To study the functional intermediates in SNARE complex assembly, we assayed fusion without an added tether, with tethering by the physiological and multifunctional HOPS complex bound to the Rab Ypt7 on each membrane, or with a simple synthetic tether. Our synthetic tether consists of dimeric glutathione S-transferase (GST) fused to a PX domain that can bind to PtdIns3P in each proteoliposomal membrane (Song and Wickner, 2019). Proteoliposomes bearing Ypt7 and R-SNARE with lumenally entrapped biotinylated phycoerythrin were mixed with proteoliposomes bearing Ypt7 and the 3 Q-SNAREs with entrapped Cy5-streptavidin. These mixed proteoliposomes were incubated without tethering agent, with HOPS, or with GST-PX. Either tethering agent sufficed for fusion, which was detected by the FRET from the mixing of the lumenal dyes (Figure 1A). Similar proteoliposomes in which the inherently water-soluble Qc SNARE bore a synthetic C-terminal trans-membrane (tm) anchor (Xu and Wickner, 2012) showed similar fusion (Figure 1B). Although tethering is required, this shows that productive association of the three pre-assembled Q-SNAREs and the R-SNARE into functional trans-SNARE complex does not require catalysis by the Vps33 SM-protein subunit of HOPS, consistent with earlier findings that deletion within the R and Qa SNARE recognition domains of the Vps33 subunit of HOPS still permits fusion between R- and QaQbQc-SNARE proteoliposomes (Baker et al., 2015). In contrast, GST-PX does not suffice when one fusion partner bears only two Q-SNAREs and the third Q-SNARE is added in soluble form, but HOPS supports such fusion (Figure 1C–E), suggesting that HOPS helps recruit each Q-SNARE.

Since wild-type Qa and Qb are membrane anchored, and only Qc is soluble, we analyzed the fusion of R- and QaQb-proteoliposomes with soluble Qc in more depth. The full kinetic time course shows that the synthetic tether GST-PX did support detectable fusion of R- and QaQb- proteoliposomes with added Qc, but only very slowly and after a 10 min lag (Figure 1E, red curve, and Figure 1—figure supplement 2, curve a). This lag was eliminated and the fusion rate enhanced by a 30 min preincubation of the QaQb-SNARE proteoliposomes with Qc-SNARE prior to addition of the GST-PX tether (Figure 1—figure supplement 2, curves a vs. c and g), revealing a capacity for slow spontaneous assembly of stable 3Q-SNARE complex from QaQb-proteoliposomes and Qc (curve g). This was not seen with GST-PX and 2Q-SNARE proteoliposomes lacking Qa or Qb and supplemented with sQa or sQb, respectively (Figure 1C and D), suggesting that these assembly events are kinetically too slow and/or thermodynamically unfavorable.

As a second, complementary assay for spontaneous assembly of functional 3Q-SNARE complex, we employed the R-SNARE without its membrane anchor, termed soluble-R (sR), a known fusion inhibitor (Thorngren et al., 2004; Zick and Wickner, 2014; Song and Wickner, 2019). Inhibition by sR can employ two mechanisms: 1. sR may compete for the conserved R-SNARE binding groove on the Vps33 subunit of HOPS (Baker et al., 2015), and 2. If a stable SNARE complex is assembled which includes the sR-SNARE, subsequent fusion with R-SNARE proteoliposomes is blocked; for example, preincubation of Ypt7/3Q- and Ypt7/R-proteoliposomes with sR for 30 min prior to HOPS addition blocks their fusion (Zick and Wickner, 2014). R- and QbQc_tm or QaQc_tm-SNARE proteoliposomes were mixed and preincubated with or without sR and with or without the third sQ for 30 min, then HOPS and (where absent) the sQ were added to initiate fusion (Figure 1—figure supplement 3, A and B). The fusion seen without sR (curves e, f) was inhibited approximately twofold by sR (curves a-d) without regard to the order of addition and incubation, which may reflect sR competition for a conserved site on Vps33. However, there was complete fusion inhibition when QaQb-proteoliposomes were preincubated with both sR and Qc for 30 min prior to HOPS addition (C, curve a), suggesting sRQaQbQc assembly. The contrast between the full inhibition by sR when preincubated with Qc and QaQb proteoliposomes (Figure 1—figure supplement 3, C, curve a) and the lack of inhibition enhancement when either soluble Qa or soluble Qb is preincubated with sR and QbQc_tm or QaQc_tm proteoliposomes, respectively (Figure 1—figure supplement 3A and B, curve a), is another indication that soluble Qa and Qb do not spontaneously enter into complex with the other Q-SNAREs prior to HOPS addition. In sum, HOPS is required for any one of the Q-SNAREs to assemble rapidly with the others into functional SNARE complex for fusion, though a very slow spontaneous assembly of Qc can occur in the absence of HOPS.

