eLife digest

elife

eLife

2050-084X

eLife Sciences Publications, Ltd

100218

10.7554/eLife.100218

10.7554/eLife.100218.3

version of record

Research Article

Immunology and Inflammation

Expression of a single inhibitory member of the Ly49 receptor family is sufficient to license NK cells for effector functions

Piersma

Sytse J

https://orcid.org/0000-0002-5379-3556

spiersma@wustl.edu12Li

Shasha

https://orcid.org/0000-0001-5924-6396

1Wong

Pamela

1Bern

Michael D

13Poursine-Laurent

Jennifer

1Yang

Liping

1Beckman

Diana L

1Parikh

Bijal A

4Yokoyama

Wayne M

https://orcid.org/0000-0002-0566-7264

151

https://ror.org/036c27j91

Division of Rheumatology, Department of Medicine, Washington University School of Medicine

St Louis

United States2

https://ror.org/036c27j91

Siteman Cancer Center, Washington University School of Medicine

St Louis

United States3

https://ror.org/036c27j91

Division of Oncology, Department of Medicine, Washington University School of Medicine

St Louis

United States4

https://ror.org/036c27j91

Department of Pathology and Immunology, Washington University School of Medicine

St Louis

United States5

https://ror.org/036c27j91

Bursky Center for Human Immunology and Immunotherapy Programs, Washington University School of Medicine

St. Louis

United States

Zaidi

Neeha

Reviewing Editor

https://ror.org/00za53h95

Johns Hopkins University

United StatesTaniguchi

Tadatsugu

Senior Editor

https://ror.org/057zh3y96

University of Tokyo

Japan

14032025

RP100218

04062024

This manuscript was published as a preprint.

06062024

This manuscript was published as a reviewed preprint.

26092024

The reviewed preprint was revised.

06022025

2024

Piersma et al

http://creativecommons.org/licenses/by/4.0/

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Natural killer (NK) cells recognize target cells through germline-encoded activation and inhibitory receptors enabling effective immunity against viruses and cancer. The Ly49 receptor family in the mouse and killer immunoglobin-like receptor family in humans play a central role in NK cell immunity through recognition of major histocompatibility complex class I (MHC-I) and related molecules. Functionally, these receptor families are involved in the licensing and rejection of MHC-I-deficient cells through missing-self. The Ly49 family is highly polymorphic, making it challenging to detail the contributions of individual Ly49 receptors to NK cell function. Herein, we showed mice lacking expression of all Ly49s were unable to reject missing-self target cells in vivo, were defective in NK cell licensing, and displayed lower KLRG1 on the surface of NK cells. Expression of Ly49A alone on an H-2D^d background restored missing-self target cell rejection, NK cell licensing, and NK cell KLRG1 expression. Thus, a single inhibitory Ly49 receptor is sufficient to license NK cells and mediate missing-self in vivo.

eLife digest

Immune cells help to protect the body from infections and cancer. One way that they do this is by recognising and destroying harmful cells. Natural killer cells (known as NK cells) can tell whether cells are healthy or harmful based on the molecules that are present on their surface. For example, molecules known as MHC Class I are commonly found on healthy cells whereas cancer cells and those infected with viruses can lose these molecules from their surface.

NK cells use inhibitory receptors to recognise MHC Class I molecules. If they do not detect this molecule on the surface of a cell, the NK cell can become activated and kill the unhealthy cell. In mice, a group of receptors known as the Ly49 family are thought to be responsible for this process. However, Ly49 receptors are complex and their individual roles in NK cells remained unclear.

To investigate, Piersma et al. developed mice without any of the Ly49 receptors. A single receptor was then re-introduced to identify its individual role. These experiments showed that the Ly49 receptor family is required for NK cells to detect a lack of MHC Class I molecules on cells. The receptors also allow NK cells to express certain receptors and to be fully functional. Introducing an individual Ly49 receptor was sufficient to restore these abilities, suggesting that a single receptor can mediate these processes.

The findings of Piersma et al. provide a deeper understanding of how NK cell inhibitory receptors work in mice. Further investigation of the equivalent receptors in humans may aid understanding of the mechanisms involved in recognising harmful changes to cells. In the future, this information may help to improve cancer and anti-viral treatments.

natural killer cellinnate immunityimmune receptorcellular immunity

Research organismMouse

http://dx.doi.org/10.13039/100000002

National Institutes of Health

R01-AI129545

Yokoyama

Wayne M

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Author impact statement

A novel mouse model offers definitive evidence that a single inhibitory receptor family governs the critical natural killer cell functions of licensing and missing-self.

publishing-route

prc

Introduction

Natural killer (NK) cells are innate lymphoid cells (ILCs) that can mediate effective immunity against viruses and cancer through direct lysis and cytokine production (Huntington et al., 2020; Piersma and Brizić, 2022). NK cells recognize their target cells through integration of signals by germline-encoded activation and inhibitory receptors (Long et al., 2013). These inhibitory receptors include members of the Ly49 family in the mouse that are encoded by the Klra gene family and killer immunoglobin-like receptor (KIR) family in humans and they prevent killing of healthy cells through recognition of major histocompatibility complex class I (MHC-I) (Colonna and Samaridis, 1995; Karlhofer et al., 1992). Host cells may lose surface MHC-I expression in response to virus infection or malignant transformation. As a result, these cells become invisible to CD8⁺ T cells, but simultaneously become targets for NK cells through ‘missing-self’ recognition (Kärre et al., 1986).

The inhibitory Ly49 molecules appear to be responsible for missing-self recognition in mice (Babić et al., 2010; Bélanger et al., 2012; Gamache et al., 2019; Parikh et al., 2020; Zhang et al., 2019). However, it has been sometimes challenging to draw definitive conclusions because the Ly49 family is highly polymorphic and differs between mouse strains. Moreover, multiple inhibitory Ly49 receptors within a single host can recognize a given MHC-I molecule while others apparently have no ligands and instead recognize other MHC-I alleles (Schenkel et al., 2013). Yet, the Ly49s for non-host MHC-I alleles are still expressed. For example, in the C57BL/6 background, Ly49C and Ly49I can recognize H-2^b MHC-I molecules that include H-2K^b and H-2D^b, while Ly49A and Ly49G cannot recognize H-2^b molecules and instead they recognize H-2^d alleles. Still these Ly49s are expressed in C57BL/6 mice, so their individual contributions to missing-self rejection are unclear. Ly49A has also been implicated in recognition of the non-classical MHC-I molecule H2-M3, which is upregulated in response to exposure to N-formylated peptides (Andrews et al., 2012; Chiu et al., 1999). Importantly, the specificities of several Ly49s have been clearly established while others remain to be confirmed. For example, the binding of Ly49A to H-2D^d has been confirmed by crystallographic studies (Tormo et al., 1999), and validated by mutational analysis of both Ly49A and H-2D^d (Matsumoto et al., 2001; Wang et al., 2001). By contrast, the MHC-I specificities of other Ly49s have been primarily studied with MHC tetramers containing human β₂-microglobulin (B2m), which is not recognized by Ly49A (Mitsuki et al., 2004), on cells overexpressing Ly49s (Hanke et al., 1999). Thus, the contributions of individual Ly49 receptors to NK cell effector function are confounded by the expression of multiple receptors, some of which may be irrelevant to a given self-MHC haplotype, and multiple Ly49 molecules whose specificities are less well defined.

In addition to effector function in missing-self, Ly49 receptors that recognize their cognate MHC-I ligands are involved in the licensing or education of NK cells to acquire functional competence. NK cell licensing is characterized by potent effector functions including IFNγ production and degranulation in response to activation receptor stimulation (Elliott et al., 2010; Kim et al., 2005). Like missing-self recognition, inhibitory Ly49s require SHP-1 for NK cell licensing, which interacts with the ITIM-motif encoded in the cytosolic tail of inhibitory Ly49s (Bern et al., 2017; Kim et al., 2005; Viant et al., 2014). Moreover, lower expression of SHP-1, particularly within the immunological synapse, is associated with licensed NK cells (Schmied et al., 2023; Wu et al., 2021). Thus, inhibitory Ly49s have a second function that licenses NK cells to self-MHC-I, thereby generating functionally competent NK cells, but it has not been possible to exclude contributions from other co-expressed Ly49s.

The complex nature of the Ly49 family confounds our fundamental understanding of these receptors, particularly regarding their function in vivo. To better understand Ly49 function in vivo, several groups made mutant mouse lines with altered expression of the Klra locus. This was pioneered by the Makrigiannis group, which targeted the promotor of Klra15 encoding Ly49O in 129 ES cells and resulting mice were subsequently backcrossed to C57BL/6 background (Bélanger et al., 2012). These mice were defective in the rejection of MHC-I-deficient target cells in vivo and exhibited reduced tumor control as well (Tu et al., 2014). However, there was limited surface expression of NKG2A as well as Ly49s so these target defects were not solely dependent on the absence of Ly49s. Moreover, these mice likely carried 129 alleles of other genes in the NK gene complex (NKC) that are expressed on NK cells, display allelic polymorphisms and are genetically linked to Klra locus that encode the Ly49s. Following the development of mouse CRISPR engineering, the Dong group deleted the entire 1.4 Mb Klra locus in the C57BL/6 NKC and showed that Ly49-deficient mice were unable to reject MHC-I-deficient cells in vivo at steady state (Zhang et al., 2019). Besides loss of Ly49 receptor expression, surface expression of other receptors, including KLRG1, NKG2A, NKG2D, and CD94, was also reduced in these mice. Around the same time, we generated a mouse that contains a 66 kb and 149 kb deletion in the C57BL/6 Klra locus, resulting in the loss of four Ly49 molecules, including Ly49A and Ly49G (Parikh et al., 2020). The resulting ΔLy49-1 mice were also deficient in H2D^d-restricted control of murine cytomegalovirus (MCMV), which was rescued by knock-in of Ly49A into the Ncr1 locus. Thus, available genetic evidence suggests inhibitory Ly49 receptors are essential for licensing and missing-self recognition.

