<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">51131</article-id><article-id pub-id-type="doi">10.7554/eLife.51131</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell Biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Structural Biology and Molecular Biophysics</subject></subj-group></article-categories><title-group><article-title>The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-153842"><name><surname>Bodrug</surname><given-names>Tatyana</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-9017-962X</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/><xref ref-type="fn" rid="pa1">‡</xref></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-84007"><name><surname>Wilson-Kubalek</surname><given-names>Elizabeth M</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-153828"><name><surname>Nithianantham</surname><given-names>Stanley</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-6238-647X</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-153847"><name><surname>Thompson</surname><given-names>Alex F</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-153848"><name><surname>Alfieri</surname><given-names>April</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-153849"><name><surname>Gaska</surname><given-names>Ignas</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-153850"><name><surname>Major</surname><given-names>Jennifer</given-names></name><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-153851"><name><surname>Debs</surname><given-names>Garrett</given-names></name><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-153852"><name><surname>Inagaki</surname><given-names>Sayaka</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-153853"><name><surname>Gutierrez</surname><given-names>Pedro</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con10"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-112235"><name><surname>Gheber</surname><given-names>Larisa</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0003-3759-4001</contrib-id><xref ref-type="aff" rid="aff8">8</xref><xref ref-type="other" rid="fund5"/><xref ref-type="other" rid="fund6"/><xref ref-type="fn" rid="con11"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-2122"><name><surname>McKenney</surname><given-names>Richard J</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund8"/><xref ref-type="fn" rid="con12"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-18581"><name><surname>Sindelar</surname><given-names>Charles Vaughn</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0002-6646-7776</contrib-id><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con13"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-15333"><name><surname>Milligan</surname><given-names>Ronald</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund7"/><xref ref-type="fn" rid="con14"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-153826"><name><surname>Stumpff</surname><given-names>Jason</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="other" rid="fund3"/><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con15"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-15323"><name><surname>Rosenfeld</surname><given-names>Steven S</given-names></name><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con16"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-153837"><name><surname>Forth</surname><given-names>Scott T</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con17"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-152600"><name><surname>Al-Bassam</surname><given-names>Jawdat</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-6625-2102</contrib-id><email>jmalbassam@ucdavis.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con18"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution content-type="dept">Department of Molecular and Cellular Biology</institution><institution>University of California, Davis</institution><addr-line><named-content content-type="city">Davis</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution content-type="dept">Department of Integrative Structural and Computational Biology</institution><institution>Scripps Research Institute</institution><addr-line><named-content content-type="city">La Jolla</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution content-type="dept">Department of Molecular Physiology and Biophysics</institution><institution>University of Vermont</institution><addr-line><named-content content-type="city">Burlington</named-content></addr-line><country>United States</country></aff><aff id="aff4"><label>4</label><institution content-type="dept">Department of Biological Sciences</institution><institution>Rensselaer Polytechnic Institute</institution><addr-line><named-content content-type="city">Troy</named-content></addr-line><country>United States</country></aff><aff id="aff5"><label>5</label><institution content-type="dept">Department of Cancer Biology</institution><institution>Lerner Research Institute, Cleveland Clinic</institution><addr-line><named-content content-type="city">Lorain</named-content></addr-line><country>United States</country></aff><aff id="aff6"><label>6</label><institution content-type="dept">Department of Pharmacology</institution><institution>Mayo Clinic</institution><addr-line><named-content content-type="city">Jacksonville</named-content></addr-line><country>United States</country></aff><aff id="aff7"><label>7</label><institution content-type="dept">Department of Molecular Biophysics and Biochemistry</institution><institution>Yale University</institution><addr-line><named-content content-type="city">New Haven</named-content></addr-line><country>United States</country></aff><aff id="aff8"><label>8</label><institution content-type="dept">Department of Chemistry and Ilse Katz Institute for Nanoscale Science and Technology</institution><institution>Ben-Gurion University of the Negev</institution><addr-line><named-content content-type="city">Negev</named-content></addr-line><country>Israel</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Carter</surname><given-names>Andrew P</given-names></name><role>Reviewing Editor</role><aff><institution>MRC Laboratory of Molecular Biology</institution><country>United Kingdom</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Pfeffer</surname><given-names>Suzanne R</given-names></name><role>Senior Editor</role><aff><institution>Stanford University School of Medicine</institution><country>United States</country></aff></contrib></contrib-group><author-notes><fn fn-type="present-address" id="pa1"><label>‡</label><p>Department of Biochemistry and Biophysics, Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, United States</p></fn><fn fn-type="con" id="equal-contrib1"><label>†</label><p>These authors contributed equally to this work</p></fn></author-notes><pub-date date-type="publication" publication-format="electronic"><day>20</day><month>01</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e51131</elocation-id><history><date date-type="received" iso-8601-date="2019-08-16"><day>16</day><month>08</month><year>2019</year></date><date date-type="accepted" iso-8601-date="2020-01-16"><day>16</day><month>01</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Bodrug et al</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Bodrug et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-51131-v2.pdf"/><abstract><p>Kinesin-5 motors organize mitotic spindles by sliding apart microtubules. They are homotetramers with dimeric motor and tail domains at both ends of a bipolar minifilament. Here, we describe a regulatory mechanism involving direct binding between tail and motor domains and its fundamental role in microtubule sliding. Kinesin-5 tails decrease microtubule-stimulated ATP-hydrolysis by specifically engaging motor domains in the nucleotide-free or ADP states. Cryo-EM reveals that tail binding stabilizes an open motor domain ATP-active site. Full-length motors undergo slow motility and cluster together along microtubules, while tail-deleted motors exhibit rapid motility without clustering. The tail is critical for motors to zipper together two microtubules by generating substantial sliding forces. The tail is essential for mitotic spindle localization, which becomes severely reduced in tail-deleted motors. Our studies suggest a revised microtubule-sliding model, in which kinesin-5 tails stabilize motor domains in the microtubule-bound state by slowing ATP-binding, resulting in high-force production at both homotetramer ends.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>kinesin-5</kwd><kwd>motor protein</kwd><kwd>Microtubule</kwd><kwd>sliding</kwd><kwd>mitosis</kwd><kwd>mitotic spindle</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>D. melanogaster</italic></kwd><kwd>Human</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000001</institution-id><institution>National Science Foundation</institution></institution-wrap></funding-source><award-id>1615991</award-id><principal-award-recipient><name><surname>Al-Bassam</surname><given-names>Jawdat</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>GM110283</award-id><principal-award-recipient><name><surname>Al-Bassam</surname><given-names>Jawdat</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>GM121491</award-id><principal-award-recipient><name><surname>Stumpff</surname><given-names>Jason</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>GM130556</award-id><principal-award-recipient><name><surname>Rosenfeld</surname><given-names>Steven S</given-names></name><name><surname>Stumpff</surname><given-names>Jason</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100003977</institution-id><institution>Israel Science Foundation</institution></institution-wrap></funding-source><award-id>ISF 386/18</award-id><principal-award-recipient><name><surname>Gheber</surname><given-names>Larisa</given-names></name></principal-award-recipient></award-group><award-group id="fund6"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001742</institution-id><institution>United States-Israel Binational Science Foundation</institution></institution-wrap></funding-source><award-id>BSF-2015851</award-id><principal-award-recipient><name><surname>Gheber</surname><given-names>Larisa</given-names></name></principal-award-recipient></award-group><award-group id="fund7"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>GM052468</award-id><principal-award-recipient><name><surname>Milligan</surname><given-names>Ron</given-names></name></principal-award-recipient></award-group><award-group id="fund8"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>GM124889</award-id><principal-award-recipient><name><surname>McKenney</surname><given-names>Richard J</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Biochemical, single molecule, cell and structural biology studies reveal an interaction between the kinesin-5 tail and motor domains regulating high-force production, which is critical for microtubule sliding motility.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Microtubules (MTs) form tracks for the active transport of vesicles and macromolecules inside eukaryotic cells, generate pulling forces during assembly of mitotic spindles, and promote the alignment and segregation of chromosomes (<xref ref-type="bibr" rid="bib20">Goshima and Scholey, 2010</xref>; <xref ref-type="bibr" rid="bib55">Vale, 2003</xref>). Fourteen kinesin motor subfamilies utilize MTs as tracks for many diverse functions (<xref ref-type="bibr" rid="bib55">Vale, 2003</xref>). Among them, kinesin-5 motors represent a unique and highly conserved subfamily that is essential for mitotic spindle assembly during metaphase and spindle elongation during anaphase (<xref ref-type="bibr" rid="bib30">Kashina et al., 1996</xref>). In contrast to the majority of kinesin classes, kinesin-5 motors adopt a conserved bipolar homotetrameric organization, composed of two dimeric subunits folded in an antiparallel arrangement mediated by the assembly of a 60 nm long central minifilament (<xref ref-type="bibr" rid="bib1">Acar et al., 2013</xref>; <xref ref-type="bibr" rid="bib30">Kashina et al., 1996</xref>; <xref ref-type="bibr" rid="bib42">Scholey et al., 2014</xref>; <xref ref-type="bibr" rid="bib47">Singh et al., 2018</xref>). Through this conserved bipolar organization, kinesin-5 motors promote MT crosslinking and mediate their sliding apart during mitotic spindle assembly and elongation. This activity can be recapitulated in vitro with purified kinesin-5 motors from a variety of species (<xref ref-type="bibr" rid="bib29">Kapitein et al., 2008</xref>; <xref ref-type="bibr" rid="bib28">Kapitein et al., 2005</xref>; <xref ref-type="bibr" rid="bib59">van den Wildenberg et al., 2008</xref>).</p><p>Metazoan kinesin-5 motors such as <italic>D. melanogaster</italic> KLP61F or human Eg5 exhibit slow plus-end directed motility especially during antiparallel MT sliding (<xref ref-type="bibr" rid="bib29">Kapitein et al., 2008</xref>; <xref ref-type="bibr" rid="bib28">Kapitein et al., 2005</xref>; <xref ref-type="bibr" rid="bib46">Shimamoto et al., 2015</xref>; <xref ref-type="bibr" rid="bib59">van den Wildenberg et al., 2008</xref>). In contrast, yeast kinesin-5 motors, such as Cin8, Kip1 and Cut7 uniquely undergo minus-end directed motility as single motors and reverse direction toward MT plus-ends upon clustering into multi-motor assemblies along single MTs, or during antiparallel MT sliding (<xref ref-type="bibr" rid="bib13">Edamatsu, 2014</xref>; <xref ref-type="bibr" rid="bib17">Fridman et al., 2013</xref>; <xref ref-type="bibr" rid="bib18">Gerson-Gurwitz et al., 2011</xref>; <xref ref-type="bibr" rid="bib40">Roostalu et al., 2011</xref>; <xref ref-type="bibr" rid="bib44">Shapira et al., 2017</xref>). The conserved plus-end directed MT sliding activity is essential for mitotic spindle assembly by generating forces exerted on MTs emanating from opposite spindle poles during metaphase and stabilizing the characteristic bipolar spindle organization (<xref ref-type="bibr" rid="bib6">Brust-Mascher et al., 2009</xref>; <xref ref-type="bibr" rid="bib16">Forth and Kapoor, 2017</xref>; <xref ref-type="bibr" rid="bib49">Subramanian and Kapoor, 2012</xref>; <xref ref-type="bibr" rid="bib62">Wang et al., 2014</xref>). The MT sliding activity is critical for the elongation of mitotic spindles at the midzone region during anaphase (<xref ref-type="bibr" rid="bib20">Goshima and Scholey, 2010</xref>). Defects in mammalian kinesin-5 motors or their inactivation via inhibitory compounds such as monastrol disrupt the balance of mechanical forces within the spindle and lead to monopolar spindles (<xref ref-type="bibr" rid="bib20">Goshima and Scholey, 2010</xref>; <xref ref-type="bibr" rid="bib19">Goshima et al., 2005</xref>). These inhibitory compounds aided in elucidating the fundamental functions of kinesin-5 in mitosis and were suggested to be of therapeutic value in treating rapidly dividing cancer cells (<xref ref-type="bibr" rid="bib32">Kwok et al., 2006</xref>; <xref ref-type="bibr" rid="bib35">Mayer et al., 1999</xref>; <xref ref-type="bibr" rid="bib36">Owens, 2013</xref>).</p><p>Each kinesin-5 motor consists of a conserved organization including: an N-terminal motor domain, α-helical neck and bipolar assembly regions, and a C-terminal tail domain. The motor domain is connected via a neck-linker to a dimerizing α-helical coiled-coil neck (<xref ref-type="bibr" rid="bib54">Turner et al., 2001</xref>; <xref ref-type="bibr" rid="bib57">Valentine et al., 2006a</xref>; <xref ref-type="bibr" rid="bib58">Valentine et al., 2006b</xref>). The parallel α-helical coiled-coil neck forms part of the 60 nm central antiparallel homotetrameric α-helical minifilament (<xref ref-type="bibr" rid="bib1">Acar et al., 2013</xref>; <xref ref-type="bibr" rid="bib30">Kashina et al., 1996</xref>). At the center of this minifilament is a 27 nm antiparallel four α-helical bundle termed the bipolar assembly (BASS) region (<xref ref-type="bibr" rid="bib42">Scholey et al., 2014</xref>). The bipolar tetrameric organization of the kinesin-5 BASS region orients the two-parallel coiled-coils at the neck and their associated motor domains at an off-set. This results in a 100°-lateral rotation between the two opposite ends that potentially mediates the preference for kinesin-5 to bind and slide two antiparallel MTs (<xref ref-type="bibr" rid="bib42">Scholey et al., 2014</xref>). A section of unknown structure extends from the C-terminus of the BASS to the tail domain that is located near the motor domains of the antiparallel subunits (<xref ref-type="bibr" rid="bib1">Acar et al., 2013</xref>). Thus, each end of the kinesin-5 tetramer consists of twin tail and motor domains that emerge from intertwined antiparallel dimeric subunits (<xref ref-type="bibr" rid="bib1">Acar et al., 2013</xref>; <xref ref-type="bibr" rid="bib42">Scholey et al., 2014</xref>).</p><p>The kinesin-5 tail domain contains a conserved BimC box, which is a consensus motif that is phosphorylated by mitotic cyclin-dependent kinases (<xref ref-type="bibr" rid="bib4">Blangy et al., 1995</xref>; <xref ref-type="bibr" rid="bib45">Sharp et al., 1999</xref>). Mitotic phosphorylation at the BimC box induces kinesin-5 motors to concentrate along the mitotic midzone where they promote the elongation of the mitotic spindle during late anaphase by sliding apart antiparallel MTs (<xref ref-type="bibr" rid="bib45">Sharp et al., 1999</xref>), though the role for this phosphorylation in the regulation of kinesin-5 activity remains unknown. Studies of the <italic>S. cerevisiae</italic> yeast ortholog Cin8 show the tail domain is essential for kinesin-5 function; deletion of the tail leads to a lethal mitotic arrest phenotype in the absence of the analogous motor Kip1 (<xref ref-type="bibr" rid="bib25">Hildebrandt et al., 2006</xref>). The tail domain of the <italic>Xenopus laevis</italic> Eg5 has been suggested to form a secondary MT binding site during MT sliding motility (<xref ref-type="bibr" rid="bib63">Weinger et al., 2011</xref>). However, the exact function of the kinesin-5 tail domain remains unknown. Despite extensive structural, kinetic, and functional analyses of kinesin-5 motors, the origin of the highly conserved MT sliding activity in these motors and its relation the conserved tetrameric organization remains poorly understood.</p><p>Here, we describe a mechanism for the regulatory motor-to-tail interaction within the homotetrameric kinesin-5 motor and its fundamental role during MT sliding motility. Using biochemical methods, we show that the kinesin-5 tail domain decreases MT-stimulated ATP hydrolysis by binding and stabilizing the motor domain in its ADP or nucleotide-free states. Cryo-EM structures reveal that the KLP61F tail stabilizes the open conformation of the motor by binding its N-terminal subdomain via the α0-helix element located at its tip. We show that human Eg5 motors undergo very slow motility and form clusters along individual MTs, whereas deletion of the tail domain causes Eg5 to undergo rapid motility without clustering along individual MTs. Single-motor fluorescence tracking in MT sliding assays show that Eg5 motors undergo slowed unidirectional motility within active sliding zones, while tail-deleted Eg5 motors undergo rapid motility with frequent switches in direction along the antiparallel MTs within sliding zones. Optical trapping and MT sliding assays reveal that the tail is essential for zippering two MTs into sliding zones through its capacity to generate high pushing forces. In cells, tail-deletion leads to a loss of human Eg5 mitotic spindle localization in mammalian cells while retaining MT binding capability. These studies suggest a revised model for kinesin-5-mediated MT sliding in which the tail domain slows MT-stimulated ATP hydrolysis at each end of the homotetramer and enhance force production essential for MT sliding.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>The kinesin-5 tail domain decreases motor domain MT-stimulated ATP hydrolysis</title><p>To better understand the role of the tail domain on kinesin-5 function, we first evaluated the effect of the tail domain on MT-stimulated ATP hydrolysis by the kinesin-5 motor domain. To circumvent the added complexity of MT crosslinking and sliding of the full length protein (<xref ref-type="fig" rid="fig1">Figure 1A</xref>), we generated constructs consisting of the motor-neck-linker domains (termed ‘motor’; residues 1–356), the isolated tail (termed ‘tail’; residues 913–1056), and a fusion construct in which the motor-neck-linker is linked at its C-terminus to the tail via an 8-residue linker (termed ‘motor-tail fusion’) (<xref ref-type="fig" rid="fig1">Figure 1B–D</xref>). We generated and studied both human-Eg5 and Dm-KLP61F constructs in parallel to characterize the conservation of features across these two well-studied orthologs (<xref ref-type="table" rid="table1">Table 1</xref>; <xref ref-type="fig" rid="fig1">Figure 1B–D</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1K–M</xref>). For these assays, increasing levels of MTs were added to the motor, to a mixture of motor and tail, or to the motor-tail fusion and resulting MT stimulated ATP hydrolysis rates were measured (Materials and methods; <xref ref-type="fig" rid="fig1">Figure 1B–D</xref>). The KLP61F motors robustly hydrolyzed ATP in response to increasing amounts of MTs (k<sub>cat</sub>7.1 s<sup>−1</sup> and K<sub>m</sub>680 nM; <xref ref-type="fig" rid="fig1">Figure 1B</xref>; <xref ref-type="table" rid="table1">Table 1</xref>). The addition of equimolar KLP61F tail to a mixture of the motor and MTs led to a two-fold decrease in k<sub>cat</sub> (3.5 s<sup>−1</sup> vs 7.1 s<sup>−1</sup>) but produced little change in K<sub>m</sub> (756 nM vs 680 nM) suggesting that the tail does not competitively interfere with motor-MT binding but rather modulates MT-stimulated ATP hydrolysis (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). The motor-tail fusion exhibited a 2.2-fold decrease in k<sub>cat</sub> compared to the motor alone (3.4 s<sup>−1</sup> vs 7.1 s<sup>−1</sup>) and a 15-fold decrease in K<sub>m</sub> compared to that for the motor alone (39 nM vs 680 nM) (<xref ref-type="fig" rid="fig1">Figure 1D</xref>). We observed similar behavior for human Eg5 motor and tail constructs. Although, the Eg5 motor displays an eight-fold increase in K<sub>m</sub> compared to KLP61F motor at 50 mM K-acetate condition (3849 nM vs 680) suggesting the Eg5 motor is slightly sensitive to ionic strength. Therefore, we studied Eg5 constructs at both 20 mM KCl and 50 mM K-acetate ionic strength conditions. At 20 mM KCl condition, the Eg5 tail decreases the MT stimulated Eg5 motor ATP hydrolysis rate by 32% compared to Eg5 motor alone (K<sub>cat</sub>7.6 s<sup>−1</sup> vs 5.3 s<sup>-</sup>’;<xref ref-type="table" rid="table1">Table 1</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1K</xref>). The decrease in homogeneous solubility of the Eg5 tail construct compared to the KLP61F tail is likely responsible for this mild decrease in MT-stimulated ATPase. An Eg5 motor-tail fusion construct exhibited a two-fold decrease in MT-stimulated ATPase K<sub>cat</sub> (3.47 s<sup>−1</sup> vs 7.55 s<sup>−1</sup>) nearly identical to a parallel construct for Klp61F (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1L</xref>). The tail-induced decrease in MT-stimulated ATPase activity, however, was somewhat reduced at a 50 mM K-acetate condition (5.71 s<sup>−1</sup> vs 6.81 s<sup>−1</sup>; <xref ref-type="table" rid="table1">Table 1</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1M</xref>), suggesting that in this condition the tail-to-motor regulation is weakened (see next section). Our studies reveal that the kinesin-5 tail domain decreases the MT-stimulated ATP hydrolysis rate of the motor domain in either an isolated or a fused configuration and that this feature is conserved across human Eg5 and Dm-KLP61F.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>The kinesin-5 tail domain inhibits the motor domain MT-stimulated ATPase activity through stabilization of the MT bound nucleotide-free state.</title><p>(<bold>A</bold>) Top, domain organization for the kinesin-5 motors, Dm KLP61F and Hs FL-Eg5 consisting of conserved N-terminal motor domain, central BASS domain and C-terminal tail domain. Bottom, homotetrameric organization of kinesin-5. (<bold>B</bold>) Steady-state MT-stimulated ATP hydrolysis for KLP61F motor. (N = 2) (<bold>C</bold>) Steady state MT stimulated ATP hydrolysis for equimolar KLP61F motor + tail constructs. (N = 2) (<bold>D</bold>) Steady state MT stimulated ATP hydrolysis for KLP61F motor-tail fusion. (N = 2) (<bold>E</bold>) Affinity co-purification of the KLP61F motor using the KLP61F tail-StrepII trapping one of three nucleotide states conditions. Top panel, SDS-PAGE for each condition: 5 μmol motor + tail mixture is loaded onto Streptactin XT resin (Load), flow-through fraction (FL) and biotin elution fraction (elute) are shown. Left lanes, incubation of motor + tail with non-hydrolysable ATP-analog, 2 mM AMPPNP. Center lanes, incubation of motor + tail with 2 mM ADP. Right lanes, incubation of motor + tail in the presence of 2 U Apyrase resulting in a nucleotide free state. Bottom panel, quantitative densitometry reveals the molar ratios of motor to tail in the elution fractions at 25 mM KCl (yellow column) and 75 mM KCl (blue columns) buffer conditions (N = 3, n = 6 for each column). (<bold>F</bold>) MT co-sedimentation assays of the KLP61F motor (motor) and tail domain (tail) with MTs (MT) in the presence of non-hydrolysable analog, 2 mM AMPPNP at 25 mM KCl. Co-sedimentation was carried out with MTs for 0.01, 0.025, 0.05, 0.1,0.25 μmol motor and tail mixture at 25 mM KCl conditions, and in the absence of MTs (-MT) control. Additional data are shown in <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>. (<bold>G</bold>) MT co-sedimentation assays of the KLP61F motor (motor) and tail domain (tail) with MTs (MT) in the presence of 2 mM ADP at 25 mM KCl. Co-sedimentation was carried out with MTs for 0.01, 0.025, 0.05, 0.1,0.25 μmol motor and tail mixture at 25 mM KCl condition and in the absence of MTs (-MT) control. Additional data are shown in <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>. (<bold>H</bold>) MT co-sedimentation assays of the KLP61F motor (motor) and tail domain (tail) with MTs (MT) in the nucleotide-free state, achieved by adding 10 U of Apyrase. Co-sedimentation was carried out with MTs for 0.01, 0.025, 0.05, 0.1,0.25 μmol motor and tail mixture at 25 mM KCl conditions and in the absence of MTs (-MT) control. Detailed and additional data are shown in <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1E</xref>. (<bold>I</bold>) Molar ratios of motor to tubulin monomer (blue) and tail to tubulin dimer (green) measured using quantitative densitometry (Materials and methods). The motor-to-tubulin ratios observed at 75 mM KCl are roughly 0.5 and the amount of tail bound to the motor increases in the ADP and Nucleotide-free states increases in the 25 mM KCl compared to the 75 mM KCl conditions. The amount of tail bound to motor remain low in the AMPPNP and ADP.AlF4 states compared to the ADP and nucleotide-free states. (<bold>J</bold>) Summary of data presented resulting in a model for motor (green) and tail (blue) domain affinities and MT (blue and pink) binding capacities in four nucleotide states during the ATP hydrolysis cycle.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig1-v2.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>The kinesin-5 tail domain inhibits motor domain MT-stimulated ATPase activity through stabilization of ADP-bound and nucleotide-free state.</title><p>(<bold>A</bold>) Affinity co-purification of the KLP61F motor using the tail-StrepII construct in solution in the presence of three nucleotide states at 15 μmol mixture of motor+ tail-StrepII, which is three-fold higher than data shown in <xref ref-type="fig" rid="fig1">Figure 1E</xref>. (<bold>B</bold>) MT co-sedimentation assays of the KLP61F motor (motor) and tail domain (tail) at 0.01, 0.25, 0.05,0.1,0.25 μmol with MTs (tubulin) in the presence of non-hydrolysable analog, 2 mM AMPPNP separated into pellet (left) and supernatant (right) fractions at 75 mM KCl (top panel) and 25 mM KCl (bottom panel). (<bold>C</bold>) MT co-sedimentation assays of the KLP61F motor (motor) and tail domain (tail) at 0.01, 0.25, 0.05,0.1,0.25 μmol with MTs (tubulin) in the presence of non-hydrolysable analog, 2 mM ADP.AlF4, mimicking the ADP.Pi state separated into pellet (left) and supernatant (right) fractions at 75 mM KCl (top panel) and 25 mM KCl (bottom panel). (<bold>D</bold>) MT co-sedimentation assays of the KLP61F motor (motor) and tail domain (tail) at 0.01, 0.25, 0.05,0.1,0.25 μmol with MTs (tubulin) in the presence of the 2 mM ADP separated into pellet (left) and supernatant (right) fractions at 75 mM KCl (top panel) and 25 mM KCl (bottom panel). (<bold>E</bold>) MT co-sedimentation assays of the KLP61F motor (motor) and tail domain (tail) at 0.01, 0.25, 0.05,0.1,0.25 μmol with MTs (tubulin) in the nucleotide-free state, formed by adding 10 U of Apyrase and were separated into pellet (left) and supernatant (right) fractions at 75 mM KCl (top panel) and 25 mM KCl (bottom panel). (<bold>F</bold>) MT co-sedimentation assays of the KLP61F tail domain (tail) with MTs (tubulin) in the presence of 2 mM ADP at 75 mM KCl (top panel) and 25 mM KCl (lower panel). (<bold>G</bold>) MT co-sedimentation assays of the KLP61F motor domain (motor) with MTs (tubulin) in the presence of ADP at 75 mM KCl (top panel) and 25 mM KCl (lower panel). (<bold>H</bold>) The measured motor to tubulin (-tail) and tail to tubulin (-motor) molar ratios calculated using densitometry of SDS-PAGE data revealing thatthey saturate at ~1.0 and 0.5 per tubulin dimer, respectively. (<bold>I</bold>) Top panel, MT co-sedimentation of the human Eg5 motor domain (Eg5 motor) and tail domain (Eg5 tail) at 0.01, 0.025, 0.05, 0.1,0.25, 0.5 μmol mixture with MTs (tubulin) in the presence of 2 mM ADP. Note, the Eg5 tail domain shows a minor degradation form which also behaves in a similar manner to the tail construct (marked by *tail). Bottom panel, MT co-sedimentation assays of the human Eg5 motor domain (Eg5 motor) and tail domain (Eg5 tail) at 0.01, 0.025, 0.05, 0.1,0.25, 0.5 μmol mixtures with MTs (tubulin) with MTs (tubulin) in the presence of 2 mM AMPPNP. MT bound Pellet fraction (left) and soluble supernatant (right) are shown. Note, in the AMPPNP state the motor binds tightly while the tail is not found in the Pellet fraction. (<bold>J</bold>) Left panel, quantitative densitometry of the molar ratios of Eg5 motor/tubulin (blue) and tail/tubulin (green). These data show that the ratios are similar to the KLP61F experiments with lower binding stoichiometry in the AMPPNP state than the nucleotide-free and ADP states. (<bold>K</bold>) Top panel, schemes for Eg5 motor and tail constructs. Bottom panel, Steady state ATP hydrolysis for Eg5 motor (blue) and equimolar Eg5-motor + tail constructs (green) with increasing MT concentrations at 20 mM KCl condition (<xref ref-type="table" rid="table1">Table 1</xref>). (<bold>L</bold>) Top panel, schemes for Eg5 motor and Eg5-motor-tail fusion constructs. Bottom panel, steady state ATP hydrolysis for Eg5 motor (blue) and Eg5-motor-tail fusion constructs (red) with increasing MT concentrations at 20 mM KCl condition. Note the similarity of this data to the KLP61F data for a similar construct in <xref ref-type="fig" rid="fig1">Figure 1D</xref>. (<xref ref-type="table" rid="table1">Table 1</xref>). (<bold>M</bold>) Top panel, schemes for Eg5 motor and Eg5-motor-tail fusion constructs. Bottom panel, steady state ATP hydrolysis for Eg5 motor (blue) and Eg5-motor-tail fusion constructs (red) with increasing MT concentrations at 50 mM K-Acetate condition. Note the less severe decrease in ATPase in the Eg5.