The above studies show that HOPS can support the integration of each Q-SNARE for fusion (Figure 1C–E), but do not address whether HOPS has the capacity to bind each SNARE directly. Prior studies have shown that HOPS has direct affinity for the PX domain of the Qc SNARE (Stroupe et al., 2006) through the HOPS Vps16 and Vps18 subunits (Krämer and Ungermann, 2011) and for the R- and Qa-SNARE domains through its Vps33 SM-family subunit (Baker et al., 2015). HOPS has not been reported to have direct affinity for the Qb SNARE. To evaluate the ability of HOPS to bind to each SNARE, we prepared six sets of liposomes, either protein-free liposomes or proteoliposomes bearing one of the four vacuolar SNAREs (including a characterized membrane-anchored form of Qc; Xu and Wickner, 2012) or all four SNAREs. Each set of proteoliposomes was incubated with HOPS, then mixed with density medium, overlaid with a density gradient, and subjected to ultracentrifugation. The floated proteolipsomes were assayed by immunoblot for bound HOPS. Although HOPS was not recovered with protein-free liposomes (Figure 2, lane 1; also Figure 2—figure supplement 1), HOPS bound to each of the 4 SNAREs (lanes 2–5) or their complex (lane 6). There are several possible reasons why HOPS may bind better to individual SNAREs than to the SNARE complex. Though the large apolar surfaces of the R- and Qa-SNARE domains can bind into grooves on the Vps33 surface (Baker et al., 2015), these same surfaces are oriented into the center of the 4-helical SNARE complex (Sutton et al., 1998). This may shield these apolar surfaces and thereby attenuate their contribution to HOPS binding the 4-SNARE complex. Furthermore, HOPS binds to Qc through the Qc N-domain (Stroupe et al., 2006). The interactions among the SNARE N-domains in a 4-SNARE complex may modulate the contribution of the Qc N-domain to binding the SNARE complex to HOPS.

Since Qc is the one physiologically soluble Q-SNARE, we sought to physically and functionally measure any HOPS stabilized fusion-competent assemblies in trans when Ypt7/R-SNARE proteoliposomes were incubated with Ypt7/QaQb proteoliposomes in the presence or absence of HOPS. Fusion required both HOPS and Qc (Figure 3A, curve d; other incubations initially lacked HOPS or Qc or both). After 30 min of incubation of mixed proteoliposomes with HOPS alone, the addition of Qc (red curve e) triggered very rapid fusion which was not seen without Qc (curve c), showing that a highly active fusion intermediate had accumulated. Samples from each incubation were withdrawn at 33 min, solubilized in detergent with an excess of GST-R to competitively block any wild-type R which might have otherwise associated with Qa in the extract, and assayed by pulldown with antibody to Qa for the amount of untagged R-SNARE which had become associated with the Qa-SNARE (Figure 3B and C). While there was background association of the R and Qa SNAREs in incubations without HOPS or Qc (lane a) and maximal association with both HOPS and Qc (lane d), HOPS promoted substantial trans complex assembly between R and Qa SNAREs in the absence of Qc (lane c) while fusion remained blocked (Figure 3A, curve c). The addition of Qc at 30 min triggered rapid fusion (Figure 3A, red curve e) with only a modest increase in trans complex (Figure 3C,e vs c). HOPS thus forms an assembly which includes the R- and Qa-SNAREs in trans, whether directly with each other in coiled coils 3-SNARE bundles or with the R- and the two Q- SNAREs associated with common HOPS molecules or by some combination of these associations. We refer to these rapid-fusion complexes as ‘trans-complexes’, since they include two proteins anchored to different membranes, and reserve the term ‘trans-SNARE complex’ for when the anchored SNAREs themselves are clearly in a coiled coils complex with each other.

