| Predicted mutations | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 140,966 | IS150 (–) +4 bp | 100% | coding (198‑201/348 nt) | yacC ← | hypothetical protein | |||||||||||
| 199,024 | IS150 (+) +3 bp | 100% | intergenic (+19/‑165) | ispC → / → uppS | 1‑deoxy‑D‑xylulose 5‑phosphate reductoisomerase/undecaprenyl pyrophosphate synthase | |||||||||||
| 237,985 | IS150 (+) +3 bp | 100% | coding (339‑341/1359 nt) | mltD ← | predicted membrane‑bound lytic murein transglycosylase D | |||||||||||
| 243,649 | (G)8→7 | 100% | coding (193/372 nt) | ECB_00212 → | hypothetical protein | |||||||||||
| 247,779 | IS150 (–) +3 bp | 100% | coding (1540‑1542/2445 nt) | fadE ← | acyl‑CoA dehydrogenase | |||||||||||
| 248,532 | IS150 (–) +4 bp | 100% | coding (786‑789/2445 nt) | fadE ← | acyl‑CoA dehydrogenase | |||||||||||
| 249,356 | C→A | 100% | intergenic (‑36/‑204) | fadE ← / → lpcA | acyl‑CoA dehydrogenase/phosphoheptose isomerase | |||||||||||
| 323,378 | G→A | 100% | D201N (GAT→AAT) | prpB → | 2‑methylisocitrate lyase | |||||||||||
| 435,255 | IS150 (+) +3 bp | 100% | intergenic (+30/‑160) | hupB → / → ppiD | HU, DNA‑binding transcriptional regulator, beta subunit/peptidyl‑prolyl cis‑trans isomerase (rotamase D) | |||||||||||
| 464,051 | IS150 (+) +3 bp | 100% | 100% | coding (274‑276/528 nt) | priC ← | primosomal replication protein N'' | ||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 468,912 | IS150 (+) +3 bp | 100% | coding (279‑281/1875 nt) | htpG → | heat shock protein 90 | |||||||||||
| 547,546 | Δ103 bp | 100% | IS1‑mediated | ylcG → / → insA‑10 | predicted protein/IS1 protein InsA | |||||||||||
| 549,926 | Δ39,972 bp | 100% | 100% | ? | between IS1 | ECB_00510–insA‑7 | 35 genes ECB_00510, nohB, ECB_00512, ECB_00513, ECB_00514, ECB_00515, ECB_00516, ECB_00517, appY, ompT, envY, ybcH, nfrA, ECB_00524, yhhI, ECB_00526, ECB_00527, ECB_00528, ECB_00529, ECB_00530, cusS, cusR, cusC, ylcC, cusB, cusA, pheP, ybdG, nfnB, ybdF, ybdJ, ybdK, insJ‑1, insB‑7, insA‑7 |
|||||||||
| 557,465 | +TGA :: IS3 (+) +3 bp | Δ | 100% | Δ | ? | coding (542‑544/705 nt) | ECB_00515 → | conserved hypothetical protein | ||||||||
| 572,890 | Δ16,240 bp | Δ | Δ | 100% | ? | ? | IS1‑mediated | [ECB_00530]–insJ‑1 | [ECB_00530], cusS, cusR, cusC, ylcC, cusB, cusA, pheP, ybdG, nfnB, ybdF, ybdJ, ybdK, insJ‑1 | |||||||
| 574,068 | IS150 (–) +3 bp | Δ | 100% | Δ | Δ | ? | 100% | ? | ? | coding (1179‑1181/1449 nt) | cusS ← | sensory histidine kinase in two‑component regulatory system with CusR, senses copper ions | ||||
| 579,159 | IS150 (–) +3 bp | Δ | ? | Δ | 100% | Δ | ? | ? | coding (1203‑1205/1224 nt) | cusB → | copper/silver efflux system, membrane fusion protein | |||||
| 590,047 | Δ2,134 bp | Δ | ? | ? | Δ | 100% | ? | ? | ? | ? | IS150‑mediated | hokE–[entD] | hokE, insL‑3, [entD] | |||
| 590,047 | Δ2,297 bp | 100% | ? | ? | Δ | ? | ? | ? | ? | IS150‑mediated | hokE–[entD] | hokE, insL‑3, [entD] | ||||
