<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">55165</article-id><article-id pub-id-type="doi">10.7554/eLife.55165</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Short Report</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Loss of Doc2b does not influence transmission at Purkinje cell to deep nuclei synapses under physiological conditions</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-171609"><name><surname>Khan</surname><given-names>Mehak M</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-5710-7421</contrib-id><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-15254"><name><surname>Regehr</surname><given-names>Wade G</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-3485-8094</contrib-id><email>wade_regehr@hms.harvard.edu</email><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><institution>Department of Neurobiology, Harvard Medical School</institution><addr-line><named-content content-type="city">Boston</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Brose</surname><given-names>Nils</given-names></name><role>Reviewing Editor</role><aff><institution>Max Planck Institute of Experimental Medicine</institution><country>Germany</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Aldrich</surname><given-names>Richard W</given-names></name><role>Senior Editor</role><aff><institution>The University of Texas at Austin</institution><country>United States</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>29</day><month>04</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e55165</elocation-id><history><date date-type="received" iso-8601-date="2020-01-14"><day>14</day><month>01</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2020-04-09"><day>09</day><month>04</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Khan and Regehr</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Khan and Regehr</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-55165-v1.pdf"/><abstract><p>Doc2a and Doc2b are high-affinity calcium-binding proteins that interact with SNARE proteins and phospholipids. Experiments performed on cultured cells indicated that Doc2 proteins promote spontaneous vesicle fusion and asynchronous neurotransmitter release, regulate vesicle priming, mediate augmentation, and regulate transmission during sustained activity. Here, we assess the role of Doc2 proteins in synaptic transmission under physiological conditions at mature synapses made by Purkinje cells onto neurons in the deep cerebellar nuclei (PC to DCN synapses). PCs express Doc2b but not Doc2a. Surprisingly, spontaneous neurotransmitter release, synaptic strength, the time course of evoked release, responses evoked by sustained high-frequency stimulation, and short-term plasticity were normal in Doc2b KO mice. Thus, in stark contrast to numerous functions previously proposed for Doc2, here we find that Doc2b removal does not influence transmission at PC-to-DCN synapses, indicating that conclusions based on studies of Doc2b in cultured cells do not necessarily generalize to mature synapses under physiological conditions.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>synapse</kwd><kwd>calcium</kwd><kwd>plasticity</kwd><kwd>deep cerebellar nuclei</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Mouse</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000052</institution-id><institution>NIH Office of the Director</institution></institution-wrap></funding-source><award-id>R35NS097284</award-id><principal-award-recipient><name><surname>Regehr</surname><given-names>Wade G</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000001</institution-id><institution>National Science Foundation</institution></institution-wrap></funding-source><award-id>DGE1745303</award-id><principal-award-recipient><name><surname>Khan</surname><given-names>Mehak</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Eliminating the calcium-binding protein Doc2b does not alter transmission at a mature synapse under physiological conditions, counter to the prevailing view of Doc2b based on cultured neurons.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Presynaptic calcium signaling plays a critical role in neurotransmitter release and synaptic plasticity. Numerous types of Ca-binding proteins are present in presynaptic terminals and have the potential to contribute to synaptic transmission. Of particular interest are proteins that contain tandem C2 domains that bind Ca and interact with phospholipids and SNARE proteins, such as several Ca-sensitive Synaptotagmin isoforms (Syts) and two Doc2 isoforms, Doc2a and Doc2b (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>; <xref ref-type="bibr" rid="bib10">Pang et al., 2011</xref>; <xref ref-type="bibr" rid="bib21">Yao et al., 2011</xref>). Some of these proteins (Syt1 and Syt2) bind calcium with low affinity and fast kinetics to mediate fast synaptic transmission (<xref ref-type="bibr" rid="bib4">Fernández-Chacón et al., 2001</xref>). Others, such as Syt7, bind Ca with high affinity and slow kinetics and mediate facilitation and asynchronous neurotransmitter release (<xref ref-type="bibr" rid="bib19">Wen et al., 2010</xref>; <xref ref-type="bibr" rid="bib8">Jackman et al., 2016</xref>). Doc2b and Doc2a also bind calcium with high affinity, but their contribution to synaptic transmission is unclear.</p><p>Multiple physiological functions have been ascribed to Doc2a and Doc2b based primarily on cell culture studies. These proteins are understood to function in a similar manner but can be differentially expressed (<xref ref-type="bibr" rid="bib3">Courtney et al., 2018</xref>; <xref ref-type="bibr" rid="bib18">Verhage et al., 1997</xref>). In hippocampal cultures, Doc2b knockout (KO) reduced the frequency of miniature postsynaptic currents (‘minis’) compared to control (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>; <xref ref-type="bibr" rid="bib3">Courtney et al., 2018</xref>). This reduction in mini frequency has also been observed at Purkinje cell (PC) to PC collateral synapses in acute slices from P7-8 Doc2b KO mice (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>). These results led to the proposal that Doc2b is a Ca sensor for spontaneous release. Doc2b and Doc2a have also been proposed to be Ca sensors for asynchronous release in hippocampal cultures (<xref ref-type="bibr" rid="bib21">Yao et al., 2011</xref>). Another study from hippocampal cultures reported that Doc2 proteins mediate synaptic augmentation (<xref ref-type="bibr" rid="bib20">Xue et al., 2018</xref>). Furthermore, in cultured chromaffin cells, Doc2b is thought to act as a Ca sensor for vesicle priming (<xref ref-type="bibr" rid="bib7">Houy et al., 2017</xref>). Despite the intriguing results of these studies, the role of Doc2b at mature synapses under physiological conditions remains unaddressed.</p><p>Here, we investigate how Doc2b contributes to transmission at the PC to Deep Cerebellar Nuclei (DCN) synapse in mature animals. PCs form powerful synapses onto neurons in the DCN which relay cerebellar output to numerous brain regions. This synapse was chosen because <italic>Doc2b</italic> is expressed in PCs but <italic>Doc2a</italic> is not (<xref ref-type="bibr" rid="bib18">Verhage et al., 1997</xref>; <xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>), and because Doc2b might contribute to several distinguishing features of this synapse. The PC to DCN synapse remains effective even for high-frequency sustained activation, as is typical in vivo (<xref ref-type="bibr" rid="bib15">Turecek et al., 2016</xref>; <xref ref-type="bibr" rid="bib23">Zhou et al., 2014</xref>). Furthermore, a specialized vesicle pool with a very low initial probability of release is thought to mediate transmission during high-frequency activation, but this pool is poorly understood. We hypothesized that Doc2b regulates this pool because Doc2b regulates release during prolonged stimulation of chromaffin cells (<xref ref-type="bibr" rid="bib11">Pinheiro et al., 2013</xref>). Second, facilitation at the PC to DCN synapse helps these synapses maintain frequency-invariance (<xref ref-type="bibr" rid="bib16">Turecek et al., 2017</xref>). Although Syt7 has been proposed to mediate facilitation at the PC to DCN synapse, we tested the possibility that Doc2b also contributes to short-term synaptic plasticity and frequency-invariance. Unexpectedly, no aspect of PC to DCN transmission was altered in Doc2b KO mice. These results present a striking dichotomy between the previously described contributions of Doc2b to the synaptic physiology of cultured neurons and the lack of an apparent role in transmission at an intact synapse under physiological conditions.