Based on the known function of Syts in vesicle exocytosis and as calcium sensors (Chapman, 2002; Südhof, 2013), we hypothesized that Syts play a role in MR1-dependent antigen presentation. Among 17 Syt isoforms, Syt1 and Syt7 are the most widely studied Syts (MacDougall et al., 2018). We first defined the expression of Syt1 and Syt7, two calcium-sensing Syts, in human bronchial epithelial BEAS-2B cells as well as differentiated monocytic THP-1 cells. Syt1 and Syt7 transcripts were expressed in both cell types (Figure 1a). While we previously found that small-interfering RNA (siRNA) knockdown of Syt7 reduced MR1-mediated presentation of Mtb in BEAS-2B cells (Karamooz et al., 2025), we sought to further define the role of these proteins in the presentation of mycobacterial antigens. As a result, we generated Syt1 and Syt7 knockout (KO) BEAS-2B cells using a lentiviral CRISPR/Cas9 system. We confirmed the gene knockout efficiency in clonal cell lines through Sanger sequencing and used the Inference of CRISPR Editing (ICE) tool to calculate editing efficiency and percent indel distribution (Conant et al., 2022). The editing efficiency was 97% for Syt1 with –1 and –21 indel deletions. For Syt7, the editing efficiency was 96% with –14 and –15 indel deletions (Figure 1b). There was no observed cell toxicity in these clonal cell lines. Then, to determine the functional role of Syt1 and Syt7 in antigen presentation, we measured IFN-γ release from human T cell clones co-cultured with Mtb-infected BEAS-2B cells. We found that both Syt1 and Syt7 KO BEAS-2B cells showed a decrease in MR1 presentation of Mtb (Figure 1c). To confirm that the degree of intracellular infection was not impacted by genetic deletion of Syt1 and Syt7, we used an HLA-B45-restricted T cell clone specific for the Mtb peptide CFP10_2–9. Here, we did not observe any differences in the presentation of Mtb-derived antigen. Also, as controls for exogenously delivered antigens, there were no changes in presentation of Mycobacterium smegmatis (Msmeg) supernatant or the CFP10_2–9 peptide to the MAIT cell or the HLA-B45-restricted T cell clone, respectively (Figure 1d). These findings show that genetic deletion of Syt1 and Syt7 specifically inhibited MR1 presentation of intracellular Mtb while leaving HLA-Ia (HLA-B45) presentation and presentation of exogenous antigens intact.

To further investigate if Syt1 and Syt7 contribute to an MR1 endosomal pathway involving recycling endosomes, we used a prodrug of 5-amino-6-D-ribitylaminouracil (5-A-RU) as an antigen (Lange et al., 2020). 5-A-RU is a precursor of 5-OP-RU, a highly potent MR1 ligand that is unstable without the formation of an MR1–antigen complex. While 5-A-RU is also unstable, a recently developed 5-A-RU prodrug exhibits greater stability. This prodrug requires enzymatic cleavage in acidic compartments for loading to occur in recycling endosomes (Lange et al., 2020). We found that deletion of Syt1 or Syt7 in BEAS-2B cells did not affect 5-A-RU prodrug presentation (Figure 1e). Therefore, Syt1 and Syt7 are selectively involved in MR1 presentation of Mtb-derived antigens discrete from other MR1 endosomal antigen presentation pathways.

Prior publications have demonstrated that Syt7 can facilitate phagocytosis in macrophages but do not affect phagocytic ability in dendritic cells (Czibener et al., 2006; Becker et al., 2009). To examine whether Syt1 and Syt7 play a role in the uptake of Mtb in bronchial epithelial cells, we used an auxotrophic strain of Mtb (AuxMtb). AuxMtb is an attenuated strain of the virulent H37Rv Mtb that retains the region of difference 1 (RD1) locus (Hondalus et al., 2000; Jain et al., 2014). RD1 encodes for ESAT-6 and CFP-10, which create pores and lyse phagosomes as in H37Rv Mtb. We further modified AuxMtb into a live/dead reporter strain, mEmeraldRFP-AuxMtb, which constitutively expresses mEmerald and tetracycline-inducible RFP (Martin et al., 2012). To assess uptake, we measured the percentage of live GFP⁺ cells after overnight infection (Figure 2a, b). There were no significant differences in AuxMtb uptake between Syt1 and Syt7 KO and wild-type BEAS-2B cells (Figure 2c). To determine the viability of intracellular Mtb, we conducted colony-forming unit (CFU) assays in lysed cells after overnight infection. As shown in Figure 2d, we observed no statistical differences in Mtb viability and growth. Lastly, we tested whether there was a change in MR1 expression in Syt1 and Syt7 KO cells, and we found no differences in MR1 transcripts by RT-qPCR compared to wild-type cells (Figure 2e). These findings suggest that Syt1 and Syt7 influence antigen presentation independently of effects on Mtb uptake, Mtb growth, or MR1 transcript levels.