Fusion mediated by the four SNAREs alone is blocked by Sec17, Sec18, and ATP, but these chaperones stimulate fusion in the presence of HOPS (Mima et al., 2008). Is the rapid-fusion intermediate which HOPS forms with Ypt7/R and Ypt7/QaQb proteoliposomes compatible with Sec17, Sec18, and ATP? Ypt7/R- and Ypt7/QaQb-SNARE proteoliposomes fuse when incubated with HOPS and Qc (Figure 4A, solid black curve a; also Figure 4—figure supplement 1). When Qc is withheld, there is no fusion, but upon its addition there is rapid fusion (dotted black curve d). Sec17/Sec18/ATP does not inhibit fusion, whether added from the start of incubations with HOPS and Qc (solid blue curve b) or after 25 min (solid red curve c). When Qc is withheld and only added after 30 min of incubation with HOPS (dotted black curve d), fusion is not diminished by the presence of Sec17/Sec18/ATP from the start of the incubation (dotted blue curve e) or when added after 25 min (dotted red curve f). This HOPS-dependent fusion intermediate is thus fully compatible with the Sec17/Sec18 SNARE disassembly chaperones.

To determine whether Qb was necessary for HOPS-dependent formation of this rapid-fusion intermediate between Ypt7/R and Ypt7/QaQb proteoliposomes, we prepared Ypt7/Qa proteoliposomes. Ypt7/Qa proteoliposomes can fuse with Ypt7/R proteoliposomes when provided HOPS, sQb without the Qb membrane anchor, and Qc (Figure 5A, curve a, and Figure 5—figure supplement 1), as reported (Song et al., 2017). When sQb, Qc, or both were omitted, fusion was blocked, but there was rapid fusion when the omitted Q-SNAREs were restored after the proteoliposomes had incubated for 30 min with HOPS (curves b-d). Rapid fusion required HOPS during the initial incubation period (curves e-h). Thus, the R- and Qa-SNAREs alone will suffice for a HOPS-dependent assembly of a rapid-fusion intermediate.

To test whether Qc SNARE will, when present, actually join in this HOPS:R:Qa rapid-fusion intermediate, we exploited Qc-3Δ, a mutant Qc SNARE which lacks its three C-terminal heptad repeats and thereby blocks fusion (Schwartz and Merz, 2009). The fusion of Ypt7/R and Ypt7/Qa proteoliposomes with sQb, Qc, and HOPS (Figure 5B, curve a) was blocked by a large molar excess of Qc-3Δ (curve b). Other incubations were performed with full-length Qc and HOPS but without Qb (curves c-i). Without Qc-3Δ, the addition of Qb after 30 min triggered rapid fusion (curve c). There was substantial resistance to inhibition by Qc-3Δ when it was added immediately before sQb (curve d), but just 1 min of incubation with Qc-3Δ prior to sQb addition allowed full fusion inhibition (curve i). Had there been no association between wild-type Qc and the HOPS:R:Qa rapid-fusion machinery, the same fusion would have been seen in d-i, which each had the same 40-fold excess of Qc-3Δ to Qc at the time of sQb addition. The data indicate a labile association of wild-type Qc with the HOPS:R:Qa rapid-fusion machinery, taking a minute for full dissociation of Qc and capture by Qc-3Δ.