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Spontaneous release</title><p>In order to assess the suitability of the PC to DCN synapse for our studies, we used fluorescence in situ hybridization (FISH) to evaluate <italic>Doc2b</italic> and <italic>Doc2a</italic> gene expression in adult (P60-P70) wildtype and Doc2b KO mice (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>). PCs strongly expressed <italic>Doc2b</italic> but not <italic>Doc2a</italic> in wildtype animals (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). In PCs of Doc2b KO mice, <italic>Doc2b</italic> expression was eliminated and <italic>Doc2a</italic> expression remained absent (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). In wildtype animals, DCN neurons did not express either <italic>Doc2b</italic> or <italic>Doc2a</italic> (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). <italic>Doc2b</italic> was apparent in the dentate gyrus of the hippocampus (<xref ref-type="bibr" rid="bib18">Verhage et al., 1997</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>), and the striatum (data not shown) of wildtype animals but was absent in the KO (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>). <italic>Doc2a</italic> expression was apparent in the CA3 region of the hippocampus in both WT and Doc2b KO (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). Furthermore, we used immunostaining to demonstrate that Doc2b protein colocalizes with parvalbumin, a marker for PC boutons, in the DCN of WT animals (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). Doc2b immunoreactivity was not detected in Doc2b KO animals (<xref ref-type="fig" rid="fig1">Figure 1D</xref>). Doc2b immunoreactivity was also prominent in PC cell bodies and dendrites and in other brain regions including the hippocampus (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). These studies indicate that Doc2b is the only calcium-dependent Doc2 present at PC synapses of adult wildtype mice, that it is eliminated in Doc2b KO mice, and that there is no compensatory expression of <italic>Doc2a</italic> in PCs of Doc2b KO mice.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Loss of Doc2b does not affect mIPSC frequency at the PC to DCN synapse.</title><p>(<bold>A</bold>) Sagittal cerebellum slice from a WT mouse at postnatal day 60 (P60) labeled using FISH for <italic>DAPI</italic> (blue), <italic>Doc2b</italic> (green), and <italic>Doc2a</italic> (red). Abbreviations, Purkinje Cell Layer (PCL), Molecular Layer (ML), Granule Cell Layer (GCL), and Deep Cerebellar Nuclei (DCN). Scale bar, 200 μm. (<bold>B</bold>) Same as in (<bold>A</bold>) but for Doc2b KO. Images are on the same scale as in (<bold>A</bold>). (<bold>C</bold>) Sagittal DCN section from a WT mouse at postnatal day 60 (P60) immunostained for parvalbumin (left, cyan) and Doc2b (right, magenta). Scale bar, 25 μm. (<bold>D</bold>) Same as in (<bold>C</bold>) but for Doc2b KO. Images are on the same scale as in (<bold>C</bold>). (<bold>E</bold>) mIPSCs were recorded at the PC to DCN synapse in P40-50 mice in the presence of TTX, NBQX, and CPP. Representative traces from individual cells for WT and Doc2b KO littermates. (<bold>F</bold>) Summary data for mIPSC frequency and amplitude at the PC to DCN synapse in P40-50 mice. n = 14 cells (3 animals) for WT, n = 12 cells (3 animals) for Doc2b KO. Individual cells are shown as small circles and genotype average is shown as larger bold circle. Statistical significance was assessed using two-tailed Student’s <italic>t</italic>-tests after data were found to be normally distributed (Shapiro-Wilk test) (see Materials and Methods for details). (<bold>G</bold>) Same as in (<bold>C</bold>) but for P11-12 mice. (<bold>H</bold>) Same as in (<bold>D</bold>) but for P11-12 mice. n = 20 cells (3 animals) for WT, n = 20 cells (2 animals) for Doc2b KO.</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>PC to DCN mini frequencies and amplitudes.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-55165-fig1-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig1-v1.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title><italic>Doc2a</italic> expression is normal in Doc2b KO.</title><p>(<bold>A</bold>) Sagittal hippocampus slice from a WT mouse at P60 labeled with RNAscope probe for <italic>DAPI</italic> (blue). Scale bar, 200 μm. (Aa). Inset from (<bold>A</bold>) with expanded view of dentate gyrus, labeled with RNAscope probes for <italic>DAPI</italic>, <italic>Doc2b</italic> (green), and <italic>Doc2a</italic> (red). Scale bar, 50 μm. (Ab). Inset from (<bold>A</bold>) with expanded view of CA3 hippocampus, labeled with RNAscope probes for <italic>DAPI</italic>, <italic>Doc2b</italic>, and <italic>Doc2a</italic>. Scale bar, 50 μm. (<bold>B</bold>) Same as in (<bold>A</bold>) but for Doc2b KO. Images are on the same scale as in (<bold>A</bold>). (Ba) Same as in (Aa) but for Doc2b KO. (Bb) Same as in (Ab) but for Doc2b KO.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig1-figsupp1-v1.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 2.</label><caption><title>Doc2b immunohistochemistry in wildtype and Doc2b KO animals.</title><p>(<bold>A</bold>) Sagittal cerebellum slice from a WT mouse at postnatal day 60 (P60) immunostained for parvalbumin (left, cyan) and Doc2b (right, magenta). Scale bar, 300 μm. (<bold>B</bold>) Same as in (<bold>A</bold>) but for Doc2b KO. Images are on same scale as in (<bold>A</bold>). (<bold>C</bold>) Sagittal hippocampus slice from a WT mouse at P60 immunostained for DAPI (top, blue) and Doc2b (bottom, magenta). Scale bar, 300 μm. Abbreviation, Dentate gyrus (DG). (<bold>D</bold>) Same as in (<bold>C</bold>) but for Docb2 KO. Images are on same scale as in (<bold>C</bold>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig1-figsupp2-v1.tif"/></fig><fig id="fig1s3" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 3.</label><caption><title>Doc2b KO reduces mIPSC frequency at PC to PC collateral synapses.</title><p>(<bold>A</bold>) mIPSCs were recorded at PC to PC synapses in P7-8 mice in the presence of TTX, NBQX, CPP, and strychnine. Representative traces from individual cells for WT (black) and Doc2b KO (red) littermates. (<bold>B</bold>) Summary data for mIPSC frequency and amplitude at PC to PC synapses. n = 25 cells (7 animals) for WT, n = 36 cells (7 animals) for Doc2b KO. <italic>Left:</italic> Statistical significance was assessed using two-tailed Wilcoxon Signed-Rank test after the data were found to be asymmetrically distributed (Shapiro-Wilk test). <italic>Right:</italic> Statistical significance was assessed using two-tailed Student’s <italic>t</italic>-tests after data were found to be normally distributed (Shapiro-Wilk test).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig1-figsupp3-v1.tif"/></fig><fig id="fig1s4" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 4.</label><caption><title>Postsynaptic loss of Doc2b does not alter mEPSC frequency onto PCs.</title><p>(<bold>A</bold>) mEPSCs were recorded at PC to PC synapses in P11-12 mice in the presence of TTX and gabazine. Representative traces from individual cells for WT (black) and Doc2b KO (red) littermates. (<bold>B</bold>) Summary data for mEPSC frequency and amplitude at PF to PC synapses. n = 25 cells (four animals) for WT, n = 24 cells (three animals) for Doc2b KO. Statistical significance was assessed using two-tailed Student’s <italic>t</italic>-tests.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig1-figsupp4-v1.tif"/></fig></fig-group><p>Based on multiple studies that show that Doc2b positively regulates mini frequency (<xref ref-type="bibr" rid="bib3">Courtney et al., 2018</xref>; <xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>; <xref ref-type="bibr" rid="bib10">Pang et al., 2011</xref>; <xref ref-type="bibr" rid="bib13">Ramirez et al., 2017</xref>), we expected the loss of Doc2b to decrease mIPSC frequency at the PC to DCN synapse. Surprisingly, however, there was no difference in mIPSC frequency for WT and Doc2b KO mice at the mature PC to DCN synapse under physiological conditions (34-35<sup>o</sup> C, 1.5 mM external calcium, Ca<sub>e</sub>) (p=0.93, two-tailed unpaired Student’s <italic>t-</italic>test) (<xref ref-type="fig" rid="fig1">Figure 1E–F</xref>). This contrasts with the strong reduction in mIPSC frequency that Doc2b KO causes in hippocampal autapse cultures (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>), hippocampal neuronal cultures (<xref ref-type="bibr" rid="bib3">Courtney et al., 2018</xref>; <xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>; <xref ref-type="bibr" rid="bib10">Pang et al., 2011</xref>; <xref ref-type="bibr" rid="bib13">Ramirez et al., 2017</xref>), and PC to PC synapses (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>). In the latter case, the observed 75% reduction in mIPSC frequency at PC to PC synapses is paricularly interesting because it also involves synapses made by PCs. In contrast to our PC to DCN studies which were perfomed in near physiological conditions (34-35<sup>o</sup> C, 1.5 Ca<sub>e</sub>), experiments at PC to PC synapses were performed in brain slices of P7-P8 mice at room temperature in elevated Ca<sub>e</sub> (2.0 mM). This raises the possibility that the age of the animal, the temperature of the experiments, or the external calcium levels could all contribute to differences in the Doc2b dependence of mIPSC frequency. We found that mIPSC frequency was reduced by 65% in P7-P8 in Doc2b KO mice for experiments that were performed at 34-35<sup>o</sup> C and in 1.5 Ca<sub>e</sub> (p&lt;0.001, two-tailed Wilcoxon signed-rank test) (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>). This result suggests that the age of the animal could account for the Doc2b dependence of mIPSC frequency. It is impractical to extend studies of the PC to PC synapse to older animals because PCs are the dominant source of inhibition for other PCs for only a brief developmental window, and in older animals, molecular layer interneurons become the dominant source of inhibition (<xref ref-type="bibr" rid="bib1">Altman, 1972</xref>; <xref ref-type="bibr" rid="bib2">Bernard and Axelrad, 1993</xref>). These observations suggest that Doc2b contributes to mini release in developing animals but not in adults. To address this possibility, we repeated experiments at the PC to DCN synapse in P11-12 animals, but again observed no difference in mini release in Doc2b KO mice (p=0.57, two-tailed unpaired Student’s <italic>t-</italic>test) (<xref ref-type="fig" rid="fig1">Figure 1G–H</xref>).