We next sought to determine whether the roles of Syt1 and Syt7 are generalizable to professional antigen-presenting cells. As Syt1 and Syt7 are expressed in differentiated monocytic THP-1 cells (Figure 1a), we generated Syt1 and Syt7 KO THP-1 cells using the CRISPR/Cas9 system. We confirmed knockout efficiency using Sanger sequencing and the ICE analysis tool. The editing efficiency was 95% for Syt1 with –1 and –20 indel deletions and 100% for Syt7 with –16 indel deletion (Figure 3a). To identify the functional role of Syt1 and Syt7 in macrophages for MR1 presentation, we differentiated Syt1 and Syt7 KO THP-1 cells with phorbol 12-myristate 13-acetate (PMA) and measured T cell-dependent IFN-γ release. We found that the genetic deletion of Syt1 and Syt7 in THP-1 cells also resulted in a decrease in MR1 presentation of Mtb, while we observed no changes in the presentation of Msmeg supernatant compared to wild-type cells (Figure 3b, c). Due to HLA mismatch, we were not able to include controls for HLA-Ia and CFP10_2–9 peptide. However, these findings indicate that Syt1 and Syt7 also specifically promote MR1 presentation of Mtb and not exogenous antigen in professional antigen-presenting cells.

To test the hypothesis that Syt1 and Syt7 specifically mediate MR1 presentation of Mtb, we investigated additional calcium-related trafficking proteins (Wolfes and Dean, 2020; Saheki and De Camilli, 2017). Syt11 is a non-calcium-sensing Syt because it does not contain active calcium binding sites (Wolfes and Dean, 2020). It localizes to recycling endosomes and primarily inhibits endocytosis in neurons (Wang et al., 2016). Given the extensive study of the ER pathway in MR1 presentation and the role of the ER as the primary calcium storage site (McWilliam et al., 2016; McWilliam et al., 2020; Schwarz and Blower, 2016), we examined the role of ER-associated calcium-sensing proteins Esyt1 and Esyt2, which facilitate ER-plasma membrane tethering (Giordano et al., 2013). We found that Syt11, Esyt1, and Esyt2 were highly expressed in BEAS-2B cells (Figure 4a). To determine their roles in MR1 presentation, we transfected BEAS-2B cells with siRNAs targeting SYT11, ESYT1, or ESYT2 and confirmed over 80% reduction in mRNA transcripts (Figure 4b). Co-culture with human T cell clones and measurement of T cell-dependent IFN-γ release revealed three distinct phenotypes. Syt11 knockdown increased MR1 presentation of Msmeg supernatant but had no effect on MR1 presentation of Mtb (Figure 4c). In contrast, Esyt2 knockdown reduced MR1 presentation of both Mtb and Msmeg supernatant, while Esyt1 knockdown had no effect (Figure 4d, e). To test whether there is a decrease in MR1 surface translocation in the presence of a ligand in Esyt2 knockdown, we used Ac-6-FP, a potent MR1 ligand that induces MR1 translocation from the ER to the cell surface (Eckle et al., 2014). Treatment with Ac-6-FP resulted in increased MR1 surface stabilization, but MR1 surface level was significantly lower than those observed in missense control (Figure 4—figure supplement 1a, b). Interestingly, the impact of Esyt2 knockdown on MR1 presentation was similar to that of Syntaxin 18 knockdown (Harriff et al., 2014), both of which localize to the ER and influence MR1 presentation of exogenous ligands and intracellular Mtb. Moreover, knockdown of these trafficking proteins did not alter HLA-B45 antigen presentation, indicating specific involvement of Syt11 and Esyt2 in MR1 presentation and distinguishing them from traditional HLA-Ia pathways (Figure 4c–e). These findings demonstrate that among the calcium-related trafficking proteins we investigated, Syt1 and Syt7 uniquely contribute to the MR1 presentation of Mtb without affecting exogenous antigen presentation.