To explore the role of HOPS in the assembly of each of the 3 Q-SNAREs into rapid-fusion intermediates, Ypt7/R-SNARE proteoliposomes were mixed with each of the three Ypt7/2Q-SNARE proteoliposomes, the soluble Q-SNARE that was not proteoliposome-bound, and HOPS (Figure 6A–C, black curve a). In each case, the rate of fusion was compared to that seen when HOPS had been preincubated with the two mixed sets of proteoliposomes without the soluble Q-SNARE for 30 min prior to soluble Q-SNARE addition (red curve b). For each Q-SNARE, the fusion was distinctly more rapid when the soluble Q-SNARE was added after 30 min (Figure 6A–C, red curve b; see Figure 6—figure supplement 1) than when it had been added from the start (curve a), indicating that HOPS allowed the accumulation of fusion-competent intermediates which included either R and QaQb, R and QaQc_tm, or R and QbQc_tm, respectively. The formation of the rapid-fusion state required the presence of HOPS during the preincubation (compare curve b to curves c, d). The action of HOPS is not merely due to its tethering function, as the synthetic tether GST-PX does not support fusion at all unless the three Q-SNAREs have been pre-assembled (Figure 1). These assays do not distinguish whether the R- and two Q-SNAREs had entered three-helical coiled coils SNARE subcomplexes or whether HOPS catalysis consisted of binding the R and two Q-SNAREs in a configuration which could rapidly and functionally receive the third Q-SNARE for fusion.

Does each rapid-fusion complex correspond to a triad of SNAREs which alone can associate stably without HOPS? As reported (Fukuda et al., 2000), purified vacuolar SNAREs will associate in mixed micellar solution and can be isolated as a complex on affinity beads (Figure 7A–C, lanes 2). The single omissions of Qb, Qc, or R still allows formation of RQaQc, RQaQb, or QaQbQc complexes (Figure 7A, lanes 4–6). However, RQbQc complex is not seen when Qa is omitted (Figure 7B and C, lanes 2 vs 3). This need for Qa for spontaneous SNARE complex assembly, and the conserved recognition of Qa by SM proteins (Baker et al., 2015), makes the absence of Qa from the Ypt7/R and Ypt7/QbQc rapid-fusion intermediate of particular interest.

Since Ypt7/R and Ypt7/QbQc proteoliposomes which are incubated with HOPS will undergo rapid fusion when sQa is added (Figure 6A, and Figure 8A, red curve e), we assayed whether there was HOPS-dependent physical association between Qb- and R-SNARE prior to sQa addition. This association was indeed seen in a HOPS-dependent manner (Figure 8B and C, lanes a vs c), even though the R, Qb, and Qc SNAREs in detergent will not stably associate (lane f, and Figure 7B and C). Since there is no fusion without added sQa (Figure 8A, curve c), the corresponding complex (Figure 8B and C, lane c) is all in trans. In contrast, at least some of the complex seen when sQa had been present during the 30 min incubation (Figure 8B and C, lane d) may be cis-complex that had assembled from SNAREs brought together by fusion (Figure 8A, lane d), as there was less complex seen just 2 min after sQa addition (Figure 8B and C, lane e vs d), although they had undergone comparable fusion (Figure 8A, curve e vs d). Furthermore, the HOPS-mediated rapid-fusion intermediate formed between QbQc and R is stable in the presence of Sec17, Sec18, and ATP (Figure 4B), whether present from the start of incubation or added after 25 min (d, no Sec17 or Sec18; e, addition from t = 0; f, added after 25 min incubation), as seen for HOPS-mediated intermediates with QaQb and R (Figure 4A).