</p><p>Another potential issue in interpreting previous studies is that Doc2b is present both presynaptically and postsynaptically at PC to PC synapses and at many cultured synapses that have been studied. Although Doc2b is thought to function presynaptically, it remains possible that Doc2b may act postsynaptically to influence mini frequency. We therefore tested whether postsynaptic loss of Doc2b affects mini frequency by recording miniature excitatory postsynaptic currents (mEPSCs) at the parallel fiber to PC synapse, in which <italic>Doc2b</italic> is normally expressed in the postsynaptic PC, but not in the presynaptic granule cells (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). At the parallel fiber to PC synapse, we saw no effect on mEPSC frequency or amplitudes in Doc2b KO mice (p=0.83), arguing against a postsynaptic contribution of Doc2b to minis (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>).</p></sec><sec id="s2-2"><title>Synaptic strength and release kinetics</title><p>We assessed the role of Doc2b in determining the strength and kinetics of evoked release by studying individual PC inputs. To isolate synaptic responses from single PCs, we stimulated PC axons at the stimulus threshold and evoked failures and synaptic currents with a similar probability (<xref ref-type="fig" rid="fig2">Figure 2A–B</xref>). The peak single fiber conductances were similar for WT and Doc2b KO mice (p=0.22, two-tailed Wilcoxon signed-rank test) (WT: 30.9 ± 3.5 nS, n = 30 inputs, Doc2b KO: 26.9 ± 2.7, n = 29 inputs), indicating that the loss of Doc2b does not alter evoked release at the PC to DCN synapse.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Doc2b does not contribute to the strength or kinetics of evoked release.</title><p>(<bold>A</bold>) Top: Example minimal stimulation of a PC input to a DCN neuron, where the stimulus intensity was lowered until failures or single inputs were evoked with similar probability. Bold traces show average traces for failures and single inputs. Bottom: IPSC amplitudes at a fixed stimulus intensity. (<bold>B</bold>) Representative examples of single inputs from WT and Doc2b KO mice. (<bold>C</bold>) Summary data for minimal conductances and single IPSC decay time constant (tau) for WT and Doc2b KO. n = 30 inputs for WT, n = 29 inputs for Doc2b KO. Average conductance was 30.9 ± 4 nS for WT and 26.9 ± 3 nS for Doc2b KO. Average IPSC tau decay was 3.43 ± 0.2 ms for WT and 3.63 ± 0.2 for Doc2b KO. Left: Statistical significance was assessed using two-tailed Wilcoxon Signed-Rank test after the data were found to be asymmetrically distributed (Shapiro-Wilk test). Right: Statistical significance was assessed using two-tailed Student’s t-tests after data were found to be normally distributed (Shapiro-Wilk test).</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>PC to DCN single fibers and spontaneous events.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-55165-fig2-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig2-v1.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Asynchronous release after single stimuli does not occur at the PC to DCN synapse.</title><p>(<bold>A</bold>) Representative example of single input from WT, showing average failure and average input. (<bold>B</bold>) Individual trials from the example in (<bold>A</bold>) showing failures (top) and successfully evoked single inputs (bottom). Stimulus artifact is blanked for clarity. (<bold>C</bold>) Same as in (<bold>A</bold>) but for Doc2b KO. Same scale as in (<bold>A</bold>). (<bold>D</bold>) Same as in (<bold>B</bold>) but for Doc2b KO. Same scale as in (<bold>B</bold>). (<bold>E</bold>) Summary data of spontaneous events occurring before and after a minimal electrical stimulus in WT, sorted by events occurring during failures (dark) and inputs (light). Stimulus duration blanked for clarity. n = 9 cells (3 animals). (<bold>F</bold>) Same as in (<bold>E</bold>) but for Doc2b KO. n = 11 cells (4 animals). Same scale as in (<bold>E</bold>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig2-figsupp1-v1.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Asynchronous release after stimulus bursts does not occur at the PC to DCN synapse.</title><p>(<bold>A</bold>) Representative example of DCN response to 4 × 100 Hz burst stimulation of PC fibers from WT. (<bold>B</bold>) Individual trials from the example in (<bold>A</bold>). Stimulus artifact is blanked for clarity. (<bold>C</bold>) Same as in (<bold>A</bold>) but for Doc2b KO. Same scale as in (<bold>A</bold>). (<bold>D</bold>) Same as in (<bold>B</bold>) but for Doc2b KO. Same scale as in (<bold>B</bold>). (<bold>E</bold>) Summary data of spontaneous events occurring before and after burst stimulation in WT. Stimulus duration blanked for clarity. n = 9 cells (three animals). (<bold>F</bold>) Same as in (<bold>E</bold>) but for Doc2b KO. n = 11 cells (four animals). Same scale as in (<bold>E</bold>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig2-figsupp2-v1.tif"/></fig></fig-group><p>The high affinity and slow kinetics of calcium-binding made Doc2 a strong candidate sensor for asynchronous release, and a study concluded that Doc2 mediates slow asynchronous release in hippocampal cultures (<xref ref-type="bibr" rid="bib21">Yao et al., 2011</xref>). However, we found that the decays of the synaptic currents were unaltered in Doc2b KO mice (<xref ref-type="fig" rid="fig2">Figure 2B–C</xref>). The IPSC decay time constants were similar for WT and Doc2b KO mice (p=0.45, two-tailed unpaired Student’s <italic>t-</italic>test) (WT: 3.43 ± 0.18 ms, Doc2b KO: 3.63 ± 0.17 ms). We also quantified asynchronous release by detecting individual inhibitory synaptic events. There was a high frequency (50–100 Hz) of spontaneous IPSCs onto DCN cells. As expected, during failure trials, there was no change in spontaneous event frequency (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). If asynchronous release is present at the PC to DCN synapse, the number of events after a success trial would be expected to transiently increase, but this was not the case (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). Instead there was a transient decrease in sIPSC frequency. This reduction was present in both WT and Doc2b KO mice and could be lengthened by stimulating PCs 4 times at 100 Hz (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>). Several possible mechanisms could account for the transient decrease of sIPSC frequency, including depletion of the readily releasable pool, or shunting of more distal inputs as somatic PC conductances are activated. However, with regard to the issue of asynchronous release, these experiments demonstrate that asynchronous release is not detected at the PC to DCN synapse in WT or Doc2b KO animals.</p></sec><sec id="s2-3"><title>Sustained responses and synaptic plasticity</title><p>PCs usually fire at high frequencies for sustained periods, and it is therefore important to use appropriate stimulus patterns to assess the contribution of Doc2b under physiological conditions. The PC to DCN synapse changes considerably during development. We therefore examined the role of Doc2b at PC to DCN synapses in both juveniles (P13-15) and adults (P60-80). We tested the hypothesis that Doc2b helps PC to DCN synapses maintain their efficacy during sustained periods of high-frequency activation.</p><p>We began by studying the PC to DCN synapse in juveniles, where synaptic depression is prominent and becomes more pronounced at higher PC stimulation frequencies (<xref ref-type="fig" rid="fig3">Figure 3</xref>; <xref ref-type="bibr" rid="bib16">Turecek et al., 2017</xref>; <xref ref-type="bibr" rid="bib15">Turecek et al., 2016</xref>). We stimulated PC axons with 50 stimuli delivered at frequencies between 5 Hz and 100 Hz and recorded synaptic responses in DCN cells. In both WT and Doc2b KO mice, frequency-dependent synaptic depression was readily observable, and responses from individual cells were comparable (<xref ref-type="fig" rid="fig3">Figure 3A–B</xref>). Paired pulse plasticity was unaffected by the loss of Doc2b (p=0.74, two-tailed unpaired Student’s <italic>t-</italic>test) (<xref ref-type="fig" rid="fig3">Figure 3C</xref>), suggesting that Doc2b does not contribute to the initial probability of release. We found no difference in the magnitude of the steady-state IPSCs between WT and Doc2b KO (p=0.64) (<xref ref-type="fig" rid="fig3">Figure 3D</xref>), and the kinetics of reaching steady-state were unaltered in Doc2b KO mice (p=0.83) (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). These results demonstrate that Doc2b does not play a role in synaptic transmission during ongoing activity in juvenile PC to DCN synapses.</p><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Short-term plasticity at the developing PC to DCN synapse is unaffected by Doc2bKO.</title><p>(<bold>A</bold>) PC axons were stimulated at various frequencies and responses were recorded from large DCN neurons in P13-15 mice. Representative IPSCs for WT are shown with stimulus artifact blanked for clarity. (<bold>B</bold>) Same as in (<bold>A</bold>) but for Doc2b KO. Same scale as in (<bold>A</bold>) unless indicated otherwise. (<bold>C</bold>) Normalized paired pulse ratio (PPR) as a function of stimulation frequency. Data are mean ± S.E.M. n = 14 cells (6 animals) for WT, n = 11 cells (6 animals) for Doc2b KO. Statistical significance was assessed using two-tailed Student’s <italic>t</italic>-tests after data were found to be normally distributed (Shapiro-Wilk test). (<bold>D</bold>) Same as in C but showing steady-state IPSC amplitude as a function of stimulation frequency. (<bold>E</bold>) Same as in C but showing steady-state decay time constant (λ) as a function of stimulation frequency.