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig1-figsupp1-v2.tif"/></fig></fig-group><table-wrap id="table1" position="float"><label>Table 1.</label><caption><title>Steady kinetic parameters for MT-activated ATP hydrolysis.</title></caption><table frame="hsides" rules="groups"><thead><tr><th valign="top">Construct</th><th valign="top">Source</th><th valign="top">Ionic Strength</th><th valign="top">k<sub>cat</sub> (sec<sup>−1</sup>)</th><th valign="top">K<sub>0.5,MT</sub> (nM)</th></tr></thead><tbody><tr><td valign="top">Motor</td><td valign="top"><italic>Dm KLP61F</italic></td><td valign="top">50 mM K Acetate</td><td valign="top">7.1 ± 0.1</td><td valign="top">680 ± 48</td></tr><tr><td valign="top">Motor + Tail</td><td valign="top"><italic>Dm KLP61F</italic></td><td valign="top">50 mM K Acetate</td><td valign="top">3.5 ± 0.5</td><td valign="top">757 ± 327</td></tr><tr><td valign="top">Motor-Tail fusion</td><td valign="top"><italic>Dm KLP61F</italic></td><td valign="top">50 mM K Acetate</td><td valign="top">3.3 ± 0.1</td><td valign="top">39 ± 11</td></tr><tr><td valign="top">Motor</td><td valign="top">Hs Eg5</td><td valign="top">20 mM KCl</td><td valign="top">7.3 ± 0.2</td><td valign="top">334 ± 14</td></tr><tr><td valign="top">Motor-Tail fusion</td><td valign="top">Hs Eg5</td><td valign="top">20 mM KCl</td><td valign="top">3.4 ± 0.2</td><td valign="top">158 ± 41</td></tr><tr><td valign="top">Motor + Tail</td><td valign="top">Hs Eg5</td><td valign="top">20 mM KCl</td><td valign="top">5.4 ± 0.3</td><td valign="top">209 ± 56</td></tr><tr><td valign="top">Motor</td><td valign="top">Hs Eg5</td><td valign="top">50 mM K Acetate</td><td valign="top">6.71 ± 0.7</td><td valign="top">3849 ± 800</td></tr><tr><td valign="top">Motor-Tail fusion</td><td valign="top">Hs Eg5</td><td valign="top">50 mM K Acetate</td><td valign="top">5.87 ± 0.23</td><td valign="top">391 ± 59</td></tr></tbody></table></table-wrap></sec><sec id="s2-2"><title>The tail domain binds the motor domain in the ADP or nucleotide-free states</title><p>To understand the biochemical basis for the kinesin-5 tail-mediated regulation of motor domain MT-stimulated ATP hydrolysis, we studied the binding of kinesin-5 motor domain with and without the MT lattice. First, we measured the capacity of the motor domain to co-purify and co-elute with a C-terminally strep-II tagged KLP61F tail domain construct onto streptactin XT resin (See Materials and methods; <xref ref-type="fig" rid="fig1">Figure 1E</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>). We compared the binding activities at two ionic strength conditions (25 and 75 mM KCl) for which motility assays indicated distinct modes of tail-dependent motility regulation (see below; Figures 3–4). We also tested how the binding is influenced by distinct nucleotides that trap the motor domain in different steps of the ATP hydrolysis cycle (<xref ref-type="fig" rid="fig1">Figure 1E</xref>). At 25 mM KCl, the motor co-eluted with the tail in the 2 mM ADP and in the nucleotide free state (in presence of Apyrase enzyme) but very poorly co-eluted with the tail in the presence of 2 mM AMPPNP (<xref ref-type="fig" rid="fig1">Figure 1E</xref>). Furthermore, the proportion of Klp61F motor co-eluting with the tail decreased dramatically at 75 mM KCl conditions (<xref ref-type="fig" rid="fig1">Figure 1E</xref>). Higher concentration of motor and tail did not change the molar ratio of the eluting proteins (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>).</p><p>Next, we reconstituted binding of the Klp61F and Eg5 motor and tail constructs onto Paclitaxel-stabilized MTs in different nucleotide state conditions and analyzed the binding using MT co-sedimentation assays (<xref ref-type="fig" rid="fig1">Figure 1F–I</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B–H</xref>). We again used conditions that mimic each step of the kinesin ATP hydrolysis cycle (<xref ref-type="fig" rid="fig1">Figure 1F–I</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B–H</xref>). We also compared the binding activities at two ionic strength conditions (25 and 75 mM KCl) as described above. The KLP61F tail and motor individually bound MTs in the presence of 2 mM ADP, as has been shown previously (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1G–H</xref>; <xref ref-type="bibr" rid="bib63">Weinger et al., 2011</xref>). The molar ratio of the bound tail and motor to MTs (polymerized tubulin) are roughly ~0.5 and~1 per αβ-tubulin at 25 mM KCl and decreased at 75 mM KCl (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1F,H</xref>). MT co-sedimentation of motor and tail together in the presence of 2 mM AMPPNP or ADP.AlF4 revealed that the tail is displaced from MTs, while the motor bound with high affinity to saturation (<xref ref-type="fig" rid="fig1">Figure 1F</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B–C</xref>). Even at the lowest molar ratio of motor to MTs, where there is an abundance of unoccupied MT lattice sites, the tail does not co-sediment with MTs and does not compete with the motor for MT binding sites.</p><p>In the ADP and nucleotide free states, the KLP61F motor domain recruits the tail domain more effectively to the MT lattice despite the different motor affinities for MTs. In the presence of 2 mM ADP, the motor binds MTs with low affinity in a concentration-dependent manner, and its binding molar ratio is higher at 25 mM KCl compared to 75 mM KCl (<xref ref-type="fig" rid="fig1">Figure 1G</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>). At 25 mM KCl, a higher amount of motor binds MTs, resulting in a higher amounts of tail being recruited into the pellet, approaching a molar ratio of ~1 motor per αβ-tubulin MT lattice site (<xref ref-type="fig" rid="fig1">Figure 1G</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>). At 75 mM KCl, both motor and tail amounts bound to MTs decreased and their molar ratio decreased (<xref ref-type="fig" rid="fig1">Figure 1I</xref>). MT co-sedimentation in the presence of apyrase (1 U/ml) to promote thenucleotide-free state of the motor revealed a high affinity of the motor for MTs at both 25 and 75 mM KCl (<xref ref-type="fig" rid="fig1">Figure 1H</xref>). Under the nucleotide-free condition, higher levels of tail are recruited in a manner that correlates with the amount of motor bound to MT in the pellet fraction (<xref ref-type="fig" rid="fig1">Figure 1I</xref>). Quantitative densitometry analyses indicates the molar ratios of tail recruited to the MT-bound fraction are highest in the ADP and nucleotide-free state in contrast to the AMPPNP and ADP.AlF4 states (<xref ref-type="fig" rid="fig1">Figure 1I</xref>). We studied analogous human Eg5 motor and tail constructs in the AMPPNP, ADP, and nucleotide free states which revealed essentially similar patterns of behavior to those described above for KLP61F (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1I–J</xref>). The human Eg5 motor recruits the Eg5 tail to the MT-bound fraction in the presence of 2 mM ADP. Despite the high affinity of the Eg5 motor for MTs in the presence of 2 mM AMPPNP, the tail remains unbound and in the soluble fraction (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1H–J</xref>). This suggest that the Eg5 tail binds to Eg5 motor in the presence of 2 mM ADP, but its binding to the Eg5 motor in presence of 2 mM AMPPNP is similar but weaker than the KLP61F tail (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1I–J</xref>). Together, our studies revealed that the ATP and ADP.Pi states of the kinesin-5 motor domains exhibit a high binding affinity for MTs, but a low affinity for the tail domain, while also displacing the isolated tail from MTs. In contrast, in the ADP and nucleotide-free states the kinesin-5 motor exhibits increased affinity for the tail, leading the tail to be recruited to the MT bound fraction despite the difference in the motor-MT affinity in these two states (<xref ref-type="fig" rid="fig1">Figure 1J</xref>).</p></sec><sec id="s2-3"><title>Cryo-EM structure reveals the tail domain stabilizes an open active site conformation of the motor domain</title><p>We used cryo-electron microscopy (cryo-EM) to investigate the kinesin-5 tail-motor interface and its role in motor mediated ATP hydrolysis. We collected cryo-EM images of KLP61F motor decorated onto MTs in the AMPPNP state, and the KLP61F motor and tail decorated onto MTs in the nucleotide free state. Class averages for the MT-decorated segments in the two states clearly revealed repeating motordensities decorating the MT lattice sites (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). New and previously described image analysis strategies (see Materials and methods) were used to calculate and refine structures of MTs decorated with the KLP61F motor in the AMPPNP state and the KLP61F motor and tail complex in the nucleotide-free state to ~4.4 Å. We adopted a new strategy to apply local classification to the motor and tail densities in the nucleotide free state, which involved classifying small patch of the MT lattice (Materials and methods). Only 70% of the data were utilized for this refinement step (Materials and methods). However, this new strategy generally improved the resolution of the motor domain density but did not enhance the occupancy or resolution for the tail (<xref ref-type="fig" rid="fig2">Figure 2A–F</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A–C</xref>; <xref ref-type="table" rid="table2">Table 2</xref>; see Materials and methods). Additional density, which we attribute to the tail domain, is observed on top of the motor domain in the nucleotide-free motor and tail-decorated MTs. Despite the size of the tail domain (80–100 residues), this density is small and accounts for only about one third of this mass (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1B–C,H</xref>). This suggests that two thirds of the tail is either unstructured, or forms a flexibly attached and separate domain; a major part of the tail region is rendered invisible after averaging. Furthermore, the density attributed to the tail region cannot be interpreted in terms of secondary structure as there is a substantial drop in the resolution to ~8 Å at the motor-tail interface (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1B–C</xref>; <xref ref-type="video" rid="video1">Video 1</xref>). In keeping with the biochemical data, we do not observe any ordered additional density on the MT lattice, consistent with the idea that the tail does not bind the MT lattice in the presence of the motor domain. Overall, the data strongly suggest that the tail interacts loosely with the underlying motor domain, binding directly to its α0 helix hairpin element, located on its MT minus end facing side (<xref ref-type="fig" rid="fig2">Figure 2D–F</xref>). Comparison of the KLP61F motor AMPPNP structure with the motor-tail nucleotide-free structure revealed conformational changes within the motor domain leading a major rotation in the α0 helix hairpin (<xref ref-type="fig" rid="fig2">Figure 2D–F</xref>; <xref ref-type="video" rid="video1">Video 1</xref>), and suggests how elements of the nucleotide-free state form an effective binding site for the tail (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). One end of the α0 helix is connected to the phosphate binding loop (p-loop) (<xref ref-type="fig" rid="fig2">Figure 2G</xref>) and allows possible feedback between the nucleotide pocket and the tail binding site.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Cryo-EM reveals the kinesin-5 tail engages the motor domain in the nucleotide-free state and stabilizes an open ATP active site.</title><p>(<bold>A-C</bold>) (<bold>A</bold>) Side view of 4.0 Å cryo-EM structure of Klp61F motor domain decorated MT unit in the AMPPNP state. A single kinesin motor-bound αβ-tubulin unit is shown. The segmented motor domain (yellow) and α-tubulin (cyan) and β-tubulin (green) densities are sown. (<bold>B</bold>) <italic>De novo</italic> built KLP61F motor domain model in the AMPPNP state (red) displayed within the motor domain density. The αβ-tubulin dimer model fitted into the αβ-tubulin density (green and cyan). (<bold>C</bold>) Top end view of the kinesin-5 motor density map with the MT density computationally removed. (<bold>D-F</bold>) (<bold>D</bold>) Side view of 4.0 Å cryo-EM structure of Klp61F motor and tail domains decorated onto MTs in the nucleotide-free state obtained using well-established and refined with new strategies (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A–C</xref>; see Materials and methods). The kinesin-motor + tail bound to a single αβ-tubulin unit is shown. Segmentation of the motor domain (yellow), tail domain is shown (blue), α-tubulin (cyan) and β-tubulin (green). (<bold>E</bold>) <italic>De novo</italic> built Klp61F motor domain model in the nucleotide-free state (orange) displayed within the motor domain density and the tail density (dark blue). The αβ-tubulin dimer fitted into the αβ-tubulin density (green and cyan). (<bold>F</bold>) Top-end view of the docked kinesin-5 motor and tail density with the MT density computationally removed. (<bold>G</bold>) Conformational transition of Klp61F motor domain from nucleotide-free (light gray) to AMPPNP (dark gray). The elements that undergo the most change in colors: α6 (blue), α2 (yellow), p-loop (green) and α0 helix (red). (<bold>I-J</bold>) Two views of the Klp61F AMPPNP and nucleotide-free motor domain models describing the movements of motor with N-terminal subdomain (deep blue, nucleotide-free (nuc.-free); light blue, AMPPNP) and Upper subdomain (deep pink, nucleotide-free; light pink, AMPPNP) around the α4-helix, L11 switch II (swII) MT bound subdomain (deep red, nucleotide-free; light red, AMPPNP). The switch I (swI) changes conformation in response to ATP binding. The N-terminal subdomain rotation leads to a 20° rotation of the α0-helix closer to the MT surface in the AMPPNP state. The tail binds the α0-helix in the nucleotide-free state. H) Side-view of the Klp61F motor domain maps in AMPPNP (red) compared to the nucleotide-free state model (orange) docked into the nucleotide free-state motor density with the tail density shown in blue.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Cryo-EM reveals the kinesin-5 tail domain engages the motor domain directly through the α0-helix and stabilizes an open ATP active site.</title><p>(<bold>A</bold>) Top panel (I): Colores view of the Klp61F motor MT AMPPNP map, colored based on resolution scale. Bottom Panel (II): A gold standard Fourier Shell correlation (FSC) curve for the MT-decorated Klp61F motor -AMPPNP state revealing an overall resolution of 4.4 Å. (<bold>B</bold>) Top panel (I): Colores view of the Klp61F motor + tail nucleotide-free MT decorated map colored based on resolution scale. Note the small size of the tail region. Bottom Panel (II); A gold standard Fourier Shell correlation (FSC) curve for the MT decorated Klp61F motor nucleotide-free map state revealing an overall resolution of 4.4 Å. (<bold>C</bold>) Top panel (I): Colores view of the Klp61F motor + tail nucleotide-free MT decorated map after MT-patch refinement (see Materials and methods). Note the increased size of the tail region but its low 8 Å resolution. The motor density resolution improved through the refinement procedure. Bottom Panel (II); A gold standard Fourier Shell correlation (FSC) curve for the MT-decorated Klp61F motor and tail in the nucleotide-free state revealing an overall resolution of 4.0 Å. (<bold>D</bold>) Close-up views of the motor domain active site in the AMPPNP state (left), nucleotide-free state (middle) and both states overlaid (overlay, right) with nucleotide-free state elements in faded colors. These views highligh switch II (swII; red), switch I loop (swI; pink) and the α0 helix hairpin(α0; blue). The right (overlay) panel shows the direction of displacement (in Å) between the AMPPNP and nucleotide free states. (<bold>E</bold>) Class averages of the Klp61F motor AMPPNP decorated MTs (AMPPNP top), and the Klp61F motor + tail nucleotide-free state decorated MTs (Nucleotide-free bottom). Right panels, top, a single AMPPNP motor-decorated MT, compared to nucleotide-free motor + tail decorated MT density is extracted and magnified. These reveal the general conformational changes of the motor domain and average density for the tail around the single binding site on the backside of the motor domain. (<bold>F</bold>) An overlay of the kinesin-5 motor, three subdomains highlighted, nucleotide-free state model to the kinesin-1 ATP-like state in faded highlighted subdomains revealing the conformational change in the α0 helix in kinesin-5 compared to the kinesin-1 ATP state. Loops L6 and L8 are seen at unique conformations compared to kinesin-1 and are labeled with black arrows. (<bold>G</bold>) An overlay of the kinesin-5 subdomain nucleotide-free model to the kinesin-1 nucleotide-free state model revealing the nearly identical conformation of α0 helix. Loops L6 and L8 are seen at a unique conformation compared to kinesin-1 and are labeled with black arrows. (<bold>H</bold>) View of the raw kinesin-5 motor tail nucleotide free map after patch refinement (as seen in panel <bold>C</bold>) with the segmentation for the map shown in the middle motor domain. Motor domain is shown in yellow; tail domain is shown in blue while α and β-tubulin are shown in cyan and green, respectively.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig2-figsupp1-v2.tif"/></fig></fig-group><table-wrap id="table2" position="float"><label>Table 2.</label><caption><title>Cryo-EM KLp61F motor and tail MT structures: collection and reconstruction.</title></caption><table frame="hsides" rules="groups"><thead><tr><th valign="top"/><th valign="top">Dm Klp61F motor-AMPPNP <break/>(15 protofilaments)</th><th valign="top">Dm Klp61F- motor AMPPNP <break/>(14 protofilaments)</th><th valign="top">Dm KLP61F motor-tail- nucleotide free <break/>(15 protofilaments)</th><th valign="top">Dm Klp61F5 <break/>motor-tail-nucleotide free <break/>(14-protofilaments)</th></tr></thead><tbody><tr><th valign="top">Data collection</th><td valign="top"/><td valign="top"/><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Microscope</td><td valign="top">Titan Krios (FEI)</td><td valign="top">Titan Krios (FEI)</td><td valign="top">Titan Krios (FEI)</td><td valign="top">Titan Krios (FEI)</td></tr><tr><td valign="top">Voltage (kV)</td><td valign="top">300</td><td valign="top">300</td><td valign="top">300</td><td valign="top">300</td></tr><tr><td valign="top">Ls</td><td valign="top">22,500X</td><td valign="top">22,500X</td><td valign="top">22,500X</td><td valign="top">22,500X</td></tr><tr><td valign="top">Cumulative exposure dose (e<sup>-</sup> Å<sup>−2</sup>)</td><td valign="top">38</td><td valign="top">38</td><td valign="top">40</td><td valign="top">40</td></tr><tr><td valign="top">Exposure rate (e<sup>-</sup>/pixel/sec)</td><td valign="top">7.9</td><td valign="top">7.9</td><td valign="top">8.3</td><td valign="top">8.3</td></tr><tr><td valign="top">Detector</td><td valign="top">K2 Summit</td><td valign="top">K2 Summit</td><td valign="top">K2 Summit</td><td valign="top">K2 Summit</td></tr><tr><td valign="top">Pixel size (Å)*</td><td valign="top">1.31</td><td valign="top">1.31</td><td valign="top">1.31</td><td valign="top">1.31</td></tr><tr><td valign="top">Defocus range (µm)</td><td valign="top">0.3–3.78</td><td valign="top">0.7–3.78</td><td valign="top">0.19–5.12</td><td valign="top">0.19–5.12</td></tr><tr><td valign="top">Average defocus (m)</td><td valign="top">1.75</td><td valign="top">1.75</td><td valign="top">1.86</td><td valign="top">1.86</td></tr><tr><td valign="top">Micrographs Used</td><td valign="top">1260</td><td valign="top">1260</td><td valign="top">955</td><td valign="top">955</td></tr><tr><td valign="top">Total extracted helical segment (no.)</td><td valign="top">73,451</td><td valign="top">73,451</td><td valign="top">44,081</td><td valign="top">44,081</td></tr><tr><td valign="top">Refined helical segment (no.)</td><td valign="top">21,004</td><td valign="top">39,001</td><td valign="top">9490</td><td valign="top">27,433</td></tr><tr><th valign="top">Reconstruction</th><td valign="top"/><td valign="top"/><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Final helical segments (no.)</td><td valign="top">21,004</td><td valign="top">39,220</td><td valign="top">9490</td><td valign="top">14,570</td></tr><tr><td valign="top">Symmetry imposed</td><td valign="top">HP</td><td valign="top">HP</td><td valign="top">HP</td><td valign="top">HP</td></tr><tr><td valign="top">Resolution (global) FSC 0.143</td><td valign="top">4.2</td><td valign="top">4.4</td><td valign="top">4.2</td><td valign="top">4.3</td></tr></tbody></table></table-wrap><media id="video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-51131-video1.mp4"><label>Video 1.</label><caption><title>Structural transition of the kinesin-5 motor domain from AMPPNP to nucleotide state and its effect on binding of the tail domain.</title><p>View of the kinesin-5 motor domain map with AMPPNP showing the motor domain model, transition to the motor nucleotide state map showing the site of binding for the tail domain density, and model for the motor. Views of the two states using three motor subdomains and their conformational changes in the N-terminal subdomain (blue) and its effect on the ATP binding site and the rotation around the Upper subdomain (pink) and the MT bound subdomain (red).</p></caption></media><p>Model building for both the kinesin-5 AMPPNP and nucleotide-free motor domain structures revealed conformational changes in α0-helix hairpin that may regulate the affinity of the tail within the motor domain (<xref ref-type="table" rid="table3">Table 3</xref>; <xref ref-type="fig" rid="fig2">Figure 2C,F</xref>; <xref ref-type="video" rid="video1">Video 1</xref>). Compared to kinesin-1, the kinesin-5 motor structure revealed the conserved kinesin fold with two longer and reorganized class-specific L6 and L8 loops which form part of the motor MT-binding interface (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1E–F-G</xref>), similar to the map of the recently-determined <italic>S. pombe</italic> and <italic>U. maydis</italic> kinesin-5 motor domain structures (<xref ref-type="bibr" rid="bib61">von Loeffelholz and Moores, 2019</xref>; <xref ref-type="bibr" rid="bib60">von Loeffelholz et al., 2019</xref>). Structurally, the kinesin-5 motor domain can be divided to three subdomains, comparable to those seen in kinesin-1: the N-terminal subdomain, the upper subdomain, and the MT-binding subdomain (<xref ref-type="fig" rid="fig2">Figure 2FH-I</xref>; <xref ref-type="bibr" rid="bib7">Cao et al., 2014</xref>; <xref ref-type="bibr" rid="bib43">Shang et al., 2014</xref>). The MT-bound subdomain consists of the α4-helix L11 and L12, as described for kinesin-1 (<xref ref-type="fig" rid="fig2">Figure 2I–J</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1E–F-G</xref>; <xref ref-type="video" rid="video1">Video 1</xref>). As in kinesin-1, the N-terminal subdomain rotates around the MT-bound subdomain in the kinesin-5 nucleotide-free state, leading to a reorganization of the MT minus-end facing end of the motor (<xref ref-type="fig" rid="fig2">Figure 2H–I</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1F–G</xref>). In the nucleotide-free state, the N-terminal subdomain (blue) rotates upward with respect to the upper subdomain (pink) and the MT bound α4 helix (switch-II), and L11 (red) to open the switch I loop in the active site (<xref ref-type="fig" rid="fig2">Figure 2H–J</xref>). Compared to the AMPPNP state, the N-terminal subdomain in the nucleotide-free state rotates upward by 20° causing the α0-helix hairpin, which lies at its extreme tip, to move upward by 10 Å from the MT surface (<xref ref-type="fig" rid="fig2">Figure 2H–J</xref>; <xref ref-type="video" rid="video1">Video 1</xref>). This N-terminal subdomain rotation repositions the switch I, switch II, and P-loops, resulting in an open active site (<xref ref-type="fig" rid="fig2">Figure 2H–J</xref>), whereas in the AMPPNP state, the α0-helix is positioned downward and 10 Å closer to the MT lattice, (<xref ref-type="fig" rid="fig2">Figure 2H–J</xref>) due to ATP binding and active site closure. Our structures suggest that binding of the tail domain to the N-terminal subdomain likely stabilizes the upward α0-helix conformation which prevents the P-loop and switch I//II from engaging ATP (<xref ref-type="fig" rid="fig2">Figure 2J</xref>; <xref ref-type="video" rid="video1">Video 1</xref>). Our models suggest that the tail interface stabilizes this upward N-terminal subdomain motor conformation leading to a decrease in the ability of the active site to bind incoming ATP. This suggests that the motor-α0-helix may cycle between ‘on’ and ‘off’ states while binding the tail to result in a slower ATP hydrolysis cycle.</p><table-wrap id="table3" position="float"><label>Table 3.</label><caption><title>Cryo-EM refinement and Structure model statistics.</title></caption><table frame="hsides" rules="groups"><thead><tr><th valign="top"/><th valign="top">Dm-Klp61F motor AMPPNP-MT</th><th valign="top">Dm-Klp61F motor -Nucleotide free-MT</th></tr></thead><tbody><tr><th valign="top">Data collection</th><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Microscope/detector</td><td valign="top">Titan Krios/Gatan K2</td><td valign="top">Titan Krios/Gatan K2</td></tr><tr><td valign="top">Magnification</td><td valign="top">22,500x</td><td valign="top">22,500x</td></tr><tr><td valign="top">Voltage (keV)</td><td valign="top">300</td><td valign="top">300</td></tr><tr><td valign="top">Dose rate (electrons/pixel/second)</td><td valign="top">7.96</td><td valign="top">8.3</td></tr><tr><td valign="top">Pixel size (Å/pixel)</td><td valign="top">1.31</td><td valign="top">1.31</td></tr><tr><td valign="top">Map resolution (Å)</td><td valign="top">4.4</td><td valign="top">4.4</td></tr><tr><td valign="top">FSC threshold</td><td valign="top">0.143</td><td valign="top">0.143</td></tr><tr><th valign="top">Refinement</th><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Model resolution cutoff (Å)</td><td valign="top">4.4</td><td valign="top">4.4</td></tr><tr><td valign="top">FSC threshold</td><td valign="top">0.143</td><td valign="top">0.143</td></tr><tr><td valign="top">Protein residues</td><td valign="top">1173</td><td valign="top">1174</td></tr><tr><td valign="top">Ligands</td><td valign="top">3 (GTP/GDP/AMPPNP)</td><td valign="top">2 (GTP/GDP)</td></tr><tr><td valign="top">Map CC</td><td valign="top">0.8</td><td valign="top">0.78</td></tr><tr><td valign="top">B factor (Å)</td><td valign="top">216</td><td valign="top">208</td></tr><tr><th valign="top">R.M.S deviations</th><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Bond lengths (Å)</td><td valign="top">0.003</td><td valign="top">0.006</td></tr><tr><td valign="top">Bond angles (°)</td><td valign="top">0.53</td><td valign="top">1.14</td></tr><tr><th valign="top">Validation</th><td valign="top"/><td valign="top"/></tr><tr><td valign="top">All-atom clash score</td><td valign="top">14.05</td><td valign="top">11.71</td></tr><tr><td valign="top">MolProbity score</td><td valign="top">2.52</td><td valign="top">1.9</td></tr><tr><th valign="top">Ramachandran plot</th><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Favored (%)</td><td valign="top">96.19</td><td valign="top">94.65</td></tr><tr><td valign="top">Allowed (%)</td><td valign="top">3.81</td><td valign="top">5.18</td></tr><tr><td valign="top">Outliers (%)</td><td valign="top">0.00</td><td valign="top">0.17</td></tr></tbody></table></table-wrap></sec><sec id="s2-4"><title>The kinesin-5 tail domain decreases homotetramer velocity along single MTs</title><p>We next set out to examine the role of the tail to motor interface in kinesin-5 motility, we reconstituted the motility of homotetrameric human Eg5 motors along individual MTs. We studied two human Eg5 constructs that either contain or exclude the tail domain (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). We purified full-length Eg5 (termed FL-Eg5, residues 1–1056), full-length Eg5 with a C-terminal GFP (termed FL-Eg5-GFP), and mutant Eg5 with the tail domain deleted with a C-terminal GFP (termed Eg5-Δtail-GFP, residues 1–912) (<xref ref-type="fig" rid="fig3">Figure 3A–B</xref>). These motors were expressed in insect cells and purified using StrepII-tag affinity, followed by size exclusion chromatography (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–B</xref>; see Materials and methods). Deleting the tail domain does not alter the shape or the homotetrameric oligomerization of Eg5, as was described previously (<xref ref-type="bibr" rid="bib1">Acar et al., 2013</xref>; <xref ref-type="bibr" rid="bib63">Weinger et al., 2011</xref>; <xref ref-type="fig" rid="fig3">Figure 3B</xref>; <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–B</xref>). Using TIRF microscopy, we reconstituted FL-Eg5-GFP and Eg5-Δtail-GFP motility along GMPCPP or Paclitaxel-stabilized AlexaF-633 labeled MTs (<xref ref-type="fig" rid="fig3">Figure 3A</xref>, lower panel). Both FL-Eg5-GFP and Eg5-Δtail-GFP exhibited robust and processive motility along MTs in 25 mMHEPES pH 7.5 containing 25 to 100 mM KCl (<xref ref-type="fig" rid="fig3">Figure 3D–E</xref>; <xref ref-type="video" rid="video2">Video 2</xref>). The processive motility we observe in pH 7.5 condition is highly homogeneous in contrast to the non-processive diffusive motility that has been seen at 80 mM PIPES pH 6.8 (BRB-80) with a range of 0–100 mM KCl conditions (<xref ref-type="bibr" rid="bib29">Kapitein et al., 2008</xref>; <xref ref-type="bibr" rid="bib28">Kapitein et al., 2005</xref>; data not shown). These observations, coupled with previous work on other kinesin motors, suggest that buffer composition, which influences pH and ionic strength, is critical for observing robust Eg5 motor motility along single MTs and affects landing rates along MTs (<xref ref-type="bibr" rid="bib29">Kapitein et al., 2008</xref>).