In a genetic screen for mutants that suppressed a sluggish phenotype caused by an engineered hyperactive or gain-of-function (gf) SLO-2 (Liu et al., 2018), we isolated two mutants (zw80 and zw81) of the adr-1 gene, as revealed by analyses of whole-genome sequencing data. zw80 and zw81 carry nonsense mutations leading to premature stops at tryptophan (W) 366 and W33, respectively (Figure 1A). slo-2(gf) worms showed greatly decreased locomotion speed compared with wild type, and this phenotype was substantially alleviated in slo-2(gf);adr-1(lf) double mutants (Figure 1B). To confirm that the suppression of slo-2(gf) phenotype resulted from mutations of adr-1 rather than that of another gene, we created a new adr-1 mutant allele (zw96) by introducing a premature stop codon at serine (S) 333 (Figure 1A) using the CRISPR/Cas9 approach. The sluggish phenotype of slo-2(gf) was similarly suppressed by adr-1(zw96), which, by itself, did not enhance locomotion speed (Figure 1B). Expression of wild-type adr-1 under the control of the pan-neuronal rab-3 promotor (Prab-3) in slo-2(gf);adr-1(zw96) unmasked the sluggish phenotype (Figure 1B). These results indicate that the sluggish phenotype of slo-2(gf) is mainly caused by SLO-2 hyperactivity in neurons, and that neuronal function of SLO-2(gf) depends on ADR-1.

In C. elegans, cholinergic motor neurons control body-wall muscle cells by producing bursts of postsynaptic currents (PSC bursts) (Liu et al., 2014). To determine how adr-1 mutants might alleviate the slo-2(gf) locomotion defect, we recorded voltage-activated whole-cell currents from a representative cholinergic motor neuron (VA5) and postsynaptic currents from body-wall muscle cells in wild type, slo-2(gf), slo-2(gf);adr-1(zw96), and slo-2(gf);adr-1(zw96) with adr-1 rescued in neurons. Compared with wild type, the slo-2(gf) strain displayed much larger outward currents, and greatly decreased PSC burst frequency, duration and charge transfer (Figure 1C and D). These phenotypes of slo-2(gf) were mostly suppressed in the slo-2(gf);adr-1(zw96) strain (Figure 1C and D), suggesting that adr-1(lf) alleviated the sluggish phenotype through inhibiting SLO-2(gf). In addition, expression of wild-type adr-1 in neurons of slo-2(gf);adr-1(zw96) unmasked the effects of slo-2(gf) on VA5 whole-cell currents and PSC bursts (Figure 1C and D). These observations suggest that the suppressing effect of adr-1(lf) on the slo-2(gf) sluggish phenotype was likely due to reduced SLO-2 activities in motor neurons.

We suspected that the suppression of SLO-2(gf) by adr-1(lf) resulted from deficient RNA-editing. If so, adr-2(lf) might also suppress the sluggish phenotype of slo-2(gf) because ADR-2 is required for RNA editing. Indeed, the sluggish phenotype of slo-2(gf) worms was substantially alleviated in slo-2(gf);adr-2(lf) double mutants (Figure 2A), and the augmenting effect of slo-2(gf) on VA5 whole-cell outward currents was mostly eliminated by adr-2(lf) (Figure 2B). Furthermore, adr-2(lf) brought VA5 whole-cell currents below the wild-type level (Figure 2B), which presumably resulted from reduced activities of wild-type SLO-2. These results suggest that RNA editing is important to SLO-2 function in neurons.

The expression pattern of adr-1 was examined by expressing GFP under the control of adr-1 promoter (Padr-1). In transgenic worms, strong GFP expression was observed in the nervous system, including ventral cord motor neurons and many neurons in the head and tail, while weak GFP expression was observed in the intestine and body-wall muscles (Figure 3A). We then examined the subcellular localization pattern of ADR-1 by expressing GFP-tagged full-length ADR-1 (ADR-1::GFP) under the control of Prab-3. We found that ADR-1::GFP is localized in the nucleus, as indicated by its colocalization with the mStrawberry-tagged nucleus marker HIS-58 (Liu et al., 2018) in ventral cord motor neurons (Figure 3B).