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>PC to DCN train data for young animals.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-55165-fig3-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig3-v1.tif"/></fig><p>In adults, steady-state transmission at PC to DCN synapses is frequency-independent (<xref ref-type="bibr" rid="bib16">Turecek et al., 2017</xref>; <xref ref-type="bibr" rid="bib15">Turecek et al., 2016</xref>). This unusual property requires a precise balance between activity-dependent vesicle depletion and activity-dependent facilitation mediated by Syt7 (<xref ref-type="bibr" rid="bib16">Turecek et al., 2017</xref>). However, synaptic responses are present during sustained high-frequency activation in Syt7 KO mice, although they are no longer frequency-invariant (<xref ref-type="bibr" rid="bib16">Turecek et al., 2017</xref>). Therefore, there must be Syt7-independent mechanisms that help sustain release after repetitive PC activity. We hypothesized that Doc2b, which exhibits similar Ca-binding properties as Syt7, could help enhance release in response to PC activity. We tested this hypothesis by studying PC to DCN synapses from adults (P60-P80). Frequency-invariance is readily observed at this age in WT, as steady-state synaptic strength remains constant across PC firing frequency (<xref ref-type="fig" rid="fig4">Figure 4A</xref>; <xref ref-type="bibr" rid="bib15">Turecek et al., 2016</xref>). In Doc2b KO mice, we observed no difference in synaptic responses compared to WT mice, and frequency-invariance remained intact (<xref ref-type="fig" rid="fig4">Figure 4</xref>). Specifically, steady-state synaptic strength and the kinetics of reaching steady-state were normal in Doc2b KO (p=0.32 and p=0.51, respectively) (<xref ref-type="fig" rid="fig4">Figure 4C–D</xref>). In addition, we examined whether the amount of Syt7-dependent facilitation was affected by Doc2b KO. If Syt7 and Doc2b are activated by a shared Ca source, then Syt7-dependent facilitation may become more prominent in Doc2b KO as Doc2b competing for Ca is absent. However, we did not observe any difference in the magnitude or time-course of facilitation in Doc2b KO at the PC to DCN synapse (<xref ref-type="fig" rid="fig4">Figure 4G–H</xref>). Altogether, our data do not support a role for Doc2b in PC to DCN synaptic transmission or short-term plasticity in young or mature animals under physiological conditions.</p><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Doc2b is not necessary for frequency-invariant transmission at the mature PC to DCN synapse.</title><p>(<bold>A</bold>) Example of DCN response to PC axon stimulation at 10 Hz or 100 Hz in WT. Stimulus artifact blanked for clarity. (<bold>B</bold>) Same as in (<bold>A</bold>) but for Doc2b KO. Same scale as in (<bold>A</bold>) unless indicated otherwise. (<bold>C</bold>) Normalized steady-state IPSC amplitude as a function of stimulation frequency. Data are mean ± S.E.M. n = 10 cells (four animals) for WT, n = 9 cells (four animals) for Doc2b KO. Statistical significance was assessed using two-tailed Student’s <italic>t</italic>-tests after data were found to be normally distributed (Shapiro-Wilk test). (<bold>D</bold>) Same as in C but showing steady-state decay time constant (λ) as a function of stimulation frequency. (<bold>E</bold>) Example of DCN response to PC axon stimulation switched between 100 Hz and 10 Hz in WT and Doc2b KO, showing the frequency-independence of steady-state. Scale on right is same as scale on left. (<bold>F</bold>) Normalized IPSC amplitudes as a function of stimulus number for the protocol in (<bold>D</bold>). (<bold>G</bold>) Expanded view of examples in (<bold>D</bold>), showing a hidden facilitation unmasked when stepping from 10 Hz to 100 Hz. Scale on right is same as scale on left. (<bold>H</bold>) Same as in (<bold>E</bold>) but expanded view of frequency step from 10 Hz to 100 Hz.</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>PC to DCN train data for adult animals.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-55165-fig4-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55165-fig4-v1.tif"/></fig></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>In this study, we aimed to answer whether Doc2b contributes to neurotransmitter release at a mature synapse. We used a hypothesis-driven approach that prioritized physiological relevance to clarify the function of Doc2b. We found no evidence to support previously proposed roles for Doc2b that were mainly based on studies in cultured cells. The frequency of spontaneous release was unaltered in Doc2b KO mice, indicating that Doc2b is not a calcium sensor for spontaneous release at this synapse (<xref ref-type="bibr" rid="bib3">Courtney et al., 2018</xref>; <xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>; <xref ref-type="bibr" rid="bib10">Pang et al., 2011</xref>; <xref ref-type="bibr" rid="bib13">Ramirez et al., 2017</xref>). In addition, the PC to DCN synapse is extremely fast (average Tau decay = 2.1 ms; <xref ref-type="fig" rid="fig2">Figure 2</xref>), asynchronous release is not apparent in WT animals, and the time-course of synaptic responses is unaltered in Doc2b KO mice. We therefore conclude that Doc2b does not serve as a calcium sensor for asynchronous release (<xref ref-type="bibr" rid="bib21">Yao et al., 2011</xref>) at PC to DCN synapses. Furthermore, the amplitudes of evoked synaptic responses were normal in Doc2b KO mice, suggesting that Doc2b does not influence the initial release probability or vesicle priming at the PC to DCN synapse (<xref ref-type="bibr" rid="bib5">Friedrich et al., 2008</xref>; <xref ref-type="bibr" rid="bib7">Houy et al., 2017</xref>). Finally, the observation that synaptic responses during prolonged high-frequency stimulation are maintained and unaltered in Doc2b KO mice, ruled out our hypothesis that Doc2b helps regulate transmission during sustained activation of the PC to DCN synapse (<xref ref-type="bibr" rid="bib11">Pinheiro et al., 2013</xref>). Thus, we find that Doc2b does not contribute to any aspect of synaptic transmission at the mature PC to DCN synapse under physiological conditions.</p><p>It is surprising that the loss of this high-affinity calcium-binding protein which interacts with key secretory elements, including SNARE proteins and cell membranes (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>; <xref ref-type="bibr" rid="bib10">Pang et al., 2011</xref>; <xref ref-type="bibr" rid="bib21">Yao et al., 2011</xref>), fails to affect neurotransmitter release at the mature PC to DCN synapse. It is important to note that the studies implicating Doc2 in so many aspects of synaptic transmission were primarily performed at synapses between cultured cells. The only data previously reported for intact synapses in brain slices were conducted in very young (P7-8) mice at PC to PC synapses, where Doc2b KO reduces mIPSC frequency (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>; <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3B</xref>). It is not feasible to follow this effect over time because PCs do not provide the dominant source of inhibition onto other PCs after this brief period. This raises the possibility that the involvement of Doc2 in transmission could be a developmental effect on synaptic maturation. If true, this effect appears to be negligible by P11 for PC synapses, as mIPSC frequency was normal at this age and into adulthood at the PC to DCN synapse in Doc2b KO animals (<xref ref-type="fig" rid="fig1">Figure 1</xref>). It is also possible that redundant mechanisms and compensation by other calcium-binding proteins masked the effect of Doc2b KO. Although we have shown that this is not a consequence of compensation by Doc2a, which is absent from PCs in WT and Doc2b KO mice, there are many other calcium-binding proteins present in presynaptic terminals. One thing is very clear, however, loss of Doc2b does not influence neurotransmitter release at the mature PC to DCN synapse. We conclude that the roles of Doc2b in synaptic transmission described in previous in vitro studies do not necessarily apply to mature synapses under physiological conditions.