</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>The kinesin-5 tail domain decreases velocity for homotetrameric motors along MTs.</title><p>(<bold>A</bold>) Human Eg5 constructs used in reconstitution studies. Top panel, domain organization of FL-Eg5-GFP. Second panel, domain organization of Eg5-Δtail-GFP with its tail domain deleted (residues 920–1058) with the C-termini fused to monomeric superfolder GFP (msf-GFP). (<bold>B</bold>) The homotetrameric Eg5 organizations for the two constructs FL-Eg5-GFP and Eg5-Δtail-GFP, as described previously (<xref ref-type="bibr" rid="bib1">Acar et al., 2013</xref>). (<bold>C</bold>) Scheme for TIRF microscopy of Eg5 motors (green) undergoing motility along single surface anchored AlexaF-633 and biotin labeled MTs via neutravidin-biotin attachment (red). (<bold>D</bold>) Kymographs of FL-Eg5-GFP motor motility along MTs in 25, 50 and 100 mM KCl pH 7.5 condition. Kymographs in dual color showing MTs (red) and GFP channels (green) are shown. Left panel, FL-Eg5-GFP motors undergo extremely slow motility at 25 mM KCl motor and their particle intensities are generally uniform. Middle panel, FL-Eg5 GFP undergoes motility with increased velocity and exhibits visual variation in particle intensity. Right panel, FL-Eg5-GFP motor show motility with higher velocity and exhibit bright and dim intensity particles at 100 mM KCl. Note FL-Eg5-GFP motors accumulate at MT plus-ends in 25 mM KCl; this plus-end residence decreases at 50 and 100 mM KCl. (<bold>E</bold>) Kymographs of Eg5-Δtail-GFP motility along anchored MTs at 25, 50 and 100 mM KCl pH 7.5 condition. Kymographs in dual color showing MTs (red) and GFP channels (green) are shown. Eg5-Δtail-GFP motors exhibit motility at similar velocities in all conditions. Note the homogeneity in motor intensities for Eg5-Δtail-GFP and its rapid motility at 25 mM KCl in contrast to the very slow motility of FL-Eg5-GFP. Motor intensities are uniform for Eg5-Δtail-GFP at 25 mM KCl and remain mostly homogeneously dim at 100 mM KCl. Note all Eg5-Δtail-GFP accumulate at MT plus-ends in a salt dependent manner. (<bold>F</bold>) Top panel, histogram for FL-Eg5-GFP motile particle velocity to frequency distribution reveals homogeneous and very slow velocity 25 mM KCl. Middle panel, histogram for FL-Eg5-GFP motor velocity to frequency distribution at 50 mM KCl reveals a 3-fold higher velocity than at 25 mM KCl. Bottom panel, histogram for velocity frequency bi-modal distribution for FL-Eg5-GFP at 100 mM KCl. Right inset panels show Eg5 fluorescence intensity distribution for motile particles at 25 and100 mM kCl. The fitted trend lines are shown in blue and averages are shown above each peak. These reveal that the motors are homogeneous homotetramers at 25 mM KCl, but cluster into dimers and tetramers of homotetramers at 100 mM KCl. Statistical t-tests are shown in <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1F</xref>. (<bold>G</bold>) Top panel, histogram for Eg5-Δtail-GFP motor motile particle velocity to frequency distribution (blue) at 25 mM KCl condition, revealing a three-folds faster than FL-Eg5-GFP at 25 mM KCl. Middle panel, histogram of velocity to frequency Eg5-Δtail-GFP motor particle distribution at 50 mM KCl revealing little change in velocity. Bottom panel, histogram of velocity to frequency distribution Eg5-Δtail-GFP motor particle revealing a bi-modal trend at 100 mM KCl. The fitted trend lines are shown in red and averages are shown above each peak. Inset panels at 25 and 100 mM KCl show that Eg5-Δtail-GFP motor fluorescence intensity distribution remain mostly as single homotetramers at 25 and 100 mM KCl. Statistical t-tests are shown in <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1G</xref>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>The tail domain decreases the velocity of homotetrameric kinesin-5 motors along MTs.</title><p>(<bold>A</bold>) Right panel, Size exclusion chromatography (SEC) for recombinant FL-Eg5-GFP (red) and SDS-PAGE lane for peak fraction. Left panel, SEC for recombinant Eg5-Δtail-GFP and SDS-PAGE lane for peak fraction. (<bold>B</bold>) Two color TIRF Fields for surface anchored MTs (red) with FL-Eg5-GFP (left) and Eg5-Δtail-GFP (right) revealing the highly robust motility activity in these imaging conditions at pH 7.5 at 25–100 mM KCl. (<bold>C</bold>) Frequency distribution for motile Fl-Eg5-GFP (red) and Eg5-Δtail-GFP (blue) motor run length at 50 and 100 mM KCl. These were fit with logarithmic decay trend linestrend lines to determine the average run length values. The run length analyses reveal that Fl-Eg5-GFP retains processive motility in both 50 and 100 mM KCl conditions, in contrast to Eg5-Δtail-GFP which is processive at 50 mM KCl but shows a two-fold decrease in run lengths at 100 mM KCl. (<bold>D</bold>) Additional example kymographs for Fl-Eg5-GFP as shown in <xref ref-type="fig" rid="fig3">Figure 3D</xref>. (<bold>E</bold>) Additional example kymographs for Eg5-Δtail-GFP as shown in <xref ref-type="fig" rid="fig3">Figure 3E</xref>. (<bold>F</bold>) Statistical t-tests comparing the data shown in <xref ref-type="fig" rid="fig3">Figure 3F–G</xref>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig3-figsupp1-v2.tif"/></fig></fig-group><media id="video2" mime-subtype="mp4" mimetype="video" xlink:href="elife-51131-video2.mp4"><label>Video 2.</label><caption><title>Wide view of FL-Eg5-GFP and Eg5-Δtail-GFP (green) along single MTs (Red).</title></caption></media><p>We analyzed the motility properties of FL-Eg5-GFP and Eg5-Δtail-GFP motors at 25 mM HEPES pH 7.5 buffer conditions with added ionic strengths of 25, 50 and 100 mM KCl. At 25 mM KCl, FL-Eg5-GFP exhibited active yet extremely slow velocities (7 nm/s; <xref ref-type="table" rid="table4">Table 4</xref>; <xref ref-type="fig" rid="fig3">Figure 3D</xref>, left panel; <xref ref-type="video" rid="video3">Video 3</xref>), which was roughly four times lower than the velocity of Eg5-Δtail-GFP (31 nm/s; <xref ref-type="fig" rid="fig3">Figure 3E</xref>, left panel; <xref ref-type="video" rid="video2">Video 2</xref>). Quantitative analysis of motility events revealed mono-disperse distributions of velocities for the two motors that fit single Gaussians with single average values (<xref ref-type="fig" rid="fig3">Figure 3F–G</xref>, top panels). At 50 mM KCl, FL-Eg5-GFP exhibited a more than three-fold increase in average velocity (24 nm/s) compared to 25 mM KCl conditions (<xref ref-type="fig" rid="fig3">Figure 3D</xref>, middle panel). In contrast, Eg5-Δtail-GFP exhibited a nearly identical average velocity (35 nm/s) at 50 mM KCl, which is indistinguishable from what was observed at 25 mM KCl (<xref ref-type="table" rid="table4">Table 4</xref>; <xref ref-type="fig" rid="fig3">Figure 3G</xref>, middle panel). At 100 mM KCl, FL-Eg5-GFP motors exhibited two velocities (24 and 41 nm/s), with a bimodal distribution representing 60% and 40% of total, respectively (<xref ref-type="fig" rid="fig3">Figure 3D</xref> right panel; <xref ref-type="video" rid="video3">Video 3</xref>; <xref ref-type="fig" rid="fig3">Figure 3F</xref>, lower panel). Eg5-Δtail-GFP motors also exhibited two velocities at 100 mM KCl (36 nm/s and 55 nm/s) that were 20% higher than FL-Eg5-GFP and showed a similar bimodal distribution representing 85% and 15% of the total, respectively (<xref ref-type="table" rid="table4">Table 4</xref>; <xref ref-type="fig" rid="fig3">Figure 3D</xref> right panel; <xref ref-type="video" rid="video3">Video 3</xref>; <xref ref-type="fig" rid="fig3">Figure 3G</xref>, lower panel). At the 50 and 100 mM KCl conditions, fewer motor landing events were observed compared to 25 mM KCl (<xref ref-type="fig" rid="fig3">Figure 3D–E</xref>, right panels) for both FL-Eg5-GFP and Eg5-∆Tail-GFP. Thus, FL-Eg5 tetramers strongly respond to ionic strength, with 25 mM KCl significantly reducing its velocity, while Eg5-∆tail-GFP remains largely impervious to these effects. At 50 to 100 mM KCl, Eg5-Δtail-GFP consistently exhibited 20% higher velocities compared to FL-Eg5-GFP with bimodal distributions of slow and fast motors (<xref ref-type="table" rid="table4">Table 4</xref>).</p><table-wrap id="table4" position="float"><label>Table 4.</label><caption><title>Motility parameters for FL-Eg5-GFP and Eg5-Δtail-GFP along single MTs.</title></caption><table frame="hsides" rules="groups"><thead><tr><th valign="top">FL-Eg5-GFP</th><th valign="top">Motility (nm/s)</th><th valign="top">Motor Fluorescence (Au)</th><th valign="top">Run length (μm)</th></tr></thead><tbody><tr><td valign="top">25 mM KCl</td><td valign="top">7 ± 0.5 n = 149</td><td valign="top">1080 ± 30 n = 100</td><td valign="top">N/A</td></tr><tr><td valign="top">50 mM KCl</td><td valign="top">26 ± 4 n = 200</td><td valign="top">N/A</td><td valign="top">13.7 ± 0.6</td></tr><tr><td valign="top">100 mM KCl</td><td valign="top">26 ± 5 (60%) <break/>41 ± 4 (40%) n = 149</td><td valign="top">2277 ± 100 <break/>4467 ± 630 n = 92</td><td valign="top">13.08 ± 0.6</td></tr><tr><td valign="top">Eg5-Δtail-GFP</td><td valign="top"/><td valign="top"/><td valign="top"/></tr><tr><td valign="top">25 mM KCl</td><td valign="top">32 ± 5 n = 421</td><td valign="top">960 ± 20 n = 95</td><td valign="top">N/A</td></tr><tr><td valign="top">50 mM KCl</td><td valign="top">33 ± 4 n = 420</td><td valign="top">N/A</td><td valign="top">14.9 ± 0.6</td></tr><tr><td valign="top">100 mM KCl</td><td valign="top">36 ± 5 (85%) <break/>55 ± 10 (15%) n = 149</td><td valign="top">1450 ± 3 n = 95</td><td valign="top">8.0 ± 0.6</td></tr></tbody></table></table-wrap><media id="video3" mime-subtype="mp4" mimetype="video" xlink:href="elife-51131-video3.mp4"><label>Video 3.</label><caption><title>close up views of FL-Eg5-GFP (left) and Eg5-Δtail-GFP (right) along single MTs at 25, 50 and 100 mM KCl conditions.</title></caption></media><p>We next explored the potential for FL-Eg5-GFP and Eg5-Δtail-GFP motile particles to form higher-order oligomers and sought to determine whether they form clusters based on the relative fluorescence intensities of motile GFP-fused motors (<xref ref-type="fig" rid="fig3">Figure 3F–G</xref>, inset graphs). Kymographs show that FL-Eg5-GFP motors in 25 mM KCl and Eg5-Δtail-GFP motors in 25 and 100 mM KCl conditions exhibited a homogeneous distribution of low-intensity values that was well fit by a single Gaussian (<xref ref-type="fig" rid="fig3">Figure 3D–E</xref>, left panels; <xref ref-type="video" rid="video3">Video 3</xref>; <xref ref-type="table" rid="table4">Table 4</xref>; <xref ref-type="fig" rid="fig3">Figure 3F,G</xref> insert graphs in top panels). In contrast, FL-Eg5-GFP particles exhibited both bright and dim intensity value distributions and a bimodal intensity value distribution at 100 mM KCl (<xref ref-type="fig" rid="fig3">Figure 3D</xref>, right panel; <xref ref-type="video" rid="video3">Video 3</xref>) which can be fitted by two overlapping Gaussians. FL-Eg5-GFP particles displayed high intensity values that were on average four-fold higher than the dim motile particles observed at 25 mM KCl, and low intensity values that were roughly two-folds higher than the dim particles at 25 mM KCl (<xref ref-type="fig" rid="fig3">Figure 3F</xref>, insert graph in bottom panel; <xref ref-type="table" rid="table4">Table 4</xref>). Conversely, at 100 mM KCl, Eg5-Δtail-GFP motile particles exhibited a narrow intensity distribution that closely matched Eg5-Δtail-GFP motile particle distributions at 25 mM KCl (<xref ref-type="fig" rid="fig3">Figure 3G</xref>, insert graph in bottom panel; <xref ref-type="table" rid="table4">Table 4</xref>). Thus, FL-Eg5-GFP and Eg5-Δtail-GFP both show motility as homogeneous particles, likely individual homotetramers, with little clustering at 25 mM KCl. At 100 mM KCl, FL-Eg5-GFP motors form clusters consisting of up to two to four homotetramers at 100 mM KCl, unlike the Eg5-Δtail-GFP, which remained as individual homotetramers under all conditions tested. The tail domain may thus mediate inter-homotetramer interactions that induce clustering of Eg5 motors on the MT.</p><p>Analysis of the FL-Eg5-GFP and Eg5-Δtail-GFP motility run lengths revealed that the tail influences the processive motility of kinesin-5. At 25 mM KCl, both FL-Eg5-GFP and Eg5-Δtail-GFP motors exhibit run lengths that exceed the experimental imaging time with both motors eventually concentrating at MT plus-ends and were thus were not quantifiable (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1C</xref>; <xref ref-type="table" rid="table4">Table 4</xref>). In contrast, at 50 mM KCl we observe measurable run lengths for FL-Eg5-GFP and Eg5-Δtail-GFP motility events that are identical and in the range of 13–14 μm. At 100 mM KCl, FL-Eg5-GFP retained long run lengths with an average of 13 μm, while Eg5-Δtail-GFP showed a 45% decrease in run lengths to an average of 8 μm (<xref ref-type="fig" rid="fig3">Figure 3C</xref>; <xref ref-type="table" rid="table4">Table 4</xref>). These data suggest that the tail plays a role in maintaining homotetramer-MT interactions, with deletion of the tail resulting in a less processive motility cycle and a decrease in its affinity to the MT lattice.</p></sec><sec id="s2-5"><title>The kinesin-5 tail domain is required for efficient zippering of anti-parallel MTs into sliding zones</title><p>To understand the impact of the tail-to-motor interaction on kinesin-5 MT motility under relative MT sliding conditions, we reconstituted Eg5 MT sliding <italic>in vitro</italic> using three-color TIRF assays in 25 mM HEPES, pH 7.5 with 25–50 mM KCl conditions (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). AlexaF-633 and biotin-labeled MTs were attached to PEG-treated glass surfaces via a neutravidin to biotin linkage (anchored MT, red). AlexaF-560 labeled MTs (free MT yellow) and FL-Eg5-GFP or Eg5-Δtail-GFP motors were then added to reconstitute the crosslinking and sliding of free-MTs (yellow) along the anchored MTs (red) (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). Under these conditions we observed that 10–20 nM FL-Eg5-GFP motors promote robust MT sliding. FL-Eg5-GFP motors were able to bind along the anchored MTs, crosslink free-MTs (yellow), and zipper MTs to form anti-parallel MT sliding zones (<xref ref-type="fig" rid="fig4">Figure 4A</xref>-left; <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>; <xref ref-type="video" rid="video4">Video 4</xref>). Within a sliding event between two antiparallel MTs, FL-Eg5-GFP motors undergo slow motility similar to those observed along single MTs (<xref ref-type="fig" rid="fig3">Figure 3</xref>) and concentrate within newly formed two-MT bundles to produce sliding zones (green) (<xref ref-type="fig" rid="fig4">Figure 4B</xref>-left). To determine the effects of ionic strength on sliding, we measured motor and MT velocities at increasing solution ionic strength (25–50 mM KCl) (<xref ref-type="fig" rid="fig4">Figure 4C</xref>; <xref ref-type="table" rid="table5">Table 5</xref>). At 50 mM KCl, FL-Eg5-GFP motors displayed a two-fold increase in velocity similar to the effect along single MTs (<xref ref-type="fig" rid="fig3">Figure 3</xref>). This increase in motor velocity on anchored MTs matched a two-fold increase in the sliding rate of the free-MTs along the anchored MTs (<xref ref-type="fig" rid="fig4">Figure 4C</xref>; <xref ref-type="table" rid="table5">Table 5</xref>). Our experiments therefore show a correlation between the tail-mediated decrease in kinesin-5’s velocity at lower ionic strength, and the velocity of the MTs in anti-parallel MT sliding (<xref ref-type="table" rid="table5">Table 5</xref>; <xref ref-type="fig" rid="fig4">Figure 4C</xref>).</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>The kinesin-5 tail is critical for the zippering of two sliding MTs via slow directional motility within the overlap zones.</title><p>(<bold>A</bold>) Left panel, scheme for TIRF microscopy reconstitution of MT sliding assays where FL-Eg5-GFP motors (green) recruit free MTs (orange) along single surface anchored AlexaF-633 and biotin labeled MTs via neutravidin-biotin (red). Right panel, scheme for TIRF microscopy MT sliding where Eg5-Δtail-GFP mediates crosslinking of the free-MT (orange) without zippering them along the AlexaF-633 and biotin labeled MTs via neutravidin-biotin (red). Their activity leads to scissoring motility. (<bold>B</bold>) Montages for two types of MT sliding events. Left panels, FL-Eg5-GFP mediates MT sliding. Right panels, Eg5-Δtail-GFP crosslinks MTs but does not zipper them along the anchored MT, leading to scissoring events. Additional examples in <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B</xref> (<bold>C</bold>) The influence of ionic strength on FL-Eg5-GFP MT sliding activity. Top panel, FL-Eg5-GFP motor particle motility velocities (top panel) and free MT sliding velocity (lower panel). (<bold>D</bold>) The proportion of MT sliding and scissoring events in percentage of total observed for experiments at 20 and 200 nM Eg5-Δtail-GFP, respectively. The increase in Eg5-Δtail-GFP leads to higher proportion of MT sliding compared to scissoring events (N = 70–100 sliding/scissoring events for each condition). (<bold>E</bold>) Scheme for reconstitution of fluorescent Eg5 motor spiking in MT sliding assay with 20 nM FL-Eg5 (non-fluorescent, gray). 1 nM FL-Eg5-GFP or 1 nM Eg5-Δtail-GFP (green) were added to visualize single motors exhibit motility along the anchored MTs (red) and transition into the MT sliding zone with both free (yellow) and anchored MT (red). (<bold>F</bold>) Example kymographs of MT sliding spiking assays with 1 nM FL-Eg5-GFP in the presence of 20 nM FL-Eg5 (unlabeled). Three color kymographs are shown including the overlay (right panel), the free MT sliding (middle panel, yellow) being slide apart in the presence of single FL-Eg5-GFP motors (middle panel, green). Extreme right panels show a magnified views. Note the slow and directional motility of FL-Eg5-GFP motors. Additional examples in <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1C</xref>. (<bold>G</bold>) Example kymographs of MT sliding spiking assays with 1 nM Eg5-Δtail-GFP in the presence of 20 nM FL-Eg5 (unlabeled). Three color kymographs are shown including the overlay (right panel), the free MT sliding (middle panel, yellow) being slide apart in the presence of single Eg5-Δtail-GFP motors (middle panel, green). Extreme right panels show magnified view. Note FL-Eg5-GFP motors undergo bi-directional motility with stochastic switching (shown in red arrows) along either of the two anti-parallel MTs within sliding zones. Additional examples in <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1C</xref>. (<bold>H</bold>) Single motor track quantification of 1 nM FL-Eg5-GFP motor motility in the MT sliding zone (left, overlap) and along the anchored MT (right, single). Note FL-Eg5-GFP undergoes slow motility in general but its velocity decreases even further in the MT sliding zone. Average values reported in <xref ref-type="table" rid="table5">Table 5</xref> (<bold>I</bold>) Single motor track quantification of 1 nM Eg5-Δtail-GFP motor motility in the MT sliding zone (left, overlap zone) and along the single anchored MT (right, single-MT). Note Eg5-Δtail-GFP undergoes rapid motility in both zones, but its motility switches direction (reversals marked by red arrow heads) particularly within the overlap region of the MT sliding zone. Average values reported in <xref ref-type="table" rid="table5">Table 5</xref>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>The kinesin-5 tail domain regulates the zippering of two sliding MTs via slow directional motility within the overlapping zones.</title><p>(<bold>A</bold>) Left side panels, wide field view of reconstituting 10–20 nM FL-Eg5-GFP mediated MT sliding events. Free MTs (yellow) can be seen recruited along anchored MTs (red) mediated by the FL-Eg5-GFP motors. Right panels, wide field image of reconstitutions of 10–20 nM Eg5-Δtail-GFP revealing a defect in MT sliding zone leading the free MT (yellow) to rotate around a single point, or scissor with respect to the anchored MT. (<bold>B</bold>) Left, time-lapse montage/kymograph reveal how Eg5 FL-GFP motors mediates crosslinking and then zippering of newly captured MT. Left panel montage in three colors showing the capture of the free MT (yellow) by Fl-Eg5-GFP motors (green) along the anchored MT, second panel, kymograph for event in three channels. Third panel, free MT channel. Fourth panel, FL-Eg5-GFP channels. The latter three panels show the boundaries of the free-MT sliding marked with broken lines. Right panels, Time-lapse montage/kymograph reveal how Eg5-Δtail-GFP motors mediates crosslinking and zippering defect leading to scissoring of the newly captured MT. Left panel, two color kymographs showing anchored MT (red) by Eg5-Δtail-GFP motors (green) along the anchored MT. (<bold>C</bold>) Additional Kymographs, similar to <xref ref-type="fig" rid="fig4">Figure 4F</xref>, for motor spiking into MT sliding assays. Left panels, 1 nM FL-Eg5-GFP motor (green) is spiked into MT sliding events formed by FL-Eg5 where free MT (yellow) is being slid along anchored MT (red). Note the unidirectional motility of the FL-EG5-GFP motors and their slow motility within the MT sliding zone. Right panels, 1 nM Eg5-Δtail-GFP are spiked into MT sliding events formed by FL-Eg5-GFP. Note the bi-directional motility of Eg5-Δtail-GFP within MT sliding zones. (<bold>D</bold>) Statistical t-tests comparing the raw motility data shown in <xref ref-type="fig" rid="fig4">Figure 4F–G</xref>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig4-figsupp1-v2.tif"/></fig></fig-group><table-wrap id="table5" position="float"><label>Table 5.</label><caption><title>Motor motility and MT sliding parameters in vitro MT sliding assays.</title></caption><table frame="hsides" rules="groups"><thead><tr><th colspan="3" valign="top">Single motor velocities in relation to free MT sliding motility</th></tr></thead><tbody><tr><td valign="top">FL-Eg5-GFP</td><td valign="top">Free MT sliding motility (nm/s)</td><td valign="top">Motility in sliding zones (nm/s)</td></tr><tr><td valign="top">25 mM KCl</td><td valign="top">13.8 ± 1.0 n = 26</td><td valign="top">13.9 ± 1.0 n = 32</td></tr><tr><td valign="top">50 mM KCl</td><td valign="top">31.2 ± 1.2 n = 33</td><td valign="top">22.7 ± 1.2 n = 71</td></tr><tr><th colspan="3" valign="top">Single motor motility within MT sliding zones</th></tr><tr><td valign="top"/><td valign="top">Eg5-Δtail-GFP motors (nm/s)</td><td valign="top">FL-Eg5-GFP motors (nm/s)</td></tr><tr><td valign="top">Overlap Zone</td><td valign="top">8.6 ± 0.9 n = 32</td><td valign="top">3.4 ± 0.3 n = 67</td></tr><tr><td valign="top">Single MT</td><td valign="top">9.6 ± 0.8 n = 52</td><td valign="top">5.6 ± 0.3 n = 45</td></tr></tbody></table></table-wrap><media id="video4" mime-subtype="mp4" mimetype="video" xlink:href="elife-51131-video4.mp4"><label>Video 4.</label><caption><title>left, close up views of FL-Eg5-GFP motors (green) mediating zippering of free MT (yellow) along anchored MT (red).</title><p>Right close up view of Eg5-Δtail-GFP motors crosslinking but unable to zipper MTs leading to scissoring defect.</p></caption></media><p>We next studied the Eg5-Δtail-GFP in the MT sliding assays at similar motor concentrations (10–20 nM). Strikingly, the Eg5-Δtail-GFP motors crosslinked the free-MT only at focal points and were unable to completely zipper the free MT along the anchored MT (<xref ref-type="fig" rid="fig4">Figure 4A</xref>, right; <xref ref-type="fig" rid="fig4">Figure 4B</xref> right; <xref ref-type="video" rid="video4">Video 4</xref>). This MT zippering defect by the Eg5-Δtail-GFP motors lead the free MTs to ‘scissor’ along the anchored MTs due to Brownian motion at the crosslinking point (<xref ref-type="fig" rid="fig4">Figure 4B</xref>-right; <xref ref-type="video" rid="video4">Video 4</xref>). The scissoring behavior occurred most frequently near or at MT plus-ends, where the Eg5-Δtail-GFP motors concentrate (<xref ref-type="fig" rid="fig4">Figure 4B</xref>, lower right, second and third panels). We next studied the effect of increasing Eg5-Δtail-GFP motor concentrations on the formation of MT sliding zones. A ten-fold higher concentration of Eg5-Δtail-GFP (200 nM) led to a higher number of MT sliding events relative to scissoring events (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). At 20 nM Eg5-Δtail-GFP, only 6% of MT crosslinking events transitioned toward MT sliding events and the remaining 94% of events retained a scissoring defect. In contrast, at 200 nM Eg5-Δtail-GFP about 45% of crosslinking events transitioned into sliding events and 55% remained only scissoring events (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). A possible reason for this is tail-mediated regulation leading to slower motility, which concentrates Eg5 motors in the overlap zone and facilitates MT zippering, as suggested by the fact that a high concentration of Eg5-Δtail-GFP did not fully restore the zippering of two MTs into sliding zones.</p></sec><sec id="s2-6"><title>The kinesin-5 tail domain is critical for slowing motility within MT sliding zones</title><p>To dissect the role of the tail-motor interface in kinesin-5 engagement within the MT sliding zones, we next studied how FL-Eg5-GFP or Eg5-Δtail-GFP motors behave outside and within active sliding zones formed by non-fluorescent FL-Eg5 (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). FL-Eg5-GFP or Eg5-Δtail-GFP were spiked in at 1 nM into MT sliding assays containing 20 nM unlabeled FL-Eg5 to visualize single motors along the anchored MT and within active MT sliding zones (<xref ref-type="fig" rid="fig4">Figure 4E</xref>; see Materials and methods). FL-Eg5-GFP motors exhibit slow plus-end directed motility along anchored MTs with infrequent direction reversals, with their average velocity decreasing within MT sliding zones (5–7 nm/sec) (<xref ref-type="fig" rid="fig4">Figure 4H</xref>). In contrast, Eg5-Δtail-GFP motors exhibit an increased plus-end directed motility (10 nm/sec) along the anchored MT (<xref ref-type="fig" rid="fig4">Figure 4I</xref>). Upon entering MT sliding zones and interacting with both MTs, Eg5-Δtail-GFP motility remained rapid but the motors transitioned to bi-directional motility with frequent reversals (<xref ref-type="fig" rid="fig4">Figure 4I</xref>). We interpret these direction reversals to be uncoordinated MT plus-end directed motility along either of the two anti-parallel MTs within sliding zones that potentially indicate a higher rate of unbinding from the MT (<xref ref-type="fig" rid="fig4">Figure 4G</xref>, third panel from the left; <xref ref-type="video" rid="video5">Video 5</xref>). The Eg5-Δtail-GFP velocity is roughly two-fold higher than that of FL-Eg5 GFP along single MTs and within MT sliding zones. Eg5-∆tail-GFP also exhibited a three-fold shorter average run length compared to FL-Eg5-GFP within MT sliding zones (<xref ref-type="table" rid="table5">Table 5</xref>; <xref ref-type="fig" rid="fig4">Figure 4F</xref> right panels; <xref ref-type="fig" rid="fig4">Figure 4I</xref>; <xref ref-type="video" rid="video5">Video 5</xref>). The kinesin-5 tail thus is critical for Eg5 motors to engage within the MT sliding zones by modulating a unique motor-MT association which decreases motor unbinding rates, and potentially mediates coupling between the two MT-bound ends of kinesin-5. The bi-directional motility of Eg5-∆tail-GFP and its frequent direction reversals suggest that the two ends of the motor are undergoing rapid uncoordinated ATP hydrolysis cycles as they bind both MTs within sliding zones.</p><media id="video5" mime-subtype="mp4" mimetype="video" xlink:href="elife-51131-video5.mp4"><label>Video 5.</label><caption><title>Top left, close up view of 1 nM FL-Eg5-GFP motor (green) spiking during free MT (yellow) sliding along anchored MT (red) mediated by 20 nM unlabeled FL-Eg5.</title><p>Top right, same event without the free MT revealing FL-Eg5-GFP motors along the anchored MT. Bottom left, close up view of 1 nM Eg5-Δtail-GFP motor (green) spiking during free MT (yellow) sliding along anchored MT (red) mediated by 20 nM unlabeled FL-Eg5. Bottom right, same event without the free MT revealing Eg5-Δtail-GFP motors along anchored MT.</p></caption></media></sec><sec id="s2-7"><title>The tail domain is critical for kinesin-5 to generate high forces that slide apart MTs</title><p>In order to understand how the tail regulates the ability of kinesin-5 to slide apart antiparallel MTs, we next measured the forces generated by FL-Eg5-GFP or Eg5-Δtail-GFP on the free MT during sliding events using optical trapping combined with TIRF assays as previously described (<xref ref-type="bibr" rid="bib46">Shimamoto et al., 2015</xref>; <xref ref-type="fig" rid="fig5">Figure 5A</xref>). Here, we reconstituted anti-parallel pairs of MTs similar to those described above (<xref ref-type="fig" rid="fig4">Figure 4</xref>), but with an additional step of attaching polystyrene beads coated with nucleotide-free kinesin-1 motor domain to the ends of Rhodamine-labeled MTs (red). These bead-associated free-MTs were reconstituted to form anti-parallel overlaps within flow chambers containing Hilyte-647-labeled MTs (purple) anchored to the slide surface and either FL-Eg5-GFP or Eg5-Δtail-GFP (green). These sliding MT pairs were then simultaneously imaged using TIRF microscopy while measuring the force exerted on the bead using an optical trap (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). Under these conditions, 3–10 nM FL-Eg5-GFP produced robust MT sliding events (<xref ref-type="fig" rid="fig5">Figure 5B</xref> left panel; <xref ref-type="video" rid="video6">Video 6</xref>). In contrast, for 3–10 nM Eg5-Δtail-GFP, MT sliding was very rarely observed, and the majority of crosslinking events resulted in free MTs undergoing ‘scissoring’ movements about a single point on the anchored MT, similar to our previous observations in TIRF sliding assays (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). In order to recruit comparable amounts of Eg5-Δtail-GFP motors within the overlap regions and to promote relative MT sliding, we increased the amount of Eg5-Δtail-GFP in the chamber by 50–100-fold (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1D</xref>; <xref ref-type="fig" rid="fig5">Figure 5B</xref>; <xref ref-type="video" rid="video6">Video 6</xref>). Under these conditions, regions of MT overlap exhibited increased recruitment of kinesin-5 molecules (<xref ref-type="fig" rid="fig5">Figure 5B</xref>; <xref ref-type="video" rid="video6">Video 6</xref>).