The current data, however, do not take into account that individual Ly49s are stochastically expressed on NK cells, and multiple receptors are simultaneously expressed on individual NK cells, resulting in a diverse Ly49 repertoire of potential specificities on overlapping subsets of NK cells (Dorfman and Raulet, 1998; Kubota et al., 1999; Smith et al., 2000). As a result, not all NK cells express a specific Ly49 receptor and most NK cells express multiple Ly49 molecules, making it difficult to study the biology of a specific Ly49 receptor without genetic approaches. However, Klra genes encoding the Ly49 receptor family are highly related and clustered together, resulting in a high concentration of repetitive elements (Makrigiannis et al., 2005), complicating the capacity to target individual Klra genes for definitive analysis. Moreover, in ΔLy49-1 mice, which had an intact Klra4 coding sequence encoding Ly49D, the percentage of NK cells expressing Ly49D was markedly reduced, even though Ly49D was otherwise expressed at normal levels, suggesting a regulatory locus control region within the deleted fragments (Parikh et al., 2020). Such data raise the possibility that the large genetic deletions of the Ly49 locus may affect other NK cell receptors in the NKC that contribute to NK cell function. Thus, expression of individual Ly49 receptors without confounding effects of other Ly49s and potentially other NKC genes is needed to validate the conclusions from the study of mice lacking Ly49 expression.

Here, we studied the role of an individual Ly49 receptor in NK cell function. To this end, we deleted all NK cell Klra genes encoding the Ly49 receptor family using CRISPR/Cas9 and confirmed the role of the Ly49 family in missing self and licensing. Subsequently, we expressed Ly49A in isolation under control of the Ncr1 locus in Ly49-deficient mice on an H-2D^d background to show that a single inhibitory Ly49 receptor expressed by all NK cells is sufficient for licensing and mediating missing-self in vivo.

ResultsNK cells from CRISPR-generated mice lacking all NK cell-related Ly49 molecules display reduced KLRG1 expression

To investigate the role of individual Ly49 molecules, we generated a mouse that lacked all expressed Ly49 receptors. We targeted the remaining Klra region encoding the Ly49 receptor family in our previously published ΔLy49-1 mouse (Parikh et al., 2020) with guide RNAs targeting Klra9 and Klra17. The resulting mouse contained a fusion between Klra9 and Klra17 with a deletion of the start codon and insertion of a fusion sequence that did contain a potential start site for a putative five amino acid polypeptide (Figure 1A). We confirmed that the 3′ deletion reported in the ΔLy49-1 mouse was unaffected, resulting in a frameshift and a premature stop codon after nine amino acids in the fused Klra7/1 gene. Thus, genetic and sequencing analysis revealed all Ly49 genes were disrupted and we termed this mouse line Ly49KO (Figure 1A).

Figure 1.Mice generated to lack all natural killer (NK)-related Ly49 molecules using CRISPR have NK cells that display alterations in select surface molecules.

(A) Genetic map of the Ly49 family encoded by the Klra gene locus of wildtype C57BL/6 and Ly49KO mice with Sanger sequencing of the fusion sequences in the Ly49KO mice. (B) Ly49 receptor expression on splenic NK cells of the indicated genotype with 2-3 mice per group. (C) Surface receptor expression on splenic NK cells from indicated genotype with 3 mice per group. (D) Expression of the maturation markers CD27 and CD11b on splenic NK cells from indicated genotype with 3 mice per group. MFI, median fluorescent intensity. Statistics were calculated using two-way ANOVA with corrections for multiple testing. Error bars indicate SEM; ns, not significant; *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001.

Figure 1—source data 1.Ly49KO Sanger sequencing files.

Figure 1—source data 2.Receptor expression profile raw data.

Flow cytometry confirmed loss of cell surface expression of Ly49 molecules in homozygous Ly49KO mice (Figure 1B). NKG2A, CD94, and NKG2D molecules that are encoded by the NKG2 locus, located next to the Ly49 locus, were still expressed, albeit at marginally lower frequencies (Figure 1C; Yokoyama and Plougastel, 2003). Unrelated molecules 2B4 and CD122 were unaffected. In heterozygous Ly49KO mice, the percentages of NK cells expressing Ly49A, Ly49C, Ly49D, Ly49G2, Ly49H, and Ly49I were reduced by 33–41%. The median fluorescent intensity (MFI) for Ly49I was reduced by 26% in Ly49I⁺ NK cells in heterozygous Ly49KO mice, while the other Ly49s did not display significant differences in MFI. Consistent with apparent dependence of normal KLRG1 expression on MHC-I expression (Corral et al., 2000) and previous reports (Zhang et al., 2019), Ly49KO NK cells showed a 51% reduction in KLRG1 expression (Figure 1C). NK cells in Ly49KO mice displayed similar maturation to wildtype NK cells, based on the expression of the surface markers CD27 and CD11b (Figure 1D). Thus, Ly49KO mice specifically lack all Ly49 molecules and display moderate alterations in select surface molecules while showing otherwise normal numbers of apparently mature NK cells.

Ly49-deficient NK cells are defective in licensing and rejection of MHC-I-deficient target cells

Inhibitory Ly49-positive NK cells can be licensed through recognition of cognate MHC-I molecules, resulting in a phenotype of increased IFNγ production following plate-bound anti-NK1.1 stimulation (Kim et al., 2005). NKG2A has been implicated in NK cell licensing by the non-classical MHC-I molecule Qa1 (Anfossi et al., 2006), and to eliminate potential confounding effects by this interaction, effector functions of NKG2A- NK cells were evaluated as described before (Bern et al., 2017). Stimulation of Ly49KO NK cells with anti-NK1.1 resulted in a 73% reduction in IFNγ production compared to wildtype NK cells, similar to unlicensed NK cells from H-2K^b and H-2D^b double-deficient (KODO) mice (Figure 2A). Both Ly49KO and KODO NK cells produced high amounts of IFNγ in response to phorbol 12-myristate 13-acetate (PMA) plus ionomycin (Figure 2B), indicating that their IFNγ production machinery is intact. Thus, these results confirm that Ly49 molecules are required for the NK cell licensed phenotype.

Figure 2.Natural killer (NK) cell licensing and rejection of MHC-I-deficient target cells are defective in Ly49KO mice.

Splenocytes from the indicated mice were stimulated with plate-bound anti-NK1.1 (A) or phorbol 12-myristate 13-acetate (PMA)/ionomycin (B) and IFNγ production by NKG2A- NK cells and analyzed by flow cytometry with 2-3 mice per group. (C) In vivo cytotoxicity assay against H-2K^b, H-2D^b, and full MHC-I -deficient targets. Splenocytes from WT, H-2Kb, H-2Db, and MHC-I-deficient mice were differentially labeled with CellTrace Violet (CTV) and CellTrace Far Red (CTFR) as indicated. Mixture of labeled target cells was injected i.v. into wildtype, Ly49KO, and anti-NK1.1-depleted mice with 6-8 mice per group. Target cells were analyzed in the spleens by flow cytometry 2 days after challenge. KODO, H-2K^b × H-2D^b knock out; MHC-I KO, KODO × B2m knockout; MFI, median fluorescent intensity. Statistics were calculated using one-way (A and B) and two-way (C) ANOVA with corrections for multiple testing. Error bars indicate SEM; ns, not significant; *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001.

Figure 2—source data 1.IFNγ production and in vivo killing assay raw data.

To investigate the capability of Ly49KO NK cells to reject MHC-I-deficient target cells, we challenged anti-NK1.1 NK cell-depleted, wildtype, and Ly49KO mice with a mixture of wildtype, B2m-deficient × KODO (MHC-I KO), H-2D^b KO, and H-2K^b KO splenocytes that were differentially labeled with CellTrace Far Red (CTFR) and CellTrace Violet (CTV) (Figure 2C). While wildtype mice efficiently rejected MHC-I KO and H-2K^b KO target cells, only 13% of H-2D^b KO target cells were rejected by wildtype mice, indicating that missing-self recognition in the C57BL/6 background depends on the absence of H-2K^b rather than H-2D^b. None of the target cell populations were rejected in the Ly49KO mice, comparable to wildtype controls depleted of NK cells. Thus, Ly49 molecules mediate NK cell-dependent MHC-I-deficient target cell killing in vivo under steady-state conditions and rejection of MHC-I-deficient target cells is predominantly controlled by H-2K^b in the H-2^b background.

Expression of Ly49A in Ly49-deficient H-2D<sup>d</sup> transgenic mice rescues KLRG1 expression

To investigate the potential of a single inhibitory Ly49 receptor on mediating NK cell licensing and missing-self rejection, the Ly49KO mice were backcrossed to H-2D^d transgenic KODO (D8-KODO) Ly49A KI mice that express Klra1 cDNA encoding the inhibitory Ly49A receptor in the Ncr1 locus encoding NKp46 and its cognate ligand H-2D^d but not any other classical MHC-I molecules (Parikh et al., 2020). Ly49A expression in the resulting Ly49KO/Ly49A KI D8-KODO mice closely follows NKp46 expression because NKp46^- NK1.1⁺ NK cells in the bone marrow of these mice do not express Ly49A, while virtually all the NKp46⁺ NK1.1⁺ NK cells in the bone marrow and spleen express Ly49A (Figure 3A). Ly49KO/Ly49A KI D8-KODO NK cells expressed robust levels of Ly49A, albeit at lower MFI compared to Ly49A expression on D8-KODO NK cells, consistent with prior observations with wildtype Ly49A and H2D^d (Held et al., 1996; Karlhofer et al., 1994). NK cells were able to fully mature in Ly49KO D8-KODO and Ly49KO/Ly49A KI D8-KODO mice as we observed similar percentage of mature CD27^- CD11b⁺ NK cells in the spleen, bone marrow, and liver (Figure 3B). While there was a modest significant increase in immature CD27⁺ CD11b^- NK cells in the bone marrow of Ly49KO D8-KODO and Ly49KO/Ly49A KI D8-KODO mice, no differences were observed in NK cell maturation in the spleen and liver. The decrease in the frequency of KLRG1⁺ NK cells observed in the Ly49KO NK cells on the H-2^b background was recapitulated in the D8-KODO background (Figure 3C). Intriguingly, expression of Ly49A in Ly49KO/Ly49A KI D8-KODO mice rescued KLRG1 expression and resulted in similar levels of KLRG1 as D8-KODO NK cells. Taken together, Ly49A engineered to be encoded within the NKp46 locus was efficiently expressed as an isolated Ly49 receptor and supported KLRG1 expression.