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type <break/>(species) or <break/>resource</th><th valign="top">Designation</th><th valign="top">Source or <break/>reference</th><th valign="top">Identifiers</th><th valign="top">Additional <break/>information</th></tr></thead><tbody><tr><td valign="top">Gene (<italic>M. musculus</italic>)</td><td valign="top"><italic>Doc2b</italic> (gene) <break/>Doc2b (protein)</td><td valign="top">UniProtKB</td><td valign="top">P-70169</td><td valign="top"/></tr><tr><td valign="top">Strain, strain background (<italic>M. musculus</italic>)</td><td valign="top">Doc2b KO mice</td><td valign="top">Doi:<ext-link ext-link-type="uri" xlink:href="http://doi.org/10.1126/science.1183765">http://doi.org/10.1126/science.1183765</ext-link>; <break/>PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/20150444">20150444</ext-link></td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Antibody</td><td valign="top">Rabbit polyclonal anti-Doc2b</td><td valign="top">Synaptic Systems</td><td valign="top">Cat #174 103; <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2619874">AB_2619874</ext-link></td><td valign="top">IHC (1:200)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Mouse monoclonal anti-Parvalbumin</td><td valign="top">Sigma-Aldrich</td><td valign="top">Product#P3088-.2ML; <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_477329">AB_477329</ext-link></td><td valign="top">IHC (1:500)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Goat anti-rabbit IgG H and L Alexa Fluor647</td><td valign="top">Abcam</td><td valign="top">Ab150083; <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2714032">AB_2714032</ext-link></td><td valign="top">IHC (1:1000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Goat anti-mouse IgG H and L Alexa Fluor568</td><td valign="top">Abcam</td><td valign="top">Ab175473</td><td valign="top">IHC (1:1000)</td></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top">Fluorophore-conjugated Probe-Mm-Doc2b</td><td valign="top">ACD Bio</td><td valign="top">Cat#484798</td><td valign="top"/></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top">2.5 VS Probe -Mm-Doc2A probe</td><td valign="top">ACD Bio</td><td valign="top">Cat#531549-C2</td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Matlab</td><td valign="top">Mathworks (<ext-link ext-link-type="uri" xlink:href="https://www.mathworks.com/downloads/">https://www.mathworks.com/</ext-link> <break/><ext-link ext-link-type="uri" xlink:href="https://www.mathworks.com/downloads/">downloads/</ext-link>)</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_001622">SCR_001622</ext-link></td><td valign="top">Version R2017a</td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">IgorPro</td><td valign="top">Wavemetrics (<ext-link ext-link-type="uri" xlink:href="https://www.wavemetrics.com/order/order_igordownloads6.htm">https://www.wavemetrics.com/order/order_igordownloads6.htm</ext-link>)</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_000325">SCR_000325</ext-link></td><td valign="top">Version 6.37</td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">ImageJ software</td><td valign="top">ImageJ <break/>(<ext-link ext-link-type="uri" xlink:href="http://imagej.nih.gov/ij/">http://imagej.nih.gov/ij/</ext-link>)</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_003070">SCR_003070</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">OlyVIA software</td><td valign="top">Olympus (<ext-link ext-link-type="uri" xlink:href="https://www.olympus-lifescience.com/en/support/downloads/">https://www.olympus-lifescience.com/en/support/downloads/</ext-link>)</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_016167">SCR_016167</ext-link></td><td valign="top">Version 2.9.1</td></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top">Doc2b primers</td><td valign="top">This paper</td><td valign="top">PCR primers</td><td valign="top">5’<named-content content-type="sequence">CATTGCCACTTCATAAGCGTAAGTTTCC</named-content> 3’ <break/>5’<named-content content-type="sequence">CGAGGATGGAACCCTGTTTACTCTGG</named-content> 33’ <break/>5’<named-content content-type="sequence">CCTTCTATCGCCTTCTTGACG</named-content> 3’</td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">NBQX disodium salt</td><td valign="top">Abcam</td><td valign="top">Ab120046</td><td valign="top"/></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">(R)-CPP</td><td valign="top">Abcam</td><td valign="top">Ab120159</td><td valign="top"/></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">Strychnine hydrochloride</td><td valign="top">Abcam</td><td valign="top">Ab120416</td><td valign="top"/></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">SR95531 (gabazine)</td><td valign="top">Abcam</td><td valign="top">Ab120042</td><td valign="top"/></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">Tetrodotoxin citrate</td><td valign="top">Abcam</td><td valign="top">Ab120055</td><td valign="top"/></tr><tr><td valign="top">Other</td><td valign="top">DAPI stain</td><td valign="top">Invitrogen (ThermoFIsher Scientific)</td><td valign="top">Cat#00-3958-02</td><td valign="top">(1 µg/mL)</td></tr></tbody></table></table-wrap><sec id="s4-1"><title>Ethics</title><p>All animal procedures were carried out in accordance with the NIH and Animal Care and Use Committee (IACUC) guidelines and protocols approved by the Harvard Medical Area Standing Committee on Animals (animal protocol #1493).</p></sec><sec id="s4-2"><title>Animals</title><p>Doc2b heterozygotes were kindly given by the Chapman laboratory and bred to produce Doc2b KOs and WT animals for experiments. Mice were originally produced in a C57/BL6 background (<xref ref-type="bibr" rid="bib6">Groffen et al., 2010</xref>). Animal genotypes were assessed by PCR.</p></sec><sec id="s4-3"><title>Slice preparation</title><p>WT or Doc2b KO mice of both sexes were used for physiology experiments. Animal age varied across experiments (P12 and P40-P50 for PC to DCN mIPSCs, P7-8 for PC to PC mIPSCs, P18-P20 for PC to DCN minimal stimulation and burst stimulation, and P13-15 and P60-P80 for PC to DCN train experiments). Animals older than P20 were anesthetized with ketamine/xylazine/ acepromazine and transcardially perfused with warm choline-ACSF solution containing in mM: 110 Choline Cl, 2.5 KCl, 1.25 NaH<sub>2</sub>PO<sub>4</sub>, 25 NaHCO<sub>3</sub>, 25 glucose, 0.5 CaCl<sub>2</sub>, 7 MgCl<sub>2</sub>, 3.1 Na-Pyruvate, 11.6 Na-Ascorbate, 0.005 NBQX, and 0.0025 (R)-CPP, oxygenated with 95% O2/5% CO2. To prepare sagittal slices of the cerebellum, the hindbrain was first removed, a cut was made down the midline of the cerebellum, and the two halves of the cerebellum were glued down to the slicing chamber. 150–200 µm thick sagittal slices were cut with a Leica 1200S vibratome in warm choline-ACSF. Slices were transferred to a standard ACSF solution containing, in mM: 127 NaCl, 2.5 KCl, 1.25 NaH<sub>2</sub>PO<sub>4</sub>, 25 NaHCO<sub>3</sub>, 25 glucose, 1.5 CaCl<sub>2</sub>, and 1 MgCl<sub>2</sub> maintained at 34–35°C for 10–12 min and then moved to room temperature for 20–30 min before beginning recordings. Procedures involving animals were approved by the Harvard Medical Area Standing Committee on Animals.</p></sec><sec id="s4-4"><title>Electrophysiology</title><p>Whole-cell voltage clamp recordings were performed on spontaneously active, large diameter (20–25 µm) neurons in the lateral and interposed deep cerebellar nuclei. These large DCN neurons have been characterized as glutamatergic projection neurons (<xref ref-type="bibr" rid="bib17">Uusisaari et al., 2007</xref>). Selection criteria used to identify these cells are similar to those used in a previous study (<xref ref-type="bibr" rid="bib15">Turecek et al., 2016</xref>), which confirmed glutamatergic identity of DCN cells in mice expressing TdTomato-labeled vesicular glutamate transporter (VGLUT2) (Slc17a6-IRES-Cre;Ai14). Cells were also selected in the more dorsal areas of the DCN along fiber tracts, as finding reliable PC inputs was easiest in these areas. Borosilicate glass electrodes were filled with a high chloride (E<sub>Cl</sub> = 0 mV) internal containing in mM: 110 CsCl, 10 HEPES, 10 TEA-Cl, 1 MgCl<sub>2</sub>, 4 CaCl<sub>2</sub>, 5 EGTA, 20 Cs-BAPTA, 2 QX314, and 0.2 D600, adjusted to pH 7.3 with CsOH. BAPTA was used in high concentration to prevent long-term plasticity (<xref ref-type="bibr" rid="bib9">Ouardouz and Sastry, 2000</xref>; <xref ref-type="bibr" rid="bib12">Pugh and Raman, 2006</xref>; <xref ref-type="bibr" rid="bib22">Zhang and Linden, 2006</xref>). Low resistance (1–2 MΩ) electrodes were used to minimize series resistance (1–8 MΩ), which was compensated up to 80%. Compensation was only applied for the estimated capacitance of the cell body (5 pF). DCN cells were held at −30 to −40 mV and PCs were held at −60 to −70 mV. Liquid junction potentials were left unsubtracted. All experiments were done at 34–35°C. For DCN and PC recordings, 5 µM NBQX to block AMPARs, 2.5 µM (R)-CPP to block NMDARs, and 1 µM strychnine to block glycine receptors were included in the bath. For parallel fiber to PC recordings, 5 µM SR95531 was added in the bath to isolate mEPSCs. All experiments measuring mIPSCs or mEPSCs included 1 µM TTX in the bath. Flow rate was measured as 5 mL/min. All recordings and analysis were performed blind.</p></sec><sec id="s4-5"><title>Analysis</title><p>Recordings were obtained using Multiclamp 700B (Molecular Devices), sampled at 20 kHz and filtered at 4 kHz, and collected in Igor Pro (Wavemetrics). Data were analyzed using custom-written scripts in Matlab (Mathworks), which are available at <ext-link ext-link-type="uri" xlink:href="https://github.com/waderegehr-lab/Doc2b-eLife">https://github.com/waderegehr-lab/Doc2b-eLife</ext-link> (copy archived at <ext-link ext-link-type="uri" xlink:href="https://github.com/elifesciences-publications/Doc2b-eLife">https://github.com/elifesciences-publications/Doc2b-eLife</ext-link>; <xref ref-type="bibr" rid="bib14">Regehr, 2020</xref>). All data are shown as means ± SEM unless otherwise indicated. For data obtained from each electrophysiology experiment, a Shapiro-Wilk test with significance level of 0.05 was used to test whether data were normally distributed. Most data were found to be normally distributed and subsequently analyzed by a two-tailed unpaired Student’s <italic>t</italic>-test. Some data were asymmetrically distributed with a right skew (<xref ref-type="fig" rid="fig2">Figure 2</xref>; <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>) and were tested by non-parametric Wilcoxon signed-rank. The threshold for statistical significance was set at p&lt;0.05.