To determine whether adr-1 is co-expressed with slo-2, we crossed the Padr-1::GFP transgene into an existing strain expressing Pslo-2::mStrawberry (Liu et al., 2018). We found that the expression patterns of adr-1 and slo-2 overlapped extensively in the nervous system (Figure 3C). For example, the majority of ventral cord motor neurons and numerous head neurons were colabeled by GFP and mStrawberry (Figure 3C). The occasional non-overlapping expressions of GFP and mStrawberry in ventral cord motor neurons probably resulted from mosaic expression of the transgenes.

SLO-2 is the primary conductor of delayed outward currents in C. elegans cholinergic motor neurons (Liu et al., 2014). We wondered whether the function of native SLO-2 channels in motor neurons depends on ADR-1. Consistent with our previous report (Liu et al., 2014), VA5 delayed outward currents were dramatically smaller and VA5 resting membrane potential was much less hyperpolarized in slo-2(lf) than wild type. While adr-1(lf) also caused significantly decreased outward currents and less hyperpolarized resting membrane potential in VA5, it did not produce additive effects when combined with slo-2(lf) (Figure 4A–C). These results suggest that adr-1(lf) affects motor neuron outward currents and resting membrane potential through SLO-2.

We next determined whether adr-1(lf) also alters PSC bursts. We found that adr-1(lf) caused an increase in the duration and mean charge transfer rate of PSC bursts without altering the burst frequency compared with wild type (Figure 4D and E). These phenotypes of adr-1(lf) were similar to those of slo-2(lf) and did not become more severe in the double mutants (Figure 4D and E), suggesting that ADR-1 modulates neurotransmitter release through SLO-2. The similar effects of adr-1(lf) and slo-2(lf) on PSC bursts are in contrast to their differential effects on VA5 outward currents and resting membrane potential. This discrepancy suggests that reducing SLO-2 activity beyond a certain threshold may produce similar effects on PSC bursts as does slo-2(lf).

Given that our results suggest that RNA editing is important to SLO-2 function, we determined whether adr-1(lf) causes deficient editing or decreased expression of slo-2 mRNA by comparing RNA-seq data between adr-1(lf) and wild type. The adr-1(zw96) allele was chosen for these analyses to avoid complications by potential mutations of other genes introduced into the genome during the generation of the other adr-1 mutants (zw80 and zw81). Unexpectedly, no RNA editing event was detected in slo-2 transcripts, and slo-2 mRNA level was similar between wild type and the adr-1 mutant (Figure 4—figure supplement 1). These results suggest that ADR-1 might regulate SLO-2 function through RNA editing of another gene.

A previous study identified 270 high-confidence editing sites in transcripts of 51 genes expressed in C. elegans neurons (Washburn et al., 2014). We suspected that the putative molecule mediating the effect of ADR-1 on SLO-2 is encoded by one of these genes, and the mRNA level of this gene is reduced in adr-1(lf). Therefore, we compared transcript expression levels of these genes (excluding those encoding transposons) in our RNA-Seq data between wild type and adr-1(zw96). Most of these genes showed either no decrease or only a small decrease in expression, but two of these genes, rncs-1 and scyl-1, were reduced greatly in adr-1(lf) compared with wild type (Figure 5). rncs-1 is not a conceivable candidate for the putative SLO-2 regulator because it is a non-coding gene expressed in the hypodermis and vulva (Hellwig and Bass, 2008). We therefore focused our analyses on scyl-1, which encodes an orthologue of mammalian SCYL1 important to neuronal function and survival (Pelletier, 2016). Like its mammalian homologs, SCYL-1 has an amino-terminal kinase domain that lacks residues critical to kinase activity, and a central domain containing five HEAT repeats (HEAT for Huntingtin, elongation factor 3, protein phosphatase 2A, yeast kinase TOR1) (Pelletier, 2016). SCYL-1 shares 38% identity and 60% similarity with human SCYL1. Notably, amino acid sequence in the HEAT domain, which is often highly degenerative (Pelletier, 2016), shows a very high level of sequence homology (53% identity and 76% similarity) between these two proteins (Figure 5—figure supplement 1).