Figure 3.Ly49A is efficiently expressed in Ncr1-Ly49A knock-in mice and rescues KLRG1 expression in natural killer (NK) cells.

Flow cytometric analysis of NK cells in D8-KODO, Ly49KO D8-KODO, and Ly49KO/Ly49A KI D8-KODO mice (A) Ly49A expression in NKp46⁺ and NKp46^- NK1.1⁺ NK cells in bone marrow and spleen of the indicated mice. (B) Expression of the maturation markers CD27 and CD11b on NK cells in the spleen, bone marrow, and liver of indicated mice. (C) KLRG1 expression by NK cells in the spleen, bone marrow, and liver of indicated mice. MFI, median fluorescent intensity. All data is from 4 mice per group. Statistics were calculated using one-way ANOVA with corrections for multiple testing. Error bars indicate SEM; ns, not significant; *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001.

Figure 3—source data 1.Receptor expression profile raw data.

NK cells expressing Ly49A in isolation are fully licensed and capable of rejecting MHC-I-deficient target cells

Next, we investigated the potential of Ly49A expression alone to mediate NK cell licensing and rejection of MHC-I-deficient target cells. In D8-KODO mice, Ly49A⁺ NK cells displayed increased levels of IFNγ production and degranulation measured by CD107 in response to plate-bound anti-NK1.1 stimulation compared to all NK cells including unlicensed cells (Figure 4A). Similar to Ly49KO NK cells on the H-2^b background, Ly49KO NK cells on the D8-KODO background showed a 72% decrease in IFNγ production, but also showed a 59% decrease in degranulation compared to Ly49A⁺ NK cells in D8-KODO mice. This impaired IFNγ production and degranulation was reversed in Ly49A KI NK cells on the Ly49KO D8-KODO background that showed similar IFNγ production and degranulation to Ly49A⁺ NK cells on the D8-KODO background, indicating that Ly49A KI NK cells are licensed. Importantly, there were no differences among all NK cell populations in IFNγ production and degranulation in response to PMA/Ionomycin (Figure 4B), indicating that the IFNγ production and degranulation machinery are not affected in any of the mouse strains. Thus, the Ly49KO/Ly49A KI D8-KODO NK cells displayed a fully licensed phenotype comparable to licensed Ly49A⁺ NK cells in D8-KODO mice.

Figure 4.Expression of Ly49A in isolation is sufficient for natural killer (NK) cell licensing and missing-self rejection.

Splenocytes from the indicated mice were stimulated with plate-bound anti-NK1.1 (A) or phorbol 12-myristate 13-acetate (PMA)/ionomycin (B) with 4 mice per group. IFNγ production and degranulation (CD107a) by NKG2A- NK cells were analyzed by flow cytometry. (C) Splenocytes from D8-KODO and KODO mice were differentially labeled with CTV as indicated. A mixture of labeled target cells was injected i.v. into D8-KODO, Ly49KO D8-KODO, and Ly49KO/Ly49A KI D8-KODO mice with 6-8 mice per group. Specific rejection of target cells was analyzed in spleens by flow cytometry 2 days after challenge. Statistics were calculated using one-way ANOVA with corrections for multiple testing. Error bars indicate SEM; ns, not significant; ***p<0.001 and ****p<0.0001.

Figure 4—source data 1.IFNγ production, degranulation, and in vivo killing assay raw data.

Finally, we interrogated whether a single inhibitory Ly49 molecule would be sufficient to mediate missing-self rejection of MHC-I-deficient cells. To this end, D8-KODO, Ly49KO D8-KODO, and Ly49KO/Ly49A KI D8-KODO mice were challenged with a mixture of D8-KODO and KODO (MHC-I-deficient) splenocytes that were differentially labeled with CTV. D8-KODO mice efficiently rejected KODO target splenocytes, while Ly49KO D8-KODO mice were unable to reject these cells. However, this defect was completely restored in the Ly49KO/Ly49A KI D8-KODO mice, demonstrating that a single inhibitory Ly49 receptor is sufficient to mediate missing-self rejection of cells lacking its MHC class I ligand.

Discussion

Several mice with genetic modifications in the Ly49 complex have been developed to study the role of Ly49 receptors but they have limitations (Bélanger et al., 2012; Bern et al., 2017; Gamache et al., 2019; Parikh et al., 2020; Zhang et al., 2019). A complicating factor in these studies is that multiple Ly49s, often with incompletely understood specificities, may be involved in target cell recognition. Here, we studied a mouse where a single Ly49 was under control of the Ncr1 locus, which is expressed on all NK cells on the background of a complete Ly49 KO. Consistent with previous reports (Bélanger et al., 2012; Parikh et al., 2020; Zhang et al., 2019), Ly49-deficient NK cells were deficient in licensing and missing-self rejection, both on a H-2^b background and in the presence of a single classical MHC-I allele, H-2D^d. While our results did not interrogate licensing by inhibitory receptors outside of the Ly49 receptor family, such as has been reported for NKG2A (Anfossi et al., 2006; Zhang et al., 2019), they do demonstrate that expression of Ly49A without other Ly49 family members can mediate NK cell licensing. Moreover, we found that Ly49 receptors are required and sufficient for missing-self rejection under steady-state conditions. However, these observations do not rule out the involvement of other inhibitory receptors under specific inflammatory conditions. For example, NKG2A contributes to the rejection of missing-self targets in poly(I:C)-treated mice (Zhang et al., 2019). Finally, expression of the inhibitory Ly49A in isolation did not alter NK cell numbers or maturation, indicating that the Ly49s do not affect these parameters of NK cells. Yet the NK cells were fully licensed in terms of IFNγ production and degranulation in vitro and efficiently rejected MHC-I-deficient target cells in vivo. Thus, a single Ly49 receptor is capable of conferring the licensed phenotype and missing-self rejection in vitro and in vivo.

We observed that rejection of H-2K^b-deficient targets was more potent than H-2D^b-deficient target splenocytes, comparable to previous observations (Johansson et al., 2005). These data indicate that H-2K^b is more efficiently recognized by Ly49s compared to H-2D^b. This is further supported by early studies using Ly49 transfectants binding to Con A blasts showing that Ly49C and Ly49I can bind to H-2D^b-deficient but not H-2K^b-deficient cells (Hanke et al., 1999), despite the caveat of testing binding to cells overexpressing Ly49s in these studies. Our studies indicate that the efficiency of Ly49-dependent missing-self rejection depends on the characteristics of specific MHC-I alleles recognized by cognate Ly49 receptors in vivo.

KLRG1 is an inhibitory receptor that recognizes E-, N-, and R- cadherins to inhibit NK cell cytotoxicity (Ito et al., 2006). KLRG1 is expressed on a subset of mature NK cells and can be upregulated in response to proliferation in a host with lymphopenia (Huntington et al., 2007). Consistent with previously published results (Zhang et al., 2019), we observed decreased KLRG1 expression in Ly49-deficient NK cells. The Klra gene family as well as Klrg1 is located within the NKC on chromosome 6 (Yokoyama and Plougastel, 2003), thus an effect of regulatory elements deleted in Ly49KO mice cannot be excluded. This is further emphasized by studies of our ΔLy49-1 mouse, which expresses Ly49D on fewer NK cells (Parikh et al., 2020). The Klra4 gene appears intact and Ly49D⁺ NK cells expressed Ly49D at normal levels, suggesting the absence of a regulatory element in the deleted regions. Here, we showed the expression of only Ly49A, encoded in the Ncr1 locus located on chromosome 7, in Ly49KO mice on an H-2D^d background restored KLRG1 expression in NK cells from different tissues, indicating that inhibitory Ly49 receptors rather than regulatory elements influence KLRG1 expression. Moreover, NK cell KLRG1 expression is modulated by MHC-I molecules (Corral et al., 2000). Therefore, KLRG1 expression may be modulated as a consequence of NK cell licensing through inhibitory Ly49 receptors.

The Ly49 family is stochastically expressed in NK cells, resulting in an NK cell repertoire with different combinations of Ly49 receptors on individual NK cells. Not all Ly49 alleles are equally expressed, which has been suggested to be dependent on allelic exclusion (Held et al., 1995). Epigenetic control, including DNA-methylation, histone modification, and regulatory elements, has been linked to Ly49 expression (Kissiov et al., 2022; McCullen et al., 2016; Rouhi et al., 2006; Saleh et al., 2004). We observed that in Ly49KO heterozygous mice the percentage of Ly49⁺ NK cells was reduced for each Ly49 molecule, yet the expression level measured by MFI was not affected except for Ly49I, indicating that loss of one allele does not affect Ly49 surface levels. Nonetheless, alternate mechanisms may control Ly49 expression as was observed for Ly49I. Expression of Klra1 encoding Ly49A within the Ncr1 locus resulted in ubiquitous Ly49A expression in NK cells, albeit at lower levels compared to Ly49A⁺ D8-KODO NK cells. Despite the lower expression levels of Ly49A, Ly49A KI NK cells were fully licensed and efficiently eliminated MHC-I-deficient target cells, suggesting that minor alterations in expression levels of various Ly49s on individual NK cells may not affect NK cell functions. In conclusion, these data show that the expression of a single inhibitory Ly49 receptor is necessary and sufficient to license NK cells and mediate missing self-rejection under steady-state conditions in vivo.