</p><p>The frequencies of miniature postsynaptic currents and spontaneous events were measured using the second derivative of the original trace to detect each event. Amplitudes were detected using an integration threshold. As DCN neurons have high spontaneous activity both with and without TTX, it was critical to make sure our event detection algorithm was sensitive and reliable. Therefore for each cell, we checked the output of the detection algorithm by plotting individual traces along with each event detected by the algorithm and visually ensured that events were detected for each observed event.</p><p>During trains, IPSC amplitudes were measured from averaged traces as the peak evoked current relative to a baseline measured 2 ms before onset of the stimulus. In young animals, IPSCs usually do not fully decay during high-frequency trains before subsequent stimuli. To accurately measure IPSC amplitude, baselines were then measured by extrapolating a single exponential fit from the previous IPSC. The steady-state IPSC was measured as the average size of the IPSCs between the 50th to 80th stimuli.</p></sec><sec id="s4-6"><title>Fluorescence in situ hybridization (FISH)</title><p>Eight- to 9-week-old WT and Doc2b KO animals were anesthetized with isoflurane before the brain was quickly removed, frozen in dry ice, and embedded in optimal cutting temperature (OCT) compound (Tissue-Tek). 20-µm-thick sagittal slices of the whole brain were cut on a cryostat (Microm HM500-CM) and mounted on glass slides (Superfrost Plus, VWR, 48311–703). Fluorescent in situ hybridization was carried out according to the ACD-Bio RNAscope Multiplex Assay manual (document Number 320514). Samples were subsequently fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 15 min at 4°C and then dehydrated with 50% (x1), 70%, and 100% (x2) ethanol washes for 5 min each. Slides were air-dried and a barrier around the tissue was drawn using an Immedge hydrophobic barrier pen (Vector Laboratories). Brain slices were then incubated in RNAscope protease III reagent (ACD-Bio 322337) at room temperature for 30 min and rinsed twice in PBS for 5 min. Fluorophore-conjugated Probe-Mm-Doc2b (Cat #484798) and 2.5 VS Probe -Mm-Doc2A probe (Cat# 531549-C2) were incubated with the slide-mounted tissue sections in a HybEz II oven (ACD-Bio) for two hours at 40°C, then washed in RNAscope wash buffer reagent (ACD-Bio 310091) twice. To amplify fluorescence signals, the tissue was incubated in AMP 1-Fl for 30 min at 40°C (HybEZ oven), washed twice with wash buffer for 3 min at room temperature. Subsequently, the tissue was incubated in AMP 2-FL for 15 min at 40°C, washed twice, and incubated in AMP 4-LA-A for 15 min at 40°C, then washed twice again. Sections were then stained with DAPI and mounted using ProLong antifade reagent (Thermo Fisher Scientific P36930). Positive control probes to ensure in situ quality included housekeeping genes (C1-Mm-Polr2a, C2-Mm PPIB, and C3-Mm-UBC). Fluorescence from negative control probes targeting bacterial RNA (C1, C2, C3-dapB) was not detected. Slides were imaged at 20x (air) by a whole slide scanning microscope (Olympus VS120). All image acquisition and processing were done blind.</p></sec><sec id="s4-7"><title>Immunohistochemistry and imaging</title><p>Mice were anesthetized with isoflurane and perfused first with cold phosphate buffered saline (PBS, pH = 7.4, Sigma Cat# P-3813), then by 4% paraformaldehyde in PBS. The brain was removed and post-fixed overnight at 4°C in the same solution. For slicing, the brain was embedded in 4% agar (Sea Plaque, Lonza, Cat# 50101) and sliced in PBS using a vibratome (VT1000S, Leica) at a thickness of 50 µm. Slices were then incubated in blocking solution containing 4% normal goat serum (NGS) in PBS for 1–2 hr. After blocking, the slices were incubated in the same solution with the addition of primary antibody overnight at 4°C (rabbit polyclonal anti-Doc2b (1:200; Synaptic Systems, Cat# 174 103) and mouse monoclonal anti-Parvalbumin (1:500, Sigma-Aldrich, Product # P3088-.2ML)). Slices were then washed three times for 10 min. Next, slices were incubated in 4% NGS and 0.1% triton X-100 in PBS with the addition of secondary antibodies for 2 hr at room temperature (goat anti-rabbit IgG H and L Alexa Fluor647 (1:1000, ab150083) and goat anti-mouse IgG H and L Alexa Fluor568 (1:1000, ab175473)). Slices were then washed three times for 5 min in PBS, mounted on glass slides and covered with mounting medium (Invitrogen Fluoromount-G Mounting Medium, Cat #: 00-4958-02) and a glass coverslip. Mounting medium was allowed to cure for at least 24 hr before imaging.</p><p>Whole-brain images were taken on an Olympus VS120 slide scanner (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>), and confocal stacks were acquired on an Olympus FV1000 confocal microscope (<xref ref-type="fig" rid="fig1">Figure 1C–D</xref>). Images were acquired and processed using standard routines in Fiji (ImageJ) using identical settings across genotypes. All image acquisition and processing were done blind.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Pascal Kaeser for valuable help and insightful discussion. We thank Edwin Chapman (University of Wisconsin – Madison) for providing Doc2b KO mice. We thank Mahmoud el-Rifai and the Harvard Medical School Neuroimaging Core for help with RNAscope and Stephanie Rudolph and Christopher Chen for help with immunostaining. This work was supported by National Institutes of Health Grant R35NS097284 to WGR and a National Science Foundation Graduate Research Fellowship under grant DGE1745303 to MMK.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Investigation, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Resources, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>Animal experimentation: All experiments were conducted in accordance with federal guidelines and protocols (#1493) approved by the Harvard Medical Area Standing Committee on Animals.</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="pdf" mimetype="application" xlink:href="elife-55165-transrepform-v1.pdf"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>All data used in this study are originally generated. Source data are included in the source data files indicated for each Figure or Figure supplement. Values of individual measurements within an experiment are included in captions for relevant graphs.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Altman</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="1972">1972</year><article-title>Postnatal development of the cerebellar cortex in the rat I</article-title><source>The Journal of Comparative Neurology</source><volume>145</volume><fpage>353</fpage><lpage>398</lpage><pub-id pub-id-type="doi">10.1002/cne.901450402</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bernard</surname> <given-names>C</given-names></name><name><surname>Axelrad</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Effects of recurrent collateral inhibition on purkinje cell activity in the immature rat cerebellar cortex--an in vivo electrophysiological study</article-title><source>Brain Research</source><volume>626</volume><fpage>234</fpage><lpage>258</lpage><pub-id pub-id-type="doi">10.1016/0006-8993(93)90584-A</pub-id><pub-id pub-id-type="pmid">8281434</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Courtney</surname> <given-names>NA</given-names></name><name><surname>Briguglio</surname> <given-names>JS</given-names></name><name><surname>Bradberry</surname> <given-names>MM</given-names></name><name><surname>Greer</surname> <given-names>C</given-names></name><name><surname>Chapman</surname> <given-names>ER</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Excitatory and inhibitory neurons utilize different Ca<sup>2+</sup> Sensors and Sources to Regulate Spontaneous Release</article-title><source>Neuron</source><volume>98</volume><fpage>977</fpage><lpage>991</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2018.04.022</pub-id><pub-id pub-id-type="pmid">29754754</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernández-Chacón</surname> <given-names>R</given-names></name><name><surname>Königstorfer</surname> <given-names>A</given-names></name><name><surname>Gerber</surname> <given-names>SH</given-names></name><name><surname>García</surname> <given-names>J</given-names></name><name><surname>Matos</surname> <given-names>MF</given-names></name><name><surname>Stevens</surname> <given-names>CF</given-names></name><name><surname>Brose</surname> <given-names>N</given-names></name><name><surname>Rizo</surname> <given-names>J</given-names></name><name><surname>Rosenmund</surname> <given-names>C</given-names></name><name><surname>Südhof</surname> <given-names>TC</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Synaptotagmin I functions as a calcium regulator of release probability</article-title><source>Nature</source><volume>410</volume><fpage>41</fpage><lpage>49</lpage><pub-id pub-id-type="doi">10.1038/35065004</pub-id><pub-id pub-id-type="pmid">11242035</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Friedrich</surname> <given-names>R</given-names></name><name><surname>Groffen</surname> <given-names>AJ</given-names></name><name><surname>Connell</surname> <given-names>E</given-names></name><name><surname>van Weering</surname> <given-names>JR</given-names></name><name><surname>Gutman</surname> <given-names>O</given-names></name><name><surname>Henis</surname> <given-names>YI</given-names></name><name><surname>Davletov</surname> <given-names>B</given-names></name><name><surname>Ashery</surname> <given-names>U</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>DOC2B acts as a calcium switch and enhances vesicle fusion</article-title><source>Journal of Neuroscience</source><volume>28</volume><fpage>6794</fpage><lpage>6806</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.0538-08.2008</pub-id><pub-id