We examined the expression pattern of scyl-1 by expressing GFP under the control of scyl-1 promoter (Pscyl-1). Because another gene (lap-2) resides ~2 kb upstream of scyl-1 (www.wormbase.org), we first expressed GFP under the control of 2 kb Pscyl-1. However, no GFP signal was detected in transgenic worms (not shown). We then used an in vivo homologous recombination approach to express a Pscyl-1::GFP transcriptional fusion that included a much longer sequence upstream of the scyl-1 initiation site. Specifically, a 0.5 kb genomic fragment upstream of the scyl-1 initiation site was fused to GFP in a plasmid, which was co-injected with a fosmid covering part of the scyl-1 coding region and 32 kb sequence upstream of the initiation site into wild type worms. In vivo homologous recombination between the plasmid and the fosmid is expected to result in a promoter::GFP transcriptional fusion that includes all the upstream genomic sequence in the fosmid. Transgenic worms from coinjection of the plasmid and the fosmid showed GFP signal in a variety of cells (Figure 6), suggesting distant upstream sequences are required for scyl-1 expression. To determine how the expression pattern of scyl-1 correlates with that of slo-2, we crossed the transgene into the Pslo-2::mStrawberry strain, and examined the expression patterns of GFP and mStrawberry. Co-expression of scyl-1 and slo-2 was observed in many ventral cord motor neurons (Figure 6). However, most other neurons expressing slo-2 (e. g. head and tail neurons) did not appear to express scyl-1. In addition, scyl-1 expression was detected in some cells that did not express slo-2, including the excretory cell, spermatheca, uterine ventral cells, and intestinal cells (Figure 6).

We next determined whether SCYL-1 is important to SLO-2 function. To this end, we created a mutant, scyl-1(zw99), by introducing a stop codon after isoleucine 152 using the CRISPR/Cas9 approach, and examined the effect of this mutation on VA5 delayed outward currents. scyl-1(zw99) showed a substantial decrease in VA5 outward currents compared with wild type; this phenotype could be rescued by expressing wild-type SCYL-1 in neurons, and was non-additive with that of either slo-2(lf) or adr-1(zw96) (Figure 7A). These results suggest that SCYL-1 and ADR-1 likely act in a common pathway to contribute to SLO-2 function.

The decrease of delayed outward currents in scyl-1(lf) could have resulted from either reduced expression or reduced function of SLO-2. We first determined whether scyl-1(lf) alters SLO-2 expression by crossing a stable (near 100% penetrance) Prab-3::SLO-2::GFP transgene from an existing transgenic strain of wild-type genetic background (Liu et al., 2018) into scyl-1(zw99), and comparing GFP signal between the two strains. We found that GFP signal in the ventral nerve cord was similar between wild type and the scyl-1 mutant (Figure 7B), suggesting that SCYL-1 does not regulate SLO-2 expression. We then determined whether SCYL-1 regulates SLO-2 function by obtaining inside-out patches from VA5 and analyzing SLO-2 single-channel properties. SLO-2 showed >50% decrease in open probability (P_o) without a change of single-channel conductance in scyl-1(zw99) compared with wild type, and this mutant phenotype was completely rescued by neuronal expression of wild-type SCYL-1 (Figure 8A). Analyses of single-channel open and closed events revealed that SLO-2 has at least two open states and three closed states, and that the decreased P_o of SLO-2 in scyl-1(lf) mainly resulted from shorter and fewer long openings (Figure 8B) and a larger proportion of the longest closings (Figure 8C).

The observed effects of scyl-1(lf) on SLO-2 single-channel properties suggest that SCYL-1 may physically interacts with SLO-2. To address this possibility, we performed bimolecular fluorescence complementation (BiFC) (Hu et al., 2002) and coimmunoprecipitation assays, which indicate whether these two proteins are physically very close in vivo and whether they coexist in a molecular complex, respectively. In both assays, we determined whether full-length SCYL-1 interacts with either the full-length, the amino-terminal portion (amino acids 1–317), or the carboxyl-terminal portion (amino acids 318–1107) of SLO-2 (Figure 9A). In the BiFC assay, SCYL-1 and SLO-2 were fused to the N- and C-terminal portions of YFP (YFPa and YFPc), respectively (Figure 9A). A detection of YFP signal would indicate physical closeness of the two fusion proteins. We observed YFP fluorescence in ventral cord motor neurons when either the full-length or the C-terminal of SLO-2 was used but not when the N-terminal was used in the assays (Figure 9B). The coimmunoprecipitation assay was performed with homogenates of worms expressing HA-tagged SCYL-1 and GFP-tagged SLO-2. We found that the SCYL-1 immunoprecipitated with either full-length SLO-2 or SLO-2 C-terminal but not SLO-2 N-terminal (Figure 9C), which is in agreement with the BiFC results. Thus, both the BiFC and coimmunoprecipitation results suggest that SCYL-1 physically interacts with SLO-2, and this interaction is mediated by SLO-2 carboxyl terminal.