In neurons, Syt1 and Syt7 mainly localize to synaptic vesicles to facilitate membrane fusion (Chapman, 2002; Südhof, 2013). Other studies show that Syt7 is associated with lysosomes in non-neuronal cells (Martinez et al., 2000; Reddy et al., 2001). Therefore, we hypothesized that Syt1 and Syt7 will have a similar distribution in lysosomes of bronchial epithelial cells. To define the localization of Syt1 and Syt7, we transfected BEAS-2B cells with RFP-tagged Syt1 and Syt7 and infected them with baculoviruses that deliver constructs to express fluorescent fusion proteins targeted at different subcellular compartments (Kost et al., 2005). Using fluorescence microscopy, we found that both Syt1 and Syt7 highly co-localized with late endosomes (Rab7a; 60.4% ± 1.7% of vesicles) and lysosomes (LAMP1; 53.0% ± 2.4% of vesicles) compared to early endosomes (Rab5a; 9.3% ± 1.3% of vesicles) (Figure 5a, b). Next, we sought to identify the association of Syt1 and Syt7 with MR1 by live-cell imaging. MR1 localizes in the ER and late endo-lysosomes (Harriff et al., 2016; McWilliam et al., 2016; Huang et al., 2008). We used BEAS-2B cells expressing GFP-tagged MR1 to transfect RFP-tagged Syt1 and Syt7. We observed that about 60% of MR1 vesicles co-localized with Syt1 and Syt7 (Figure 5c, d), which is comparable to the extent of co-localization of MR1 with LAMP1 (Harriff et al., 2014). These findings suggest a potential role of Syt1 and Syt7 in trafficking MR1 vesicles to or from endo-lysosomes.

To investigate the role of Syt1 and Syt7 in MR1 vesicular trafficking and cellular distribution, we generated Syt1 and Syt7 KO in BEAS-2B MR1KO cells stably transduced with a doxycycline-inducible MR1-GFP plasmid (BEAS-2B:TET-MR1GFP) (Kulicke et al., 2025). We validated knockout efficiency using Sanger sequencing and the ICE tool (Figure 6a). Similar to wild-type BEAS-2B cells, Syt1 and Syt7 KO BEAS-2B:TET-MR1GFP cells exhibited a decrease in MR1 presentation of Mtb (Figure 6b). Syt7 KO BEAS-2B:TET-MR1GFP cells also demonstrated a small but statistically significant reduction in HLA-B45 presentation of Mtb. However, there was a more pronounced effect in MR1-mediated antigen presentation in Syt7 KO cells compared to WT. We hypothesized that the decreased MR1-mediated presentation of Mtb antigen could be due to decreased MR1 surface translocation in the presence of a ligand. Live-cell imaging showed no differences in MR1 cellular distribution in the presence or absence of Ac-6-FP between WT, Syt1, and Syt7 KO BEAS-2B:TET-MR1GFP cells as MR1 translocated from the ER and vesicles to the cell surface as expected (Figure 6c). Similarly, Syt1 and Syt7 KO cells did not alter MR1 surface translocation and HLA-Ia expression in the presence or absence of Ac-6-FP when measured by flow cytometry (Figure 6d). These findings suggest that Syt1 and Syt7 are not involved in the ER pathway of MR1 presentation of exogenous ligands and indicate that the reduction in MR1-mediated presentation of Mtb antigen in Syt1 and Syt7 KO cells is independent of ER-mediated MR1 surface translocation.

We further explored MR1 cellular distribution in Syt1 and Syt7 KO BEAS-2B:TET-MR1GFP cells by live-cell imaging. Interestingly, Syt1 and Syt7 KO cells exhibited enlargement of MR1 vesicles and an accumulation of vesicles in close proximity to one other (Figure 6e). Quantitative analysis showed a significant increase in the area of larger MR1 vesicles in Syt1 (~60%) and Syt7 (~35%) KO cells compared to WT cells (Figure 6f). Given that Syt1, Syt7, and MR1 co-localize with markers associated with late endosomes (Rab7a) and lysosomes (LAMP1) at steady state, we hypothesized that these larger and accumulated MR1 collections localized to lysosomal compartments. To test this, we infected Syt1 and Syt7 KO BEAS-2B:TET-MR1GFP cells with baculoviruses expressing RFP in either early endosomes (Rab5a) or lysosomes (LAMP1) (Kost et al., 2005). We found that the larger MR1 vesicles in Syt1 and Syt7 KO cells co-localized more with LAMP1 than Rab5a, similar to WT cells (Figure 6g, h). These findings suggest that while Syt1 and Syt7 are not involved in the recruitment of MR1 vesicles to LAMP1⁺ compartments, they play a critical role in the trafficking of MR1 vesicles from LAMP1⁺ compartments to other endosomal compartments or to the cell surface for antigen presentation.