</p><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Kinesin-5 tail is critical in generating pushing forces during MT sliding.</title><p>(<bold>A</bold>) Scheme for MT sliding and optical trapping to measure the MT sliding pushing forces. Hilyte 649 labeled and biotins labeled MTs (purple) were attached to glass surfaces via neutravidin-biotin. FL-Eg5-GFP motors (green) slide apart the Rhodamine-labeled MTs (red) while bound to a polystyrene bead (sphere) coated with kinesin-1 rigor mutant protein, which becomes locked into the optical trap to measure forces. (<bold>B</bold>) Example images of MT sliding events mediated by FL-Eg5-GFP (left) and Eg5-Δtail-GFP (right). Top, free MT shown in gray scale. Second, Eg5-GFP intensity in the overlap zone. Third, attached MT. The polystyrene bead can be seen attached to the free MT. Lower panel, fluorescence intensity for each of the channels above showing the identification of the overlap zone length and total GFP intensity above background. (<bold>C</bold>) Example optical trapping force profiles generated for sliding events by FL-Eg5-GFP (top) and Eg5-Δtail-GFP (bottom). Top panel, FL-Eg5-GFP MT sliding events generate and build up forces that then plateau (highlighted level). Lower panel, Eg5-Δtail-GFP MT sliding events generate very weak forces, which plateau at lower values. (<bold>D</bold>) Scaled comparison for overlap zone length (μm) plotted in relation to the overall GFP intensity for each sliding event. FL-Eg5-GFP is shown in red while Eg5-Δtail-GFP is shown in blue. Note there is generally little discernible statistical difference between the slopes of these comparisons. (<bold>E</bold>) Scaled comparison of the plateau forces generated (pN) in relation to the size of the overlap zone for each MT sliding event. FL-Eg5-GFP is shown in red while Eg5-Δtail-GFP is shown in blue. Note the slope of the FL-Eg5-GFP force to length comparison is steeper than the Eg5-Δtail-GFP force to length comparison (<bold>F</bold>) Forces generated per μm of overlap length representing the slope of linear comparison in E.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig5-v2.tif"/></fig><media id="video6" mime-subtype="mp4" mimetype="video" xlink:href="elife-51131-video6.mp4"><label>Video 6.</label><caption><title>left, optical trapping of MT sliding experiments revealing the bead attached to sliding free MT (red) along anchored MT (purple) mediated by FL-Eg5-GFP motors.</title><p>Right, optical trapping of MT sliding experiments revealing the bead attached to sliding free MT (red) along anchored MT (purple) mediated by Eg5-Δtail-GFP motors.</p></caption></media><p>To measure the pushing forces generated by MT sliding under these conditions, the Rhodamine-labeled MT-bound polystyrene bead was optically trapped upon observation of a sliding event (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). FL-Eg5-GFP-mediated MT sliding exhibited a steady increase in the force produced until a maximum ‘plateau’ force was reached, frequently resulting in many 10 s of pN of force across the MT sliding pair. This behavior was quite similar in both timescale and force magnitude to reports of <italic>Xenopus</italic> Eg5 pushing forces measured in a similar assay (<xref ref-type="bibr" rid="bib46">Shimamoto et al., 2015</xref>). In contrast, Eg5-Δtail-GFP-mediated MT pairs exhibited short excursions of force increase and reached significantly lower ‘plateau’ values with lower total forces generated overall (<xref ref-type="fig" rid="fig5">Figure 5C</xref>).</p><p>For each individual MT sliding event examined, we also calculated the integrated intensity of GFP signal within the overlap region as defined by the distance between MT plus-ends (dashed gray lines, <xref ref-type="fig" rid="fig5">Figure 5B</xref>). This served as a proportional readout of the amount of motors localized within the overlap region. By comparing a number of MT sliding zones, we determined there is an approximately linear relationship between the relative MT overlap zone length and the number of motors within this region (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Furthermore, a comparable concentration of FL-Eg5-GFP and Eg5-Δtail-GFP were measured within overlap zones, suggesting that similar numbers of motors were engaged within overlaps of similar size, despite the different concentration used in the assays (<xref ref-type="fig" rid="fig5">Figure 5D</xref>).</p><p>We also examined the relationship between the magnitude of the force plateau reached in each individual MT sliding event and the length of the MT overlap zone during force generation. For both Eg5-GFP and Eg5-Δtail-GFP we observed a nearly linear increase in plateau force relative to MT overlap zone length (<xref ref-type="fig" rid="fig5">Figure 5E</xref>). However, the slopes of these relationships differed significantly between the two constructs. Here the slopes represent the plateau pushing force generated per μm length of sliding zone: the Eg5-Δtail-GFP generates about 0.6 ± 0.3 pN per μm while the FL-Eg5-GFP generates about 4.0 ± 0.6 pN per μm, indicating about a seven-fold difference in MT sliding forces (<xref ref-type="fig" rid="fig5">Figure 5F</xref>). The pushing forces produced within sliding anti-parallel MT bundles by ensembles of Eg5-Δtail-GFP are roughly seven-fold lower than that those generated by comparable numbers of FL-Eg5-GFP motors. Together, these data indicate that the tail domain is critical for homotetrameric kinesin-5 motor sliding behavior and mediates regulation of force production during MT sliding events.</p></sec><sec id="s2-8"><title>The tail domain is critical for kinesin-5 localization to metaphase and anaphase mitotic spindles <italic>in vivo</italic> </title><p>We next determined the role of the kinesin-5 tail domain in motor localization of Eg5 in metaphase and anaphase in HeLa cells. Cells were transfected with human GFP-α-tubulin to visualize MTs, and either FL-Eg5-mCherry (FL-Eg5-mCh), Eg5-Δtail-mCherry (Eg5-Δtail-mCh), or mCherry alone (mCh). Expression of each construct in HeLa cells was assessed by western blot (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). In fixed metaphase cells, FL-Eg5-mCh localized to spindle MTs. In contrast, localization of Eg5-Δtail-mCh was more diffuse, with increased cytoplasmic signal (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). This difference in localization was quantified as the ratio of mCh signal localized to the mitotic spindle and mCh signal in the cytoplasm. In cells with comparable mCh-construct expression levels (<xref ref-type="fig" rid="fig6">Figure 6C</xref>, left), this spindle-to-cytoplasm ratio was high for FL-Eg5-mCh (2.39 ± 0.08, mean ± SEM) and significantly reduced for Eg5-Δtail-mCh (1.37 ± 0.02, p&lt;0.0001, ANOVA with Tukey’s multiple comparisons test), indicating that deletion of the tail causes a defect in localization to metaphase spindle MTs (<xref ref-type="fig" rid="fig6">Figure 6C</xref>, right). Treatment with the compound BRD-9876, which locks Eg5 in a nucleotide-free-like state (<xref ref-type="bibr" rid="bib10">Chen et al., 2017</xref>), only partially rescued the localization of Eg5-Δtail-mCh to metaphase spindle MTs, potentially due to defects in both the on and off-rates (<xref ref-type="fig" rid="fig6">Figure 6D and E</xref>).</p><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Deletion of the kinesin-5 tail domain disrupts localization of the motor to the mitotic spindle in metaphase and anaphase.</title><p>(<bold>A</bold>) Western blot for mCherry (mCh, green) and GAPDH (red) indicating the expression of FL-Eg5-mCherry (FL Eg5-mCh, green) and Eg5-Δtail-mCherry (Eg5-Δtail-mCh, green) in HeLa cells. Results are representative of three independent experiments. (<bold>B</bold>) Localization of mCh, FL-Eg5-mCh, and Eg5-Δtail-mCh in HeLa cells arrested in metaphase via treatment with MG-132. FL-Eg5-mCh localized to spindle MTs. Tail deletion disrupted localization, and Eg5-Δtail-mCh signal was distributed between spindle MTs and the cytoplasm. Scale bar 10 μm. Images are representative of three independent experiments. (<bold>C</bold>) Left panel, mCh fluorescence intensities of single cells used for quantification of localization to spindle MTs (n = 13–29 cells per transfection condition, three independent experiments). Right panel, the ratio of mCh fluorescence signal on the spindle to signal in the cytoplasm was significantly lower in fixed metaphase cells expressing Eg5-Δtail-mCh compared to FL-Eg5-mCh, indicating reduced localization of Eg5-Δtail-mCh to spindle MTs (n = 13–29 cells per transfection condition, three independent experiments, p values from ANOVA with Tukey’s post hoc test). (<bold>D</bold>) Treatment of live HeLa cells expressing Eg5-mCh constructs and GFP-Tubulin with the Eg5 rigor inhibitor BRD-9876 resulted in a rapid (&lt;1 min) increase in FL-Eg5-mCh signal on the spindle. Inhibitor treatment increased, but did not fully rescue, localization of Eg5-Δtail-mCh to the spindle. Scale bar 10 μm. Images are representative of three independent experiments. (<bold>E</bold>) The ratio of mCh fluorescence signal on the spindle to signal in the cytoplasm rapidly increased after treatment with BRD-9876 in cells expressing FL-Eg5-mCh or Eg5-Δtail-mCh. The spindle-to-cytoplasm intensity ratio of Eg5-Δtail-mCh expressing cells never reached that of cells expressing FL-Eg5-mCh, indicating only partial rescue of motor localization with rigor inhibitor treatment. BRD-9876 treatment did not alter the ratio of mCh control cells (n = 7–13 cells per transfection condition, three independent experiments). (<bold>F</bold>) Deletion of the tail domain disrupted localization of Eg5 to the spindle in anaphase. Paired rows of images demonstrate the localization of FL-Eg5-mCh and Eg5-Δtail-mCh as HeLa cells expressing GFP-tubulin transitioned from metaphase to anaphase. FL-Eg5-mCh signal was observed at the spindle throughout the metaphase to anaphase transition and the motor localized to the midzone after anaphase onset (see 4–6 min panels). Increased cytoplasmic and reduced spindle signal was observed in cells expressing Eg5-Δtail-mCh throughout the metaphase to anaphase transition. Scale bar 10 μm. Images are representative of three independent experiments. (<bold>G</bold>) The ratio of mCh fluorescence signal on the spindle to signal in the cytoplasm was measured six minutes after anaphase onset. As in metaphase cells, localization of Eg5-Δtail-mCh to the spindle was significantly reduced compared to FL-Eg5-mCh (n = 7–12 cells per transfection condition, three independent experiments, p values from ANOVA with Tukey’s post hoc test). (<bold>H</bold>) The spindle-to-cytoplasm intensity ratio of cells expressing Eg5-Δtail-mCh was lower than that of cells expressing FL-Eg5-mCh throughout the metaphase to anaphase transition, indicating a persistent localization defect caused by deletion of the tail domain (n = 7–12 cells per transfection condition, three independent experiments).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig6-v2.tif"/></fig><p>Live cell imaging was used to assess whether this tail deletion localization defect was present in anaphase as well as metaphase mitotic spindles. Measurement of spindle to cytoplasm mCh intensity ratios in anaphase showed a similar reduction, indicating decreased localization to spindle MTs, for Eg5-Δtail-mCh compared to FL-Eg5-mCh as seen in metaphase cells (ratios 1.36 ± 0.04 and 2.21 ± 0.17, mean ± SEM, respectively, p&lt;0.0001, ANOVA with Tukey’s multiple comparisons test) (<xref ref-type="fig" rid="fig6">Figure 6F and G</xref>). As HeLa cells progressed from metaphase to anaphase, the deletion of the tail consistently reduced the localization of Eg5 to spindle MTs (<xref ref-type="fig" rid="fig6">Figure 6F and H</xref>). These data support a critical role for the tail domain in kinesin-5 mitotic spindle MT localization.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Kinesin-5 motors share a conserved anti-parallel MT sliding activity, which is essential for the assembly and elongation of mitotic spindles. This conserved activity allows kinesin-5 motors to mobilize each of their MT tracks simultaneously as cargos for transport. Here, we show that a conserved tail-to-motor interaction at the two ends of the kinesin-5 homotetramer is responsible for kinesin-5 conserved MT sliding function (<xref ref-type="fig" rid="fig7">Figure 7A–B</xref>). The regulation is most clearly observed at low ionic strength conditions, where the tail exhibits the highest affinity to the motor domain and the highest level of MT-stimulated ATP hydrolysis regulation leading to a longer lived and highaffinity binding on MT lattices during its catalysis cycle (<xref ref-type="fig" rid="fig1">Figure 1</xref>; <xref ref-type="fig" rid="fig7">Figure 7B</xref>). Structurally, the tail domain binds the motor domain in either the nucleotide-free or ADP MT-bound states by engaging the N-terminal subdomain at the α0-helix hairpin (<xref ref-type="fig" rid="fig7">Figure 7C</xref>). This element of the kinesin-5 motor domain rotates upward from the MT lattice in the nucleotide free state relative to a downward positioning upon binding nucleotide in the ATP-like state. The tail-induced stabilization of the upward state likely slows ATP binding into the active site of each motor during the ATP catalysis cycle (<xref ref-type="fig" rid="fig2">Figure 2</xref>; <xref ref-type="fig" rid="fig7">Figure 7C</xref>). We observed processive FL-Eg5-GFP homotetramer motility along individual MTs, a behavior previously not observed likely due to the lower than physiological pH (pH 6.8) conditions used in previous studies (<xref ref-type="bibr" rid="bib29">Kapitein et al., 2008</xref>). The tail-motor interaction decreases the MT-stimulated ATP hydrolysis rate resulting in very slow motility for FL-Eg5-GFP at 25 mM KCl along individual MTs and within MT sliding zones (<xref ref-type="fig" rid="fig3">Figures 3</xref>–<xref ref-type="fig" rid="fig4">4</xref>). Increasing the solution ionic strength (50–100 mM KCl) weakens tail-motor interface partially and relieves the suppression of ATP hydrolysis, leading to increased motility velocities. The tail domain also enhances the clustering of kinesin-5 homotetramers into oligomeric assemblies. At higher ionic strength (50 mM KCl), the MT sliding velocity directly correlated with an increased velocity of FL-Eg5-GFP motors within MT sliding zones. In contrast, Eg5-Δtail-GFP motors exhibited no suppression in motor velocity at 25 mM KCl, maintained a mostly constant average velocity at higher ionic strengths (50–100 mM KCl) and exhibited no clustering behavior. The Eg5-Δtail-GFP velocity also remained consistently 20% higher than that of Eg5-FL-GFP at 50 and 100 mM KCl, suggesting that some tail regulation remains in place at even higher ionic strength. The weakened tail-to-motor interaction may play a role in enhancing the inter-molecular interactions between kinesin-5 homotetramers as it resulted in higher-order clustering among FL-Eg5-GFP tetramers at 100 mM KCl, (<xref ref-type="fig" rid="fig7">Figure 7A</xref>, broken lines). The tail domain also enhances processive motility run lengths for FL-Eg5-GFP at higher ionic strengths, which decreased by 45% for Eg5-Δtail-GFP (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1B</xref>). These data are fairly consistent with previous observations for full-length and tail-deleted <italic>Xenopus</italic> Eg5 (<xref ref-type="bibr" rid="bib63">Weinger et al., 2011</xref>).</p><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>A revised model for kinesin-5 tail-motor interaction during stepping motility and critical role for force generation during MT sliding.</title><p>(<bold>A</bold>) Model for kinesin-5 homotetramers with their motor and tail domains at each end of the bipolar minifilament (60 nm). The motors and tail domains at each end may form assemblies where the tail domain of one homo-tetramer makes contact with motors of a second tetramer to form clusters of two to four motors (<bold>B</bold>) The role of the tail in regulating the kinesin-5 hand-over-hand motility cycle by slowing ATP binding of the lead motor leading to slow hand over-hand motility and prevalence of the dual bound state at each end of kinesin-5. (<bold>C</bold>) The conformations of the kinesin-5 motor subdomains in the process of ATP binding. Left, The N-terminal subdomain (blue) is in upward state with the helix-0 to engage the tail domain and wedging the nucleotide binding pocket open. Right, the N-terminal subdomain moves downward enclosing on the bound ATP, leading the helix-0 to move downward and disengage from the tail domain. (<bold>D</bold>) Synthesized view of dual dimeric motor bound state of the kinesin-5 motor end. This state was synthesized based on the cryo-EM maps and, in vitro reconstitution, biochemical and kinetic studies described here. The tail makes contact with the motor domain only in the nucleotide-free state but dissociates when the motor is in the ATP state. The lead motor is bound to the tail while the trailing motor dissociates from the tail domain.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-51131-fig7-v2.tif"/></fig><p>Our studies suggest that the tail-to-motor interaction of kinesin-5 is critical for coordinating the motility activities that are required in promoting MT sliding motility. We show that human FL-Eg5-GFP motors capture antiparallel MTs and zipper them into sliding MT bundles (<xref ref-type="fig" rid="fig4">Figure 4</xref>). Loss of the tail-to-motor interaction in Eg5-Δtail-GFP motors does not prevent initial crosslinking of MTs at or near MT-plus-ends, but leads to a severe defect in the zippering of two MTs into sliding bundles (<xref ref-type="fig" rid="fig4">Figure 4</xref>). Within active MT sliding zones, we observe that the Eg5-Δtail-GFP motors are persistently bi-directional and moving along either antiparallel MTs likely due to loss of coordination between the two bipolar kinesin-5 motile ends (<xref ref-type="fig" rid="fig4">Figure 4F</xref>, left panel). In contrast, FL-Eg5-GFP undergoes smooth, slow and unidirectional motility towards the MT plus-end of the anchored MT. FL-Eg5-GFP motors generate seven-fold higher pushing forces compared to Eg5-Δtail-GFP motors while sliding apart antiparallel MTs. The forces generated by FL-Eg5-GFP likely result from the kinesin-5 tail-to-motor interface modulating motility along each MT within the sliding zone. The tail enhances the FL-Eg5-GFP motor-MT affinity leading to tightly engaged and slow-moving motors on both MTs within the sliding zone.</p><sec id="s3-1"><title>A revised model for kinesin-5 sliding motility: Tail domains are essential for facilitating slow motility and high force production between two sliding MTs</title><p>Our studies suggest that the tail domain regulates processive hand-over-hand stepping during kinesin-5 motility (<xref ref-type="fig" rid="fig7">Figure 7B–D</xref>; <xref ref-type="bibr" rid="bib56">Vale and Milligan, 2000</xref>). Well-studied MT plus-end-directed kinesin motors (i.e. kinesin-1) undergo hand-over-hand walking motility along MT protofilaments utilizing dimeric motor domains coupled by their neck linkers and neck coil-coils. During hand-over-hand motility, one motor domain of a dimeric kinesin binds the MT lattice in a trailing position, while the other motor domain occupies a leading position, 8 nm apart along two consecutive αβ-tubulins within MT protofilaments (<xref ref-type="fig" rid="fig7">Figure 7D</xref>). The trailing motor is in an ATP-like state with its neck-linker docked, while the lead motor initially binds weakly, leading to ADP dissociation and a nucleotide-free state (<xref ref-type="fig" rid="fig7">Figure 7D</xref>). The hand over hand cycle of dimeric kinesin-1 motors result in 8 nm steps toward the MT plus-ends (<xref ref-type="bibr" rid="bib56">Vale and Milligan, 2000</xref>). Our studies suggest a new form of regulation for kinesin-5 hand-over-hand motility, where the tail domain decreases ATP binding and stabilizes the ADP or nucleotide-free states of the lead motor domain (<xref ref-type="fig" rid="fig7">Figure 7C–D</xref>). The kinesin-5 tail binds the α0-helix within the motor domain, stabilizing its N-terminal subdomain in an upward conformation and resulting in an open active site that slows its ATP binding capacity (<xref ref-type="fig" rid="fig1">Figures 1</xref>–<xref ref-type="fig" rid="fig3">3</xref>; <xref ref-type="fig" rid="fig7">Figure 7C–D</xref>). Our model is the simplest explanation for all the data presented here. The tail-motor regulatory mechanism, described here, is likely to be the source of kinesin-5’s conserved sliding force-generating capabilities and is essential for its anti-parallel MT sliding activity. In yeast kinesin-5 motors, such as Cin8, these interactions may also regulate the reversal of direction from minus-end-directed motility along single MTs to plus-end-directed motility within sliding zones as tail deletion in Cin8 interferes with directionality reversal (<xref ref-type="bibr" rid="bib12">Düselder et al., 2015</xref>).</p><p>The tail-motor interface may stiffen both kinesin-5-MT interactions at both ends of the homotetrameric filament within MT sliding zones and thus may improve force transmission between the two bipolar ends (<xref ref-type="fig" rid="fig5">Figures 5</xref> and <xref ref-type="fig" rid="fig7">7B–D</xref>). Our data suggests that the tail-motor interaction increases the time each end of the kinesin-5 homotetramer spends in the dual motor-bound state. The tail may promote a high affinity state for the motor domains at each of the homotetramer (<xref ref-type="fig" rid="fig7">Figure 7C–D</xref>). In the absence of the tail domain, Eg5-Δtail-GFP motors are unable to effectively engage both sliding MTs and exhibit reversal in motility direction by moving to the MT plus-end on either sliding MTs asynchronously. This leads to a poor capacity for generating MT sliding and pushing forces (<xref ref-type="fig" rid="fig4">Figures 4</xref>–<xref ref-type="fig" rid="fig5">5</xref>). Our data also indicate that this interaction may be responsible for clustering multiple homotetramers into larger complexes under certain conditions (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). Clusters of up to four kinesin-5 homotetramers were observed in the yeast ortholog, Cin8, where cluster formation induced motility direction reversal and generated sites for the capture of free MTs to promote MT sliding (<xref ref-type="bibr" rid="bib44">Shapira et al., 2017</xref>). We suggest that the clustering of kinesin-5 motors may serve to coordinate the motor motility cycles of groups of motors within MT sliding zones (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). Cooperativity may also be a result of multiple motors stalled in a traffic jam due to slow stepping, a model previously suggested for Cut7, the <italic>S. pombe</italic> ortholog (<xref ref-type="bibr" rid="bib5">Britto et al., 2016</xref>).</p></sec><sec id="s3-2"><title>Tail regulation of the kinesin-5 motor domain maybe modulated by mitotic kinases and the tail is critical for mitotic kinesin-5 functions</title><p>The kinesin-5 tail domain is essential for mitotic spindle assembly and elongation functions. Our studies confirm that the mitotic localization defect in Eg5-Δtail-GFP may relate to its rapid binding and unbinding from spindle MTs; trapping Eg5-Δtail-GFP motor in the nucleotide-free state using chemical strategies dramatically enhances their MT spindle localization (<xref ref-type="fig" rid="fig6">Figure 6</xref>). A recent study identified Eg5 mutations in cultured cells that result in resistance to Eg5 inhibitors (<xref ref-type="bibr" rid="bib48">Sturgill et al., 2016</xref>). Among these is a mutant cell strain that possesses an Eg5 mutant with motor domain mutation that traps it in the nucleotide-free state that forms a near-normal bipolar metaphase spindle and for which correct mitotic organization is restored in the presence of specific compounds (<xref ref-type="bibr" rid="bib48">Sturgill et al., 2016</xref>). This data highlights the importance of the stabilization of the nucleotide-free state during the force generation cycle of kinesin-5.</p><p>The tail-motor interface is essential for the stable localization of kinesin-5 motors to mitotic spindle MTs by also acting as a regulatory site for phosphorylation. The tail domain contains the conserved BimC box, a mitotic CyclinB dependent kinase phosphorylation consensus site (<xref ref-type="bibr" rid="bib4">Blangy et al., 1995</xref>; <xref ref-type="bibr" rid="bib45">Sharp et al., 1999</xref>). This motif is conserved across kinesin-5 motors and its mitotic phosphorylation was shown to promote the accumulation of kinesin-5 motors at the mitotic spindle midzone and to mediate spindle elongation in anaphase (<xref ref-type="bibr" rid="bib45">Sharp et al., 1999</xref>). It remains unclear how phosphorylation of the BimC box influences the kinesin-5 tail-motor interaction. It is possible that phosphorylation enhances motor regulation by the tail and further slows MT-based motility to increase MT sliding efficiency during anaphase. Future studies of kinesin-5 motors phosphorylated at the BimC box will provide further clues for kinesin-5 regulation throughout the cell cycle.</p></sec><sec id="s3-3"><title>Concluding remarks</title><p>We present a new mechanism for the regulation of the kinesin-5 motor via its tail domain during plus-end-directed motility along MTs. The tail binds the motor domain to stabilize it in the high affinity MT-bound nucleotide-free state. This regulatory role is critical for slowing kinesin-5 motility along MTs allowing motors to crosslink and generate force to slide apart antiparallel MTs, an aspect of kinesin-5 that is essential for cell division to occur.