Materials and methodsAnimals

C57BL/6 (stock# 556) mice were purchased from Charles Rivers laboratories, B2m-deficient (stock# 2087) were purchased from Jackson Laboratories, H-2K^b × H-2D^b double-deficient (stock# 4215; KODO) mice were purchased from Taconic Farms. D8 is an H-2D^d transgenic mouse that has been previously described (Bieberich et al., 1986) and was provided by D. Marguiles, National Institute of Allergy and Infectious Diseases, Bethesda, MD. D8-KODO mice have been previously generated by crossing D8 transgenic mice to a KODO background (Choi et al., 2011). ΔLy49-1 and Ly49A KI mice were previously generated in our laboratory (Parikh et al., 2020). In Ly49A KI mice, the stop codon of Ncr1 encoding NKp46 is replaced with a P2A peptide-cleavage site upstream of the Ly49A cDNA, while maintaining the 3′ untranslated region. All mice were maintained within the Washington University animal facility in accordance with the institutional ethical guidelines under protocol number 21-0090. All experiments utilized sex- and age-matched mice.

Generation of Ly49KO mice

The remaining Ly49 receptors in ΔLy49-1 mice were targeted using CRISPR/Cas9 as previously described (Parikh et al., 2015a). Briefly, the Ly49 locus was targeted with gRNAs directed against Klra17 (5′-ACCCATGATGAGTGAGCAGG-3′) and Klra9 (5′-TGAGACTTCATAAGTCTTCAAGG-3′), with the PAM sequence underlined. For the mRNA microinjections, 20 ng of each guide and 100 ng of Cas9 mRNA were used. Deletions in the Ly49 locus were screened using the primers 5′-GCCCATCTGGCTTCCTTTCT-3′ (Klra17-Rv), 5′-CAAGCCCCGATGAGATGGAT-3′ (Klra9-Rv), and GGATCAGTCCATGTCAGGGTT (Klra17-Fw) yielding a 409 bp wildtype and a 552 bp mutant band and confirmed using Southern blot analysis (data not shown). To minimize off-target CRISPR/Cas9 effects, candidate founder mice were backcrossed to C57BL/6 mice for two generations then crossed to derive homozygous Ly49KO mice. Deletions were verified by Sanger sequencing (Azenta Life Sciences) in homozygous Ly49KO mice using the PCR primers Klra17-Rv and Klra9-Fw for the Klra17/9 fusion sequence and the primers AACCAAGCCCCAATGAGATC (Klra7-Rv) and TGGGTCAGTCCATGTCAGTG (Klra1-Fw) for the Klra7/1 fusion sequence resulting in 552 bp and 409 bp products, respectively.

Flow cytometry

Fluorescent-labeled antibodies Ly49D (clone 4D11), Ly49EF (CM4), Ly49F (HBF-719), Ly49G2 (eBio4D11), Ly49H (3D10), Ly49I (YLI-90), 2B4 (eBio244F4), CD122 (TM-b1), NKG2AB6 (16a11), NKG2ACE (20D5), CD94 (18d3), NKG2D (CX5), CD27 (LG.7F9), CD11b (M1/70), IFNγ (XMG1.2), CD107a (eBio1D4B), NKp46 (29A1.4), CD3(145-2C11), CD4 (RM4-5), CD8 (53-6.7), TCRB (H597), and CD19 (eBio1D3) were purchased from Thermo Fisher Scientific; Ly49A (YE1/48.10.6), KLRG1 (2F1), and NK1.1 (PK136), were purchased from BioLegend; and Ly49C (4LO311) was purchased from Leinco Technologies. Cells were stained with fixable viability dye eF506 (Thermo Fisher Scientific), continued by staining of cell surface molecules in 2.4G2 hybridoma supernatant to block Fc receptors. For intracellular staining, cells were fixed and stained intracellularly using the BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD Bioscience) according to the manufacturer’s instructions. Samples were acquired using FACSCanto (BD Biosciences) and analyzed using FlowJo software (BD Biosciences). NK cells were defined as singlet Viability-NK1.1+NKp46+CD3-CD19- or Viability-NK1.1+NKp46+CD4-CD8-TCRB-CD19-.

In vitro stimulation assays

Stimulation of splenic NK cells was performed as previously described (Parikh et al., 2020; Piersma et al., 2019). Briefly, 1–4 µg/ml anti-NK1.1 (clone PK136, Leinco Technologies) in PBS was coated in 24-well plates for 90 min at 37°C. Plates were washed with PBS and 5 × 10⁶ splenocytes were added per well. In parallel, splenocytes were stimulated with 200 ng/ml phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich) and 400 ng/ml ionomycin (Sigma-Aldrich). After 30 min incubation at 37°C, Monensin (Thermo Fisher Scientific) and fluorescently labeled anti-CD107a antibody were added, cultures were incubated for an additional 7 hours at 37°C and subsequently analyzed by flow cytometry.

In vivo killing assays

In vivo killing assays were performed as previously described (Parikh et al., 2015b). Briefly, target splenocytes were isolated from C57BL/6, MHC-I-deficient (TKO), H-2K^b-deficient, H-2D^b-deficient, KODO and D8-KODO mice. Indicated target splenocytes were differentially labeled with CTV and/or CTFR (Thermo Fisher Scientific). Target splenocytes were additionally labeled with CFSE to identify transferred target splenocytes from host cells. Target cells were mixed at equal ratios for each target and 2 × 10⁶ splenocytes per target were injected i.v. into naïve hosts. Where indicated, NK cells were depleted with 100 µg anti-NK1.1 (Leinco Technologies) 2 days before target cell injection. Two days after challenge, splenocytes were harvested and analyzed by flow cytometry. Target cell rejection was calculated using the formula [(1−(Ratio(KO target/wildtype target)_sample/Ratio(KO target/wildtype target)_control))×100].

Statistics

All experiments were performed at least twice, and representative examples are shown. Cumulative data for two independent experiments is shown for in vivo killing assays. Statistical analysis was performed with PRISM (GraphPad Software) using one-way and two-way ANOVA with corrections for multiple testing. Error bars in figures represent the SEM. Statistical significance was indicated as follows: **** p<0.0001; ***p<0.001; **p<0.01; *p<0.05; ns, not significant.

Additional information

Competing interests

No competing interests declared

Author contributions

Conceptualization, Data curation, Formal analysis, Supervision, Investigation, Visualization, Writing – original draft, Writing – review and editing

Data curation, Formal analysis, Investigation, Writing – review and editing

Data curation, Formal analysis, Investigation, Writing – original draft

Data curation, Formal analysis, Investigation, Writing – review and editing

Investigation, Methodology, Writing – review and editing

Investigation, Writing – review and editing

Investigation, Methodology, Writing – review and editing

Conceptualization, Investigation, Methodology, Writing – review and editing

Conceptualization, Supervision, Funding acquisition, Writing – original draft

Ethics

This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to the approved institutional animal care and use committee (IACUC) protocol (#21-0090). The protocol was approved by the Animal Studies Committee of Washington University.

Additional files

MDAR checklist

Data availability

All data generated and analyzed in this study are included in the manuscript and supporting files; source data files have been provided for the figures.

Acknowledgements

We thank J Michael White (Transgenic, Knockout, and Micro-Injection Core at Washington University) for CRISPR-Cas9 injections. This work was supported by the National Institutes of Health grants R01-AI129545 to WMY

References

Andrews

Sullivan

Baschuk

Chan

Berry

Cotterell

Lin

Halse

Watt

Poursine-Laurent

Wang

Scalzo

Yokoyama

Rossjohn

Brooks

Smyth

2012

Recognition of the nonclassical MHC class I molecule H2-M3 by the receptor Ly49A regulates the licensing and activation of NK cells

Nature Immunology1311711177

10.1038/ni.2468

23142773

Anfossi

André

Guia

Falk

Roetynck

Stewart

Breso

Frassati

Reviron

Middleton

Romagné

Ugolini

Vivier

2006

Human NK cell education by inhibitory receptors for MHC class I

Immunity25331342

10.1016/j.immuni.2006.06.013

16901727

Babić

Pyzik

Zafirova

Mitrović

Butorac

Lanier

Krmpotić

Vidal

Jonjić

2010

Cytomegalovirus immunoevasin reveals the physiological role of “missing self” recognition in natural killer cell dependent virus control in vivo

The Journal of Experimental Medicine20726632673

10.1084/jem.20100921

21078887

Bélanger

Rahim

MMA

Mahmoud

Patel

Tai

L-H

Troke

Wilhelm

Landry

J-R

Zhu

Tung

Raulet

Makrigiannis

2012

Impaired natural killer cell self-education and “missing-self” responses in Ly49-deficient mice

Blood120592602

10.1182/blood-2012-02-408732

Bern

Beckman

Ebihara

Taffner

Poursine-Laurent

White

Yokoyama

2017

Immunoreceptor tyrosine-based inhibitory motif-dependent functions of an MHC class I-specific NK cell receptor

PNAS114E8440E8447

10.1073/pnas.1713064114

Bieberich

Scangos

Tanaka

Jay

1986

Regulated expression of a murine class I gene in transgenic mice

Molecular and Cellular Biology613391342

10.1128/mcb.6.4.1339-1342.1986

3785166

Chiu

Chun

Fay

Mandal

Wang

1999

The majority of H2-M3 is retained intracellularly in a peptide-receptive state and traffics to the cell surface in the presence of N-formylated peptides