| 590,047 | Δ8,054 bp | 100% | ? | ? | IS150‑mediated | hokE–[entF] | hokE, insL‑3, entD, fepA, fes, ybdZ, [entF] | |||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 599,136 | ISRSO11 (+) +3 bp | 100% | ? | ? | coding (2697‑2699/3882 nt) | entF → | enterobactin synthase multienzyme complex component, ATP‑dependent | |||||||||
| 642,809 | Δ131 bp | 100% | IS150‑mediated | lipA ← / → insJ‑2 | lipoyl synthase/IS150 hypothetical protein | |||||||||||
| 642,935 | Δ1 bp | 100% | Δ | intergenic (‑561/‑52) | lipA ← / → insJ‑2 | lipoyl synthase/IS150 hypothetical protein | ||||||||||
| 660,274 | Δ5,435 bp | 100% | IS150‑mediated | ybeR–rihA | ybeR, ybeV, hscC, rihA | |||||||||||
| 681,779 | IS150 (+) +3 bp | 100% | coding (513‑515/1665 nt) | asnB ← | asparagine synthetase B | |||||||||||
| 719,392 | 2 bp→CA | 100% | intergenic (+986/‑613) | ECB_00664 → / → ybfD | hypothetical protein/hypothetical protein | |||||||||||
| 719,413 | G→T | 100% | intergenic (+1007/‑593) | ECB_00664 → / → ybfD | hypothetical protein/hypothetical protein | |||||||||||
| 734,968 | IS1 (–) +9 bp | 100% | intergenic (‑361/+21) | ybgD ← / ← gltA | predicted fimbrial‑like adhesin protein/citrate synthase | |||||||||||
| 735,104 | T→G | 100% | I393L (ATC→CTC) | gltA ← | citrate synthase | |||||||||||
| 735,572 | A→C | 100% | S237A (TCC→GCC) | gltA ← | citrate synthase | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 735,580 | G→T | 100% | A234D (GCC→GAC) | gltA ← | citrate synthase | |||||||||||
| 735,765 | C→A | 100% | 100% | M172I (ATG→ATT) | gltA ← | citrate synthase | ||||||||||
| 735,797 | C→T | 100% | 100% | A162T (GCG→ACG) | gltA ← | citrate synthase | ||||||||||
| 735,941 | T→A | 100% | 100% | I114F (ATC→TTC) | gltA ← | citrate synthase | ||||||||||
| 736,121 | C→T | 100% | E54K (GAA→AAA) | gltA ← | citrate synthase | |||||||||||
| 736,126 | G→T | 100% | S52Y (TCC→TAC) | gltA ← | citrate synthase | |||||||||||
| 736,323 | T→G | 100% | intergenic (‑43/‑666) | gltA ← / → sdhC | citrate synthase/succinate dehydrogenase cytochrome b556 large membrane subunit | |||||||||||
| 736,619 | T→C | 100% | intergenic (‑339/‑370) | gltA ← / → sdhC | citrate synthase/succinate dehydrogenase cytochrome b556 large membrane subunit | |||||||||||
| 831,886 | C→T | 100% | A73T (GCT→ACT) | ybiI ← | hypothetical protein | |||||||||||
| 891,825 | +TGA :: IS3 (+) +3 bp | 100% | coding (913‑915/924 nt) | ECB_00830 → | hypothetical protein | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 923,149 | IS150 (–) +3 bp | 100% | coding (509‑511/831 nt) | ybjR → | predicted amidase and lipoprotein | |||||||||||
| 923,167 | IS150 (+) +3 bp | 100% | coding (527‑529/831 nt) | ybjR → | predicted amidase and lipoprotein | |||||||||||
| 939,393 | Δ3,661 bp | 100% | [macB]–[clpA] | [macB], cspD, clpS, [clpA] | ||||||||||||
| 940,328 | C→T | 100% | Δ | intergenic (‑11/‑312) | cspD ← / → clpS | cold shock protein homolog/ATP‑dependent Clp protease adaptor protein ClpS | ||||||||||