To understand whether Syt1 and Syt7 are involved in trafficking MR1 vesicles for antigen presentation during intracellular Mtb infection, we conducted live-cell imaging to visualize Mtb-containing vacuoles. Using Syt1 and Syt7 KO BEAS-2B:TET-MR1GFP cells, we infected the cells with wild-type AuxMtb labeled with Alexa Fluor 555 NHS ester dye. Live-cell imaging showed that MR1 vesicles accumulated near Mtb-containing vacuoles in Syt1 and Syt7 KO cells (Figure 7a). Quantitative analysis demonstrated a significant increase in the number of MR1 vesicles within 1 µm of AuxMtb for Syt1 (1.23 ± 0.21) and Syt7 KO (1.28 ± 0.22) cells compared to WT cells (Figure 7b). However, there were no significant differences in the total number or average speed of MR1 vesicles between WT, Syt1, and Syt7 KO cells (Figure 7c). Furthermore, the surface of MR1 vesicles in Syt1 and Syt7 KO cells showed an approximately fourfold increase in overlap area with Mtb surfaces (Figure 7d). To confirm the increased number and surface overlap of MR1 vesicles with Mtb-containing vacuoles of Syt1 and Syt7 KO cells, we quantified MR1 expression within phagolysosomes using flow organellometry. Our lab previously established this method for separating and phenotyping subcellular compartments (Grotzke et al., 2009; Ramachandra et al., 2001). Flow organellometry enables separation of plasma membrane, ER, lysosomes, and phagosomes in a 27% Percoll gradient. Phagosomes are detected in the last few subcellular fractions (Grotzke et al., 2009). We infected WT, Syt1, and Syt7 KO BEAS-2B:TET-MR1GFP cells overnight with wild-type AuxMtb labeled with Alexa Fluor 647 NHS ester dye. We performed flow organellometry to separate phagosomes from other subcellular fractions and identified enrichment of Mtb-containing vacuoles in fractions 42–50 (Figure 7e, f). When comparing MR1 expression within the fractions containing the highest percentage of Mtb⁺LAMP1⁺ vesicles, Syt7 KO cells showed about 25% increase in the geometric mean fluorescence intensity of MR1 compared to WT cells (Figure 7g). Although these findings do not determine the exact location of MR1 loading, they support a model whereby Syt1 and Syt7 transport MR1 vesicles, whether loaded or unloaded, from the Mtb-containing vacuoles and to the cell surface for antigen presentation.

H37Rv Mycobacterium tuberculosis (Mtb) strain, obtained from the American Type Culture Collection (ATCC), was grown in Middlebrook 7H9 Broth supplemented with Middlebrook ADC (BD), 0.05% Tween-80 (OmniPur), and 0.5% glycerol (Thermo Fisher Scientific). Mtb was used from frozen glycerol stocks by passaging 20 times through a tuberculin syringe (BD) with a 27-gauge needle before infection. Multiplicity of infection (MOI) of 8 was used for IFN-γ ELISpot assays. ΔleuD ΔpanCD double auxotroph Mtb (AuxMtb), an attenuated strain of H37Rv Mtb, was gifted by Dr. William Jacobs (Hondalus et al., 2000; Jain et al., 2014). A modification of AuxMtb was generated to constitutively express the green fluorescent protein mEmerald and the tetracycline (tet)-inducible red fluorescent protein (mEmeraldRFP-AuxMtb) (Martin et al., 2012). MOIs of 5 (for fluorescence microscopy), 8 (for Mtb uptake assay), and 10 (for flow organellometry assay) were used. Mycobacterium smegmatis (Msmeg, mc² 155 strain) supernatant was obtained by culturing Msmeg for 24 hr in 7H9 broth, passing the supernatant through a 0.22-μm filter, and concentrating it using a 10-kDa Amicon filter (Millipore Sigma). Msmeg supernatant was used from frozen aliquots stored at –80°C.