Our RNA-Seq data revealed eight high-frequency (>15%) adenosine-to-guanosine editing sites in scyl-1 transcripts of wild type (Figure 10A). All these editing sites are located within a predicted 746 bp hair-pin structure in the 3’ end of scyl-1 pre-mRNA, which contains an inverted repeat with >98% complementary base pairing (Figure 10B). Interestingly, RNA editing at only one of these sites was significantly deficient (by 74%) in adr-1(zw96) compared with wild type (Figure 10A). Sanger sequencing of scyl-1 mRNA and the corresponding genomic DNA from wild type, adr-1(zw96), and adr-2(gv42) showed that RNA editing at this site was deficient in both the adr-1 and adr-2 mutants whereas that at an adjacent site was deficient only in the adr-2 mutant (Figure 10C), suggesting that RNA editing at the site impaired by adr-1(lf) might be important to scyl-1 expression. To address this possibility, we created transgenic worms expressing a Prab-3::GFP transcriptional fusion (wp1923), in which a genomic DNA fragment covering part of the last exon of scyl-1 and 5 kb downstream sequence was fused in-frame to the 3’-end of GFP coding sequence (Figure 10D). We also created transgenic worms expressing a modified plasmid (wp1924), in which adenosine (A) at the specific ADR-1-dependent editing site was changed to guanosine (G) to mimic the edited nucleotide (Figure 10D). GFP signal was observed in worms harboring wp1924 but no GFP signal was detected in worms harboring wp1923 (Figure 10E). While observation of GFP signal in the wp1924 strain was expected, the complete absence of GFP signal in the wp1923 strain caught us by surprise. To better understand the role of ADR-1 in scyl-1 mRNA expression, we integrated the wp1924 transgene into the wild-type genome, crossed it into adr-1(zw96), and compared GFP signal in ventral cord motor neurons between wild type and the mutant. GFP signal was ~50% weaker in the mutant than wild type (Figure 10F and G). Because the transgene mimicked the edited 3’-UTR sequence of scyl-1 mRNA, the weaker GFP signal in the mutant than wild type suggests that ADR-1 can also increase scyl-1 mRNA level through a post-editing effect.

If ADR-1 does enhance scyl-1 mRNA level through a post-editing mechanism in addition to RNA editing, it likely perform this function through interacting with some other proteins, and such proteins might be identified by screening for mutants showing decreased GFP signal from the wp1924 transgene. Indeed, eleven mutants with reduced GFP expression were isolated from ~5000 mutagenized haploid genomes in a pilot genetic screen, as shown by two examples (Figure 10—figure supplement 1). The deficiency of GFP expression in these mutants was related to the function of scyl-1 3’-UTR because GFP expression from a control transgene with unc-10 3’-UTR was not compromised in these mutants (Figure 10—figure supplement 1). These results favor the notion that ADR-1 may also interact with other molecules after RNA editing to promote scyl-1 expression.

The HEAT domain of SCYL proteins is important to protein-protein interactions but generally varies considerably in amino acid sequence for interactions with specific protein partners (Yoshimura and Hirano, 2016). The high level of sequence homology of the HEAT domain between mammalian SCYL1 and worm SCYL-1 (Figure 5—figure supplement 1) promoted us to test whether mammalian Slo2.2/Slack is also regulated by SCYL1. We expressed human Slo2.2 (hSlo2.2) either alone or together with mouse SCYL1 in Xenopus oocytes, and analyzed hSlo2.2 single-channel properties in inside-out patches. SCYL1 increased hSlo2.2 P_o greatly without altering the single-channel conductance (Figure 11A). The channel has at least two open states and three closed states (Figure 11B–D). While events of both the open states and the two shorter closed states were numerous, those of the longest closed state were infrequent. Nevertheless, the longest closed state had a major impact on P_o because of its rather long duration. Dwell time analyses indicate that SCYL1 increased hSlo2.2 P_o mainly by increasing the duration and proportion of the longer open state, and shortening the duration of the longest closed state (Figure 11B–D). The overall effect of SCYL1 on hSlo2.2 P_o is similar to that of SCYL-1 on SLO-2 P_o in wild-type worms (Figure 8). Taken together, these results suggest that a physiological function of both mammalian SCYL1 and worm SCYL-1 is to enhance Slo2 channel activities.