The Journal of Experimental Medicine190423434

10.1084/jem.190.3.423

10430630

Choi

Ferris

Matsumoto

Poursine-Laurent

Yokoyama

2011

Ly49-dependent NK cell licensing and effector inhibition involve the same interaction site on MHC ligands

Journal of Immunology18639113917

10.4049/jimmunol.1004168

21335486

Colonna

Samaridis

1995

Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells

Science268405408

10.1126/science.7716543

7716543

Corral

Hanke

Vance

Cado

Raulet

2000

NK cell expression of the killer cell lectin‐like receptor G1 (KLRG1), the mouse homolog of MAFA, is modulated by MHC class I molecules

European Journal of Immunology30920930

10.1002/1521-4141(200003)30:33.0.co;2-p

Dorfman

Raulet

1998

Acquisition of Ly49 receptor expression by developing natural killer cells

The Journal of Experimental Medicine187609618

10.1084/jem.187.4.609

9463411

Elliott

Wahle

Yokoyama

2010

MHC class I-deficient natural killer cells acquire a licensed phenotype after transfer into an MHC class I-sufficient environment

The Journal of Experimental Medicine20720732079

10.1084/jem.20100986

20819924

Gamache

Cronk

Nash

Puchalski

Gillespie

Wei

Gray

Hammarskjold

Brown

2019

Ly49R activation receptor drives self-MHC-educated NK cell immunity against cytomegalovirus infection

PNAS1162676826778

10.1073/pnas.1913064117

31843910

Hanke

Takizawa

McMahon

Busch

Pamer

Miller

Altman

Liu

Cado

Lemonnier

Bjorkman

Raulet

1999

Direct assessment of MHC class I binding by seven Ly49 inhibitory NK cell receptors

Immunity116777

10.1016/s1074-7613(00)80082-5

10435580

Held

Roland

Raulet

1995

Allelic exclusion of Ly49-family genes encoding class I MHC-specific receptors on NK cells

Nature376355358

10.1038/376355a0

7630404

Held

Dorfman

Raulet

1996

Major histocompatibility complex class I-dependent skewing of the natural killer cell Ly49 receptor repertoire

European Journal of Immunology2622862292

10.1002/eji.1830261003

8898935

Huntington

Tabarias

Fairfax

Brady

Hayakawa

Degli-Esposti

Smyth

Tarlinton

Nutt

2007

NK cell maturation and peripheral homeostasis is associated with KLRG1 up-regulation

Journal of Immunology17847644770

10.4049/jimmunol.178.8.4764

17404256

Huntington

Cursons

Rautela

2020

The cancer-natural killer cell immunity cycle

Nature Reviews. Cancer20437454

10.1038/s41568-020-0272-z

32581320

Ito

Maruyama

Saito

Koganei

Yamamoto

Matsumoto

2006

Killer cell lectin-like receptor G1 binds three members of the classical cadherin family to inhibit NK cell cytotoxicity

The Journal of Experimental Medicine203289295

10.1084/jem.20051986

16461340

Johansson

Rosmaraki

Vahlne

Mehr

Salmon-Divon

Lemonnier

Kärre

Höglund

2005

Natural killer cell education in mice with single or multiple major histocompatibility complex class I molecules

The Journal of Experimental Medicine20111451155

10.1084/jem.20050167

15809355

Karlhofer

Ribaudo

Yokoyama

1992

MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells

Nature3586670

10.1038/358066a0

1614533

Karlhofer

Hunziker

Reichlin

Margulies

Yokoyama

1994

Host MHC class I molecules modulate in vivo expression of a NK cell receptor

Journal of Immunology15324072416

8077656

Kärre

Ljunggren

Piontek

Kiessling

1986

Selective rejection of H-2-deficient lymphoma variants suggests alternative immune defence strategy

Nature319675678

10.1038/319675a0

3951539

Kim

Poursine-Laurent

Truscott

Lybarger

Song

Yang

French

Sunwoo

Lemieux

Hansen

Yokoyama

2005

Licensing of natural killer cells by host major histocompatibility complex class I molecules

Nature436709713

10.1038/nature03847

16079848

Kissiov

Ethell

Chen

Wolf

Zhang

Dang

Madsen

Paranjpe

Lee

Chim

Muljo

Raulet

2022

Binary outcomes of enhancer activity underlie stable random monoallelic expression

eLife11

e74204

10.7554/eLife.74204

35617021

Kubota

Lohwasser

Mager

Takei

1999

Diversity of NK cell receptor repertoire in adult and neonatal mice

Journal of Immunology163212216

10.4049/jimmunol.163.1.212

10384118

Long

Kim

Liu

Peterson

Rajagopalan

2013

Controlling natural killer cell responses: integration of signals for activation and inhibition

Annual Review of Immunology31227258

10.1146/annurev-immunol-020711-075005

23516982

Makrigiannis

Patel

Goulet

Dewar

Anderson

2005

Direct sequence comparison of two divergent class I MHC natural killer cell receptor haplotypes

Genes and Immunity67183

10.1038/sj.gene.6364154

15674375

Matsumoto

Mitsuki

Tajima

Yokoyama

Yamamoto

2001

The functional binding site for the C-type lectin-like natural killer cell receptor Ly49A spans three domains of its major histocompatibility complex class I ligand

The Journal of Experimental Medicine193147158

10.1084/jem.193.2.147

11148219

McCullen

Cam

Sen

McVicar

Anderson

2016

Analysis of Ly49 gene transcripts in mature NK cells supports a role for the Pro1 element in gene activation, not gene expression

Genes and Immunity17349357

10.1038/gene.2016.31

27467282

Mitsuki

Matsumoto

Yamamoto

2004

A species-specific determinant on beta2-microglobulin required for Ly49A recognition of its MHC class I ligand

International Immunology16197204

10.1093/intimm/dxh017

14734604

Parikh

Beckman

Patel

White

Yokoyama

2015a

Detailed phenotypic and molecular analyses of genetically modified mice generated by CRISPR-Cas9-mediated editing

PLOS ONE10

e0116484

10.1371/journal.pone.0116484

25587897

Parikh

Piersma

Pak-Wittel

Yang

Schreiber

Yokoyama

2015b

Dual requirement of cytokine and activation receptor triggering for cytotoxic control of murine cytomegalovirus by NK cells

PLOS Pathogens11

e1005323

10.1371/journal.ppat.1005323

26720279

Parikh

Bern

Piersma

Yang

Beckman

Poursine-Laurent

Plougastel-Douglas

Yokoyama

2020

Control of viral infection by natural killer cell inhibitory receptors

Cell Reports32

107969

10.1016/j.celrep.2020.107969

32726632

Piersma

Pak-Wittel

Lin

Plougastel-Douglas

Yokoyama

2019

Activation receptor-dependent IFN-γ production by NK cells is controlled by transcription, translation, and the proteasome

Journal of Immunology20319811988

10.4049/jimmunol.1900718

31444264

Piersma

Brizić

2022

Natural killer cell effector functions in antiviral defense

The FEBS Journal28939823999

10.1111/febs.16073

34125493

Rouhi

Gagnier

Takei

Mager

2006

Evidence for epigenetic maintenance of Ly49a monoallelic gene expression

Journal of Immunology17629912999

10.4049/jimmunol.176.5.2991

16493057

Saleh

Davies

Pascal

Wright

Hodge

Cho

Lockett

Abshari

Anderson

2004

Identification of probabilistic transcriptional switches in the Ly49 gene cluster: A eukaryotic mechanism for selective gene activation

Immunity215566

10.1016/j.immuni.2004.06.005

15345220

Schenkel

Kingry

Slayden

2013

The ly49 gene family: A brief guide to the nomenclature, genetics, and role in intracellular infection

Frontiers in Immunology4

10.3389/fimmu.2013.00090

23596445

Schmied

Luu

Søndergaard

Hald

Meinke

Mohammad

Singh

Mayer

Perinetti Casoni

Chrobok

Schlums

Rota

Truong

Westerberg

Guarda

Alici

Wagner

Kadri

Bryceson

Saeed

Höglund

2023

SHP-1 localization to the activating immune synapse promotes NK cell tolerance in MHC class I deficiency

Science Signaling16

eabq0752

10.1126/scisignal.abq0752

37040441

Smith

Chuang

Wang

Salcedo

Heusel

Yokoyama

2000

Nonstochastic coexpression of activation receptors on murine natural killer cells

The Journal of Experimental Medicine19113411354

10.1084/jem.191.8.1341

10770801

Tormo

Natarajan

Margulies

Mariuzza

1999

Crystal structure of a lectin-like natural killer cell receptor bound to its MHC class I ligand

Nature402623631

10.1038/45170

10604468

Mahmoud

Wight

Mottashed

Bélanger

Rahim

MMA

Abou-Samra

Makrigiannis

2014

Ly49 family receptors are required for cancer immunosurveillance mediated by natural killer cells

Cancer Research7436843694

10.1158/0008-5472.CAN-13-3021

24802191

Viant

Fenis

Chicanne

Payrastre

Ugolini

Vivier

2014

SHP-1-mediated inhibitory signals promote responsiveness and anti-tumour functions of natural killer cells

Nature Communications5

5108

10.1038/ncomms6108

25355530

Wang

Whitman

Natarajan

Tormo

Mariuzza

Margulies

2001

Binding of the natural killer cell inhibitory receptor Ly49A to its major histocompatibility complex class I ligand: crucial contacts include both H-2Dd AND beta 2-microglobulin

The Journal of Biological Chemistry27714331442

10.1074/jbc.M110316200

Park

Lau

Zhong

Sheppard

Sun

Das

Altan-Bonnet

Hsu

2021

Dynamic variability in SHP-1 abundance determines natural killer cell responsiveness

Science Signaling14

eabe5380

10.1126/scisignal.abe5380

34752140

Yokoyama

Plougastel

BFM

2003

Immune functions encoded by the natural killer gene complex

Nature Reviews Immunology3304316

10.1038/nri1055

12669021

Zhang

Feng

Chen

Yang

Dong

2019

Synergized regulation of NK cell education by NKG2A and specific Ly49 family members

