the bar graph?</p><p>One shade of grey represents products derived from the <italic>wt pub1</italic> plasmid while the other represents products derived from the ∆BP <italic>pub1</italic> plasmid. We apologize if this was not clear in our initial submission; we have created a legend to clarify this figure.</p></body></sub-article></article>