C. elegans hermaphrodites were grown on nematode growth medium (NGM) plates spotted with a layer of OP50 Escherichia coli at 22°C inside an environmental chamber. All the strains used in this study are listed in the Key Resource Table (plasmids used in making the transgenic strains are indicated by numbers with a ‘wp’ prefix).

An integrated transgenic strain expressing Pslo-1::SLO-2(gf) and Pmyo-2::YFP (transgenic marker) in the wild-type genetic background was used for mutant screen. L4-stage slo-2(gf) worms were treated with the chemical mutagen ethyl methanesulfonate (50 mM) for 4 hr at room temperature. F2 progeny from the mutagenized worms were screened under stereomicroscope for animals that moved better than the original slo-2(gf) worms. 17 suppressors were isolated in the screen and were subjected to whole-genome sequencing. Analysis of the whole-genome sequencing data showed that 2 mutants have mutations in the adr-1 gene (www.wormbase.com). Identification of adr-1 mutants was confirmed by the recovery of the sluggish phenotype when a wild-type cDNA of adr-1 under the control of Prab-3 was expressed in slo-2(gf);adr-1(zw81) double mutants.

The CRISPR/Cas9 approach (Dickinson et al., 2013) was used to create adr-1 and scyl-1 knockouts. The guide RNA sequences for adr-1 and scyl-1 are 5’- CCAGTTTTCGAAGCTTCGG and 5’- GAGGAGATTGGAAAATTGG, which were inserted into pDD162 (Peft-3::Cas9 + Empty sgRNA; Addgene #47549), respectively. The resultant plasmids (wp1645 for adr-1 and wp1887 for scyl-1) were injected into wild type worms, respectively, along with a repair primer (5’-GAGAAGTATTCACCAGTTTTCGAAGCTTAATGAGTTCCAAAAGATCCAGAGATTCCCGAA for adr-1, and 5’-TTGTAACAGCCGGAGGAGATTGGAAAATCTAGCTGGTGGACTTCATTTGGTCACTGGATT for scyl-1) and Pmyo-2::mStrawberry (wp1613) as the transgenic marker. The adr-1 knockout worms were identified by PCR using primers 5’-TCACCAGTTTTCGAAGCTTAATGA (forward) and 5’-TCTTCTGCTGGCTCACATTCA (reverse). The scyl-1 knockout worms were identified by PCR using primers 5’- CCGAAGTCCCAATTCCCAT (forward) and 5’- CCAAATGAAGTCCACCAGCTAG (reverse). The knockout worms were confirmed by Sanger sequencing.

The expression pattern of adr-1 was assessed by expressing GFP under the control of 1.8 kb adr-1 promoter (Padr-1::GFP, wp1872). Primers for cloning Padr-1 are 5’- TAAGGTACCAAGGACACGTTGCATATGAAT (forward) and 5’- TTTACCGGTTGGCTGACATATTGTGGGA (reverse). Subcellular localization of ADR-1 was determined by fusing GFP to its carboxyl terminus and expressing the fusion protein under the control of Prab-3 (Prab-3::adr-1::GFP, wp1374). Primers for cloning adr-1 cDNA are 5’- AAAGCGGCCGCATGGATCAAAATCCTAACTACAA (forward) and 5’- TTTACCGGTCCATCGAAAGCAGCAAGAGTGAAG (reverse). A plasmid (wp1749) harboring Prab-3::his-58::mStrawberry serves as a nucleus marker. The expression pattern of scyl-1 was assessed by an in vivo recombination approach. Specifically, a 0.5 kb fragment immediately upstream of scyl-1 initiation site was cloned and fused to GFP using the primers 5’- AATCTGCAGCATCGGCACGAGAAGTACA (forward) and 5’- TTAGGATCCCTAAAAGTGATCGAAATTTA (reverse). The resultant plasmid (Pscyl-1::GFP, wp1902) was linearized and co-injected with a linearized (fosmid WRM068bA03), which contains 32 kb of scyl-1 upstream sequence and part of its coding region, into the lin-15(n765) strain along with a lin-15 rescue plasmid to serve as a transformation marker. To assay the effect of the identified adenosine site at the 3’UTR of scyl-1 on gene expression, a 5.1 kb genomic DNA fragment covering part of the scyl-1 last exon and subsequent sequence was cloned and fused in-frame to GFP using the primers 5’- AATGCTAGCATGCAGGCTAGAAATGAAGCTCG (forward) and 5’- TATGGGCCCGAAATCAGCATCTTTGACGAA (reverse). To mimic the A-to-I editing at the identified specific site, a second plasmid was made by mutating the specific adenosine to guanosine in the above plasmid. The two resultant plasmids were injected into lin-15(n765), respectively, with a lin-15 rescue plasmid as the transgenic marker. Images of transgenic worms were taken with a digital CMOS camera (Hamamatsu, C11440-22CU) mounted on a Nikon TE2000-U inverted microscope equipped with EGFP/FITC and mCherry/Texas Red filter sets (49002 and 49008, Chroma Technology Corporation, Rockingham, VT, USA).