Will membrane-anchored Qb suffice without Qc for HOPS-dependent assembly of a rapid-fusion complex with R-proteoliposomes? Proteoliposomes with Ypt7 and R fused with proteoliposomes bearing Ypt7 and the Qb and Qc-_tm SNAREs when given HOPS and sQa (Figure 9A, solid black curve a) at a comparable rate to that seen with Ypt7/Qb proteoliposomes in the presence of HOPS, sQa, and Qc (dotted black curve c). Preincubation of HOPS with Ypt7/R- and Ypt7-QbQc_tm proteoliposomes yielded substantially more rapid fusion upon sQa addition (solid red curve b) than when sQa had been added from the start (curve a), as shown above (Figures 6A and 8). However, HOPS incubation with Ypt7/R-proteoliposomes and Ypt7/Qb proteoliposomes did not yield a rapid-fusion intermediate (Figure 9A, dotted green curve f), and inclusion of either Qc or sQa from the start of the incubation of HOPS with Ypt7/R- and Ypt7/Qb- proteoliposomes did not markedly enhance the rate of fusion upon the later addition of sQa or Qc, respectively (dotted red and blue curves d, e). The analogous comparison was done between fusion reactions which included Ypt7/R proteoliposomes and either Ypt7/QbQc-tm proteoliposomes or Ypt7/Qc-tm proteoliposomes (Figure 9B). The rapid-fusion state formed by HOPS, Ypt7/R proteoliposomes, and Ypt7/QbQc-tm proteoliposomes (Figure 9B, red curve b) was not seen when Ypt7/R and Ypt7/Qc-tm proteoliposomes were incubated with HOPS, either alone (green curve f) or with sQb (blue curve e) or sQa (dotted red curve d), for 30 min prior to addition of the missing soluble Q-SNAREs. Thus, while HOPS can stabilize a rapid-fusion intermediate between R and Qa alone without Qb or Qc (Figure 5), both Qb and Qc-tm are needed for the accumulation of rapid-fusion complex in the absence of Qa (Figure 9).

We complemented our physical assays of HOPS binding to single SNAREs (Figure 2) and the capacity of HOPS to promote physical associations between R- and Q-SNAREs (Figures 3 and 8) which correspond to rapid-fusion intermediates (Figure 6) with assays of whether the HOPS-dependent fusion between proteoliposomes bearing Ypt7 plus the R-SNARE and those with Ypt7 plus a single integrally-anchored Q-SNARE was saturable at low concentrations of each Q-SNARE, a hallmark of active site catalysis (Figure 10). The fusion of proteoliposomes that have Ypt7, R-SNARE, and lumenally entrapped biotinylated phycoerythrin with those bearing Ypt7, Qa-SNARE, and lumenally entrapped Cy5-streptavidin is supported by sQb, Qc, and an additional agent, either HOPS (Song and Wickner, 2017) or polyethylene glycol (PEG). While HOPS can specifically bind SNAREs (Figure 2), PEG is a nonspecific dehydrating agent (Lentz, 2007) which clusters membranes and promotes SNARE assembly without any SNARE-binding specificity. With PEG, the fusion rate steadily declines with diminishing sQb (Figure 10A, filled bars), as expected for four SNAREs spontaneously assembling into a required tetramer. However, with HOPS the rate is almost constant over the same wide sQb concentration range (Figure 10A, open bars), indicating saturation of an active HOPS binding site for sQb. [Earlier studies of HOPS-mediated fusion between R- and Qa-SNARE proteoliposomes had employed MBP-sQb, and found that it hadn't exhibited saturable kinetics (Zick and Wickner, 2013). We reproduce this finding (Figure 10—figure supplement 1, filled bars), and note that the MBP ‘tag’ had prevented a high-affinity, saturable engagement with HOPS, which is seen upon proteolytic removal of the tag (open bars).] When Ypt7/R and Ypt7/Qa proteoliposomes were mixed with ample sQb and the concentration of Qc was varied, fusion with PEG tethering was again proportional to the Qc concentration, while fusion with HOPS as the tether showed little change over a wide range of Qc (Figure 10B). This saturation indicates that HOPS has a functional Qc binding site. In a similar approach, proteoliposomes bearing Ypt7 and R were incubated with those bearing Ypt7 and Qb, in the presence of sQa, Qc, and either HOPS or PEG. With HOPS, the rate of fusion was saturable with respect to the concentration of Qa or Qc (Figure 10C and D). HOPS-dependent fusion of Ypt7/R and Ypt7/Qc proteoliposomes, where Qc was fused to a membrane anchor, is also invariant over a wide range of sQa or sQb concentrations (Figure 10E and F); direct comparison with PEG-mediated fusion was not possible, as PEG did not support the SNARE-dependent fusion of these proteoliposomes. In short, only tethered proteoliposomes will assemble trans-SNARE complexes and proceed to fuse. Once HOPS or PEG has tethered the membranes, trans-SNARE assembly can begin. If HOPS had no function beyond tethering, then membranes tethered by HOPS or PEG would have the same Km for each SNARE. However, when HOPS, which can recognize each SNARE, performs the tethering, we find that fusion has a far lower Km for each SNARE than when tethering is through PEG, which cannot recognize SNAREs. This indicates that HOPS not only functions by tethering but also by its recognition of each individual SNARE.The ability of HOPS to bind each SNARE (Figure 2), the low Km saturability of HOPS-mediated fusion for each Q-SNARE (Figure 10) and the capacity of HOPS to assemble a rapid-fusion complex between R- and Q-SNAREs in trans (Figures 3–6 and 8) demonstrate a central role of HOPS in the recognition of each Q-SNARE and in the assembly of rapid-fusion intermediates.