Nature Communications1050105012

10.1038/s41467-019-13032-5

Appendix 1

Appendix 1—key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background(Mus musculus)	C57BL/6, wildtype	Charles River	Stock# 556
Strain, strain background(M. musculus)	H-2Kb x H-2Db double-deficient	Taconic Farms	Stock# 4215
Strain, strain background(M. musculus)	H-2Dd transgenic mouse	Marguiles		Bieberich et al., 1986
Strain, strain background(M. musculus)	ΔLy49-1	Previously generated by authors		Parikh et al., 2020
Strain, strain background(M. musculus)	Ly49A KI	Previously generated by authors		Parikh et al., 2020
Strain, strain background(M. musculus)	Ly49 KO	This paper		Figure 1A
Sequence-based reagent	Klra17 gRNA	This paper	gRNA	5′-ACCCATGATGAGTGAGCAGG-3′
Sequence-based reagent	Klra9 gRNA	This paper	gRNA	5′-TGAGACTTCATAAGTCTTCAAGG-3′
Sequence-based reagent	Klra17-Rv	This paper	Sequencing primer	5′-GCCCATCTGGCTTCCTTTCT-3′
Sequence-based reagent	Klra9-Rv	This paper	Sequencing primer	5′-CAAGCCCCGATGAGATGGAT-3′
Sequence-based reagent	Klra17-Fw	This paper	Sequencing primer	5′-GGATCAGTCCATGTCAGGGTT-3′
Sequence-based reagent	Klra7-Rv	This paper	Sequencing primer	5′-AACCAAGCCCCAATGAGATC-3′
Sequence-based reagent	Klra1-Fw	This paper	Sequencing primer	5′-TGGGTCAGTCCATGTCAGTG-3′
Antibody	Rat monoclonal anti-human/mouse CD107a eF660	Thermo Fisher Scientific	Catalog#50-1071-82	1:1000 dilution
Antibody	Rat monoclonal anti-mouse/pig CD117APC	Thermo Fisher Scientific	Catalog#17-1171-81	1:100 dilution
Antibody	Rat monoclonal anti-mouse CD11b eF450	Thermo Fisher Scientific	Catalog#48-0112-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse CD122 FITC	Thermo Fisher Scientific	Catalog#11-1222-82	1:50 dilution
Antibody	Rat monoclonal anti-mouse CD19APC-eF780	Thermo Fisher Scientific	Catalog#47-0193-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse CD244.2 (2B4) PE-Cy7	Thermo Fisher Scientific	Catalog#25-2441-80	1:100 dilution
Antibody	Armenian hamster monoclonal anti-human/mouse/rat CD27 APC	Thermo Fisher Scientific	Catalog#17-0271-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse CD4 APC-eF780	Thermo Fisher Scientific	Catalog#47-0042-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse CD49b PE	Thermo Fisher Scientific	Catalog#12-5971-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse CD8 APC-eF780	Thermo Fisher Scientific	Catalog#47-0081-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse CD94 eF450	Thermo Fisher Scientific	Catalog#48-0941-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse IFN-gamma eF450	Thermo Fisher Scientific	Catalog#48-7311-82	1:100 dilution
Antibody	Syrian hamster monoclonal anti-mouse/human KLRG1 biotin	BioLegend	Catalog#138406	1:100 dilution
Antibody	Syrian hamster monoclonal anti-mouse/human KLRG1PE-Cy7	Thermo Fisher Scientific	Catalog#25-5893-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse Ly49A FITC	BioLegend	Catalog#116805	1:100 dilution
Antibody	Mouse monoclonal anti-mouse Ly49C PE	Leinco	Catalog#L312	1:100 dilution
Antibody	Rat monoclonal anti-mouse Ly49D APC	Thermo Fisher Scientific	Catalog#17-5782-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse Ly49E/F PerCP	Thermo Fisher Scientific	Catalog#46-5848-82	1:100 dilution
Antibody	Mouse monoclonal anti-mouse Ly49F PE	BD Biosciences	Catalog#550987	1:100 dilution
Antibody	Rat monoclonal anti-mouse Ly49G2 FITC	Thermo Fisher Scientific	Catalog#11-5781-85	1:100 dilution
Antibody	Mouse monoclonal anti-mouse Ly49H APC	BioLegend	Catalog#144710	1:100 dilution
Antibody	Mouse monoclonal anti-mouse Ly49I Biotin	Thermo Fisher Scientific	Catalog#MA5-28667	1:100 dilution
Antibody	Mouse monoclonal anti-mouse NK1.1 BV650	BioLegend	Catalog#108736	1:100 dilution
Antibody	Rat monoclonal anti-mouse NKG2A/C/EFITC	Thermo Fisher Scientific	Catalog#11-5896-85	1:100 dilution
Antibody	Rat monoclonal anti-mouse NKG2APerCP	Thermo Fisher Scientific	Catalog#46-5897-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse NKG2DPE	Thermo Fisher Scientific	Catalog#12-5882-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse NKp46 PE-Cy7	Thermo Fisher Scientific	Catalog#25-3351-82	1:100 dilution
Antibody	Rat monoclonal anti-mouse NKp46 PerCP	ThermoFisher Scientific	Catalog#46-3351-82	1:100 dilution
Antibody	Armenian hamster monoclonal anti-mouse TCRB APC-eF780	Thermo Fisher Scientific	Catalog#47-5961-82	1:100 dilution
Antibody	Fc-Block	2.4g2 hybridoma	In-house produced hybridoma supernatant	Undiluted
Antibody	Mouse monoclonal anti-mouse NK1.1 for in vivo use	Leinco	N268	100 ug/mouse;1–4 ug/ml for in vitro stimulation
Commercial assay or kit	CellTrace CFSE Cell Proliferation Kit	Thermo Fisher Scientific	Catalog#C34554
Commercial assay or kit	CellTrace Far Red Cell Proliferation Kit	Thermo Fisher Scientific	Catalog#C34564
Commercial assay or kit	CellTrace Violet Cell Proliferation Kit	Thermo Fisher Scientific	Catalog#C34557
Commercial assay or kit	Cytofix/Cytoperm Fixation/Permeabilization Kit	BD Biosciences	Catalog#554714
Chemical compound, drug	Ionomycin calcium salt	MilliporeSigma	Catalog#IO634-5MG
Commercial assay or kit	Monensin	Thermo Fisher Scientific	Catalog#00-4505-51
Chemical compound, drug	PMA (phorbol 12-myristate 13-acetate)	MilliporeSigma	Catalog#P1585-1MG
Chemical compound, drug	Sterptavidin-APC	Thermo Fisher Scientific	Catalog#17-4317-82
Chemical compound, drug	Sterptavidin-PE	BioLegend	Catalog#405204
Chemical compound, drug	eBioscience Fixable Viability Dye eFluor 506	Thermo Fisher Scientific	Catalog#65-0866
Software, algorithm	PRISM 10	GraphPad	RRID:SCR_002798	https://www.graphpad.com
Software, algorithm	FlowJo 10	Treestar	RRID:SCR_008520	https://www.flowjo.com/

10.7554/eLife.100218.3.sa0

eLife Assessment

Zaidi

Neeha

Reviewing EditorJohns Hopkins UniversityUnited States

Convincing

Valuable

This study on mouse Ly49 receptors expressed on natural killer (NK) cells shows that Ly49A, in the presence of the corresponding MHC class I allele, can lead to NK cell licensing, thereby providing valuable insights into the mechanisms of NK cell modulation by Ly49 receptors. The work may have significant implications for studies of human killer-cell immunoglobulin-like receptors (KIR) expressing and other NK cells. Overall, the study was well-developed with convincing evidence.

10.7554/eLife.100218.3.sa1

Reviewer #1 (Public review):

Reviewer

Summary:

The article by Piersma et al. aims to reduce the complex process of NK cell licensing to the action of a single inhibitory receptor for MHC class I. This is achieved using a mouse strain lacking all of the Ly49 receptors expressed by NK cells and inserting the Ly49a gene into the Ncr1 locus, leading to expression on all the majority of NK cells.

Strengths:

The mouse model used represents a precise deletion of all NK-expressed genes within the Ly49 cluster. Re-introduction of the Ly49a gene into the Ncr1 locus allows expression by most NK cells. Convincing effects of Ly49a expression on in vitro activation and in vivo killing assay are shown.

Weaknesses:

The choice of Ly49a provides a clear picture of H-2Dd recognition by this Ly49. It would be valuable to perform additional studies investigating Ly49c and Ly49i receptors for H-2b. This is of interest because there are reports indicating that Ly49c may not be a functional receptor in B6 mice due to strong cis interactions. Investigation of the Ly49c and Ly49i receptors in this model would be the basis of future studies that are beyond the scope of the current report.

This work generates an excellent mouse model for the study of NK cell licensing by inhibitory Ly49s that will be useful for the community. It provides a platform whereby the functional activity of a single Ly49 can be assessed.

Comments on revisions: No additional concerns

10.7554/eLife.100218.3.sa2

Reviewer #2 (Public review):

Reviewer

Piersma et al. continue to work on deciphering the role and function of Ly49 NK cell receptors. This manuscript shows that a single inhibitory Ly49 receptor is sufficient to license NK cells and eliminate MHC-I-deficient target cells in mice. In short, they refined the mouse model ∆Ly49-1 (Parikh et al., 2020) into the Ly49KO model in which all Ly49 genes are disrupted. Using this model, they confirmed that NK cells from Ly49KO mice cannot be licensed, produce lower levels of IFN-gamma, and cannot reject MHC-I-deficient cells. To study the effect of a single Ly49 receptor in the function of NK cells, the authors backcrossed Ly49KO mice to H-2Dd transgenic KODO (D8-KODO) Ly49A knock-in mice in which a single inhibitory Ly49A receptor that recognizes H-2Dd ligands is expressed. By doing so, they demonstrate that a single inhibitory Ly49 receptor expressed by all NK cells is sufficient for licensing and missing-self killing.