BEAS-2B and THP-1 cells were obtained from ATCC. BEAS-2B cells were cultured in DMEM (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (GeminiBio) and L-glutamine (Gibco). THP-1 cells were cultured in RPMI 1640 (Gibco) supplemented with 10% heat-inactivated fetal bovine serum and L-glutamine. Polyclonal BEAS-2B:tetMR1-GFP cells were developed by transducing BEAS-2B cells with tet-inducible MR1-GFP as described previously (Huber et al., 2020). BEAS-2B MR1KO:tetMR1-GFP clone D4 was generated by reconstituting a clonal BEAS-2B MR1 KO cell line with a lentiviral vector encoding GFP-tagged MR1A under a tet-inducible promoter (Narayanan et al., 2020). The polyclonal cell line was sorted based on GFP expression, and individual clonal lines were generated (Kulicke et al., 2025). Due to the constitutive expression of Cas9 and the sgRNA targeting MR1, the MR1 sequence at each insertion of the tetMR1-GFP cassette into the genome was edited. CRISPR editing resulted in a V12I substitution for clone D4, which is phenotypically similar to cell lines over-expressing WT MR1A (Narayanan et al., 2020). Of note, bovine and porcine MR1 have an I at this position (Xiao et al., 2019). Clone D4 was then used to generate Syt1 and Syt7 KO BEAS-2B MR1KO:tetMR1-GFP cells.

All cell lines were passaged up to 15 times before being discarded. Freezebacks are frozen down during the first 2–3 passages. Cell lines were periodically tested for mycoplasma contamination and confirmed negative. Modification to cell lines was validated. Cells transduced with tet-inducible MR1-GFP were verified by flow cytometry and western blot. Knockout cells were verified by Sanger sequencing and analyzed with the ICE (Synthego) tool (Conant et al., 2022).

Lentiviral particles for sgRNAs targeting Syt1 (GGTACCATACTCGGAATTGGG) and Syt7 (GGTGTCAGCGCAAACTGGT) were generated as described previously by co-transfecting low-passage HEK293T cells with lentiviral vector (sgOpti; addgene 85681), packaging vector (psPAX2; addgene 12260), and envelope vector (pVSVg; addgene 138479) using Lipofectamine 2000 (Thermo Fisher) (Thomas et al., 2022; Shalem et al., 2014). Generated lentiviral particles were used to transduce low-passage BEAS-2B Cas9 and THP-1 Cas9 cells with 200 µg Polybrene (Sigma). Transduced cells were selected for 6 days with 8 µg/ml Puromycin (Sigma). Monoclonal cell lines were generated by limiting dilution and screened by functional IFN-γ ELISpot assay. Genome editing efficiency and clonality were verified by Sanger sequencing and analyzed with the ICE (Synthego) tool (Conant et al., 2022). Genomic DNA was isolated from KO clones using the QIAmp DNA Mini Kit (QIAGEN) per the manufacturer’s protocol. DNA surrounding sgRNA target region was amplified with Q5 HF DNA polymerase (NEB) and primers (Syt1 F: CCTCAGTAAGTTACACCCTGAC, Syt1 R: TTGTGTCCAGGGTTGCTGTT, Syt7 F: TGAGGGTCTCAAGTTTGGAGG, Syt7 R: TGTCCCCGAATGTGTCCCTA). Sanger sequencing was performed with an Applied Biosystems 3730xl 96-capillary DNA Analyzer at the OHSU Vollum Institute DNA Sequencing Core.

To generate Syt1 and Syt7 KO in the BEAS-2B MR1KO:tetMR1-GFP clone D4 background, a CRISPR Gene Knockout Kit (Synthego) was used per the manufacturer’s protocol on CRISPR editing of immortalized cell lines (Synthego). Ribonucleoprotein (RNP) complexes, consisting of three sgRNAs and SpCas9 nuclease, were assembled at a 9:1 ratio in resuspension buffer R. Electroporation of RNPs was performed with the Neon NxT Electroporation System (Invitrogen) with the following conditions: 1400 V, 20 ms, and 2 pulses. After the electroporated cells rested for 3 days, monoclonal cell lines were generated, and genome editing efficiency was analyzed as described above, with the exception of using the primer sets recommended by Synthego.