pub-id-type="pmid">18596155</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Groffen</surname> <given-names>AJ</given-names></name><name><surname>Martens</surname> <given-names>S</given-names></name><name><surname>Díez Arazola</surname> <given-names>R</given-names></name><name><surname>Cornelisse</surname> <given-names>LN</given-names></name><name><surname>Lozovaya</surname> <given-names>N</given-names></name><name><surname>de Jong</surname> <given-names>AP</given-names></name><name><surname>Goriounova</surname> <given-names>NA</given-names></name><name><surname>Habets</surname> <given-names>RL</given-names></name><name><surname>Takai</surname> <given-names>Y</given-names></name><name><surname>Borst</surname> <given-names>JG</given-names></name><name><surname>Brose</surname> <given-names>N</given-names></name><name><surname>McMahon</surname> <given-names>HT</given-names></name><name><surname>Verhage</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Doc2b is a high-affinity Ca2+ sensor for spontaneous neurotransmitter release</article-title><source>Science</source><volume>327</volume><fpage>1614</fpage><lpage>1618</lpage><pub-id pub-id-type="doi">10.1126/science.1183765</pub-id><pub-id pub-id-type="pmid">20150444</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Houy</surname> <given-names>S</given-names></name><name><surname>Groffen</surname> <given-names>AJ</given-names></name><name><surname>Ziomkiewicz</surname> <given-names>I</given-names></name><name><surname>Verhage</surname> <given-names>M</given-names></name><name><surname>Pinheiro</surname> <given-names>PS</given-names></name><name><surname>Sørensen</surname> <given-names>JB</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Doc2B acts as a calcium sensor for vesicle priming requiring synaptotagmin-1, Munc13-2 and SNAREs</article-title><source>eLife</source><volume>6</volume><elocation-id>e27000</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.27000</pub-id><pub-id pub-id-type="pmid">29274147</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jackman</surname> <given-names>SL</given-names></name><name><surname>Turecek</surname> <given-names>J</given-names></name><name><surname>Belinsky</surname> <given-names>JE</given-names></name><name><surname>Regehr</surname> <given-names>WG</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>The calcium sensor synaptotagmin 7 is required for synaptic facilitation</article-title><source>Nature</source><volume>529</volume><fpage>88</fpage><lpage>91</lpage><pub-id pub-id-type="doi">10.1038/nature16507</pub-id><pub-id pub-id-type="pmid">26738595</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ouardouz</surname> <given-names>M</given-names></name><name><surname>Sastry</surname> <given-names>BR</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Mechanisms underlying LTP of inhibitory synaptic transmission in the deep cerebellar nuclei</article-title><source>Journal of Neurophysiology</source><volume>84</volume><fpage>1414</fpage><lpage>1421</lpage><pub-id pub-id-type="doi">10.1152/jn.2000.84.3.1414</pub-id><pub-id pub-id-type="pmid">10980014</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pang</surname> <given-names>ZP</given-names></name><name><surname>Bacaj</surname> <given-names>T</given-names></name><name><surname>Yang</surname> <given-names>X</given-names></name><name><surname>Zhou</surname> <given-names>P</given-names></name><name><surname>Xu</surname> <given-names>W</given-names></name><name><surname>Südhof</surname> <given-names>TC</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Doc2 supports spontaneous synaptic transmission by a ca(2+)-independent mechanism</article-title><source>Neuron</source><volume>70</volume><fpage>244</fpage><lpage>251</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2011.03.011</pub-id><pub-id pub-id-type="pmid">21521611</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pinheiro</surname> <given-names>PS</given-names></name><name><surname>de Wit</surname> <given-names>H</given-names></name><name><surname>Walter</surname> <given-names>AM</given-names></name><name><surname>Groffen</surname> <given-names>AJ</given-names></name><name><surname>Verhage</surname> <given-names>M</given-names></name><name><surname>Sørensen</surname> <given-names>JB</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Doc2b synchronizes secretion from chromaffin cells by stimulating fast and inhibiting sustained release</article-title><source>Journal of Neuroscience</source><volume>33</volume><fpage>16459</fpage><lpage>16470</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.2656-13.2013</pub-id><pub-id pub-id-type="pmid">24133251</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pugh</surname> <given-names>JR</given-names></name><name><surname>Raman</surname> <given-names>IM</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Potentiation of mossy fiber EPSCs in the cerebellar nuclei by NMDA receptor activation followed by postinhibitory rebound current</article-title><source>Neuron</source><volume>51</volume><fpage>113</fpage><lpage>123</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2006.05.021</pub-id><pub-id pub-id-type="pmid">16815336</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ramirez</surname> <given-names>DMO</given-names></name><name><surname>Crawford</surname> <given-names>DC</given-names></name><name><surname>Chanaday</surname> <given-names>NL</given-names></name><name><surname>Trauterman</surname> <given-names>B</given-names></name><name><surname>Monteggia</surname> <given-names>LM</given-names></name><name><surname>Kavalali</surname> <given-names>ET</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Loss of Doc2-Dependent spontaneous neurotransmission augments glutamatergic synaptic strength</article-title><source>The Journal of Neuroscience</source><volume>37</volume><fpage>6224</fpage><lpage>6230</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.0418-17.2017</pub-id><pub-id pub-id-type="pmid">28539418</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="software"><person-group person-group-type="author"><name><surname>Regehr</surname> <given-names>WG</given-names></name></person-group><year iso-8601-date="2020">2020</year><data-title>Doc2b-eLife</data-title><version designator="575f28a">575f28a</version><publisher-name>Github</publisher-name><ext-link ext-link-type="uri" xlink:href="https://github.com/waderegehr-lab/Doc2b-eLife">https://github.com/waderegehr-lab/Doc2b-eLife</ext-link></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Turecek</surname> <given-names>J</given-names></name><name><surname>Jackman</surname> <given-names>SL</given-names></name><name><surname>Regehr</surname> <given-names>WG</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Synaptic specializations support Frequency-Independent purkinje cell output from the cerebellar cortex</article-title><source>Cell Reports</source><volume>17</volume><fpage>3256</fpage><lpage>3268</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2016.11.081</pub-id><pub-id pub-id-type="pmid">28009294</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Turecek</surname> <given-names>J</given-names></name><name><surname>Jackman</surname> <given-names>SL</given-names></name><name><surname>Regehr</surname> <given-names>WG</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Synaptotagmin 7 confers frequency invariance onto specialized depressing synapses</article-title><source>Nature</source><volume>551</volume><fpage>503</fpage><lpage>506</lpage><pub-id pub-id-type="doi">10.1038/nature24474</pub-id><pub-id pub-id-type="pmid">29088700</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Uusisaari</surname> <given-names>M</given-names></name><name><surname>Obata</surname> <given-names>K</given-names></name><name><surname>Knöpfel</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Morphological and electrophysiological properties of GABAergic and non-GABAergic cells in the deep cerebellar nuclei</article-title><source>Journal of Neurophysiology</source><volume>97</volume><fpage>901</fpage><lpage>911</lpage><pub-id pub-id-type="doi">10.1152/jn.00974.2006</pub-id><pub-id pub-id-type="pmid">17093116</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Verhage</surname> <given-names>M</given-names></name><name><surname>de Vries</surname> <given-names>KJ</given-names></name><name><surname>Røshol</surname> <given-names>H</given-names></name><name><surname>Burbach</surname> <given-names>JP</given-names></name><name><surname>Gispen</surname> <given-names>WH</given-names></name><name><surname>Südhof</surname> <given-names>TC</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>DOC2 proteins in rat brain: complementary distribution and proposed function as vesicular adapter proteins in early stages of secretion</article-title><source>Neuron</source><volume>18</volume><fpage>453</fpage><lpage>461</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(00)81245-3</pub-id><pub-id pub-id-type="pmid">9115738</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wen</surname> <given-names>H</given-names></name><name><surname>Linhoff</surname> <given-names>MW</given-names></name><name><surname>McGinley</surname> <given-names>MJ</given-names></name><name><surname>Li</surname> <given-names>G-L</given-names></name><name><surname>Corson</surname> <given-names>GM</given-names></name><name><surname>Mandel</surname> <given-names>G</given-names></name><name><surname>Brehm</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Distinct roles for two synaptotagmin isoforms in synchronous and asynchronous transmitter release at zebrafish neuromuscular