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type <break/>(species) or resource</th><th valign="top">Designation</th><th valign="top">Source or reference</th><th valign="top">Identifier</th><th valign="top">Additional <break/>Information</th></tr></thead><tbody><tr><td valign="top">Chemical compound, drug</td><td valign="top">ATP</td><td valign="top">Sigma</td><td valign="top">A-2383</td><td valign="top"><xref ref-type="fig" rid="fig1">Figures 1</xref>, <xref ref-type="fig" rid="fig3">3</xref>, <xref ref-type="fig" rid="fig4">4</xref>, <xref ref-type="fig" rid="fig5">5</xref> and <xref ref-type="fig" rid="fig6">6</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">ADP</td><td valign="top">Sigma</td><td valign="top">A-2754</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">GTP</td><td valign="top">Sigma</td><td valign="top">G-8877</td><td valign="top"><xref ref-type="fig" rid="fig1">Figures 1</xref>, <xref ref-type="fig" rid="fig3">3</xref>, <xref ref-type="fig" rid="fig4">4</xref> and <xref ref-type="fig" rid="fig5">5</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">GMPCPP</td><td valign="top">Jenna Biosciences</td><td valign="top">NU-405L</td><td valign="top"><xref ref-type="fig" rid="fig3">Figures 3</xref>, <xref ref-type="fig" rid="fig4">4</xref> and <xref ref-type="fig" rid="fig5">5</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">AMPPNP</td><td valign="top">Sigma</td><td valign="top">A-2647</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">Paclitaxel</td><td valign="top">Sigma</td><td valign="top">T7402</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">2</xref></td></tr><tr><td valign="top">Other</td><td valign="top">Streptactin XT</td><td valign="top">IBA-life sciences</td><td valign="top">2-1003-100</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig3">3</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">d-Biotin</td><td valign="top">Sigma</td><td valign="top">B-4501</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig3">3</xref></td></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">EnzCheck ATPase assay kit</td><td valign="top">Thermofisher</td><td valign="top">E6646</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">NeutrAvidin</td><td valign="top">Thermofisher</td><td valign="top">31000</td><td valign="top"><xref ref-type="fig" rid="fig3">Figure 3</xref>, <xref ref-type="fig" rid="fig4">4</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">biotin-PEG-3400-silane</td><td valign="top">Laysan Bio</td><td valign="top">Biotin-PEG-SIL-3400–500 mg</td><td valign="top"><xref ref-type="fig" rid="fig3">Figure 3</xref>, <xref ref-type="fig" rid="fig4">4</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">PEG-2000-silane</td><td valign="top">Laysan Bio</td><td valign="top">MPEG-SIL-2000–1 g</td><td valign="top"><xref ref-type="fig" rid="fig3">Figure 3</xref>, <xref ref-type="fig" rid="fig4">4</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">Pluronic-F127</td><td valign="top">Sigma</td><td valign="top">P2443</td><td valign="top"><xref ref-type="fig" rid="fig3">Figure 3</xref>, <xref ref-type="fig" rid="fig4">4</xref></td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-GAPDH (mouse monoclonal)</td><td valign="top">Thermo-Fisher</td><td valign="top">437000</td><td valign="top">Western blot: 1:10,000</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-mCherry</td><td valign="top">Abcam</td><td valign="top">ab167453</td><td valign="top">Western blot: 1:1000</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-mouse IRDye680 (goat polyclonal)</td><td valign="top">LI-COR</td><td valign="top">92568070</td><td valign="top">Western blot: 1:10,000</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-rabbit IRDye800 (goat polyclonal)</td><td valign="top">LI-COR</td><td valign="top">92632211</td><td valign="top">Western blot: 1:10,000</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-tubulin DM1α (mouse monoclonal)</td><td valign="top">Sigma</td><td valign="top">T9026</td><td valign="top">Immunofluorescence: 1:750</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-mouse AlexaFluor 488 (goat polyclonal)</td><td valign="top">Invitrogen</td><td valign="top">A-11029</td><td valign="top">Immunofluorescence: 1:500</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-mouse AlexaFluor 647 (goat polyclonal)</td><td valign="top">Invitrogen</td><td valign="top">A-21236</td><td valign="top">Immunofluorescence: 1:500</td></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">Nucleofector Cell Line SE Kit</td><td valign="top">Lonza</td><td valign="top">V4XC-1024</td><td valign="top"/></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">Phusion Site-Directed Mutagenesis</td><td valign="top">Thermo Scientific</td><td valign="top">F541</td><td valign="top"><xref ref-type="fig" rid="fig6">Figure 6</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">BRD-9876</td><td valign="top">Tocris Bioscience</td><td valign="top">5454/50</td><td valign="top"><xref ref-type="fig" rid="fig6">Figure 6</xref></td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">MG-132</td><td valign="top">Selleckchem</td><td valign="top">S2619</td><td valign="top"><xref ref-type="fig" rid="fig6">Figure 6</xref></td></tr><tr><td valign="top">Peptide, recombinant protein</td><td valign="top"><italic>Drosophila KLP61F</italic></td><td valign="top">UniprotKB/Swiss-Prot</td><td valign="top">P46863</td><td valign="top"/></tr><tr><td valign="top">Peptide, recombinant protein</td><td valign="top"><italic>Human Eg5 (KIF11)</italic></td><td valign="top">UNiportKB/Swiss-Prot</td><td valign="top">P52732</td><td valign="top"/></tr><tr><td valign="top">Peptide, recombinant protein</td><td valign="top"><italic>Porcine alpha tubulin</italic></td><td valign="top">UniprotKB/Swiss-Prot</td><td valign="top">Q2XVP4</td><td valign="top"/></tr><tr><td valign="top">Peptide, recombinant protein</td><td valign="top"><italic>Porcine beta-tubulin</italic></td><td valign="top">UniprotKB/Swiss-Prot</td><td valign="top">P02550</td><td valign="top"/></tr><tr><td valign="top">Cell line (<italic>E. coli</italic>)</td><td valign="top">SoluBL21 bacterial expression</td><td valign="top">AmsBio</td><td valign="top">C700200</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">2</xref></td></tr><tr><td valign="top">Cell line (<italic>S. frugiperda</italic>)</td><td valign="top">Spodoptera frugiperda-9 (Sf-9 cells)</td><td valign="top">Thermofisher</td><td valign="top">11496–015</td><td valign="top"><xref ref-type="fig" rid="fig3">Figures 3</xref>, <xref ref-type="fig" rid="fig4">4</xref> and <xref ref-type="fig" rid="fig5">5</xref></td></tr><tr><td valign="top">Cell line (<italic>Homo sapiens</italic>)</td><td valign="top">HeLa cell line</td><td valign="top">ATCC</td><td valign="top">CCL-2</td><td valign="top"><xref ref-type="fig" rid="fig6">Figure 6</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pLIC<italic>_</italic>V2<italic>-Dm-KLp61F motor- H6(1–369)</italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">2</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pLIC<italic>_</italic>V2<italic>-Dm-KLP61F tail H6 (913–1016)</italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">2</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pLIC_V2-Dm KLP61F motor-tail fusion (residues 1–360, GSGSGS-linker, residues 913–1016)</td><td valign="top">This paper</td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pET21a human Eg5 motor (residues 1–360)</td><td valign="top">This paper</td><td valign="top">Synthetic</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pET21a human Eg5 tail (residues 920–1056)</td><td valign="top">This paper</td><td valign="top">Synthetic</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pET21a human Eg5 motor-tail fusion (residues 1–360 GSGSGS-linker residues 920–1056)</td><td valign="top">This paper</td><td valign="top">Synthetic</td><td valign="top"><xref ref-type="fig" rid="fig1">Figure 1</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pFastbac-human FL-Eg5-GFP (residues 1–1056-msfGFP-StrepII)</td><td valign="top">This paper</td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig3">Figure 3</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pFastbac-human FL-Eg5 (residues 1–1056-StrepII)</td><td valign="top">This paper</td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig3">Figure 3</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pFastbac-human Eg5-Δ-tail-GFP (residues 1–920-msfGFP-StrepII)</td><td valign="top">This paper</td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig3">Figure 3</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pcDNA3.1 FL-Eg5-mCh (residues 1–1056, mCherry) siRNA resistant (T2124C, C2130T, G2133T, and G2136A)</td><td valign="top">This paper</td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig6">Figure 6</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pcDNA3.1 Eg5- <break/>Δtail-mCh (residues 1–920, mCherry) siRNA resistant (T2124C, C2130T, G2133T, and G2136A)</td><td valign="top">This paper</td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig6">Figure 6</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">GFP-Tubulin</td><td valign="top">Clonetech</td><td valign="top">Stock #61171</td><td valign="top"><xref ref-type="fig" rid="fig6">Figure 6</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pCMV-mCh</td><td valign="top"><xref ref-type="bibr" rid="bib37">Peris et al., 2009</xref></td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Peptide, recombinant protein</td><td valign="top">αβ-tubulin purified from porcine brains</td><td valign="top">This paper <break/><xref ref-type="bibr" rid="bib8">Castoldi and Popov, 2003</xref></td><td valign="top"/><td valign="top"><xref ref-type="fig" rid="fig1">Figures 1</xref>, <xref ref-type="fig" rid="fig3">3</xref> and <xref ref-type="fig" rid="fig4">4</xref></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">ImageLab</td><td valign="top">Biorad</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://www.bio-rad.com/webroot/web/pdf/lsr/literature/10000076953.pdf">https://www.bio-rad.com/webroot/web/pdf/lsr/literature/10000076953.pdf</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">FIJI (ImageJ)</td><td valign="top"><xref ref-type="bibr" rid="bib41">Schindelin et al., 2012</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://fiji.sc">https://fiji.sc</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Prism</td><td valign="top">GraphPad</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://www.graphpad.com/scientific-software/prism/">https://www.graphpad.com/scientific-software/prism/</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Motioncor2</td><td valign="top"><xref ref-type="bibr" rid="bib65">Zheng et al., 2017</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://emcore.ucsf.edu/ucsf-motioncor2">https://emcore.ucsf.edu/ucsf-motioncor2</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">CTFFIND4</td><td valign="top"><xref ref-type="bibr" rid="bib39">Rohou and Grigorieff, 2015</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://grigoriefflab.umassmed.edu/ctf_estimation_ctffind_ctftilt">https://grigoriefflab.umassmed.edu/ctf_estimation_ctffind_ctftilt</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">EMAN2</td><td valign="top"><xref ref-type="bibr" rid="bib52">Tang et al., 2007</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://blake.bcm.edu/emanwiki/EMAN2">http://blake.bcm.edu/emanwiki/EMAN2</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">FREALIGN</td><td valign="top"><xref ref-type="bibr" rid="bib21">Grigorieff, 2007</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://grigoriefflab.umassmed.edu/frealign">https://grigoriefflab.umassmed.edu/frealign</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">B-factor</td><td valign="top"><xref ref-type="bibr" rid="bib21">Grigorieff, 2007</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://grigoriefflab.umassmed.edu/bfactor">https://grigoriefflab.umassmed.edu/bfactor</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">UCSF-Chimera</td><td valign="top"><xref ref-type="bibr" rid="bib38">Pettersen et al., 2004</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://www.cgl.ucsf.edu/chimera/">https://www.cgl.ucsf.edu/chimera/</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">CCP4 suite</td><td valign="top"><xref ref-type="bibr" rid="bib11">Collaborative Computational Project, Number 4, 1994</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://www.ccp4.ac.uk/html/dmmulti.html">http://www.ccp4.ac.uk/html/dmmulti.html</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">GCTF</td><td valign="top"><xref ref-type="bibr" rid="bib64">Zhang, 2016</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://www.mrc-lmb.cam.ac.uk/kzhang/">https://www.mrc-lmb.cam.ac.uk/kzhang/</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Phyre protein homology model</td><td valign="top"><xref ref-type="bibr" rid="bib31">Kelley et al., 2015</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index">www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Relion 2.2</td><td valign="top"><xref ref-type="bibr" rid="bib15">Emsley et al., 2010</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://www2.mrc-lmb.cam.ac.uk/relion/index.php">https://www2.mrc-lmb.cam.ac.uk/relion/index.php</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">MolProbity</td><td valign="top"><xref ref-type="bibr" rid="bib9">Chen et al., 2010</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://molprobity.biochem.duke.edu">http://molprobity.biochem.duke.edu</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Coot</td><td valign="top"><xref ref-type="bibr" rid="bib15">Emsley et al., 2010</xref></td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/">http://www2.mrc-lmb.cam.ac.uk/personal/</ext-link><ext-link ext-link-type="uri" xlink:href="http://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/">pemsley/coot/</ext-link></td><td valign="top"/></tr></tbody></table></table-wrap><sec id="s4-1"><title>Generation of constructs for various studies</title><p>For in vitro motility studies, we generated constructs for expression insect cells full length coding regions for Human Eg5 (KIF11)(FL-Eg5: residues 1–1056) and C-terminally truncated Eg5 (Eg5-Δtail; residues 1–920) were inserted in pFastbac1 vector in frame of a C-terminal StrepII tag or fused to monomeric superfolder-GFP(msf-GFP) and a C-terminal Strep-II tag.</p><p>For in vivo imaging studies, A pcDNA-3.1 plasmid containing Eg5 full-length fused to mCherry (Eg5 FL-mCh) inserted between the EcoR1 and Not1 sites was used as a template. Plasmid pAT4206, encoding Eg5-Δtail, which encoded residues 1–912, fused to mCherry (Eg5 ΔTail-mCh), was generated using the Phusion Site-Directed Mutagenesis Kit (Thermo Scientific). These clones contained silent mutations for siRNA-resistance: T2124C, C2130T, G2133T, and G2136A. The forward and reverse primer sequences used to generate Eg5 ΔTail-mCh were 5’-<named-content content-type="sequence">GGAGCGCCAATGGTGAGCAA</named-content>-3’ and 5’-<named-content content-type="sequence">AAAGCAATTAAGCTTAGTCAAACCAATTTT</named-content>-3’, respectively.</p><p>For Kinetic and structural studies, coding regions for isolated Dm KLP61F and Human Eg5 motor constructs (KLP61F motor residues 1–369; Eg5 motor residues 1–360) and the tail domains for these proteins (KLP61F tail residues 906–1016 and Eg5 residues 920–1056) and KLP61F motor-tail fusion (KLP61F residues 1–369 fused to 906–1016 and Eg5 residues 1–360 fused to residues 920–1056) were inserted in frame with histidine-tag in pET v2 vector (macrolab UC-berkeley). For affinity co-purification studies, a KLP61F tail region (residues 906–1016) was fused to a C-terminal StrepII tag.</p></sec><sec id="s4-2"><title>Protein expression and purification</title><p>For expression FL-Eg5-GFP, FL-Eg5 and Eg5-Δtail-GFP was carried out using baculoviral expression system. Briefly 200 to 500 mL of Spodoptera frugiperda (Sf9) cells, were infected with third passaged virus for each construct and expressed for 60–72 hr. Virus-Infected Sf9 Cells were centrifuged at 1500 rpm and then washed and incubated with lysis buffer (50 mM HEPES 300 mM KCl, 10 mM beta-meractoptoethanol, 1 mM MgCl2, 0.2 mM ATP) in the presence of 0.5% Triton X100. Cells were lysed by extrusion using a dounce homogenizer and then were centrifuged at 40,000 rpm using Ti45 rotor in ultracentrifuge (Beckman). The lysate was passaged on a Streptactin XT resin (IBA lifesciences) equilibrated with lysis buffer, washed extensively and then eluted with lysis buffer supplemented with 100 mM D-Biotin. Purified Eg5 proteins were concentrated and loaded onto Superose-6 (10/300) column (GE Health Care) equilibrated onto AKTA system and eluted in 0.5 mL fractions (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–B</xref>). Fractions were evaluated using SDS-PAGE for protein quality and Eg5 protein containing fractions were either used immediately for motility experiments or were snap frozen with 15% glycerol in lysis buffer using liquid nitrogen. We did not observe any difference in the FL-Eg5-GFP, FL-Eg5 and Eg5-Δtail-GFP activities in the frozen or freshly prepared settings (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–B</xref>).</p><p>For kinetic and structural cryo-EM studies, Dm-KLP61F and human Eg5 motor, tail and motor-tail constructs were expressed using T7 expression in SoluBL21 cells. Briefly, cells were grown at 37°C and induced for expression using 0.5 mM Isopropyl thio-beta-glucoside overnight at 19°C. Cells were centrifuged and lysed in Lysis buffer using a microfluidizer. Proteins were purified using IDA-nickel affinity chromatography (Macherey Nagel), washed extensively and then eluted with lysis buffer supplemented with 200 mM Imidazole. The purified fractions were loaded onto a Superdex 200 (16/6) size exclusion column equilibrated with lysis buffer at 1 mL fractions. SDS-PAGE was used to evaluate fractions and concentrated pure proteins were incubated with 15% glycerol before freezing in liquid nitrogen.</p></sec><sec id="s4-3"><title>MT stimulated ATP hydrolysis, tail affinity motor co-purification and MT-co-sedimentation assays</title><p>MT-stimulated ATPase activity for KLP61F and Eg5 motor, tail, motor-tail fusion and Eg5-motor and tail constructs were carried out by measuring the free phosphate production rate in 50 mM Potassium acetate (K-acetate) or 20 mM KCl, 25 mM HEPES, 5 mM magnesium acetate, 1 mM EGTA, pH 7.5 buffer in the presence of a minimum of a 5-fold molar excess range of MT concentrations, using a commercially-available kit (EnzChek, Molecular Probes) at 20<sup>o</sup> C. The Eg5 motor, tail and motor-tail fusion were additionally studied at 20 mM KCl due to the 10-fold higher Eg5 motor MT stimulated ATP hydrolysis K<sub>m</sub> in 50 mM K-Acetate. These comparisons suggest that the Eg5 tail regulation of motor ATPase is slightly weaker at 50 mM K-Acetate conditions (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1L–M</xref>).</p><p>For affinity co-purification for the motor and tail, 5–10 μmoles of KLP61F tail-StrepII tagged protein was incubated with 5–10 μmoles of the KLP61F motor domain in incubation buffer (25 mM HEPES, 25–75 mM KCl 5 mM MgCl<sub>2</sub> and 1 mM EGTA, 2% glycerol). The mixture (Load) was then incubated with 200 μl of StrepXT resin (IBA-biotech). The flow-through fraction from the resin was collected (FL). The resin was washed with two column volumes of incubation buffer. The bound fraction was then eluted (Elute) with incubation buffer + 50 mM biotin. The mixture was analyzed by SDS PAGE. Quantitative densitometry was carried out to obtain the motor/tail molar ratio using Biorad Image Lab software (Biorad). Motor and tail band intensities were measured, and the intensity data was converted to μmol values and then molar ratios were calculated (<xref ref-type="fig" rid="fig1">Figure 1E</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>).</p><p>To measure MT co-sedimentation activity for KLP61F and Eg5 motor and tail constructs, we prepared 5 mg/ml MTs in 5% DMSO by polymerization at 37 °C and then stabilized with Paclitaxel (sigma), MT co-sedimentation assays were carried out by mixing 0.01, 0.025, 0.05, 0.1, 0.25 up to 0.05 μmol of KLP61F or Eg5 motor with or without their respective tail domains, in 25 mM HEPES pH 7.5, 5 mM MgCl2, 1% glycerol, 25 mM or 75 mM KCl in the presence of 2 mM AMPPNP, 2 mM ADP, 2 mM ADP.AlF4 or 10U Apyrase to mimic the nucleotide-free state. The five to six different concentration mixtures of motors, tail indicated above were mixed with MTs in these conditions were incubated at 25°C for 20 min and then centrifuged at 18 k for 25 min at 25 °C. A control condition is usually included in which co-sedimentation is carried out without MTs (-MTs). The supernatant fractions were then removed and mixed with SDS sample buffer. The pellets were resuspended with SDS sample buffer. Equal amounts of each supernatant and pellet fractions for 0.01, 0.025, 0.05, 0.1, 0.25 μmol and -MT conditions were analyzed by SDS PAGE (<xref ref-type="fig" rid="fig1">Figure 1F–H</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>),. Quantitative densitometry was carried out using Biorad Image Lab software (Biorad) to determine the saturated molar ratios of the motor and tail to polymerized tubulin in MTs. The intensities for each band was measured in comparison to a local background control. The intensity data were converted to μmoles and then molar ratios were calculated for each lane average ratios were calculated for all saturated lanes.</p></sec><sec id="s4-4"><title>Sample preparation of motor and tail decorated MTs for Cryo-EM</title><p>MTs were prepared by polymerizing 5 mg/ml tubulin (Cytoskeleton, Denver, CO) in BRB80 buffer (80 mM PIPES, pH 6.8, 1 mM EGTA, 4 mM MgCl2, 2 mM GTP, 9% dimethyl sulfoxide) for 30 min at 36° C. Paclitaxel was added at 250 μM before further incubation of 30 min at 36°C. The polymerized MTs were then incubated at room temperature for several hours or overnight before use. For grid preparations, KLP61F motor and KLP61F tail proteins were mixed in 0.5% binding buffer (25 mM HEPES, 35 mM potassium acetate plus 2 mM ADP to a final concentration of 0.1 mg/mL and 0.04 mg/mL respectively). For grid preparation of motor alone KLP61F motor (10 mg/mL) was diluted in binding buffer (50 mM HEPES, 70 mM potassium acetate plus 2 mM AMPNP). All samples were prepared on 1.2/1.3 400-mesh grids (Electron Microscopy Services). Grids were glow-discharged before sample application. The cryo-samples were prepared using a manual plunger, which was placed in a homemade humidity chamber that varied between 80% and 90% relative humidity. A 4 μl amount of the MTs at ∼0.5 μM in 80 mM PIPES, pH 6.8, 4 mM MgCl2, and 1 mM EGTA supplemented with 20 μM Paclitaxel was allowed to absorb for 2 min, and then 4 μl of the KLP61F motor and tail domains were added to the grid. After a short incubation of 2 min, 0.5 μL of Apyrase (25 units) was added and after a short incubation of 3 min the sample was blotted (from the back side of the grid) and plunged into liquid ethane. This procedure was repeated for the motor alone preparations without the addition of the apyrase step.</p></sec><sec id="s4-5"><title>Cryo-EM image analysis, structure determination and model building</title><p>Images of frozen-hydrated KLP61F motor decorated MTs in the AMPPNP state or KLP61F motor and tail decorated MTs in the nucleotide-free state (see <xref ref-type="table" rid="table2">Table 2</xref>) were collected on a Titan Krios (FEI, Hillsboro, OR) operating at 300 keV equipped with a K2 Summit direct electron detector (Gatan, Pleasanton, CA). The data were acquired using the Leginon automated data acquisition (<xref ref-type="bibr" rid="bib51">Suloway et al., 2005</xref>). Image processing was performed within the Appion processing environment (<xref ref-type="bibr" rid="bib33">Lander et al., 2009</xref>). Movies were collected at a nominal magnification of 22500 × with a physical pixel size of 1.31 Å/pixel. Movies were acquired using a dose rate of ~7.96 and 8.3 electrons/pixel/second over 8.25 s yielding a cumulative dose of ~38 and 40 electrons/Å2 (respectively). The MotionCor frame alignment program (<xref ref-type="bibr" rid="bib26">Hirschi et al., 2017</xref>; <xref ref-type="bibr" rid="bib34">Li et al., 2013</xref>) was used to motion-correct. Aligned images were used for CTF determination using CTFFIND4 (<xref ref-type="bibr" rid="bib39">Rohou and Grigorieff, 2015</xref>) and only micrographs yielding CC estimates better than 0.5 at 4 Å resolution were kept. MT segments were manually selected, and overlapping segments were extracted with a spacing of 80 Å along the filament. Binned boxed segments (2.62 Å/pixel, 192 pixel box size) were then subjected to reference-free 2D classification using multivariate statistical analysis (MSA) and multi-reference alignment (MRA) (<xref ref-type="bibr" rid="bib26">Hirschi et al., 2017</xref>). Particles in classes that did not clearly show an 80 Å layer line were excluded from further processing.</p><p>For cryo-EM reconstruction, undecorated 13,14- and 15-protofilament MT densities (<xref ref-type="bibr" rid="bib50">Sui and Downing, 2010</xref>) were used as initial models for all preliminary reconstructions. We used the IHRSR procedure (<xref ref-type="bibr" rid="bib14">Egelman, 2007</xref>) for multi-model projection matching of MT specimens with various numbers of protofilaments (<xref ref-type="bibr" rid="bib3">Alushin et al., 2014</xref>), using libraries from the EMAN2 image processing package (<xref ref-type="bibr" rid="bib52">Tang et al., 2007</xref>). After each round of projection matching, an asymmetric back-projection is generated of aligned segments, and the helical parameters (rise and twist) describing the monomeric tubulin lattice are calculated. These helical parameters are used to generate and average 13, 14 and 15 symmetry-related copies of the asymmetric reconstruction, and the resulting models were used for projection matching during the next round of refinement. The number of particles falling into the different helical families varied. Helical families that had enough segments were further refined. Final refinement of MT segment alignment parameters was performed in FREALIGN (<xref ref-type="bibr" rid="bib21">Grigorieff, 2007</xref> without further refinement of helical parameters. FSC curves were used to estimate the resolution of each reconstruction, using a cutoff of 0.143. To better display the high-resolution features, we applied a B-factor of 200 Å, using the program bfactor (<ext-link ext-link-type="uri" xlink:href="http://grigoriefflab.janelia.org">http://grigoriefflab.janelia.org</ext-link>). The final statistics for all data sets were described in <xref ref-type="table" rid="table2">Table 2</xref>.</p><p>In order to enhance the total mass of the mobile tail density and improve the resolution of the MT decorated with KLP61F motor and tail in the nucleotide-free state, an additional round of ‘MT-patch refinement’ processing was performed enhance conformational homogeneity. The same motion-corrected micrographs and boxes were used, but defocus parameters were re-estimated using GCTF (<xref ref-type="bibr" rid="bib64">Zhang, 2016</xref>). MTs were then sorted into 13, 14, and 15 protofilament MTs using reference alignment as previously described (<xref ref-type="bibr" rid="bib43">Shang et al., 2014</xref>). Of the 29,274 starting particles, roughly two thirds (19,128) MT particles corresponding to the 14 protofilament symmetry were selected for further processing. MTs were then refined using RELION helical processing (<xref ref-type="bibr" rid="bib22">He and Scheres, 2017</xref>). Initially, the asymmetric unit was defined as one full 82 Å repeat (consisting of 13 tubulin dimers), using an initial estimate of zero for the helical twist. Local symmetry searches were performed during the refinement to optimize these parameters. Following refinement, the particle coordinates were smoothed as previously described (<xref ref-type="bibr" rid="bib27">Huehn et al., 2018</xref>). After MT refinement, an additional protofilament refinement step was performed in an attempt to increase resolution of the final volume by correcting for distortions in the MT lattice. To do this, a wedge mask is applied to the final MT volume, resulting in a MT missing a single protofilament. This volume was then rotated and subtracted thirteen times from each experimental image to generate a stack of protofilament particles, with one particle for every tubulin dimer in the imaged filament. In this case, 267,792 protofilament particles were obtained from the original stack of 19,128 MT particles. Protofilament particles alignment parameters were initialized using Euler angles derived from the MT refinement step and subjected to further, local refinement using RELION. The final resolution was computed using the RELION post-processing module with a soft-edged mask. A more detailed description of the protofilament refinement method is currently being prepared for publication (Debs et al. manuscript in preparation). In order to more accurately estimate the resolution of each region of the reconstructed density, a local resolution calculation was performed using the ‘blocres’ function in the Bsoft processing package (<xref ref-type="bibr" rid="bib24">Heymann and Belnap, 2007</xref>). This analysis revealed that the majority of the tubulin density is in the range of 3.5–4.5 Å, while the kinesin portion ranges from 5 to 6 Å resolution and tail density is around 8 Å resolution (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A-C</xref>). Model building was performed using the programs Coot and UCSF chimera using the kinesin-5 structural model (<xref ref-type="bibr" rid="bib54">Turner et al., 2001</xref>). All the ligands were included in the model except the taxol molecule. The model was adjusted using the secondary structure elements in the density maps and analyzed for clash score using Coot and Molprobity (<xref ref-type="table" rid="table3">Table 3</xref>). The maps were compared using the programs UCSF chimera and Coot to determine the transitions of various elements.</p></sec><sec id="s4-6"><title>Reconstitution of human Eg5 motility along single MTs</title><p>Kinesin-5 MT stimulated motility was reconstituted as follows: Flow chambers were assembled from N 1.5 glass coverslips (0.16 mm thick; Ted Pella) that were cleaned with the Piranha protocol and functionalized with 2 mg/mL PEG-2000-silane containing 2 μg/mL biotin-PEG-3400-silane (Laysan Bio) suspended in 80% at pH 1 (<xref ref-type="bibr" rid="bib23">Henty-Ridilla et al., 2016</xref>). After the flow chamber was assembled, 0.1 mg/mL NeutrAvidin (Thermofisher) was used to functionalize surfaces. Biotin and Alexa-Fluor-633-labeled porcine tubulin were generated in the laboratory as described (<xref ref-type="bibr" rid="bib2">Al-Bassam, 2014</xref>) and were polymerized using the non-hydrolysable GTP analog guanosine-5’-[(α,β)-methyleno] triphosphate (termed GMPCPP; Jena Biosciences) or using the MT stabilizing drug, Paclitaxel (sigma). These MTs (100–200 μg/mL in BRB-80: 80 mM PIPES, 1 mM MgCl<sub>2</sub> and 1 mM ETGA; pH 6.8, 1% glycerol, 0.5% pluronic-F127, 0.3 mg/ml casein, 3 mM BME, 4 mM ATP-MgCl2) were flowed into chambers and attached to glass via biotin-neutravidin linkage. Flow chambers were then extensively washed with imaging buffer (25 mM HEPES, 25–100 mM KCl, pH 7.5, 10 mM beta-mercatopethanol; 1% glycerol, 0.5% Pluronic-F127, 0.3 mg/ml casein, 3 mM BME, 4 mM ATP-MgCl2). Kinesin-5 MT-stimulated motility was reconstituted at 25°C by injecting 1–20 nM FL-Eg5-GFP combined with a photobleach-correction mixture into flow chambers (<xref ref-type="bibr" rid="bib53">Telley et al., 2011</xref>). Movies were captured in TIRF mode using a Nikon Eclipse Ti microscope using 1.5 Na objective and an Andor IXon3 EM-CCD operating with three (488 nm, 560 nm and 640 nm) emission filters using alternating filter wheel in 2 s increments operated using elements software (Nikon).</p></sec><sec id="s4-7"><title>Reconstitution of human Eg5 MT sliding motility</title><p>To study MT sliding activities in vitro, flow chambers were prepared as described above and either Paclitaxel or GMPCPP stabilized AlexaF-633 and biotin labeled MTs were anchored along their surface via Biotin-Neutravidin linkage. A mixture of 1–20 nM FL-Eg5-GFP or 20–200 nM Eg5-Δtail-GFP were mixed with 100–200 μg/ml AlexaF-560 labeled MTs and injected into these flow chambers, after being equilibrated with imaging buffer. Imaging was initiated as described above almost immediately and areas of MT sliding events were identified through search. At 3–20 nM FL-Eg5-GFP robust free MT crosslinking (yellow) was observed, followed by zippering along anchored MT (red) and then MT sliding was consistently observed (<xref ref-type="fig" rid="fig4">Figure 4B</xref>, <xref ref-type="video" rid="video2">Videos 2</xref>–<xref ref-type="video" rid="video3">3</xref>). In contrast, 3–20 nM Eg5-Δtail-GFP MT crosslinking was often observed but free-MTs (yellow) did not zipper along the anchored MT (red) and remain in scissoring motion for extensive periods (<xref ref-type="fig" rid="fig4">Figure 4B</xref>).</p><p>For MT sliding and kinesin-5 spiking studies, MT sliding experiments were performed as described above with the exception of using 20 nM FL-Eg5. Eg5-GFP spiking was carried out by the addition of either 1 nM FL-Eg5-GFP or 1 nM Eg5-Δtail-GFP with 100–200 μg/ml AlexaF-560-MTs in imaging buffer conditions. TIRF Imaging was carried out as described above.</p></sec><sec id="s4-8"><title>Image analysis of motor motility and MT sliding motility</title><p>Image movie stacks were preprocessed with photobleach correction and image stabilization plugins using the program FIJI (<xref ref-type="bibr" rid="bib41">Schindelin et al., 2012</xref>). For motility along individual MTs, individual FL-Eg5-GFP or Eg5-Δtail-GFP motor motility events were identified along anchored MTs based on kymographs in generated for multiple channels. The FIJI plugin, trackmate, (<xref ref-type="bibr" rid="bib41">Schindelin et al., 2012</xref>) was used to measure particle motility rates and identify their run lengths. Large collections of motile events for FL-Eg5-GFP or Eg5-Δtail-GFP conditions were collected for 25, 50, and 100 mM KCl conditions (<xref ref-type="table" rid="table4">Table 4</xref>). Average MT parameters were determined by frequency binning the motility events in a range conditions and then fitting these events using Gaussian distributions using the program Prism (<xref ref-type="table" rid="table4">Table 4</xref>). In general, all parameters fit single Gaussian distributions. Run lengths were fitted using exponential decay to identify the half-length for each motor condition. T-tests were performed to determine significance of the differences observed.