While the results of the study are largely consistent with the conclusions, it is important to address some discrepancies. For instance, in the title of Figure 1, the authors state that NK cells in Ly49KO mice compared to WT mice have a less mature phenotype , which is not consistent with the corresponding text in the Results section (lines 170-171) that states there is no difference in maturation. These differences are not evident in Figure 1, panel D. It is crucial to acknowledge these inconsistencies to ensure a comprehensive understanding of the research findings.

In the legend of Figure 2. the text related to panel C indicates the use of dyes to label the splenocytes, and CFSE, CTV, and CTFR were mentioned. However, only CTV and CTFR are shown on the plots and mentioned in the corresponding text in the Results section. Similarly, in the legend of Figure 4, which is related to panel C, the authors write that splenocytes were differentially labeled with CFSE and CTV as indicated; however, in Figure 4, C and the Results section text, there is no mention of CFSE.

The authors should clarify why they assume that KLRG1 expression is influenced by the expression of inhibitory Ly49 receptors and not by manipulations on chromosome 6, where the genes for both KLRG1 and Ly49 receptors are located. However, a better explanation for the possible influence of other inhibitory NK cell receptors still needs to be included. In the study by Zhang et al. doi: 10.1038/s41467-019-13032-5 the authors showed the synergized regulation of NK cell education by the NKG2A receptor and the specific Ly49 family members. Although in this study, Piersma and colleagues show the control of MHC-I deficient cells by Ly49A+ NKG2A-NK cells in Figure 4., this receptor is not mentioned in the Results or in the Discussion section, so its role in this story needs to be clarified. Therefore, the reader would benefit from more information regarding NKG2A receptor and NKG2A+/- populations in their results.

Comments on revisions: The authors have successfully answered all my questions and edited the manuscript accordingly.

10.7554/eLife.100218.3.sa3

Reviewer #3 (Public review):

Reviewer

Summary:

In this study, Piersma et al. successfully generated a mouse model with all Ly49 genes knocked out, resulting in the complete absence of Ly49 receptor expression on the cell surface. The absence of Ly49 expression led to the loss of NK cell education/licensing and consequently, a failure in responsiveness against missing-self target cells. The authors demonstrate the restoration of NK cell licensing by knocking in a single Ly49 gene, Ly49A, in a mouse expressing the H-2Dd ligand for this receptor, which is a novel and important finding.

Strengths:

The authors established a novel mouse model enabling them to have a clean and thorough study on the function of Ly49 on NK cell licensing. Also, by knock in a single Ly49, they were able to investigate the function of a given Ly49 receptor excluding the "contamination" of co-expression any other Ly49 genes. The experiment designing and data interpretation were logically clear and the evidence was solid.

Weaknesses:

The mouse model was somehow genetically similar to a previous study. The experimental work and findings are partially overlapping with the previous work by Zhang et al. (2019), who also performed knockout of the entire Ly49 locus in mice and demonstrated that loss of NK responsiveness was due to the removal of inhibitory, and not activating Ly49 genes.

Potential achievements and discussions: The mouse model developed by the authors holds great potential for advancing NK cell functional studies, particularly regarding the regulation of NK cell functions through receptor-ligand interactions. Moreover, it provides a valuable tool for investigating NK cell education and the development of checkpoint inhibitors. These applications could significantly contribute to the broader research efforts in cancer therapy utilizing NK cells.

Comments on revisions: The authors have successfully addressed all the concerns raised in my previous feedback. They have significantly improved the logical structure, making it clearer and more coherent. Additionally, they have ensured consistency in the use of specific terminology throughout the manuscript. The substantial revisions and re-writing efforts are commendable and have greatly enhanced the overall quality of the manuscript.

10.7554/eLife.100218.3.sa4

Author response

Piersma

Sytse J

AuthorWashington University in St. Louis

St Louis

United StatesLi

Shasha

AuthorWashington University in St. Louis

St Louis

United StatesWong

Pamela

AuthorWashington University in St. Louis

St Louis

United StatesBern

Michael D

AuthorWashington University in St. Louis

St Louis

United StatesPoursine-Laurent

Jennifer

AuthorWashington University School of Medicine

St Louis

United StatesYang

Liping

AuthorWashington University School of Medicine

St Louis

United StatesBeckman

Diana L

AuthorWashington University in St. Louis

St Louis

United StatesParikh

Bijal A

AuthorWashington University School of Medicine

St Louis

United StatesYokoyama

Wayne M

AuthorWashington University in St. Louis

St Louis

United States

The following is the authors’ response to the original reviews.

Reviewer #1 (Public review):

Summary:

Strengths:

The mouse model used represents a precise deletion of all NK-expressed genes within the Ly49 cluster. The re-introduction of the Ly49a gene into the Ncr1 locus allows expression by most NK cells. Convincing effects of Ly49a expression on in vitro activation and in vivo killing assay are shown.

Weaknesses:

The choice of Ly49a provides a clear picture of H-2D^d recognition by this Ly49. It would be valuable to perform additional studies investigating Ly49c and Ly49i receptors for H-2b. This is of interest because there are reports indicating that Ly49c may not be a functional receptor in B6 mice due to strong cis interactions.

We agree with the reviewer that it will be important to extend our findings to H-2b haplotypes with individual cognate Ly49 receptors (Ly49C and Ly49I). While these experiments are subject of our ongoing studies, they are beyond the scope of the current manuscript considering the significant time, effort and cost to generate these new Ly49C and Ly49I knockin mice.

Reviewer #2 (Public review):

Piersma et al. continue to work on deciphering the role and function of Ly49 NK cell receptors. This manuscript shows that a single inhibitory Ly49 receptor is sufficient to license NK cells and eliminate MHC-I-deficient target cells in mice. In short, they refined the mouse model ∆Ly49-1 (Parikh et al., 2020) into the Ly49KO model in which all Ly49 genes are disrupted. Using this model, they confirmed that NK cells from Ly49KO mice cannot be licensed, produce lower levels of IFN-gamma, and cannot reject MHC-I-deficient cells. To study the effect of a single Ly49 receptor in the function of NK cells, the authors backcrossed Ly49KO mice to H-2D^d transgenic KODO (D8-KODO) Ly49A knock-in mice in which a single inhibitory Ly49A receptor that recognizes H-2D^d ligands is expressed. By doing so, they demonstrate that a single inhibitory Ly49 receptor expressed by all NK cells is sufficient for licensing and missing-self killing.

We thank the reviewer for pointing this out. We have corrected the figure legend title to: “Mice generated to lack all NK-related Ly49 molecules using CRISPR have NK cells that display alterations in select surface molecules.”

We thank the reviewer to point out these inconsistencies. We did label target cells with CFSE to distinguish them from host cells, to clarify we have done the following:

We have removed CFSE from figure legends of Figure 2 and 4.

We included the following on CFSE labeling in the Materials and Methods section: “Target splenocytes were additionally labeled with CFSE to identify transferred target splenocytes from host cells.”

The effect on KLRG1 expression in phenocopied in the Ly49A KI mice (on a Ly49 KO background). The Ly49A KI allele is encoded by the Ncr1 locus, which is located on chromosome 7 and not by chromosome 6 where KLRG1 is located, thus excluding involvement of cis-regulatory elements encoded by the Ly49 locus on chromosome 6.

We have clarified this in the discussion section (lines 350-358):

“The Ly49 gene family as well as Klrg1 is located within the NKC on chromosome 6 (Yokoyama and Plougastel, 2003) …. expression of only Ly49A, encoded in the Ncr1 locus located on chromosome 7, in Ly49KO mice on a H-2D^d background restored KLRG1 expression”

However, a better explanation for the possible influence of other inhibitory NK cell receptors still needs to be included. In the study by Zhang et al. doi: 10.1038/s41467-019-13032-5 the authors showed the synergized regulation of NK cell education by the NKG2A receptor and the specific Ly49 family members. Although in this study, Piersma and colleagues show the control of MHC-I deficient cells by Ly49A+ NKG2A-NK cells in Figure 4., this receptor is not mentioned in the Results or in the Discussion section, so its role in this story needs to be clarified. Therefore, the reader would benefit from more information regarding NKG2A receptor and NKG2A+/- populations in their results.

We agree with the reviewer that it is important to describe our results in the context of other inhibitory receptors. To clarify the role of NKG2A and potentially other inhibitory receptors we have made the following improvements to our manuscript:

We discuss the role of NKG2A in the discussion section, which now include (lines 259-266):

“While our results did not interrogate licensing by inhibitory receptors outside of the Ly49 receptor family, such as has been reported for NKG2A (Anfossi et al., 2006; Zhang et al., 2019), they do demonstrate that expression of Ly49A without other Ly49 family members can mediate NK cell licensing. Moreover, we found that Ly49 receptors are required and sufficient for missing-self rejection under steady-state conditions. However, these observations do not rule out involvement of other inhibitory receptors under specific inflammatory conditions. For example, NKG2A contributes to rejection of missing-self targets in poly(I:C)-treated mice (Zhang et al., 2019).”

We also added the following to the result section (lines 179-182):

NKG2A has been implicated in NK cell licensing by the non-classical MHC-I molecule Qa1 (Anfossi et al., 2006), to eliminate potential confounding effects by this interaction, effector functions of NKG2A- NK cells were evaluated as described before (Bern et al., 2017).