This study was conducted according to the principles expressed in the Declaration of Helsinki. All samples were collected with informed consent, and all experiments were conducted according to protocols approved by the Institutional Review Board at Oregon Health & Science University (IRB00000186). Peripheral blood mononuclear cells (PBMCs) were obtained by apheresis from healthy adults and used to expand T cell clones as described below. Human serum was obtained from healthy adults for ELISpot medium as described below. No data is presented on the PBMCs from human subject participants, and sex and gender were not taken into consideration.

Two T cell clones were previously characterized and used throughout the study: a MAIT cell clone (D426-G11) (Harriff et al., 2018) and an HLA-B45-restricted T cell clone (D466-A10) (Lewinsohn et al., 2007). For rapid expansion, T cell clones were co-cultured with irradiated allogenic PBMCs and allogenic lymphoblastoid cell lines in RPMI1640 medium (Gibco) containing 10% human serum and anti-CD3 (30 ng/ml, clone OKT3, eBioscience) (Heinzel et al., 2002). Recombinant IL-2 (2 ng/ml) was added the following day and every 2–3 days thereafter. T cell clones were washed on Day 5 to remove anti-CD3 and frozen down after at least 11 days. New freeze-back stocks were validated before use by comparing IFN-γ response to a previous freeze back.

5-A-RU prodrug (5-A-RU-PABC-Val-Cit-Fmoc, MedChemExpress) was resuspended in DMSO at 10 mM. Doxycycline (Sigma-Aldrich) was resuspended to 2 mg/ml in H₂O and used at 2 µg/ml unless specified. Ac-6-FP (Schirck’s laboratories) was resuspended in 0.01 M NaOH at 5.2 mM. Phytohemagglutinin (PHA, Roche) was resuspended at 10 mg/ml in RPMI1640 medium (Gibco) supplemented with 10% human serum, 2% L-glutamine, and 0.1% gentamicin for ELISpot assays. 16% paraformaldehyde (PFA, Electron Microscopy Sciences) was diluted to appropriate concentrations. CFP10_2–9 peptide was obtained from Genemed Synthesis and resuspended in DMSO at 5 mg/ml.

Multiscreen 96-well mixed cellulose esters plates (MSHAS4510, Millipore) were coated overnight at 4°C with 10 µg/ml anti-IFN-γ antibody (Clone 1-D1K, Mabtech) diluted in coating buffer (0.1 M Na₂CO₃, 0.1 M NaHCO₃, pH 9.6). Plates were washed three times with sterile PBS (Corning) and incubated with blocking buffer (RPMI (Gibco) containing 10% human serum, 2% L-glutamine, and 0.1% gentamicin (Gibco)) for 1 hr at room temperature. For exogenous antigens and peptide, 1e4 BEAS-2B cells or 1e4 THP-1 cells differentiated with 50 ng/ml phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich) for 48 hr prior were plated in duplicate. Cells were incubated with Msmeg supernatant, CFP10_2–9 peptide, or 5-A-RU prodrug in serial dilutions. PHA (Roche) was used as a positive control. After 1 hr of incubation at 37°C and 5% CO₂, 1e4 MAIT cell clone (D426-G11) or 1e4 HLA-B45-restricted T cell clone (D466-A10) were added to the plates based on the antigen. All cells and reagents were resuspended in the blocking buffer described above. Cells were co-cultured for 18 hr at 37°C and 5% CO₂. Plates were washed with PBS (Sigma-Aldrich) containing 0.05% Tween-20 (Affymetrix), followed by incubation with ALP-conjugated secondary antibody (Clone 7-B6-1-ALP, Mabtech) diluted in PBS containing 0.5% BSA (Fisher Scientific) and 0.05% Tween-20 for 2 hr at room temperature. Plates were washed again in PBS containing 0.05% Tween-20 and developed using BCIP/NBT-plus developer (Mabtech). IFN-γ spots were enumerated using an AID ELISpot reader and AID EliSpot software (version 7, Autoimmune Diagnostica).

For Mtb infection, 4e5 BEAS-2B cells were infected with H37Rv Mtb (MOI = 8) overnight. 4e5 THP-1 cells differentiated with PMA for 48 hr were washed with PBS and infected with H37Rv Mtb (MOI = 1) for 3 hr. Subsequently, infected cells were serially diluted and plated in duplicate. 1e4 MAIT cell clone (D426-G11) or 1e4 HLA-B45-restricted T cell clone (D466-A10) was added and co-cultured for 18 hr at 37°C and 5% CO₂. Plates were processed as described above.