</p><p>For motor fluorescence intensity quantifications, kymographs were manually analyzed using the line tool in FIJI, a line was placed over the initial signal of an individual Eg5 molecule and an intensity profile was generated and recorded in Microsoft Excel. The line was extended to include an area of the kymograph where a fluorescent signal was absent in order to measure the local surrounding background signal. This background measurement was subtracted from the initial fluorescence intensity of the molecules signal in Microsoft Excel. Only molecules that were observed to have landed on the MT during the observation period, and that were motile were used for quantification. The intensity data were frequency binned and Gaussian fit using Prism.</p><p>For MT sliding and MT sliding spiking assays, image analysis was carried out as described above with the exception of visualizing the free-MT sliding motility with respect to the anchored MT using 560 nm emission channel. The motility patterns FL-Eg5-GFP or Eg5-Δtail-GFP motor particles were studied with respect to sliding zone (along both the free and anchored MT) using the FIJI plugin, Trackmate, to determine motor velocities and their changes in motility direction inside or outside the sliding zone.</p></sec><sec id="s4-9"><title>Measuring pushing forces by optical trapping human Eg5 MT sliding events</title><p>To study Eg5 MT sliding forces in optical trapping, flow chambers were prepared as described above and previously (<xref ref-type="bibr" rid="bib46">Shimamoto et al., 2015</xref>). Paclitaxel stabilized Hilyte-649 and biotin labeled MTs were anchored along their surface via Biotin-Neutravidin attachment. Polystyrene beads were coated with kinesin-1 nucleotide-free mutant and linked to Rhodamine labeled MTs (bead attached free-MTs). These bead attached free-MTs were then mixed with 1–20 nM FL-Eg5-GFP or 1–500 nM Eg5-Δtail-GFP and injected into these flow chambers, after being equilibrated with imaging buffer. The beads attached free MTs were observed to interact with the anchored MTs and locked into the optical trap to measure the forces. Generally, 3–10 nM FL-Eg5-GFP was sufficient to observe MT sliding events, while 3–10 nM Eg5-Δtail-GFP rarely produced sliding events, and mostly crosslinked without zippering into sliding zones forming scissoring events. At 200–500 nM Eg5-Δtail-GFP, we observed sufficient MT sliding events. For each event, the length of the sliding zone, the total Eg5-GFP intensity, and plateau pushing forces developed were measured and used for scaled comparisons (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). The Eg5-GFP intensity scaled linearly with the MT overlap MT sliding zone length without significant difference between FL-Eg5-GFP or Eg5-Δtail-GFP conditions, despite the difference in the concentration using in the assay (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). The plateau forces generated by FL-Eg5-GFP scaled linearly with the size of the overlap MT sliding zone length, with seven-fold difference in the slope of the same comparison for Eg5-Δtail-GFP data.</p></sec><sec id="s4-10"><title>Transfection of hela cells and in vivo imaging</title><p>HeLa cells were cultured in Minimal Essential Media-α (Gibco) supplemented with 10% fetal bovine serum (Gibco). HeLa cells were authenticated by STR genotyping by the Vermont Integrative Genomics Resource. Cells were maintained at 37°C with 5% CO<sub>2</sub>. Transient transfections of plasmid DNA were performed via electroporation using a Nucleofector 4D system, pulse code CN114, and Cell Line SE reagents (Lonza). Cells were plated onto 12 mm glass coverslips (Electron Microscopy Sciences) for fixed cell immunofluorescence, 4-chamber 35 mm glass-bottom dishes (Greiner Bio-One) for live cell imaging, or 60 mm polystyrene tissue culture dishes for lysate collection.</p><p>To assess the protein levels in vivo, cells were arrested in 100 μM monastrol (Selleckchem) overnight and lysed in PHEM buffer (60 mM PIPES, 25 mM HEPES, 10 mM EGTA, 4 mM MgSO<sub>4</sub>) with Halt Protease and Phosphatase Inhibitor cocktail (Thermo-Fisher) on ice. Lysates were extracted on ice for 10 min and centrifuged at 21,130 x g for 10 min. An equal volume of 4X Laemmli buffer (Bio-Rad) was added to the supernatant and samples were heated to 95°C for 10 min. Lysates were separated by electrophoresis on 4–15% Tris-glycine polyacrylamide gels (Bio-Rad) and transferred to polyvinylidene fluoride membranes (Bio-Rad). Membranes were blocked in Odyssey blocking reagent (LI-COR) diluted 1:1 in tris-buffered saline for 1 hr, incubated with rabbit anti-mCh (diluted 1:1000, AbCam) and mouse anti-GAPDH (diluted 1:10,000, Thermo-Fisher) primary antibodies overnight, and incubated with IRDye 800- and IRDye 680-tagged fluorescent secondary antibodies (LI-COR) for 1 hr. Blot fluorescence was imaged using an Odyssey CLx system (LI-COR) and analyzed using Image Studio Lite (LI-COR).</p><p>Fixed and live cell imaging was performed using a Nikon Ti-E inverted microscope controlled by NIS Elements software (Nikon Instruments) with a Plan APO 60X/1.42 NA oil immersion objective or APO 100X/1.49 NA oil immersion objective (Nikon Instruments), Spectra-X light engine (Lumencore), and Clara CCD camera (Andor). Image processing was performed using NIS Elements (Nikon Instruments) and ImageJ (NIH). Data analysis and statistical comparisons were performed using Excel (Microsoft) and Prism (GraphPad Software).</p><p>For assessment of mCh and Eg5-mCh expression levels and localization at metaphase in fixed HeLa cells, cells were treated with 20 μM MG132 (Selleckchem) 2 hr prior to fixation. Cells were fixed for 10 min in 1% paraformaldehyde (Electron Microscopy Sciences) in ice-cold methanol (Thermo-Fisher). Cells were blocked using 20% goat serum in antibody-diluting buffer (AbDil, 1X tris-buffered saline with 2% bovine serum albumin, 0.1% Triton-X 100, and 0.1% sodium azide) for 1 hr, incubated with mouse anti-α-tubulin primary antibodies (DM1a, Sigma-Aldrich, diluted 1:750 in AbDil) for 1 hr, and incubated in fluorescent secondary antibodies conjugated to Alexa Fluor 488 or 647 (Life Technologies, diluted 1:500 in AbDil) for 1 hr. Cells were mounted in ProLong Gold with DAPI (Thermo-Fisher). Expression levels of mCh-tagged proteins were compared by drawing elliptical regions of interest (ROIs) around mitotic cells using α-tubulin staining, measuring mCh fluorescence intensity within the cellular ROIs, and subtracting averaged intensity from two background ROIs containing no visible cells. Localization was assessed by defining an ROI as the spindle based on α-tubulin staining and an ROI as cytoplasm by subtracting this spindle ROI from an ellipse that encompassed the cell. Intensity of mCh signal was measured in both the spindle and cytoplasm ROIs, and a ratio of spindle to cytoplasm intensity calculated.</p><p>For live cell imaging, growth media was exchanged for CO<sub>2</sub>-Independent Media (Gibco) supplemented with 10% fetal bovine serum (Gibco) and penicillin/streptomycin (Gibco). For assessment of localization after treatment with BRD-9876 (Tocris Bioscience), HeLa cells were treated with 20 μM MG132 (Selleckchem) for 2 hr prior to imaging. Cells were imaged prior to drug addition, 1 min after addition of 5 μM BRD-9876, and subsequently once every 5 min. For assessment of localization in anaphase, cells in metaphase were identified and imaged at 2 min intervals through anaphase. For both live cell assays, localization of proteins to the spindle was quantified as described for fixed cell imaging, with the spindle ROI defined by GFP-tubulin signal.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Dr Jonathan Scholey (Molecular Cellular Biology) for inspiring JAB with excitement about studying kinesin-5 mechanism. JAB is supported by funding support from the NSF- 1615991 and NIH-GM110283. RM. is supported by funding from NIH-GM052468. RJM is supported by funding from the NIH- GM124889. SR is supported by funding from NIH-GM130556. LG is supported in part by funding from the Israel Science Foundation (ISF) (ISF 386/18), and US NSF-Israel Binational science foundation (BSF-2015851). JS is supported by funds from the NIH-GM121491 and NIH-GM130556.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology</p></fn><fn fn-type="con" id="con2"><p>Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization</p></fn><fn fn-type="con" id="con3"><p>Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization</p></fn><fn fn-type="con" id="con4"><p>Data curation, Formal analysis, Funding acquisition, Investigation, Visualization</p></fn><fn fn-type="con" id="con5"><p>Data curation, Formal analysis, Funding acquisition, Investigation</p></fn><fn fn-type="con" id="con6"><p>Data curation, Formal analysis, Funding acquisition, Investigation</p></fn><fn fn-type="con" id="con7"><p>Data curation, Formal analysis, Funding acquisition, Investigation</p></fn><fn fn-type="con" id="con8"><p>Formal analysis, Investigation, Methodology</p></fn><fn fn-type="con" id="con9"><p>Data curation, Investigation</p></fn><fn fn-type="con" id="con10"><p>Formal analysis, Investigation</p></fn><fn fn-type="con" id="con11"><p>Data curation, Formal analysis, Investigation, Visualization, Methodology</p></fn><fn fn-type="con" id="con12"><p>Data curation, Formal analysis, Investigation</p></fn><fn fn-type="con" id="con13"><p>Formal analysis, Investigation</p></fn><fn fn-type="con" id="con14"><p>Data curation, Formal analysis, Funding acquisition</p></fn><fn fn-type="con" id="con15"><p>Data curation, Formal analysis, Validation, Investigation, Methodology</p></fn><fn fn-type="con" id="con16"><p>Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology</p></fn><fn fn-type="con" id="con17"><p>Data curation, Formal analysis, Investigation, Visualization, Methodology</p></fn><fn fn-type="con" id="con18"><p>Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="docx" mimetype="application" xlink:href="elife-51131-transrepform-v2.docx"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>The atomic coordinate file for Dm-KLP61F motor AMPPNP MT(alpha-beta-tubulin) asymmetric unit model is available at Protein Data Bank (PDB-ID: 6VPO) The Dm-KLP61F motor nucleotide-free MT(alpha-beta-tubulin) asymmetric unit model is available at Protein Data Bank (PDB-ID: 6VPP). The refined Dm-KLP61F motor AMPPNP MT cryo-EM map is available at the Electron microscopy Data bank (EMDB ID:EMD-21314) and the Dm-KLP61F motor-tail nucleotide-free (focused classification map) MT cryo-EM map is available at Electron microscopy Data bank (EMDB-iD:EMD-2135).</p><p>The following datasets were generated:</p><p><element-citation id="dataset1" publication-type="data" specific-use="isSupplementedBy"><person-group person-group-type="author"><name><surname>Wilson-Kubalek</surname><given-names>E</given-names></name><name><surname>Nithianantham</surname><given-names>S</given-names></name><name><surname>Al-Bassam</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><data-title>Atomic model for Klp61F motor domain AMPPNP in complex with alpha-beta tubulin microtubule asymmetric unit</data-title><source>RCSB Protein Data Bank</source><pub-id assigning-authority="PDB" pub-id-type="accession" xlink:href="https://www.rcsb.org/structure/6VPO">6VPO</pub-id></element-citation></p><p><element-citation id="dataset2" publication-type="data" specific-use="isSupplementedBy"><person-group person-group-type="author"><name><surname>Wilson-Kubalek</surname><given-names>E</given-names></name><name><surname>Nithianantham</surname><given-names>S</given-names></name><name><surname>Al-Bassam</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><data-title>Cryo-EM map for KLP61F motor domain AMPPNP in complex with alpha-beta tubulin microtubule asymmetric unit</data-title><source>Electron Microscopy Data Bank</source><pub-id assigning-authority="EMDB" pub-id-type="accession" xlink:href="https://www.ebi.ac.uk/pdbe/entry/emdb/EMD-21314">EMD-21314</pub-id></element-citation></p><p><element-citation id="dataset3" publication-type="data" specific-use="isSupplementedBy"><person-group person-group-type="author"><name><surname>Wilson-Kubalek</surname><given-names>E</given-names></name><name><surname>Nithianantham</surname><given-names>S</given-names></name><name><surname>Al-Bassam</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><data-title>Atomic model for Klp61F motor domain in the nucleotide free state in complex with alpha-beta-tubulin microtubule asymmetric unit</data-title><source>RCSB Protein Data Bank</source><pub-id assigning-authority="PDB" pub-id-type="accession" xlink:href="https://www.rcsb.org/structure/6VPP">6VPP</pub-id></element-citation></p><p><element-citation id="dataset4" publication-type="data" specific-use="isSupplementedBy"><person-group person-group-type="author"><name><surname>Wilson-Kubalek</surname><given-names>E</given-names></name><name><surname>Nithianantham</surname><given-names>S</given-names></name><name><surname>Al-Bassam</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><data-title>Cryo-EM map (locally classified) for KLP61F motor and tail domain complex in the nucleotide free state with alpha-beta tubulin microtubule asymmetric unit</data-title><source>Electron Microscopy Data Bank</source><pub-id assigning-authority="EMDB" pub-id-type="accession" xlink:href="https://www.ebi.ac.uk/pdbe/entry/emdb/EMD-21315">EMD-21315</pub-id></element-citation></p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Acar</surname> <given-names>S</given-names></name><name><surname>Carlson</surname> <given-names>DB</given-names></name><name><surname>Budamagunta</surname> <given-names>MS</given-names></name><name><surname>Yarov-Yarovoy</surname> <given-names>V</given-names></name><name><surname>Correia</surname> <given-names>JJ</given-names></name><name><surname>Niñonuevo</surname> <given-names>MR</given-names></name><name><surname>Jia</surname> <given-names>W</given-names></name><name><surname>Tao</surname> <given-names>L</given-names></name><name><surname>Leary</surname> <given-names>JA</given-names></name><name><surname>Voss</surname> <given-names>JC</given-names></name><name><surname>Evans</surname> <given-names>JE</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>The bipolar assembly domain of the mitotic motor kinesin-5</article-title><source>Nature Communications</source><volume>4</volume><elocation-id>1343</elocation-id><pub-id pub-id-type="doi">10.1038/ncomms2348</pub-id><pub-id pub-id-type="pmid">23299893</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Al-Bassam</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Reconstituting dynamic microtubule polymerization regulation by TOG domain proteins</article-title><source>Methods in Enzymology</source><volume>540</volume><fpage>131</fpage><lpage>148</lpage><pub-id pub-id-type="doi">10.1016/B978-0-12-397924-7.00008-X</pub-id><pub-id pub-id-type="pmid">24630105</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Alushin</surname> <given-names>GM</given-names></name><name><surname>Lander</surname> <given-names>GC</given-names></name><name><surname>Kellogg</surname> <given-names>EH</given-names></name><name><surname>Zhang</surname> <given-names>R</given-names></name><name><surname>Baker</surname> <given-names>D</given-names></name><name><surname>Nogales</surname> <given-names>E</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>High-resolution microtubule structures reveal the structural transitions in αβ-tubulin upon GTP hydrolysis</article-title><source>Cell</source><volume>157</volume><fpage>1117</fpage><lpage>1129</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2014.03.053</pub-id><pub-id pub-id-type="pmid">24855948</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Blangy</surname> <given-names>A</given-names></name><name><surname>Lane</surname> <given-names>HA</given-names></name><name><surname>d'Hérin</surname> <given-names>P</given-names></name><name><surname>Harper</surname> <given-names>M</given-names></name><name><surname>Kress</surname> <given-names>M</given-names></name><name><surname>Nigg</surname> <given-names>EA</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Phosphorylation by p34cdc2 regulates spindle association of human Eg5, a kinesin-related motor essential for bipolar spindle formation in vivo</article-title><source>Cell</source><volume>83</volume><fpage>1159</fpage><lpage>1169</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(95)90142-6</pub-id><pub-id pub-id-type="pmid">8548803</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Britto</surname> <given-names>M</given-names></name><name><surname>Goulet</surname> <given-names>A</given-names></name><name><surname>Rizvi</surname> <given-names>S</given-names></name><name><surname>von Loeffelholz</surname> <given-names>O</given-names></name><name><surname>Moores</surname> <given-names>CA</given-names></name><name><surname>Cross</surname> <given-names>RA</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title><italic>Schizosaccharomyces pombe</italic> kinesin-5 switches direction using a steric blocking mechanism</article-title><source>PNAS</source><volume>113</volume><fpage>E7483</fpage><lpage>E7489</lpage><pub-id pub-id-type="doi">10.1073/pnas.1611581113</pub-id><pub-id pub-id-type="pmid">27834216</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brust-Mascher</surname> <given-names>I</given-names></name><name><surname>Sommi</surname> <given-names>P</given-names></name><name><surname>Cheerambathur</surname> <given-names>DK</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Kinesin-5-dependent poleward flux and spindle length control in <italic>Drosophila</italic> embryo mitosis</article-title><source>Molecular Biology of the Cell</source><volume>20</volume><fpage>1749</fpage><lpage>1762</lpage><pub-id pub-id-type="doi">10.1091/mbc.e08-10-1033</pub-id><pub-id pub-id-type="pmid">19158379</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cao</surname> <given-names>L</given-names></name><name><surname>Wang</surname> <given-names>W</given-names></name><name><surname>Jiang</surname> <given-names>Q</given-names></name><name><surname>Wang</surname> <given-names>C</given-names></name><name><surname>Knossow</surname> <given-names>M</given-names></name><name><surname>Gigant</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>The structure of apo-kinesin bound to tubulin links the nucleotide cycle to movement</article-title><source>Nature Communications</source><volume>5</volume><elocation-id>5364</elocation-id><pub-id pub-id-type="doi">10.1038/ncomms6364</pub-id><pub-id pub-id-type="pmid">25395082</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Castoldi</surname> <given-names>M</given-names></name><name><surname>Popov</surname> <given-names>AV</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Purification of brain tubulin through two cycles of polymerization-depolymerization in a high-molarity buffer</article-title><source>Protein Expression and Purification</source><volume>32</volume><fpage>83</fpage><lpage>88</lpage><pub-id pub-id-type="doi">10.1016/S1046-5928(03)00218-3</pub-id><pub-id pub-id-type="pmid">14680943</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname> <given-names>VB</given-names></name><name><surname>Arendall</surname> <given-names>WB</given-names></name><name><surname>Headd</surname> <given-names>JJ</given-names></name><name><surname>Keedy</surname> <given-names>DA</given-names></name><name><surname>Immormino</surname> <given-names>RM</given-names></name><name><surname>Kapral</surname> <given-names>GJ</given-names></name><name><surname>Murray</surname> <given-names>LW</given-names></name><name><surname>Richardson</surname> <given-names>JS</given-names></name><name><surname>Richardson</surname> <given-names>DC</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>MolProbity: all-atom structure validation for macromolecular crystallography</article-title><source>Acta Crystallographica Section D Biological Crystallography</source><volume>66</volume><fpage>12</fpage><lpage>21</lpage><pub-id pub-id-type="doi">10.1107/S0907444909042073</pub-id><pub-id pub-id-type="pmid">20057044</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname> <given-names>GY</given-names></name><name><surname>Kang</surname> <given-names>YJ</given-names></name><name><surname>Gayek</surname> <given-names>AS</given-names></name><name><surname>Youyen</surname> <given-names>W</given-names></name><name><surname>Tüzel</surname> <given-names>E</given-names></name><name><surname>Ohi</surname> <given-names>R</given-names></name><name><surname>Hancock</surname> <given-names>WO</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Eg5 inhibitors have contrasting effects on microtubule stability and metaphase spindle integrity</article-title><source>ACS Chemical Biology</source><volume>12</volume><fpage>1038</fpage><lpage>1046</lpage><pub-id pub-id-type="doi">10.1021/acschembio.6b01040</pub-id><pub-id pub-id-type="pmid">28165699</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><collab>Collaborative Computational Project, Number 4</collab></person-group><year iso-8601-date="1994">1994</year><article-title>The CCP4 suite: programs for protein crystallography</article-title><source>Acta Crystallographica Section D Biological Crystallography</source><volume>50</volume><fpage>760</fpage><lpage>763</lpage><pub-id pub-id-type="doi">10.1107/S0907444994003112</pub-id><pub-id pub-id-type="pmid">15299374</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Düselder</surname> <given-names>A</given-names></name><name><surname>Fridman</surname> <given-names>V</given-names></name><name><surname>Thiede</surname> <given-names>C</given-names></name><name><surname>Wiesbaum</surname> <given-names>A</given-names></name><name><surname>Goldstein</surname> <given-names>A</given-names></name><name><surname>Klopfenstein</surname> <given-names>DR</given-names></name><name><surname>Zaitseva</surname> <given-names>O</given-names></name><name><surname>Janson</surname> <given-names>ME</given-names></name><name><surname>Gheber</surname> <given-names>L</given-names></name><name><surname>Schmidt</surname> <given-names>CF</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Deletion of the tail domain of the Kinesin-5 Cin8 affects its directionality</article-title><source>Journal of Biological Chemistry</source><volume>290</volume><fpage>16841</fpage><lpage>16850</lpage><pub-id pub-id-type="doi">10.1074/jbc.M114.620799</pub-id><pub-id pub-id-type="pmid">25991727</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edamatsu</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Bidirectional motility of the fission yeast kinesin-5, Cut7</article-title><source>Biochemical and Biophysical Research Communications</source><volume>446</volume><fpage>231</fpage><lpage>234</lpage><pub-id pub-id-type="doi">10.1016/j.bbrc.2014.02.106</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Egelman</surname> <given-names>EH</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>The iterative helical real space reconstruction method: surmounting the problems posed by real polymers</article-title><source>Journal of Structural Biology</source><volume>157</volume><fpage>83</fpage><lpage>94</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2006.05.015</pub-id><pub-id pub-id-type="pmid">16919474</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Emsley</surname> <given-names>P</given-names></name><name><surname>Lohkamp</surname> <given-names>B</given-names></name><name><surname>Scott</surname> <given-names>WG</given-names></name><name><surname>Cowtan</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Features and development of coot</article-title><source>Acta Crystallographica. Section D, Biological Crystallography</source><volume>66</volume><fpage>486</fpage><lpage>501</lpage><pub-id pub-id-type="doi">10.1107/S0907444910007493</pub-id><pub-id pub-id-type="pmid">20383002</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Forth</surname> <given-names>S</given-names></name><name><surname>Kapoor</surname> <given-names>TM</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>The mechanics of microtubule networks in cell division</article-title><source>The Journal of Cell Biology</source><volume>216</volume><fpage>1525</fpage><lpage>1531</lpage><pub-id pub-id-type="doi">10.1083/jcb.201612064</pub-id><pub-id pub-id-type="pmid">28490474</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fridman</surname> <given-names>V</given-names></name><name><surname>Gerson-Gurwitz</surname> <given-names>A</given-names></name><name><surname>Shapira</surname> <given-names>O</given-names></name><name><surname>Movshovich</surname> <given-names>N</given-names></name><name><surname>Lakämper</surname> <given-names>S</given-names></name><name><surname>Schmidt</surname> <given-names>CF</given-names></name><name><surname>Gheber</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Kinesin-5 Kip1 is a bi-directional motor that stabilizes microtubules and tracks their plus-ends in vivo</article-title><source>Journal of Cell Science</source><volume>126</volume><fpage>4147</fpage><lpage>4159</lpage><pub-id pub-id-type="doi">10.1242/jcs.125153</pub-id><pub-id pub-id-type="pmid">23868978</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gerson-Gurwitz</surname> <given-names>A</given-names></name><name><surname>Thiede</surname> <given-names>C</given-names></name><name><surname>Movshovich</surname> <given-names>N</given-names></name><name><surname>Fridman</surname> <given-names>V</given-names></name><name><surname>Podolskaya</surname> <given-names>M</given-names></name><name><surname>Danieli</surname> <given-names>T</given-names></name><name><surname>Lakämper</surname> <given-names>S</given-names></name><name><surname>Klopfenstein</surname> <given-names>DR</given-names></name><name><surname>Schmidt</surname> <given-names>CF</given-names></name><name><surname>Gheber</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Directionality of individual kinesin-5 Cin8 motors is modulated by loop 8, ionic strength and microtubule geometry</article-title><source>The EMBO Journal</source><volume>30</volume><fpage>4942</fpage><lpage>4954</lpage><pub-id pub-id-type="doi">10.1038/emboj.2011.403</pub-id><pub-id pub-id-type="pmid">22101328</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Goshima</surname> <given-names>G</given-names></name><name><surname>Wollman</surname> <given-names>R</given-names></name><name><surname>Stuurman</surname> <given-names>N</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name><name><surname>Vale</surname> <given-names>RD</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Length control of the metaphase spindle</article-title><source>Current Biology</source><volume>15</volume><fpage>1979</fpage><lpage>1988</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2005.09.054</pub-id><pub-id pub-id-type="pmid">16303556</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Goshima</surname> <given-names>G</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Control of mitotic spindle length</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>26</volume><fpage>21</fpage><lpage>57</lpage><pub-id pub-id-type="doi">10.1146/annurev-cellbio-100109-104006</pub-id><pub-id pub-id-type="pmid">20604709</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Grigorieff</surname> <given-names>N</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>FREALIGN: high-resolution refinement of single particle structures</article-title><source>Journal of Structural Biology</source><volume>157</volume><fpage>117</fpage><lpage>125</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2006.05.004</pub-id><pub-id pub-id-type="pmid">16828314</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>He</surname> <given-names>S</given-names></name><name><surname>Scheres</surname> <given-names>SHW</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Helical reconstruction in RELION</article-title><source>Journal of Structural Biology</source><volume>198</volume><fpage>163</fpage><lpage>176</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2017.02.003</pub-id><pub-id pub-id-type="pmid">28193500</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Henty-Ridilla</surname> <given-names>JL</given-names></name><name><surname>Rankova</surname> <given-names>A</given-names></name><name><surname>Eskin</surname> <given-names>JA</given-names></name><name><surname>Kenny</surname> <given-names>K</given-names></name><name><surname>Goode</surname> <given-names>BL</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Accelerated actin filament polymerization from microtubule plus ends</article-title><source>Science</source><volume>352</volume><fpage>1004</fpage><lpage>1009</lpage><pub-id pub-id-type="doi">10.1126/science.aaf1709</pub-id><pub-id pub-id-type="pmid">27199431</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heymann</surname> <given-names>JB</given-names></name><name><surname>Belnap</surname> <given-names>DM</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Bsoft: image processing and molecular modeling for electron microscopy</article-title><source>Journal of Structural Biology</source><volume>157</volume><fpage>3</fpage><lpage>18</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2006.06.006</pub-id><pub-id pub-id-type="pmid">17011211</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hildebrandt</surname> <given-names>ER</given-names></name><name><surname>Gheber</surname> <given-names>L</given-names></name><name><surname>Kingsbury</surname> <given-names>T</given-names></name><name><surname>Hoyt</surname> <given-names>MA</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Homotetrameric form of Cin8p, a <italic>Saccharomyces cerevisiae</italic> kinesin-5 motor, is essential for its <italic>in</italic> vivo function</article-title><source>The Journal of Biological Chemistry</source><volume>281</volume><fpage>26004</fpage><lpage>26013</lpage><pub-id pub-id-type="doi">10.1074/jbc.M604817200</pub-id><pub-id