The soluble version of GST-Qa (GST-sQa), with Qa amino acyl residues 1–264 but lacking its transmembrane domain, was generated by PCR with the Phusion high-fidelity DNA polymerase (NEB). The DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al., 1999) with an in-Fusion kit (Clonetech).

For GST-sVam3,

F: AGGGCGCCATGGATCCGATGTCCTTTTTCGACATCGA

R: AGTTGAGCTCGTCGACTACTTACCGCATTTGTTACGGT

Full-length, untagged Nyv1 (Mima et a.l, 2008) was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al., 1999) with the HiFi DNA assembly kit (New England Biolabs, Ipswich, MA).

For GST-Nyv1:

F: AGGGCGCCATGGATCCGATGAAACGCTTTAATGTAAGT

R: AGTTGAGCTCGTCGATTACCACAGATAGAAAAACAT

Trans-membrane (tm)-anchored Ypt7: The nucleotide sequence encoding the transmembrane domain of the Qa-SNARE Vam3 (amino acyl residues 265–283) fused to the 3' end of the nucleotide sequence encoding full length Ypt7 was amplified by PCR from pET-19 Ypt7-tm (a kind gift from C Ungermann) with the Phusion high-fidelity DNA polymerase (NEB). The DNA fragment was cloned into BamHI and SalI digested pMBP-parallel1 vector (Sheffield et al., 1999) with the HiFi DNA assembly kit (New England Biolabs, Ipswich, MA).

For Ypt7-tm

F: AGGGCGCCATGGATCCGTCTTCTAGAAAAAAAAATATTTT

R: AGTTGAGCTCGTCGACTAACTTAATACAGCAAGCA

The resulting plasmid sequence was confirmed.