Cells infected with H37Rv Mtb (MOI = 8) overnight were lysed in ultrapure water the following day. Serial dilutions were plated on 7H10 agar supplemented with glycerol and Middlebrook ADC. Plates were incubated at 37°C and 5% CO₂. Triplicates after serial dilutions with PBS + 0.05% Tween-80 were plated and enumerated after 12 days to determine CFU per 100 cells.

Small-interfering RNAs targeting Syt11 (s23283), Esyt1 (s23607), Esyt2 (s33136), and a missense control (4390844) were obtained from Thermo Fisher Scientific. 1.5e5 BEAS-2B cells were plated in 6-well plates (Corning) and transfected with 50 nM siRNA using Lipofectamine RNAiMAX (Invitrogen) at 80% confluency. Cells were used for ELISpot assays or RNA extraction at 48 hr post-transfection.

Total RNA was isolated using the RNeasy Plus Mini Kit (QIAGEN) and reverse transcribed into cDNA using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems) according to the manufacturer’s instructions. Quantitative RT-qPCR was performed on a Step One Plus Real-Time PCR System (Applied Biosystems) using TaqMan Universal PCR Master Mix (Life Technologies). Taqman FAM-MGB probes for SYT11 (Hs00383056_m1), ESYT1 (Hs00248693_m1), ESYT2 (Hs00294020_m1), SYT1 (Hs00194572_m1), SYT7 (Hs01590513_m1), and MR1 (Hs00155420_m1) were obtained from Thermo Fisher Scientific. Samples were run in triplicates. Gene expression levels were normalized to GAPDH (Hs02758991_g1) of the same sample. Relative expression of the sample was compared to control.

For Mtb uptake assays, 4e5 BEAS-2B cells were plated in a 6-well plate and incubated for at least 5 hr at 37°C and 5% CO₂. Cells were then infected with mEmeraldRFP-AuxMtb (MOI = 8) overnight. Cells were stained with Live/Dead Fixable Dead Cell Stain Kit (Thermo Fisher) for 20 min on ice, washed, and fixed in 4% PFA. For MR1 surface expression assays, cells were plated in a 12-well plate and treated with 2 µg/ml doxycycline overnight at 37°C and 5% CO₂. 10 µM Ac-6-FP or NaOH (solvent control) was added the next day for at least 18 hr. Cells were stained with Live/Dead Fixable Dead Cell Stain Kit for 20 min on ice. Then, cells were stained with APC-conjugated anti-HLA Ia antibody (clone W6/32; BioLegend #311410), APC-conjugated anti-MR1 antibody (clone 26.5; BioLegend #361108), and APC-conjugated isotype control antibody (clone MOPC-173; BioLegend #400222) for 20 min on ice in a FACS buffer (PBS containing 2% human serum, 2% goat serum, and 0.5% FBS). Cells were washed and fixed in 2% PFA. All data were obtained with LSR II (BD) cytometer at the OHSU Flow Cytometry Shared Resource and analyzed with FlowJo software version 10 (TreeStar).

WT, Syt1 KO, and Syt7 KO BEAS-2B MR1KO:tetMR1-GFP cells were plated at 9e6 and incubated with 2 µg/ml doxycycline for 5 hr at 37°C and 5% CO₂. Cells were infected overnight with AuxMtb (MOI = 10) labeled with Alexa Fluor 647 Succinimidyl Ester (Invitrogen) in the presence of leucine and pantothenate. Postnuclear supernatant was prepared as described previously (Grotzke et al., 2009). Post-nuclear supernatant was layered onto 27% Percoll and centrifuged for 1 hr at 4°C in 36,000 × g using a 70.1Ti rotor (Beckman). The Percoll gradient was manually fractionated into approximately 50 fractions (200 µl each). Fractions 36–50, the phagosome-containing fractions, were stained with BV421-conjugated anti-CD107a (LAMP-1) antibody (clone H4A3; BioLegend #328625) in FACS buffer and fixed in 2% PFA. All data were obtained with LSR II (BD) cytometer at the OHSU Flow Cytometry Shared Resource and analyzed with FlowJo software version 10 (TreeStar).