pub-id-type="pmid">16829678</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hirschi</surname> <given-names>M</given-names></name><name><surname>Herzik</surname> <given-names>MA</given-names></name><name><surname>Wie</surname> <given-names>J</given-names></name><name><surname>Suo</surname> <given-names>Y</given-names></name><name><surname>Borschel</surname> <given-names>WF</given-names></name><name><surname>Ren</surname> <given-names>D</given-names></name><name><surname>Lander</surname> <given-names>GC</given-names></name><name><surname>Lee</surname> <given-names>SY</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Cryo-electron microscopy structure of the lysosomal calcium-permeable channel TRPML3</article-title><source>Nature</source><volume>550</volume><fpage>411</fpage><lpage>414</lpage><pub-id pub-id-type="doi">10.1038/nature24055</pub-id><pub-id pub-id-type="pmid">29019979</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huehn</surname> <given-names>A</given-names></name><name><surname>Cao</surname> <given-names>W</given-names></name><name><surname>Elam</surname> <given-names>WA</given-names></name><name><surname>Liu</surname> <given-names>X</given-names></name><name><surname>De La Cruz</surname> <given-names>EM</given-names></name><name><surname>Sindelar</surname> <given-names>CV</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>The actin filament twist changes abruptly at boundaries between bare and cofilin-decorated segments</article-title><source>Journal of Biological Chemistry</source><volume>293</volume><fpage>5377</fpage><lpage>5383</lpage><pub-id pub-id-type="doi">10.1074/jbc.AC118.001843</pub-id><pub-id pub-id-type="pmid">29463680</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kapitein</surname> <given-names>LC</given-names></name><name><surname>Peterman</surname> <given-names>EJ</given-names></name><name><surname>Kwok</surname> <given-names>BH</given-names></name><name><surname>Kim</surname> <given-names>JH</given-names></name><name><surname>Kapoor</surname> <given-names>TM</given-names></name><name><surname>Schmidt</surname> <given-names>CF</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks</article-title><source>Nature</source><volume>435</volume><fpage>114</fpage><lpage>118</lpage><pub-id pub-id-type="doi">10.1038/nature03503</pub-id><pub-id pub-id-type="pmid">15875026</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kapitein</surname> <given-names>LC</given-names></name><name><surname>Kwok</surname> <given-names>BH</given-names></name><name><surname>Weinger</surname> <given-names>JS</given-names></name><name><surname>Schmidt</surname> <given-names>CF</given-names></name><name><surname>Kapoor</surname> <given-names>TM</given-names></name><name><surname>Peterman</surname> <given-names>EJG</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Microtubule cross-linking triggers the directional motility of kinesin-5</article-title><source>The Journal of Cell Biology</source><volume>182</volume><fpage>421</fpage><lpage>428</lpage><pub-id pub-id-type="doi">10.1083/jcb.200801145</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kashina</surname> <given-names>AS</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name><name><surname>Leszyk</surname> <given-names>JD</given-names></name><name><surname>Saxton</surname> <given-names>WM</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>An essential bipolar mitotic motor</article-title><source>Nature</source><volume>384</volume><elocation-id>225</elocation-id><pub-id pub-id-type="doi">10.1038/384225a0</pub-id><pub-id pub-id-type="pmid">8918872</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kelley</surname> <given-names>LA</given-names></name><name><surname>Mezulis</surname> <given-names>S</given-names></name><name><surname>Yates</surname> <given-names>CM</given-names></name><name><surname>Wass</surname> <given-names>MN</given-names></name><name><surname>Sternberg</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>The Phyre2 web portal for protein modeling, prediction and analysis</article-title><source>Nature Protocols</source><volume>10</volume><fpage>845</fpage><lpage>858</lpage><pub-id pub-id-type="doi">10.1038/nprot.2015.053</pub-id><pub-id pub-id-type="pmid">25950237</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kwok</surname> <given-names>BH</given-names></name><name><surname>Kapitein</surname> <given-names>LC</given-names></name><name><surname>Kim</surname> <given-names>JH</given-names></name><name><surname>Peterman</surname> <given-names>EJ</given-names></name><name><surname>Schmidt</surname> <given-names>CF</given-names></name><name><surname>Kapoor</surname> <given-names>TM</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Allosteric inhibition of kinesin-5 modulates its processive directional motility</article-title><source>Nature Chemical Biology</source><volume>2</volume><fpage>480</fpage><lpage>485</lpage><pub-id pub-id-type="doi">10.1038/nchembio812</pub-id><pub-id pub-id-type="pmid">16892050</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lander</surname> <given-names>GC</given-names></name><name><surname>Stagg</surname> <given-names>SM</given-names></name><name><surname>Voss</surname> <given-names>NR</given-names></name><name><surname>Cheng</surname> <given-names>A</given-names></name><name><surname>Fellmann</surname> <given-names>D</given-names></name><name><surname>Pulokas</surname> <given-names>J</given-names></name><name><surname>Yoshioka</surname> <given-names>C</given-names></name><name><surname>Irving</surname> <given-names>C</given-names></name><name><surname>Mulder</surname> <given-names>A</given-names></name><name><surname>Lau</surname> <given-names>PW</given-names></name><name><surname>Lyumkis</surname> <given-names>D</given-names></name><name><surname>Potter</surname> <given-names>CS</given-names></name><name><surname>Carragher</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Appion: an integrated, database-driven pipeline to facilitate EM image processing</article-title><source>Journal of Structural Biology</source><volume>166</volume><fpage>95</fpage><lpage>102</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2009.01.002</pub-id><pub-id pub-id-type="pmid">19263523</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>X</given-names></name><name><surname>Mooney</surname> <given-names>P</given-names></name><name><surname>Zheng</surname> <given-names>S</given-names></name><name><surname>Booth</surname> <given-names>CR</given-names></name><name><surname>Braunfeld</surname> <given-names>MB</given-names></name><name><surname>Gubbens</surname> <given-names>S</given-names></name><name><surname>Agard</surname> <given-names>DA</given-names></name><name><surname>Cheng</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Electron counting and beam-induced motion correction enable near-atomic-resolution single-particle cryo-EM</article-title><source>Nature Methods</source><volume>10</volume><fpage>584</fpage><lpage>590</lpage><pub-id pub-id-type="doi">10.1038/nmeth.2472</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mayer</surname> <given-names>TU</given-names></name><name><surname>Kapoor</surname> <given-names>TM</given-names></name><name><surname>Haggarty</surname> <given-names>SJ</given-names></name><name><surname>King</surname> <given-names>RW</given-names></name><name><surname>Schreiber</surname> <given-names>SL</given-names></name><name><surname>Mitchison</surname> <given-names>TJ</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Small molecule inhibitor of mitotic spindle bipolarity identified in a phenotype-based screen</article-title><source>Science</source><volume>286</volume><fpage>971</fpage><lpage>974</lpage><pub-id pub-id-type="doi">10.1126/science.286.5441.971</pub-id><pub-id pub-id-type="pmid">10542155</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Owens</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Kinesin inhibitor marches toward first-in-class pivotal trial</article-title><source>Nature Medicine</source><volume>19</volume><elocation-id>1550</elocation-id><pub-id pub-id-type="doi">10.1038/nm1213-1550a</pub-id><pub-id pub-id-type="pmid">24309639</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peris</surname> <given-names>L</given-names></name><name><surname>Wagenbach</surname> <given-names>M</given-names></name><name><surname>Lafanechère</surname> <given-names>L</given-names></name><name><surname>Brocard</surname> <given-names>J</given-names></name><name><surname>Moore</surname> <given-names>AT</given-names></name><name><surname>Kozielski</surname> <given-names>F</given-names></name><name><surname>Job</surname> <given-names>D</given-names></name><name><surname>Wordeman</surname> <given-names>L</given-names></name><name><surname>Andrieux</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Motor-dependent microtubule disassembly driven by tubulin tyrosination</article-title><source>The Journal of Cell Biology</source><volume>185</volume><fpage>1159</fpage><lpage>1166</lpage><pub-id pub-id-type="doi">10.1083/jcb.200902142</pub-id><pub-id pub-id-type="pmid">19564401</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pettersen</surname> <given-names>EF</given-names></name><name><surname>Goddard</surname> <given-names>TD</given-names></name><name><surname>Huang</surname> <given-names>CC</given-names></name><name><surname>Couch</surname> <given-names>GS</given-names></name><name><surname>Greenblatt</surname> <given-names>DM</given-names></name><name><surname>Meng</surname> <given-names>EC</given-names></name><name><surname>Ferrin</surname> <given-names>TE</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>UCSF chimera--a visualization system for exploratory research and analysis</article-title><source>Journal of Computational Chemistry</source><volume>25</volume><fpage>1605</fpage><lpage>1612</lpage><pub-id pub-id-type="doi">10.1002/jcc.20084</pub-id><pub-id pub-id-type="pmid">15264254</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rohou</surname> <given-names>A</given-names></name><name><surname>Grigorieff</surname> <given-names>N</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>CTFFIND4: fast and accurate defocus estimation from electron micrographs</article-title><source>Journal of Structural Biology</source><volume>192</volume><fpage>216</fpage><lpage>221</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2015.08.008</pub-id><pub-id pub-id-type="pmid">26278980</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Roostalu</surname> <given-names>J</given-names></name><name><surname>Hentrich</surname> <given-names>C</given-names></name><name><surname>Bieling</surname> <given-names>P</given-names></name><name><surname>Telley</surname> <given-names>IA</given-names></name><name><surname>Schiebel</surname> <given-names>E</given-names></name><name><surname>Surrey</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Directional switching of the kinesin Cin8 through motor coupling</article-title><source>Science</source><volume>332</volume><fpage>94</fpage><lpage>99</lpage><pub-id pub-id-type="doi">10.1126/science.1199945</pub-id><pub-id pub-id-type="pmid">21350123</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schindelin</surname> <given-names>J</given-names></name><name><surname>Arganda-Carreras</surname> <given-names>I</given-names></name><name><surname>Frise</surname> <given-names>E</given-names></name><name><surname>Kaynig</surname> <given-names>V</given-names></name><name><surname>Longair</surname> <given-names>M</given-names></name><name><surname>Pietzsch</surname> <given-names>T</given-names></name><name><surname>Preibisch</surname> <given-names>S</given-names></name><name><surname>Rueden</surname> <given-names>C</given-names></name><name><surname>Saalfeld</surname> <given-names>S</given-names></name><name><surname>Schmid</surname> <given-names>B</given-names></name><name><surname>Tinevez</surname> <given-names>JY</given-names></name><name><surname>White</surname> <given-names>DJ</given-names></name><name><surname>Hartenstein</surname> <given-names>V</given-names></name><name><surname>Eliceiri</surname> <given-names>K</given-names></name><name><surname>Tomancak</surname> <given-names>P</given-names></name><name><surname>Cardona</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Fiji: an open-source platform for biological-image analysis</article-title><source>Nature Methods</source><volume>9</volume><fpage>676</fpage><lpage>682</lpage><pub-id pub-id-type="doi">10.1038/nmeth.2019</pub-id><pub-id pub-id-type="pmid">22743772</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Scholey</surname> <given-names>JE</given-names></name><name><surname>Nithianantham</surname> <given-names>S</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name><name><surname>Al-Bassam</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Structural basis for the assembly of the mitotic motor Kinesin-5 into bipolar tetramers</article-title><source>eLife</source><volume>3</volume><elocation-id>e02217</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.02217</pub-id><pub-id pub-id-type="pmid">24714498</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shang</surname> <given-names>Z</given-names></name><name><surname>Zhou</surname> <given-names>K</given-names></name><name><surname>Xu</surname> <given-names>C</given-names></name><name><surname>Csencsits</surname> <given-names>R</given-names></name><name><surname>Cochran</surname> <given-names>JC</given-names></name><name><surname>Sindelar</surname> <given-names>CV</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>High-resolution structures of kinesin on microtubules provide a basis for nucleotide-gated force-generation</article-title><source>eLife</source><volume>3</volume><elocation-id>e04686</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.04686</pub-id><pub-id pub-id-type="pmid">25415053</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shapira</surname> <given-names>O</given-names></name><name><surname>Goldstein</surname> <given-names>A</given-names></name><name><surname>Al-Bassam</surname> <given-names>J</given-names></name><name><surname>Gheber</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A potential physiological role for bi-directional motility and motor clustering of mitotic kinesin-5 Cin8 in yeast mitosis</article-title><source>Journal of Cell Science</source><volume>130</volume><fpage>725</fpage><lpage>734</lpage><pub-id pub-id-type="doi">10.1242/jcs.195040</pub-id><pub-id pub-id-type="pmid">28069834</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sharp</surname> <given-names>DJ</given-names></name><name><surname>McDonald</surname> <given-names>KL</given-names></name><name><surname>Brown</surname> <given-names>HM</given-names></name><name><surname>Matthies</surname> <given-names>HJ</given-names></name><name><surname>Walczak</surname> <given-names>C</given-names></name><name><surname>Vale</surname> <given-names>RD</given-names></name><name><surname>Mitchison</surname> <given-names>TJ</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>The bipolar kinesin, KLP61F, cross-links microtubules within interpolar microtubule bundles of <italic>Drosophila</italic> embryonic mitotic spindles</article-title><source>The Journal of Cell Biology</source><volume>144</volume><fpage>125</fpage><lpage>138</lpage><pub-id pub-id-type="doi">10.1083/jcb.144.1.125</pub-id><pub-id pub-id-type="pmid">9885249</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shimamoto</surname> <given-names>Y</given-names></name><name><surname>Forth</surname> <given-names>S</given-names></name><name><surname>Kapoor</surname> <given-names>TM</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Measuring pushing and braking forces generated by ensembles of Kinesin-5 crosslinking two microtubules</article-title><source>Developmental Cell</source><volume>34</volume><fpage>669</fpage><lpage>681</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2015.08.017</pub-id><pub-id pub-id-type="pmid">26418296</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Singh</surname> <given-names>SK</given-names></name><name><surname>Pandey</surname> <given-names>H</given-names></name><name><surname>Al-Bassam</surname> <given-names>J</given-names></name><name><surname>Gheber</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Bidirectional motility of kinesin-5 motor proteins: structural determinants, cumulative functions and physiological roles</article-title><source>Cellular and Molecular Life Sciences</source><volume>75</volume><fpage>1757</fpage><lpage>1771</lpage><pub-id pub-id-type="doi">10.1007/s00018-018-2754-7</pub-id><pub-id pub-id-type="pmid">29397398</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sturgill</surname> <given-names>EG</given-names></name><name><surname>Norris</surname> <given-names>SR</given-names></name><name><surname>Guo</surname> <given-names>Y</given-names></name><name><surname>Ohi</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Kinesin-5 inhibitor resistance is driven by kinesin-12</article-title><source>The Journal of Cell Biology</source><volume>213</volume><fpage>213</fpage><lpage>227</lpage><pub-id pub-id-type="doi">10.1083/jcb.201507036</pub-id><pub-id pub-id-type="pmid">27091450</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Subramanian</surname> <given-names>R</given-names></name><name><surname>Kapoor</surname> <given-names>TM</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Building complexity: insights into self-organized assembly of microtubule-based architectures</article-title><source>Developmental Cell</source><volume>23</volume><fpage>874</fpage><lpage>885</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2012.10.011</pub-id><pub-id pub-id-type="pmid">23153484</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sui</surname> <given-names>H</given-names></name><name><surname>Downing</surname> <given-names>KH</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Structural basis of interprotofilament interaction and lateral deformation of microtubules</article-title><source>Structure</source><volume>18</volume><fpage>1022</fpage><lpage>1031</lpage><pub-id pub-id-type="doi">10.1016/j.str.2010.05.010</pub-id><pub-id pub-id-type="pmid">20696402</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Suloway</surname> <given-names>C</given-names></name><name><surname>Pulokas</surname> <given-names>J</given-names></name><name><surname>Fellmann</surname> <given-names>D</given-names></name><name><surname>Cheng</surname> <given-names>A</given-names></name><name><surname>Guerra</surname> <given-names>F</given-names></name><name><surname>Quispe</surname> <given-names>J</given-names></name><name><surname>Stagg</surname> <given-names>S</given-names></name><name><surname>Potter</surname> <given-names>CS</given-names></name><name><surname>Carragher</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Automated molecular microscopy: the new leginon system</article-title><source>Journal of Structural Biology</source><volume>151</volume><fpage>41</fpage><lpage>60</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2005.03.010</pub-id><pub-id pub-id-type="pmid">15890530</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tang</surname> <given-names>G</given-names></name><name><surname>Peng</surname> <given-names>L</given-names></name><name><surname>Baldwin</surname> <given-names>PR</given-names></name><name><surname>Mann</surname> <given-names>DS</given-names></name><name><surname>Jiang</surname> <given-names>W</given-names></name><name><surname>Rees</surname> <given-names>I</given-names></name><name><surname>Ludtke</surname> <given-names>SJ</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>EMAN2: an extensible image processing suite for electron microscopy</article-title><source>Journal of Structural Biology</source><volume>157</volume><fpage>38</fpage><lpage>46</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2006.05.009</pub-id><pub-id pub-id-type="pmid">16859925</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Telley</surname> <given-names>IA</given-names></name><name><surname>Bieling</surname> <given-names>P</given-names></name><name><surname>Surrey</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Reconstitution and quantification of dynamic microtubule end tracking in vitro using TIRF microscopy</article-title><source>Methods in Molecular Biology</source><volume>777</volume><fpage>127</fpage><lpage>145</lpage><pub-id pub-id-type="doi">10.1007/978-1-61779-252-6_10</pub-id><pub-id pub-id-type="pmid">21773926</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Turner</surname> <given-names>J</given-names></name><name><surname>Anderson</surname> <given-names>R</given-names></name><name><surname>Guo</surname> <given-names>J</given-names></name><name><surname>Beraud</surname> <given-names>C</given-names></name><name><surname>Fletterick</surname> <given-names>R</given-names></name><name><surname>Sakowicz</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Crystal structure of the mitotic spindle kinesin Eg5 reveals a novel conformation of the neck-linker</article-title><source>Journal of Biological Chemistry</source><volume>276</volume><fpage>25496</fpage><lpage>25502</lpage><pub-id pub-id-type="doi">10.1074/jbc.M100395200</pub-id><pub-id pub-id-type="pmid">11328809</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vale</surname> <given-names>RD</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>The molecular motor toolbox for intracellular transport</article-title><source>Cell</source><volume>112</volume><fpage>467</fpage><lpage>480</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(03)00111-9</pub-id><pub-id pub-id-type="pmid">12600311</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vale</surname> <given-names>RD</given-names></name><name><surname>Milligan</surname> <given-names>RA</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>The way things move: looking under the hood of molecular motor proteins</article-title><source>Science</source><volume>288</volume><fpage>88</fpage><lpage>95</lpage><pub-id pub-id-type="doi">10.1126/science.288.5463.88</pub-id><pub-id pub-id-type="pmid">10753125</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Valentine</surname> <given-names>MT</given-names></name><name><surname>Fordyce</surname> <given-names>PM</given-names></name><name><surname>Block</surname> <given-names>SM</given-names></name></person-group><year iso-8601-date="2006">2006a</year><article-title>Eg5 steps it up!</article-title><source>Cell Division</source><volume>1</volume><elocation-id>31</elocation-id><pub-id pub-id-type="doi">10.1186/1747-1028-1-31</pub-id><pub-id pub-id-type="pmid">17173688</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Valentine</surname> <given-names>MT</given-names></name><name><surname>Fordyce</surname> <given-names>PM</given-names></name><name><surname>Krzysiak</surname> <given-names>TC</given-names></name><name><surname>Gilbert</surname> <given-names>SP</given-names></name><name><surname>Block</surname> <given-names>SM</given-names></name></person-group><year iso-8601-date="2006">2006b</year><article-title>Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro</article-title><source>Nature Cell Biology</source><volume>8</volume><fpage>470</fpage><lpage>476</lpage><pub-id pub-id-type="doi">10.1038/ncb1394</pub-id><pub-id pub-id-type="pmid">16604065</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van den Wildenberg</surname> <given-names>SM</given-names></name><name><surname>Tao</surname> <given-names>L</given-names></name><name><surname>Kapitein</surname> <given-names>LC</given-names></name><name><surname>Schmidt</surname> <given-names>CF</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name><name><surname>Peterman</surname> <given-names>EJ</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>The homotetrameric kinesin-5 KLP61F preferentially crosslinks microtubules into antiparallel orientations</article-title><source>Current Biology</source><volume>18</volume><fpage>1860</fpage><lpage>1864</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2008.10.026</pub-id><pub-id pub-id-type="pmid">19062285</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>von Loeffelholz</surname> <given-names>O</given-names></name><name><surname>Peña</surname> <given-names>A</given-names></name><name><surname>Drummond</surname> <given-names>DR</given-names></name><name><surname>Cross</surname> <given-names>R</given-names></name><name><surname>Moores</surname> <given-names>CA</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Cryo-EM structure (4.5-Å) of yeast Kinesin-5-Microtubule complex reveals a distinct binding footprint and mechanism of drug resistance</article-title><source>Journal of Molecular Biology</source><volume>431</volume><fpage>864</fpage><lpage>872</lpage><pub-id pub-id-type="doi">10.1016/j.jmb.2019.01.011</pub-id><pub-id pub-id-type="pmid">30659798</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>von Loeffelholz</surname> <given-names>O</given-names></name><name><surname>Moores</surname> <given-names>CA</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Cryo-EM structure of the <italic>Ustilago maydis</italic> kinesin-5 motor domain bound to microtubules</article-title><source>Journal of Structural Biology</source><volume>207</volume><fpage>312</fpage><lpage>316</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2019.07.003</pub-id><pub-id pub-id-type="pmid">31288039</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>H</given-names></name><name><surname>Brust-Mascher</surname> <given-names>I</given-names></name><name><surname>Scholey</surname> <given-names>JM</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Sliding filaments and mitotic spindle organization</article-title><source>Nature Cell Biology</source><volume>16</volume><fpage>737</fpage><lpage>739</lpage><pub-id pub-id-type="doi">10.1038/ncb3019</pub-id><pub-id pub-id-type="pmid">25082196</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Weinger</surname> <given-names>JS</given-names></name><name><surname>Qiu</surname> <given-names>M</given-names></name><name><surname>Yang</surname> <given-names>G</given-names></name><name><surname>Kapoor</surname> <given-names>TM</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>A nonmotor microtubule binding site in kinesin-5 is required for filament crosslinking and sliding</article-title><source>Current Biology</source><volume>21</volume><fpage>154</fpage><lpage>160</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2010.12.038</pub-id><pub-id pub-id-type="pmid">21236672</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Gctf: real-time CTF determination and correction</article-title><source>Journal of Structural Biology</source><volume>193</volume><fpage>1</fpage><lpage>12</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2015.11.003</pub-id><pub-id pub-id-type="pmid">26592709</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zheng</surname> <given-names>SQ</given-names></name><name><surname>Palovcak</surname> <given-names>E</given-names></name><name><surname>Armache</surname> <given-names>JP</given-names></name><name><surname>Verba</surname> <given-names>KA</given-names></name><name><surname>Cheng</surname> <given-names>Y</given-names></name><name><surname>Agard</surname> <given-names>DA</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy</article-title><source>Nature Methods</source><volume>14</volume><fpage>331</fpage><lpage>332</lpage><pub-id pub-id-type="doi">10.1038/nmeth.4193</pub-id><pub-id pub-id-type="pmid">28250466</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.51131.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Carter</surname><given-names>Andrew P</given-names></name><role>Reviewing Editor</role><aff><institution>MRC Laboratory of Molecular Biology</institution><country>United Kingdom</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Nitta</surname><given-names>Ryo</given-names> </name><role>Reviewer</role><aff><institution>Kobe University Graduate School of Medicine</institution><country>Japan</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>Bodrug et al. use a predominantly in vitro approach to investigate the role of the Kinesin-5 tail in regulating the motor's mechanochemical cycle and ability to slide anti-parallel microtubules. Using microtubule co-sedimentation and nucleotide activity assays, the authors find that the tail domain downregulates Kinesin-5 ATP hydrolysis. This finding is further corroborated using cryo-EM, where it is observed that the tail engages and opens up a nucleotide-free Kinesin-5 active site on microtubules. This conformation is predicted to reduce the motor's ability to bind incoming ATP. In line with this observation, Bodrug et al. show that tail engagement promotes slow motor motility and increases clustering of Kinesin-5 on microtubules, which in turn generates the force necessary for anti-parallel microtubule sliding. The combined biochemical, structural and cellular strategies adopted provide credence for the authors' revised model of Kinesin-5 regulation.</p><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor for antiparallel microtubule sliding&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Suzanne Pfeffer as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Ryo Nitta (Reviewer #2).</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>Summary:</p><p>The authors investigate the fascinating role of kinesin-5 tail for antiparallel microtubule sliding by biochemical, structural, and biophysical approaches. They proposed that the tail domain affects motor functions including the speed of the motility, microtubule-binding affinity, or the force production, coupled with the nucleotide state of the motor. Cryo-EM structure of the MT-kinesin-5 clearly visualizes the additional density (maybe, tail domain) on the motor domain (not on the microtubule). MT sliding assays and optical trapping illustrate the importance of the tail domain for the antiparallel microtubule sliding to accomplish the mitotic function of kinesin-5.</p><p>Overall, experimental data provide the intriguing regulation mechanism of kinesin-5 motility by its tail. The reviewers were all supportive of asking for revisions. The feeling was that the authors need to improve the clarity and accuracy of this manuscript during revision.</p><p>Essential revisions:</p><p><italic>Reviewer 1:</italic></p><p>1) All figure captions, where applicable, need to state number of experimental repeats, type of statistics performed, how many molecules were included, units of average speed above histograms, axis units on inset graphs and brief experimental details. For example, Figure 1B-D, H, Figure 3F-G, Figure 4C-D, H, I, Figure 5D-F, Figure 6E.