Reviewer #3 (Public review):

Summary:

In this study, Piersma et al. successfully generated a mouse model with all Ly49n et al., 2017 genes knocked out, resulting in the complete absence of Ly49 receptor expression on the cell surface. The absence of Ly49 expression led to the loss of NK cell education/licensing and consequently, a failure in responsiveness against missing-self target cells. The experimental work and findings are partially overlapping with the previous work by Zhang et al. (2019), who also performed knockout of the entire Ly49 locus in mice and demonstrated that loss of NK responsiveness was due to the removal of inhibitory, and not activating Ly49 genes. The authors demonstrate the restoration of NK cell licensing by knocking in a single Ly49 gene, Ly49A, in a mouse expressing the H-2D^d ligand for this receptor, which is a novel and important finding.

Strengths:

The authors established a novel mouse model enabling them to have a clean and thorough study on the function of Ly49 on NK cell licensing. Also, by knocking in a single Ly49, they were able to investigate the function of a given Ly49 receptor excluding the "contamination" of co-expression of any other Ly49 genes. Their idea and method were novel though the mouse model was somehow genetically similar to a previous study. The experiment design and data interpretation were logically clear and the evidence was solid.

Weaknesses:

The paper is very poorly written and confusing. The authors should be more accurate in the usage of terminology, provide more details on experimental procedures, and revise much of the text to improve clarity and coherence. A thorough revision aiming to clarify the paper would be helpful.

We regret that the manuscript was confusing to the reviewer. We have made thorough revisions to the different sections, which we hope will improve the clarity of the manuscript.

We have made changes to all sections of the manuscript, including the title. These revisions include improved clarity on description of NK cell licensing and consistent usage throughout the manuscript, per the reviewer recommendations. We hope that all our improvements help the clarity of the manuscript.

Recommendations for the authors:

Reviewer #1 (Recommendations for the authors):

I was confused by lines 262-270 in the discussion. The data from Hanke et al. is presented as contradictory to the observation that Ly49s bind more efficiently to H2-Kb than -Db, but they showed that Ly49c/i did not bind Kb-deficient cells, supporting the preferred binding to Kb.

We have clarified this issue and the paragraph now reads: “This is further supported by early studies using Ly49 transfectants binding to Con A blasts showing that Ly49C and Ly49I can bind to H-2D^b-deficient but not H-2K^b-deficient cells (Hanke et al., 1999), despite the caveat of testing binding to cells overexpressing Ly49s in these studies.”

Reviewer #2 (Recommendations for the authors):

The authors' conclusion that one type of inhibitory Ly49 receptor expressed on NK cells is sufficient for successful licensing and rejection of missing self-cells is a significant step forward. However, it would be beneficial to complement this with additional data. For instance, exploring the role of a single inhibitory Ly49 receptor responsible for licensing in a mouse model with a different haplotype (e.g. Ly49C or Ly49I on H-2b MHC I haplotype in C57BL/6J mice) could provide valuable insights and open new avenues for research in the field.

We agree with the reviewer that it will be important to extend our findings to additional MHC-I haplotypes with single cognate Ly49 receptors. While these experiments are subject of our ongoing studies, they are beyond the scope of the current manuscript considering the significant effort, time, and cost to generate these new Ly49C and Ly49I knockin mice.

Reviewer #3 (Recommendations for the authors):

Specific issues that should be addressed are as follows:

(1) The title of the paper: "Expression of a single inhibitory Ly49 receptor is sufficient to license NK cells for effector functions" is ambiguous. When I first read the title, I thought the authors meant that only a single Ly49 molecule on the NK cell surface was necessary to induce licensing. It might be better to replace "single inhibitory receptor" with "single member of Ly49 receptor family".

We have changed the title to: “Expression of a single inhibitory member of the Ly49 receptor family is sufficient to license NK cells for effector functions”

(2) In the abstract, introduction, and results, the authors distinguish "licensing" and "rejection of missing-self targets" as two distinct phenomena. An example includes Abstract, lines 51-53: "Herein, we showed mice lacking expression of all Ly49s were unable to reject missing-self target cells in vivo, were defective in NK cell licensing, and displayed lower KLRG1 on the surface of NK cells". Similarly, the title of the second subsection of the Results states: "Ly49-deficient NK cells are defective in licensing and rejection of cognate MHC-I deficient target cells" (line 176). In these instances, it seems that by "licensing", they mean only response to plate-bound anti-NK1.1 stimulation and not a response to missing-self targets. Alternatively, in the first paragraph of the Discussion, it sounds as if licensing includes both anti-NK1.1 and missing-self responses (lines 258-260): "...NK cells were fully licensed in terms of their functional phenotype, including the capacity to be activated by an activation receptor in vitro and efficient rejection of MHC-I deficient target cells in vivo". Please define the terms and use the terms consistently throughout the paper.

We were the first to describe the term licensing and have defined this as acquisition of NK cell functional competence by self-MHC molecules (Kim et al., 2005), which is characterized by increased NK cell effector functions to activating signals. Thus, licensed NK cells are prevented from attacking normal MHC-I⁺ cells by the same self-MHC-I-specific receptor that conferred licensing, while unlicensed NK cells without appropriate Ly49 receptors are functionally incompetent.

To clarify we made changes throughout the manuscript including the following:

Lines 91-101:

“In addition to effector function in missing-self, Ly49 receptors that recognize their cognate MHC-I ligands are involved in licensing or education of NK cells to acquire functional competence. NK cell licensing is characterized by potent effector functions including IFNγ production and degranulation in response to activation receptor stimulation (Elliott et al., 2010; Kim et al., 2005). Like missing-self recognition, inhibitory Ly49s require SHP-1 for NK cell licensing which interacts with the ITIM-motif encoded in the cytosolic tail of inhibitory Ly49s (Bern et al., 2017; Kim et al., 2005; Viant et al., 2014). Moreover, lower expression of SHP-1, particularly within the immunological synapse, is associated with licensed NK cells (Schmied et al., 2023; Wu et al., 2021). Thus, inhibitory Ly49s have a second function that licenses NK cells to self-MHC-I thereby generating functionally competent NK cells but it has not been possible to exclude contributions from other co-expressed Ly49s.”

Lines 268-271 (previously 258-260):

“Yet the NK cells were fully licensed in terms of IFNγ production and degranulation in vitro and efficiently rejected MHC-I deficient target cells in vivo. Thus, a single Ly49 receptor is capable to confer the licensed phenotype and missing-self rejection in vitro and in vivo.”

Lines 309-312:

“In conclusion, these data show that expression of a single inhibitory Ly49 receptor is necessary and sufficient to license NK cells and mediate missing self-rejection under steady state conditions in vivo.”

(3) Introduction, lines 76-79. Please provide the C57BL/6 MHC-I genotype. It is difficult to follow the text here without this information. In general, please provide information to help the reader who may not be working in this precise field.

We thank the reviewer for pointing this out. We have included this and the lines now read: “For example, in the C57BL/6 background, Ly49C and Ly49I can recognize H-2^b MHC-I molecules that include H-2K^b and H-2D^b, while Ly49A and Ly49G cannot recognize H-2^b molecules and instead they recognize H-2^d alleles.”

(4) Introduction, lines 85-97. Please use commas: "...the MHC-I specificities of other Ly49s have been primarily studied with MHC tetramers containing human b2m, which is not recognized by Ly49A, on cells overexpressing Ly49s" in order to clarify the sentence.

Commas have been added as suggested by the reviewer.

(5) Introduction, lines 91-101. The whole paragraph starting with the following sentence does not make sense and should be re-written. "In addition to effector function in missing-self, when inhibitory Ly49 receptors recognize their cognate MHC-I ligands in vivo, they license or educate NK cells for potent effector functions including IFNγ production and degranulation in response to activation receptor stimulation".

We regret that this paragraph was not clear to the reviewer. We have changed this paragraph to:

(6) Results, line 181. Please edit: "...MHC-I-deficient H-2K^b x H-2D^b deficient (KODO) mice".

This sentence now reads “... NK cells from H-2K^b and H-2D^b double deficient (KODO) mice”

(7) Results, line 192. Please re-word the following phrase: "missing-self is dominated by H-2K^b in the C57BL/6 background", as it is unclear. Do you mean that H-2K^b is protected from lysis as opposed to H-2D^b?

We thank the reviewer for pointing this out, line 192 now reads: “..missing-self recognition in the C57BL/6 background depends on the absence of H-2K^b rather than H-2D^b.”

(8) Please briefly describe the Ncr1-Ly49A knockin procedure so that the reader understands the link between NKp46 and Ly49A expression without going to the earlier paper. Also, it needs to be mentioned that Ncr1 is the gene encoding NKp46.

Lines 201-205 now read: “To investigate the potential of a single inhibitory Ly49 receptor on mediating NK cell licensing and missing-self rejection, the Ly49KO mice were backcrossed to H-2D^d transgenic KODO (D8-KODO) Ly49A KI mice that express Klra1 cDNA encoding the inhibitory Ly49A receptor in the Ncr1 locus encoding NKp46 and its cognate ligand H-2D^d but not any other classical MHC-I molecules (Parikh et al., 2020).

In the materials and Methods section, the following has been added (lines 324-326):

“In Ly49A KI mice the stop codon of Ncr1 encoding NKp46 is replaced with a P2A peptide-cleavage site upstream of the Ly49A cDNA, while maintaining the 3’ untranslated region.”

(9) Figure 4C, legend. There is no CFSE staining in this experiment. Please correct.

We did label target cells with CFSE to distinguish them from host cells, to clarify we have done the following:

We have removed CFSE from figure legends of Figure 2 and 4.

We included the following on CFSE labeling in the Materials and Methods section (lines 377-379): “Target splenocytes were additionally labeled with CFSE to identify transferred target splenocytes from host cells.”

(10) Discussion, lines 262-270. This paragraph sounds as if data by Hanke et al. does not agree with the data presented in the paper. On the contrary, Hanke et al. demonstrate that Ly49C and Ly49I detectably bind to H-2K^b, but poorly to H-2D^b, supporting observations shown in Figure 2C.