Locomotion velocity was determined using an automated locomotion tracking system as described previously (Wang and Wang, 2013). Briefly, a single adult hermaphrodite was transferred to an NGM plate without food. After allowing ~30 s for recovery from the transfer, snapshots of the worm were taken at 15 frames per second for 30 s using a IMAGINGSOURCE camera (DMK37BUX273) mounted on a stereomicroscope (LEICA M165FC). The worm was constantly kept in the center of the view field with a motorized microscope stage (OptiScanTM ES111, Prior Scientific, Inc, Rockland, MA, USA). Both the camera and the motorized stage were controlled by a custom program (Source code 1) running in MATLAB (The MathWorks, Inc, Natick, MA).

Total RNA was extracted from young adult-stage worms using TRIzol Reagent (Invitrogen) and treated with TURBO DNase (Ambion). RNA-seq was performed by Novogene Corp. Sacramento, CA.

Raw reads ware filtered using Trim Galore software (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) to remove reads containing adapters or reads of low quality. The filtered reads were mapped to C. elegans genome (ce11) using TopHat2 (Kim et al., 2013). The gene expression level is estimated by counting the reads that map to exons.

BiFC assays were performed by coexpressing SLO-2 and SCYL-1 tagged with the amino and carboxyl terminal portions of YFP (YFPa and YFPc), respectively, in neurons under the control of rab-3 promoter (Prab-3). To assay which portion of SLO-2 may interact with SCYL-1, the full-length, N-terminal, and C-terminal portion of SLO-2 were fused with YFPa, respectively. The resultant plasmids (wp1783, Prab-3::SLO-2::YFPa; wp1784, Prab-3::SLO-2N::YFPa, and wp1785, Prab-3::SLO-2C::YFPa) were coinjected with Prab-3::SCYL-1::YFPc (wp1952), respectively, into lin-15(n765) strain. A lin-15 rescue plasmid was also coinjected to serve as a transformation marker. Epifluorescence of the transgenic worms was visualized and imaged as described above.

Mixed stage transgenic worms expressing either SCYL-1::HA alone or SCYL-1::HA with one of the GFP fusions (full-length SLO-2, SLO-2 amino-terminal, and SLO-2 carboxyl-terminal) were homogenized in lysis buffer containing 150 mM NaCl, 0.5 mM EDTA, 0.5 % P40, and 10 mM Tris/Cl pH 7.5. Immunoprecipitation was performed with a GFP-Trap Magnetic Agarose Kit (gtmak-20, ChromoTek Inc) according to the manufacturer’s manual. The immune complexes and the worm lysates were separated on 4–20% Novex Tris-Glysine gels (XP04202BOX, Thermo Fisher Scientific) and probed with HA or GFP antibodies (sc-7392, sc-9996, Santa Cruz Biotechnology, Inc).