The purifications of HOPS (Zick and Wickner, 2013), GST-PX (Fratti et al., 2004), Sec17p (Schwartz and Merz, 2009), Sec18p (Mayer et al., 1996), wild-type Ypt7 (Zick and Wickner, 2013), and a soluble version of MBP-Qb (MBP-sQb) lacking its transmembrane domain (Zick and Wickner, 2013) were as described. Full-length, wild-type vacuolar SNAREs GST-Qa, Qc, R, and Qb were isolated as described (Mima et al., 2008; Schwartz and Merz, 2009; Zucchi and Zick, 2011), and Qb and R were buffer exchanged into β-octylglucoside (Zucchi and Zick, 2011). Vam7-tm (Xu and Wickner, 2012) and Sec17-tm (Song et al., 2017) were purified as described. The plasmid encoding his₆-Vam3 (full length) and his₆-Vti1 (full length) were kind gifts from Joji Mima, and the protein was purified as described (Izawa et al., 2012).

GST-Nyv1 and MBP-Ypt7-tm were purified as follows: GST-Nyv1 and MBP-Ypt7-tm were produced in E. coli Rosetta(DE3)pLysS (Novagen, Milwaukee WI). A single colony was inoculated into 50 ml LB medium containing 100 μg/ml ampicillin (Amp) and 37 μg/ml Chloramphenicol (Cam) and grown overnight at 37°C, then transferred to 6 l LB with 100 μg/ml Amp and 37 μg/ml Cam. Cultures were grown at 37°C to an OD₆₀₀ of 0.5. IPTG (0.5 mM) was added and cultures were shaken for 3 hr at 37°C. Cells were harvested by centrifugation (Beckman JA10 rotor, 5000 rpm, 5 min, 4°C) and resuspended in 50 ml buffer A (20 mM HEPES/NaOH, pH 7.4, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF [phenylmethylsulfonyl fluoride] and PIC [protease inhibitor cocktail; Xu and Wickner, 1996]). Resuspended cells were lysed by French Press (8000 psi, 4°C, two passages) and lysates were centrifuged (Beckman 60Ti rotor, 30 min, 50,000 rpm, 4°C). Pellets were resuspended in 100 ml of buffer B (PBS [140 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄ and 1.8 mM KH₂PO₄, pH7.4], 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, PIC and 1 mM PMSF) with a Dounce homogenizer and centrifuged (60Ti, 50,000 rpm, 30 min, 4°C). Pellets were resuspended in 100 ml of buffer C (PBS, 1 mM EDTA, 1 mM DTT, 1% Triton X100, 10% glycerol, PIC and 1 mM PMSF) with a Dounce homogenizer and incubated (4°C) with nutation for 1 hr. The extract was centrifuged (60Ti, 50,000 rpm, 30 min, 4°C) and the supernatant was added to 24 mL of glutathione-Sepharose 4B resin for GST-Nyv1 (GE Healthcare, Pittsburg, PA) or 24 mL of amylose resin for MBP-Ypt7-tm (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C. The resin was gravity-packed into a 2.5 cm diameter column at 4°C, washed with 100 mL of buffer D (100 mM HEPES/NaOH, pH 7.4, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 100 mM β-OG, 10% glycerol). GST-Nyv1 was eluted with 40 mM reduced glutathione in buffer D and MBP-Ypt7-tm was eluted with 25 mM maltose in buffer D. Proteins were frozen in liquid nitrogen and stored at −80°C.