junction</article-title><source>PNAS</source><volume>107</volume><fpage>13906</fpage><lpage>13911</lpage><pub-id pub-id-type="doi">10.1073/pnas.1008598107</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xue</surname> <given-names>R</given-names></name><name><surname>Ruhl</surname> <given-names>DA</given-names></name><name><surname>Briguglio</surname> <given-names>JS</given-names></name><name><surname>Figueroa</surname> <given-names>AG</given-names></name><name><surname>Pearce</surname> <given-names>RA</given-names></name><name><surname>Chapman</surname> <given-names>ER</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Doc2-mediated superpriming supports synaptic augmentation</article-title><source>PNAS</source><volume>115</volume><fpage>E5605</fpage><lpage>E5613</lpage><pub-id pub-id-type="doi">10.1073/pnas.1802104115</pub-id><pub-id pub-id-type="pmid">29844163</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yao</surname> <given-names>J</given-names></name><name><surname>Gaffaney</surname> <given-names>JD</given-names></name><name><surname>Kwon</surname> <given-names>SE</given-names></name><name><surname>Chapman</surname> <given-names>ER</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter release</article-title><source>Cell</source><volume>147</volume><fpage>666</fpage><lpage>677</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2011.09.046</pub-id><pub-id pub-id-type="pmid">22036572</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>W</given-names></name><name><surname>Linden</surname> <given-names>DJ</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Long-term depression at the mossy fiber-deep cerebellar nucleus synapse</article-title><source>Journal of Neuroscience</source><volume>26</volume><fpage>6935</fpage><lpage>6944</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.0784-06.2006</pub-id><pub-id pub-id-type="pmid">16807323</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname> <given-names>H</given-names></name><name><surname>Lin</surname> <given-names>Z</given-names></name><name><surname>Voges</surname> <given-names>K</given-names></name><name><surname>Ju</surname> <given-names>C</given-names></name><name><surname>Gao</surname> <given-names>Z</given-names></name><name><surname>Bosman</surname> <given-names>LWJ</given-names></name><name><surname>Ruigrok</surname> <given-names>TJ</given-names></name><name><surname>Hoebeek</surname> <given-names>FE</given-names></name><name><surname>De Zeeuw</surname> <given-names>CI</given-names></name><name><surname>Schonewille</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Cerebellar modules operate at different frequencies</article-title><source>eLife</source><volume>2014</volume><elocation-id>e02536</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.02536</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.55165.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Brose</surname><given-names>Nils</given-names></name><role>Reviewing Editor</role><aff><institution>Max Planck Institute of Experimental Medicine</institution><country>Germany</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Fernández Chacon</surname><given-names>Rafael</given-names> </name><role>Reviewer</role><aff><institution>IBiS</institution><country>Spain</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>All reviewers, including me, agree that your study represents an important contribution to our understanding of presynapse function and that it nicely highlights the requirement to study molecular and cellular mechanisms of presynapse function in multiple preparations in order to reach meaningful conclusions with lasting relevance.</p><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;Loss of Doc2b does not influence transmission at a mature synapse under physiological conditions&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Richard Aldrich as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Rafael Fernández Chacon (Reviewer #1).</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>Summary</p><p>All three reviewers note that DOC2s are fascinating presynaptic calcium-binding proteins, and acknowledge that, despite substantial efforts, the exact role of DOC2s in synapses within intact circuits is essentially unknown. Correspondingly, they all appreciate your effort to address this important issue by testing which of the previously proposed roles of DOC2s (i.e. regulating spontaneous vesicle fusion, asynchronous vesicle fusion, augmentation, priming) can be validated in a defined synapse in brain slices.</p><p>The study, which is based on the PC-to-DCN synapse as a model, is beautifully conducted and comprehensive. The striking conclusion is that none of the relevant characteristics of mature PC-to-DCN synapses are affected by genetic deletion of DOC2s – specifically of DOC2b, which is very likely (based on available evidence) the only DOC2 expressed in these synapses. This is an important finding of substantial importance to the field of synapse biology.</p><p>Major comments</p><p>The following two issues should be addressed before the paper can be accepted for publication in <italic>eLife</italic>:</p><p>1) You assume that DOC2b mRNA levels are a faithful proxy of DOC2b protein expression, but this cannot be taken for granted (e.g. due to scenarios such as high DOC2b degradation rates or poor synaptic trafficking). It is important that you show, e.g. by using immunostaining, that DOC2b is indeed present at PC-to-DCN synapses, how its levels at PC-to-DCN synapses compare to those at other synapse types, and that the corresponding staining is gone in the knock-out. If DOC2b levels were intrinsically very low at PC-to-DCN synapses, the present study might not be all that informative.</p><p>2) It is striking that PC-to-DCN synapses are not affected by DOC2b knock-out, and the corresponding “negative” dataset is important. However, in some parts of the present manuscript, the corresponding conclusions are phrased too categorically. For instance, at the end of the Abstract, you state &quot;that conclusions based on cultured cells do not generalize to mature synapses under physiological conditions&quot;. Similar sentences appear at the end of the Results section and again at the end of the Discussion section. This does not match with the fact – which you concede in other parts of the manuscript – that the present data only concern one synapse type. Given that many studies, in cultured cells and in more intact preparations alike, showed that defined presynaptic proteins affect different synapse types differently, a more scholarly and careful phrasing and a corresponding extension of the relevant parts of the Discussion are necessary. This could be done at the end of the Discussion, where some caveats, such as alternative sensor proteins, are already mentioned. Also, the synapse type studied should be mentioned in the title and Abstract. In essence, key aspects of DOC2 function may be relevant during development and/or play a major role in synapse types that were not studied here.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.55165.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Major comments</p><p>The following two issues should be addressed before the paper can be accepted for publication in eLife:</p><p>1) You assume that DOC2b mRNA levels are a faithful proxy of DOC2b protein expression, but this cannot be taken for granted (e.g. due to scenarios such as high DOC2b degradation rates or poor synaptic trafficking). It is important that you show, e.g. by using immunostaining, that DOC2b is indeed present at PC-to-DCN synapses, how its levels at PC-to-DCN synapses compare to those at other synapse types, and that the corresponding staining is gone in the knock-out. If DOC2b levels were intrinsically very low at PC-to-DCN synapses, the present study might not be all that informative.</p></disp-quote><p>This was an excellent suggestion. We have done immunostaining to show that Doc2b is present at PC to DCN synapses and that Doc2b is not detected in the Doc2b KO (Figure 1 C-D). We include additional immunostaining, including a characterization of the hippocampus in Figure 1—figure supplement 2.</p><disp-quote content-type="editor-comment"><p>2) It is striking that PC-to-DCN synapses are not affected by DOC2b knock-out, and the corresponding “negative” dataset is important. However, in some parts of the present manuscript, the corresponding conclusions are phrased too categorically. For instance, at the end of the Abstract, you state &quot;that conclusions based on cultured cells do not generalize to mature synapses under physiological conditions&quot;. Similar sentences appear at the end of the Results section and again at the end of the Discussion section. This does not match with the fact – which you concede in other parts of the manuscript – that the present data only concern one synapse type. Given that many studies, in cultured cells and in more intact preparations alike, showed that defined presynaptic proteins affect different synapse types differently, a more scholarly and careful phrasing and a corresponding extension of the relevant parts of the Discussion are necessary. This could be done at the end of the Discussion, where some caveats, such as alternative sensor proteins, are already mentioned. Also, the synapse type studied should be mentioned in the title and Abstract. In essence, key aspects of DOC2 function may be relevant during development and/or play a major role in synapse types that were not studied here.</p></disp-quote><p>We adjusted the title, Abstract, the end of the Introduction and the end of the Discussion.</p></body></sub-article></article>