Adult hermaphrodites were used in all electrophysiological experiments. Worms were immobilized and dissected as described previously (Liu et al., 2007). Borosilicate glass pipettes were used as electrodes for recording whole-cell currents. Pipette tip resistance for recording muscle cell currents was 3–5 MΩ whereas that for recording motor neuron currents was ~20 MΩ. The dissected worm preparation was treated briefly with collagenase and perfused with the extracellular solution for 5 to 10-fold of bath volume. Classical whole-cell configuration was obtained by applying a negative pressure to the recording pipette. Current- and voltage-clamp experiments were performed with a Multiclamp 700B amplifier (Molecular Devices, Sunnyvale, CA, USA) and the Clampex software (version 10, Molecular Devices). Data were sampled at a rate of 10 kHz after filtering at 2 kHz. Spontaneous membrane potential changes were recorded using the current-clamp technique without current injection. Motor neuron whole-cell outward currents were recorded by applying a series of voltage steps (−60 to +70 mV at 10 mV intervals, 600 ms pulse duration) from a holding potential of −60 mV. Spontaneous PSCs were recorded from body-wall muscle cells at a holding potential of −60 mV. Two bath solutions and three pipette solutions were used in electrophysiological experiments as specified in figure legends. Bath solution I contained (in mM) 140 NaCl, 5 KCl, 5 CaCl₂, 5 MgCl₂, 11 dextrose and 5 HEPES (pH 7.2). Bath solution II contained (in mM) 100 K⁺ gluconate, 50 KCl, 1 Mg²⁺ gluconate, 0.1 Ca²⁺ gluconate and 10 HEPES (pH 7.2). Pipette solution I contained (in mM) 120 KCl, 20 KOH, 5 Tris, 0.25 CaCl₂, 4 MgCl₂, 36 sucrose, 5 EGTA, and 4 Na₂ATP (pH 7.2). Pipette solution II differed from pipette solution I in that 120 KCl was substituted by K⁺ gluconate. Pipette solution III contained (in mM) 150 K⁺ gluconate, 1 Mg²⁺ gluconate and 10 HEPES (pH 7.2).

A construct containing human Slack cDNA (pOX + hSlo2.2, a gift from Dr. Salkoff) was linearized with Pvu I. The mouse Scyl1 cDNA was amplified from a construct (MR210762, Origene) and cloned into an existing vector downstream of the T3 promoter. The resultant plasmid (wp1982) was linearized with NgoM4. Capped cRNAs were synthesized using the mMessage mMachine Kit (Ambion). Approximately 50 nl cRNA of either Slack alone (0.5 ng/nl) or Slack (0.5 ng/nl) plus Scyl1 (0.5 ng/nl) was injected into each oocyte using a Drummond Nanoject II injector (Drummond Scientific). Injected oocytes were incubated at 18°C in ND96 medium (in mM): 96 NaCl, 2 KCl, 1.8 CaCl₂, 1 MgCl₂, 5 HEPES (pH 7.5). 2 to 3 days after cRNA injection, single channel recordings were made in inside-out patches with a Multiclamp 700B amplifier (Molecular Devices, Sunnyvale, CA, USA) and the Clampex software (version 10, Molecular Devices). Data were sampled at 10 kHz after filtering at 2 kHz. Bath solution contained (in mM) 60 NaCl, 40 KCl, 50 K⁺ gluconate, 10 KOH, 5 EGTA, and 5 HEPES (pH 7.2). Pipette solution contained (in mM) 100 K⁺ gluconate, 60 Na⁺ gluconate, 2 MgCl₂, and 5 HEPES (pH 7.2).

Amplitudes of whole-cell currents in response to voltage steps were determined from the mean current during the last 100 ms of the 1200 ms voltage pulses using the Clampfit software. The duration and charge transfer of PSC bursts were quantified with Clampfit software (version 10, Molecular Devices) as previously described (Liu et al., 2013). The frequency of PSC bursts was counted manually. For single channel analysis, the QuB software (https://qub.mandelics.com/) was used to fit open and closed times to exponentials, and to quantify the τ values and relative areas of the fitted components, which were automatically determined by the software. Single-channel conductance was calculated by dividing the single-channel current amplitude (determined from a Gaussian fit to the amplitude histogram) by the holding voltage. The first 30 s recording of each experiment was used for such analyses. Statistical comparisons were made with Origin Pro 2019 (OriginLab Corporation, Northampton, MA) using either ANOVA or unpaired t-test as specified in figure legends. p<0.05 is considered to be statistically significant. The sample size (n) equals the number of cells or membrane patches analyzed. All values are shown as mean ± SE and data graphing was done with Origin Pro 2019.