All images were acquired on a motorized Nikon TiE stand with a Yokogawa W1 spinning disk unit and a high-powered Agilent laser-emission filter (405–445/50 nm, 488–525/36 nm, and 561–617/73 nm). A 100x (NA 1.49) objective was used and images were captured with an Andor Zyla 5.5 sCMOS camera with 2by2 camera binning. For co-localization between Syt1 and Syt7 with other endosomal markers, 1e5 BEAS-2B cells transfected with Syt1-RFP or Syt7-RFP were plated on 8-well #1.5 glass bottom chamber slides (Nunc) and incubated at 37°C and 5% CO₂ overnight. CellLight BacMam 2.0 (Invitrogen) for early endosomes (Rab5a-GFP, C10586), late endosomes (Rab7-GFP, C10588), or lysosomes (LAMP1-GFP, C10596) was added the next day and incubated overnight. For co-localization between Syt1 and Syt7 with MR1, 2–2.5e5 polyclonal BEAS-2B:tetMR1-GFP cells transfected with Syt1-RFP or Syt7-RFP were plated and incubated with 2 µg/ml doxycycline at 37°C and 5% CO₂ overnight. To measure changes in MR1 cellular distribution in Syt1 and Syt7 KO BEAS-2B MR1KO:tetMR1-GFP clone D4 cells, 2e5 cells were plated and incubated with 2 µg/ml doxycycline at 37°C and 5% CO₂. After 4 hr, either CellLight BacMam 2.0 (Invitrogen) for Rab5a-RFP (C10587), Rab7-RFP (C10589), and LAMP1-RFP (C10597) or 10 µM Ac-6-FP and NaOH (solvent control) were added to quantify co-localization with endosomal compartments or to induce MR1 translocation to the cell surface. For AuxMtb infection, 2–2.5e5 cells were plated on 4-well #1.5 glass bottom chamber slides (Nunc) and incubated with 2 µg/ml doxycycline for 4 hr at 37°C and 5% CO₂. Cells were infected overnight with mEmeraldRFP-AuxMtb or AuxMtb (MOI = 5) labeled with Alexa Fluor 555 Succinimidyl Ester (Invitrogen) in the presence of leucine and pantothenate. Before imaging, to ensure randomization, cells were stained with or without NucBlue Live ReadyProbes (Invitrogen) and imaged in an unbiased manner based on their NucBlue, RFP, or GFP expression as appropriate.

Co-localizations were analyzed using the ‘Spots’ function and ‘spots colocalization’ MatLab Xtension module on Imaris 7 (Bitplane). Area of MR1 vesicles was classified into small (≤1 µm²) and large vesicles (>1 µm²) using the ‘Surfaces’ function based on MR1-GFP fluorescence, using segmentation setup with Surfaces Detail 0.260 µm, Absolute Intensity Thresholding method, and Classification using surface area. For each cell, areas of small and large MR1 vesicles were averaged in Excel. Surface overlaps between MR1 and AuxMtb for each cell were analyzed using the ‘Surfaces’ function similar to above and calculated ‘overlapped area ratio to surfaces’ under detailed specific values using Imaris. Total number and average speed of MR1 vesicles for each cell were analyzed using the ‘Spots’ function. Number of MR1 vesicles within 1 µm of Mtb was enumerated by first defining MR1-GFP vesicles as ‘Spots’ and AuxMtb-RFP as ‘Surfaces’. Then, MR1 vesicles were classified into two groups (≤1 and >1 µm) using ‘shortest distance to surface’ with a classification filter. All analysis involving spots, surfaces, and classifications was done using Imaris 7 and 10 (Bitplane).

All data were analyzed with Prism 10 (GraphPad). At least three independent experiments were performed and plotted as mean ± SEM. Statistical significance for ELISpot assays was determined by non-linear regression using [Agonist] vs. response model with three parameters. Best-fit values of top and EC₅₀ parameters were compared between the curves, and p-values were calculated using extra sum-of-squares F test. No constraints were applied to the bottom and top parameters, and the EC₅₀ parameter was constrained to be greater than 0 for p-value calculation. Statistical significances for microscopy and others were determined by two-tailed unpaired t-test (for two groups), a one-way ANOVA with Dunnett’s multiple comparisons test (for three groups), or a two-way ANOVA with Sidak’s or Dunnett’s multiple comparisons tests was conducted for statistical analysis. A p-value of <0.05 was considered statistically significant.

All cell lines and plasmids are available upon request and completion of a Material Transfer Agreement.