</p><p>2) No model refinement parameters have been presented. Tables of refinement statistics is required for each model generated from the cryo-EM experiments.</p><p>3) FSC curve on Figure 2—figure supplement 1C(ii) shows a sharp drop-off (followed by a rise) at the low spatial frequency (~0.10 1/Å), usually indicative of an applied mask that is too tight. Can the authors try a looser mask?</p><p><italic>Reviewer 2:</italic></p><p>1) Exploring direct binding between the motor and tail domains:</p><p>Motor-tail interaction is the key feature of this manuscript. The authors performed microtubule co-sedimentation assays as well as cryo-EM analysis to propose that the tail domain of KLP61F is not bound to the microtubule but is bound directly to the motor domain through an α-helix to regulate the catalytic cycle of the motor. However, biochemical assays did not show the direct binding between motors and tails without microtubules. Cryo-EM studies illustrate the additional density at the minus-end side of the motor, albeit it is much smaller than the expected size of the tail at ~8 Å resolution. Thus, it is not strong enough to conclude whether the additional density is actually the tail or not. The reviewers agree that a direct biochemical interaction between motor and tail should be tested without microtubules (e.g. by: GST-pull down assay, Gel-filtration (or SEC-MALS), Calorimetry, Biacore, etc).</p><p>2) Validating the motor-tail interface supposed by cryo-EM structure:</p><p>Related to comment 1, a mutagenesis experiment will strengthen the structural model proposed. Please introduce a point mutation in α0-helix to investigate the contribution of this helix to the binding to the tail domain.</p><p>3) Checking the functional identity between KLP61F and Eg5:</p><p>In the manuscript, the first half (biochemical and structural studies) was mostly done with <italic>Drosophila</italic> KLP61F, whereas the other half (biophysical studies) was done with human Eg5. The authors connect these stories together with the assumption that the role of the KLP61F and Eg5 are the same. Based on the sequence identity between KLP61F and Eg5, overall identity is 33%, and that of the motor domain is more than 50%, however, those of the tail and α 0 are around 20% , which is not high enough to easily conclude they play the same function. To overcome the gap, the authors need to experimentally prove functional identity between KLP61F and Eg5, including the motor-tail binding and the regulation of ATPase activity by tail under the same conditions (nucleotide analog, salt concentration, counter ion, etc.).</p><p>4) Decreasing the ATPase rate and the velocity with/without tail:</p><p>The authors claim that the tail domain of kinesin-5 down-regulates the microtubule-activated ATPase activity of the motor, resulting in the slow motility of kinesin-5. In Table 1 and Figure 1, the ATPase rate of Eg5 was decreased to half by the addition of the tail. On the other hand, in Table 3 and Figure 3, the velocity of Eg5 was decreased to one-quarter or one-fifth by the addition of the tail. How can authors explain this discrepancy? Is there some additional reason of slow motility?</p><p><italic>Reviewer 3:</italic></p><p>1) The authors need to significantly improve the clarity and accuracy of this manuscript in the revision, as the writing of the current version does not measure up to the quality of the work and the current manuscript contains surprisingly too many errors that have made the manuscript somewhat difficult to read. Some essential errors are listed below:</p><p>1A) Panel E is missing in Figure 1; as a result, references to many panels of Figure 1 in the text are incorrect; and the text contains no mentioning of Figure 1J.</p><p>1B) In the first paragraph of the subsection “The kinesin-5 tail domain downregulates MT activated ATP hydrolysis by binding the motor domain in the ADP or nucleotide-free states”, it should be &quot;1-369&quot; instead of &quot;1-356&quot;, based on the labeling in Figure 1A.</p><p>1C) &quot;Figure 3A, lower panel&quot; should be &quot;Figure 3C&quot;.</p><p>1D) “Figure 3—figure supplement 1C should be “Figure 3—figure supplement 1D-E”.</p><p>1E) “Figure 3C” should be “Figure 3—figure supplement 1C”.</p><p>2) Based on the GFP fluorescence intensity distribution of motile Eg5-Δtail-GFP and FL-Eg5-GFP, the authors state in the text (e.g. subsections “The tail domain down-regulates kinesin-5 motility velocity along single MTs”, third paragraph and “A modified model for kinesin-5 tail regulated hand-over-hand motility and its essential role in antiparallel MT sliding activity”, last paragraph) and in Figure 7A that in higher ionic strength buffers the tail of kinesin-5 may be involved in inter-molecular interaction to cluster multiple kinesin-5 homotetramers into higher-order oligomeric complexes. Given that in TIRF microscopy experiments, GFP fluorescence intensity of these motility Eg5 particles highly depends on experimental settings, e.g., laser intensity and location in the field of view, the authors need to use one other independent assay such as sucrose gradient centrifugation to verify whether FL-Eg5-GFP indeed exists mainly as high-order oligomeric complexes in high ionic strength buffers.</p><p>3) While the authors have demonstrated that the tail domain slows kinesin-5 velocity both along single MTs and within the overlap zone formed between two antiparallel MTs, it is unclear whether this tail-to-motor interaction indeed forms part of an active regulatory pathway in vivo. As such, in the Results, the authors need change &quot;downregulate&quot; and &quot;down-regulate&quot; (or their likes) to reduce/decrease to focus on describing rather than interpreting their experimental observations.</p><p>4) In the second paragraph of the Introduction, the authors state that yeast kinesin-5s reverse direction toward the plus-ends upon clustering into multi-motor complexes along single MTs. Which study (or studies) are the authors referring to?</p><p>5) It is inaccurate to state that in motility buffers contains 25-100mM KCl, &quot;[t]his processive motility is highly homogeneous&quot;, given that the velocity histograms for FL-Eg5-GFP and Eg5-∆tail-GFP at 100 mM KCl both contain two different modes.</p><p>6) In the subsection “The tail domain is critical for slowing kinesin-5 motility within MT sliding zones”, the description of FL-Eg5-GFP motility is inaccurate, and it is not obvious from Figure 4F that FL-Eg5-GFP exhibits slower plus-end directed motility within the MT overlap zone than on the surface-anchored MT outside the overlap zone; judging by the inset velocity histograms in Figure 4H, it is unclear whether the difference between the two velocities is statistically significant.</p><p>7) In the subsection “The tail domain is critical for slowing kinesin-5 motility within MT sliding zones”, it is not clear to me how these data would necessarily suggest the kinesin-5 tail regulates MT-sliding rate by modulating a unique motor association with MTs and coupling between two MT-bound ends of kinesin-5. How about the presence of the tail domain prolonging the retention of kinesin-5 within the MT-binding overlap zone by being an extra MT-binding site?</p><p>8) In the Discussion, the authors state in multiple places that the tail domain regulates processive hand-over-hand stepping during kinesin-5 motility. Given that it remains to be determined whether homotetrameric kinesin-5s use hand-over-hand stepping to move on single microtubules and between antiparallel microtubules, the authors need to revise this part of the Discussion and related Figure 7B-D to tone down the statement.</p><p>9) It is worth noting that the conclusions were drawn based on kinetic and structural studies using Dm-KLP61F (Figures 1 and 2) and other studies (TIRF microscopy and optical trapping) using human-Eg5 (Figures 3-6). I am unsure to what extent the authors can confidently claim the model in Figure 7 is a conserved one and strongly suggest the authors to use results from either Dm-KLP61F or human Eg5 for the main figures. Do the authors have results for Dm-KLP61F equivalent to those in Figures 3-6?</p><p>10) In terms of the organization of the manuscript, I would suggest the authors to present the figures in the following order: 1) Figures 3-5 (which show that the tail domain of kinesin-5s affects kinesin-5 velocity both on single MTs and within the overlap zone of two antiparallel microtubules, is required for efficient assembly of antiparallel microtubules, and is indispensable for kinesin-5 to produce strong forces within the overlap zone of two antiparallel microtubules), 2) Figures 1-2 (which are results showing the kinetic and structural bases of the observations in Figures 3-5), 3) Figure 6 (which shows that the tail domain plays important role in spindle localization of kinesin-5), and 4) the model Figure 7.</p><p>11) The authors state that &quot;the tail domain of the <italic>Xenopus</italic> Eg5 was suggested to form a secondary [MT-binding] site during [MT-sliding] activity, yet the function of the kinesin-5 tail-MT interaction remains unclear.&quot; How does this extra MT-binding site fit into the model the authors propose in Figure 7?</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.51131.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential revisions:</p><p>Reviewer 1:</p><p>1) All figure captions, where applicable, need to state number of experimental repeats, type of statistics performed, how many molecules were included, units of average speed above histograms, axis units on inset graphs and brief experimental details. For example, Figure 1B-D, H, Figure 3F-G, Figure 4C-D, H, I, Figure 5D-F, Figure 6E.</p></disp-quote><p>These items have all been revised throughout the manuscript. These items are now included in the revised version in the figures or the tables and references were correctly added.</p><disp-quote content-type="editor-comment"><p>2) No model refinement parameters have been presented. Tables of refinement statistics is required for each model generated from the cryo-EM experiments.</p></disp-quote><p>We present Table 3 which includes model building and validation statistics in the revised manuscript.</p><disp-quote content-type="editor-comment"><p>3) FSC curve on Figure 2—figure supplement 1C(ii) shows a sharp drop-off (followed by a rise) at the low spatial frequency (~0.10 1/Å), usually indicative of an applied mask that is too tight. Can the authors try a looser mask?</p></disp-quote><p>We agree with the reviewer's point and thank them for this suggestion. The previous gold standard FSC calculation for final refinement was carried out using a home-built script. This has since been revised using the latest version of Frealign (CISTEM) which produced a revised FSC curve (shown in Figure 2—figure supplement 1) that doesn't show the sharp drop-off at low spatial frequency. The revised FSC curve now shows a normal drop off. We believe a final round of refinement with a mask that is less tight is not necessary. Masking the tail density does not improve the density suggesting that the variation in that region of the structure is quite high.</p><disp-quote content-type="editor-comment"><p>Reviewer 2:</p><p>1) Exploring direct binding between the motor and tail domains:</p><p>Motor-tail interaction is the key feature of this manuscript. The authors performed microtubule co-sedimentation assays as well as cryo-EM analysis to propose that the tail domain of KLP61F is not bound to the microtubule but is bound directly to the motor domain through an α-helix to regulate the catalytic cycle of the motor. However, biochemical assays did not show the direct binding between motors and tails without microtubules. Cryo-EM studies illustrate the additional density at the minus-end side of the motor, albeit it is much smaller than the expected size of the tail at ~8 Å resolution. Thus, it is not strong enough to conclude whether the additional density is actually the tail or not. The reviewers agree that a direct biochemical interaction between motor and tail should be tested without microtubules (e.g. by: GST-pull down assay, Gel-filtration (or SEC-MALS), Calorimetry, Biacore, etc).</p></disp-quote><p>To address the reviewers’ request and address this question directly, we generated a KLP61F tail with a C-terminal StrepII tag and utilized this construct to perform affinity co-purification of the KLP61F motor domain onto streptactin II resin, in three different nucleotide solution conditions. These studies are now included in Figure 1E. These studies reveal that the KLP61F tail domain recruited the motor domain in a stoichiometric amount to the streptactin resin (revealed by its elution with buffer with biotin) in the ADP and Nucleotide free states (Apyrase). The tail very poorly recruited the motor in the AMPPNP state. The ionic strength influences this interaction, which appears to become weaker at 75 mM KCl, compared to 25 mM KCl. Notably, size exclusion chromatography of the motor and tail shows they don't form a stable complex. This suggests that the interaction has an affinity in the micro-molar range.</p><disp-quote content-type="editor-comment"><p>2) Validating the motor-tail interface supposed by cryo-EM structure:</p><p>Related to comment 1, a mutagenesis experiment will strengthen the structural model proposed. Please introduce a point mutation in α0-helix to investigate the contribution of this helix to the binding to the tail domain.</p></disp-quote><p>We thank the reviewer for this suggestion. However, given the very low resolution of the Cryo-EM map at tail region and motor-tail interface, It is very difficult identify the type of mutation in α0-helix that would disrupt the α-0 helix tail interface but won't affect the folding of α0-helix. The outcome of these mutation would not be easily validated if this region becomes unfolded or the interface of between the motor and tail becomes disrupted. We believe higher resolution structure for the motor tail interface is required before mutational analyses can be effectively used to test the biochemical activity of the tail-motor binding interface.</p><disp-quote content-type="editor-comment"><p>3) Checking the functional identity between KLP61F and Eg5:</p><p>In the manuscript, the first half (biochemical and structural studies) was mostly done with Drosophila KLP61F, whereas the other half (biophysical studies) was done with human Eg5. The authors connect these stories together with the assumption that the role of the KLP61F and Eg5 are the same. Based on the sequence identity between KLP61F and Eg5, overall identity is 33%, and that of the motor domain is more than 50%, however, those of the tail and α 0 are around 20% , which is not high enough to easily conclude they play the same function. To overcome the gap, the authors need to experimentally prove functional identity between KLP61F and Eg5, including the motor-tail binding and the regulation of ATPase activity by tail under the same conditions (nucleotide analog, salt concentration, counter ion, etc.).</p></disp-quote><p>The kinesin-5 tail contains two regions of high conservation located at its N- and C-terminal sections. N-terminus of the tail (DM-KLP61F residues 930-970) is 80% conserved across mammals and <italic>Drosophila</italic>, while C-terminal section of the tail (Dm KLP61F residues 990-1020) is about 50% conserved. This suggests that about 50% or less of the tail is highly conserved, which is consistent with around 30% of the total mass of the 100 residues observed in cryo-EM. Our studies suggest that tail attributed density likely represents these conserved regions in a yet to be determined fold.</p><p>In response to the reviewer request of parallel biochemical analyses of Eg5 and KLP61F, we present ATPase and microtubule co-sedimentation studies with the Eg5 motor and tail domain constructs in Figure 1—figure supplement 1K-M of previous manuscript version. We have previously used ATP-γ-S which didn't mimic an effective ATP-like state in Eg5. In the revised version, we have now been expanded on these studies to address the above concerns of the reviewer. The co-sedimentation data in ATP-γ-S was removed and replaced with data collected in 2 mM AMPPNP.</p><p>As described above microtubule-stimulated ATP hydrolysis data show that the effect of the Eg5 tail construct is more moderate than KLP61F construct. We attribute this to the Eg5 tail construct solubility. Unlike the KLp61F tail construct, the isolated Eg5 tail construct suffers from soluble-aggregation issues, which likely influence the outcome of the motor + tail microtubule, stimulated ATPase assays. This is likely the reason for the more modest effect observed in these experiments. As we show below the Eg5 motor-tail fusion shows a more potent effect in decreasing the microtubule stimulated ATPase compared to the Eg5 motor alone likely due to the enhanced solubility. As we describe below, we studied this construct in two conditions to understand how the motor-tail interface affects the microtubule-activated ATP hydrolysis.</p><disp-quote content-type="editor-comment"><p>4) Decreasing the ATPase rate and the velocity with/without tail:</p><p>The authors claim that the tail domain of kinesin-5 down-regulates the microtubule-activated ATPase activity of the motor, resulting in the slow motility of kinesin-5. In Table 1 and Figure 1, the ATPase rate of Eg5 was decreased to half by the addition of the tail. On the other hand, in Table 3 and Figure 3, the velocity of Eg5 was decreased to one-quarter or one-fifth by the addition of the tail. How can authors explain this discrepancy? Is there some additional reason of slow motility?</p></disp-quote><p>As we indicate above, the modest decrease in eg5-tail mediated microtubule-stimulated ATPase rate is likely due to the poor biochemical behavior of the Eg5 tail construct, which forms soluble aggregates over time. In the revised manuscript, we present ATP hydrolysis studies of the Eg5 motor-tail fusion compared to Eg5 motor at two ionic conditions 20 mM KCl and 50 mM K-acetate. We show that at 20 mM KCl conditions, the Eg5 motor tail fusion shows a two-fold decrease in Kcat ATP hydrolysis rate compared to the Eg5 motor, nearly identical to the effect observed with KLP61F. In contrast at 50 mM K-acetate condition we observe that the Eg5 motor ATPase decreases by 20% while its Km increased by seven-fold, while in contrast the Eg5 motor-tail fusion Kcat increases by two-fold compared to its kcat at 20 mM KCl. This suggests that the tail induced decrease in Eg5 motor ATPase is more sensitive to the 50 mM K Acetate condition. These data now provide a clearer view for how Eg5 tail ATPase regulation is altered and the role of the biochemical conditions and directly relates the ATPase rates to the motility studies described in Figure 3.</p><disp-quote content-type="editor-comment"><p>Reviewer 3:</p><p>1) The authors need to significantly improve the clarity and accuracy of this manuscript in the revision, as the writing of the current version does not measure up to the quality of the work and the current manuscript contains surprisingly too many errors that have made the manuscript somewhat difficult to read. Some essential errors are listed below:</p><p>1A) Panel E is missing in Figure 1; as a result, references to many panels of Figure 1 in the text are incorrect; and the text contains no mentioning of Figure 1J.</p><p>1B) In the first paragraph of the subsection “The kinesin-5 tail domain downregulates MT activated ATP hydrolysis by binding the motor domain in the ADP or nucleotide-free states”, it should be &quot;1-369&quot; instead of &quot;1-356&quot;, based on the labeling in Figure 1A.</p><p>1C) &quot;Figure 3A, lower panel&quot; should be &quot;Figure 3C&quot;.</p><p>1D) “Figure 3—figure supplement 1C should be “Figure 3—figure supplement 1D-E”.</p><p>1E) “Figure 3C” should be “Figure 3—figure supplement 1C”.</p></disp-quote><p>We are indebted to the reviewer for their thorough comments throughout our manuscript. The panels have now been corrected and the figure legends have been added.</p><disp-quote content-type="editor-comment"><p>2) Based on the GFP fluorescence intensity distribution of motile Eg5-Δtail-GFP and FL-Eg5-GFP, the authors state in the text (e.g. subsections “The tail domain down-regulates kinesin-5 motility velocity along single MTs”, third paragraph and “A modified model for kinesin-5 tail regulated hand-over-hand motility and its essential role in antiparallel MT sliding activity”, last paragraph) and in Figure 7A that in higher ionic strength buffers the tail of kinesin-5 may be involved in inter-molecular interaction to cluster multiple kinesin-5 homotetramers into higher-order oligomeric complexes. Given that in TIRF microscopy experiments, GFP fluorescence intensity of these motility Eg5 particles highly depends on experimental settings, e.g., laser intensity and location in the field of view, the authors need to use one other independent assay such as sucrose gradient centrifugation to verify whether FL-Eg5-GFP indeed exists mainly as high-order oligomeric complexes in high ionic strength buffers.</p></disp-quote><p>The imaging experiments of FL-Eg5-GFP and Eg5-tail-GFP at the 25 mM, 50 mM and 100 mM KCl condition were carried out side by side during same days while keeping control of the laser power and imaging conditions. Furthermore, data sets analyzed included imaging data merged from multiple days. Thus, potential differences in imaging conditions, indicated by the reviewer, do not explain the difference in oligomerization observed.</p><p>We attempted to address the reviewer's concern. We freshly purified FL-Eg5-GFP and Eg5-Δtail-GFP proteins at 400 mM KCl, then we incubated them at different ionic strengths in the absence of microtubules, and analyzed their oligomerization using gel filtration. However, we observed aggregation of both proteins at 25-100 mM KCl ionic strength conditions. In these experiments, protein concentrations are in the μM (μM) range, in contrast the TIRF experiments were carried out at 100-1000-Fold lower concentration. We believe that the microtubule lattice plays an important role in the clustering process in the nanomolar (nM) range, as FL-Eg5-GFP molecules assemble into these oligomers on the microtubule lattice.</p><p> <italic>3) While the authors have demonstrated that the tail domain slows kinesin-5 velocity both along single MTs and within the overlap zone formed between two antiparallel MTs, it is unclear whether this tail-to-motor interaction indeed forms part of an active regulatory pathway</italic> in vivo<italic>. As such, in the Results, the authors need change &quot;downregulate&quot; and &quot;down-regulate&quot; (or their likes) to reduce/decrease to focus on describing rather than interpreting their experimental observations.</italic></p><p>This has been corrected.</p><disp-quote content-type="editor-comment"><p>4) In the second paragraph of the Introduction, the authors state that yeast kinesin-5s reverse direction toward the plus-ends upon clustering into multi-motor complexes along single MTs. Which study (or studies) are the authors referring to?</p></disp-quote><p>The work by Saphira et al., 2017, describes the studies on yeast Cin8 direction change along microtubules. The reference has been added in the revised manuscript.</p><disp-quote content-type="editor-comment"><p>5) It is inaccurate to state that in motility buffers contains 25-100mM KCl, &quot;[t]his processive motility is highly homogeneous&quot;, given that the velocity histograms for FL-Eg5-GFP and Eg5-∆tail-GFP at 100 mM KCl both contain two different modes.</p><p>6) In the subsection “The tail domain is critical for slowing kinesin-5 motility within MT sliding zones”, the description of FL-Eg5-GFP motility is inaccurate, and it is not obvious from Figure 4F that FL-Eg5-GFP exhibits slower plus-end directed motility within the MT overlap zone than on the surface-anchored MT outside the overlap zone; judging by the inset velocity histograms in Figure 4H, it is unclear whether the difference between the two velocities is statistically significant.</p></disp-quote><p>Statistical significance for the data is now presented in Figure 4—figure supplement 1F-G as a pairwise student's t-tests</p><disp-quote content-type="editor-comment"><p>7) In the subsection “The tail domain is critical for slowing kinesin-5 motility within MT sliding zones”, it is not clear to me how these data would necessarily suggest the kinesin-5 tail regulates MT-sliding rate by modulating a unique motor association with MTs and coupling between two MT-bound ends of kinesin-5. How about the presence of the tail domain prolonging the retention of kinesin-5 within the MT-binding overlap zone by being an extra MT-binding site?</p></disp-quote><p>The spiking experiments clearly indicate that the velocity of the FL-Eg5 motor within the overlap zones is two-three folds slower than the Eg5-Δtail-GFP. The Fl-Eg5-GFP motors are not static but rather moving slowly, in contrast to the Eg5-Δtail-GFP move rapidly with very frequent direction switching within the overlap zone. Furthermore, kinetic and structure data in Figures 1 and 2 show that the affinity of the tail to the motor domain is highest in the ADP and nucleotide free states. The decrease in microtubule stimulated ATP hydrolysis in the presence tail and the location of the tail binding site on the motor domain both suggest that the tail interface stabilizes the nucleotide free or ADP states of the motor. The data suggest that the explanation for the very slow motility velocity of FL-Eg5-GFP motor domain in the overlap zone is likely due to its slow transition due to tail inducing a decreased affinity for ATP, the transition from ADP state to ATP state by stabilizing the nucleotide free or ADP states.</p><disp-quote content-type="editor-comment"><p>8) In the Discussion, the authors state in multiple places that the tail domain regulates processive hand-over-hand stepping during kinesin-5 motility. Given that it remains to be determined whether homotetrameric kinesin-5s use hand-over-hand stepping to move on single microtubules and between antiparallel microtubules, the authors need to revise this part of the Discussion and related Figure 7B-D to tone down the statement.</p></disp-quote><p>In the data presented in Figure 3, we show that Eg5 tetramers undergo processive motility along microtubules with run lengths that are between 8 and 13 micro-meters (μm). We also would like to point the reviewer to the work of Valentine et al., 2005, on native dimeric Eg5 constructs which include the N-terminal neck, which unambiguously show these molecules take steps similar to kinesin-1 using optical trapping. The conclusion that each dimeric end of Eg5 takes processive steps is fairly reasonable based on our data and that of the Valentine et al. work.</p><disp-quote content-type="editor-comment"><p>9) It is worth noting that the conclusions were drawn based on kinetic and structural studies using Dm-KLP61F (Figures 1 and 2) and other studies (TIRF microscopy and optical trapping) using human-Eg5 (Figures 3-6). I am unsure to what extent the authors can confidently claim the model in Figure 7 is a conserved one and strongly suggest the authors to use results from either Dm-KLP61F or human Eg5 for the main figures. Do the authors have results for Dm-KLP61F equivalent to those in Figures 3-6?</p></disp-quote><p>We have revised the Discussion in the manuscript. We include additional data addressing Eg5 tail capacity to regulate the motor and added data with an Eg5 motor-tail fusion to address how the tail regulates ATPase at low and higher ionic strength conditions. We believe the sequence conservation in the motor and tail domains (see above), reasonable match in the biochemical microtubule binding and microtubule-stimulated ATPase assays for the Eg5 and KLP61F motor and tail domains, cryo-EM KLP61F structures revealing structural basis for the tail effect on the motor domain, and the reconstitutions of the tail effect in the FL-Eg5 and Eg5-Δtail microtubule motility and sliding studies all support that these features are likely conserved in the Eg5 and KLP61F motor and tail domains.</p><disp-quote content-type="editor-comment"><p>10) In terms of the organization of the manuscript, I would suggest the authors to present the figures in the following order: 1) Figures 3-5 (which show that the tail domain of kinesin-5s affects kinesin-5 velocity both on single MTs and within the overlap zone of two antiparallel microtubules, is required for efficient assembly of antiparallel microtubules, and is indispensable for kinesin-5 to produce strong forces within the overlap zone of two antiparallel microtubules), 2) Figures 1-2 (which are results showing the kinetic and structural bases of the observations in Figures 3-5), 3) Figure 6 (which shows that the tail domain plays important role in spindle localization of kinesin-5), and 4) the model Figure 7.</p></disp-quote><p>We deeply appreciate the reviewers suggested reorganization scheme. However, we have previously attempted to organize a previous draft of the manuscript in this exact manner and the results were more difficult to interpret for an audience of readers. In the current format, the biochemical and structural data allow a straightforward interpretation of the functional data presented after the biochemical and structural studies leading to a much clearer manuscript.</p><disp-quote content-type="editor-comment"><p>11) The authors state that &quot;the tail domain of the Xenopus Eg5 was suggested to form a secondary [MT-binding] site during [MT-sliding] activity, yet the function of the kinesin-5 tail-MT interaction remains unclear.&quot; How does this extra MT-binding site fit into the model the authors propose in Figure 7?</p></disp-quote><p>Our study suggests the previous work by Weinger et al., 2009, on similar versions of <italic>Xenopus</italic> Eg5 constructs should be re-interpreted in light of our data. Our studies show that the kinesin-5 tail primary binding site is located on the kinesin-5 motor domain and not on the microtubule lattice. However, we cannot rule out a secondary binding site of the tail domain on the microtubule lattice but believe the main effect comes from its motor bound form. Our data show that the tail domain binding on the motor likely regulates the ATP hydrolysis by stabilizing the nucleotide free or ADP-states, leading the motor to exhibit slow motility along microtubules particularly within overlap zones, as shown in Figure 4.</p></body></sub-article></article>