A plasmid encoding the soluble version of GST-R (GST-sR) lacking its transmembrane domain (Thorngren et al., 2004) was transformed into E. coli BL21(DE3) and the protein was purified as follows: 100 ml of LB+ 100 µg/ml Ampicillin was inoculated with a single colony, shaken overnight at 37°C, then added to 3L of LB+Ampicillin. Cultures were grown at 37°C to an OD₆₀₀ of 0.8, induced with 1 mM IPTG, and shaken overnight at 18°C. Cells were harvested and resuspended in 40mls resuspension buffer (20 mM TrisCl, pH 8.0, 200 mM NaCl, 200 µM PMSF, PIC). Cells were lysed by French Press (two passages) and lysates were centrifuged in a Beckman 60ti rotor (1 hr, 50,000 rpm, 4°C). The supernatant was nutated (2 hr, 4°C) with 10 ml glutathione-Sepharose 4B resin (GE Healthcare, Pittsburg, PA) in resuspension buffer. The slurry was poured into a column, the settled resin was washed with resuspension buffer, and protein eluted with 100 mM HEPES-NaOH pH 7.8, 300 mM NaCl, 20 mM glutathione. The protein peak was dialyzed into RB150 (20 mM HEPES-NaOH pH 7.4, 150 mM NaCl, 10% glycerol [vol/vol]) in 6–8K molecular weight cutoff dialysis tubing (Fisher Scientific, Pittsburgh, PA), aliquoted, and frozen in liquid nitrogen. GST-sVam3 was purified the same way as GST-sNyv1, except that the growth media also contained 37 μg/ml chloramphenicol, the culture was grown to OD₆₀₀ of 1.0 before induction, the elution buffer was 20 mM HEPES-NaOH pH 7.4, 300 mM NaCl, 20 mM glutathione, 1 mM DTT, and the eluate was frozen in aliquots without dialysis. Before use, the MBP-sVti1, GST-sNyv1, and GST-sVam3 were cleaved with TEV protease to remove their tags, unless otherwise noted.

Dilinoleoyl lipids (diC18:2 PC, PS, PE, and PA), soy PI, and 1,2-dipalmitoyl-sn-glycerol were purchased from Avanti Polar Lipids (Alabaster, AL). Ergosterol was from Sigma Aldrich (St. Louis, MO), PI(3)P from Echelon Biosciences (Salt Lake City, UT), and the fluorescent lipids Marina-Blue DHPE, NBD-PE, and Lissamine rhodamine DHPE were from Invitrogen by Life Technologies (Eugene, OR). N-octyl-ß-D-glucopyranoside was from Anatrace (Maumee, OH), and poly(ethylene glycol) 8000 was from Sigma-Aldrich.

Proteoliposomes were prepared as described in Zick and Wickner (2014) with modifications. Lipid compositions of vacuolar mimic lipid (VML) proteoliposomes for content-mixing assays were 47.3 or 46.1 mol% diC18:2 PC, 18% diC18:2 PE, 18% soy PI, 4.4% diC18:2 PS, 2% diC18:2 PA, 8% ergosterol, 1% diacylglycerol, 1% diC16 PI(3)P and either 0.3% Marina Blue-PE or 1.5% NBD-PE. Lipid compositions of proteoliposomes for flotation assays were either 99% diC18:2 PC and 1% Lissamine rhodamine-DHPE or 83.5% diC18:2 PC, 15% diC18:2 PS and 1.5% NBD-PE. Proteins were added at protein:lipid ratios as described in the figure legends. Proteoliposomes were isolated by flotation through density medium as described (Zick and Wickner, 2013) and assayed for total phosphate (Chen et al., 1956). Aliquots of proteoliposomes in RB150+Mg²⁺ (20 mM HEPES-NaOH, pH 7.4, 150 mM NaCl, 10% glycerol [vol/vol], 1 mM MgCl₂) were frozen in liquid nitrogen at a concentration of 2 mM lipid phosphorus.

Proteoliposomes were nucleotide exchanged by incubating proteoliposomes (1 mM lipid), RB150, streptavidin (10 μM), EDTA (2 mM), and GTP (20 μM) for 10 min at 27°C. Nucleotide exchange was completed by adding MgCl₂ (4 mM) and the mixture was placed on ice. After prewarming (10 min, 27°C), fusion was initiated by mixing 5 μl each of GTP exchanged R- and Q-SNARE proteoliposomes and adding soluble components (10 μL of for example, HOPS, GST-PX, and soluble SNAREs as noted), for a total volume of 20 μl. Plates (Corning 4514, 384 wells) were incubated at 27°C in SpectraMax Gemini XPS (Molecular Devices, Sunnyvale, CA) fluorescence plate reader and lumenal mixing was assayed every minute, as described (Zick and Wickner, 2016).