| 969,347 | IS150 (–) +3 bp | 100% | intergenic (‑153/+37) | pflA ← / ← pflB | pyruvate formate lyase activating enzyme 1/pyruvate formate lyase I | |||||||||||
| 1,004,636 | G→A | 100% | R154C (CGT→TGT) | ompF ← | outer membrane porin 1a (Ia;b;F) | |||||||||||
| 1,004,674 | C→A | 100% | G141V (GGC→GTC) | ompF ← | outer membrane porin 1a (Ia;b;F) | |||||||||||
| 1,004,905 | C→T | 100% | R64H (CGT→CAT) | ompF ← | outer membrane porin 1a (Ia;b;F) | |||||||||||
| 1,039,280 | IS150 (–) +3 bp | 100% | coding (31‑33/630 nt) | yccR → | hypothetical protein | |||||||||||
| 1,064,767 | IS150 (–) +3 bp | 100% | coding (1289‑1291/2097 nt) | ymcA ← | hypothetical protein | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 1,097,283 | IS150 (–) +3 bp | 100% | coding (674‑676/1509 nt) | putP → | proline:sodium symporter | |||||||||||
| 1,134,456 | IS150 (–) +3 bp | 100% | coding (179‑181/567 nt) | yceJ ← | predicted cytochrome b561 | |||||||||||
| 1,137,052 | IS150 (+) +3 bp | 100% | coding (27‑29/246 nt) | dinI ← | DNA damage‑inducible protein I | |||||||||||
| 1,154,915 | IS150 (+) +3 bp | 100% | 100% | coding (948‑950/1644 nt) | flgK → | flagellar hook‑associated protein K | ||||||||||
| 1,181,558 | C→T | 100% | 100% | 100% | intergenic (+283/‑125) | ycfP → / → ndh | hypothetical protein/respiratory NADH dehydrogenase 2/cupric reductase | |||||||||
| 1,205,342 | T→G | 100% | T276P (ACC→CCC) | phoQ ← | sensory histidine kinase in two‑compoent regulatory system with PhoP | |||||||||||
| 1,205,348 | C→A | 100% | D274Y (GAC→TAC) | phoQ ← | sensory histidine kinase in two‑compoent regulatory system with PhoP | |||||||||||
| 1,216,074 | (T)7→8 | 100% | coding (584/1212 nt) | ycgF ← | predicted FAD‑binding phosphodiesterase | |||||||||||
| 1,236,016 | IS150 (–) +3 bp | 100% | intergenic (‑128/‑91) | nhaB ← / → fadR | sodium/proton antiporter/fatty acid metabolism regulator | |||||||||||
| 1,236,016 | IS150 (+) +3 bp | 100% | intergenic (‑128/‑91) | nhaB ← / → fadR | sodium/proton antiporter/fatty acid metabolism regulator | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 1,236,018 | IS150 (–) +2 bp :: +TC | 100% | intergenic (‑130/‑90) | nhaB ← / → fadR | sodium/proton antiporter/fatty acid metabolism regulator | |||||||||||
| 1,257,394 | A→G | 100% | intergenic (‑271/+498) | ycgV ← / ← ychF | predicted adhesin/translation‑associated GTPase | |||||||||||
| 1,271,135 | Δ15 bp | 100% | IS150‑mediated | ldrB ← / ← insK‑2 | toxic polypeptide, small/IS150 putative transposase | |||||||||||
| 1,294,964 | IS3 (–) +4 bp :: +TC | 100% | intergenic (‑315/‑286) | hns ← / → tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase | |||||||||||
| 1,306,724 | Δ1 bp | 100% | coding (1449/1461 nt) | cls ← | cardiolipin synthetase | |||||||||||
| 1,306,894 | IS150 (–) +3 bp | 100% | coding (1277‑1279/1461 nt) | cls ← | cardiolipin synthetase | |||||||||||
| 1,307,420 | IS150 (–) +3 bp | 100% | coding (751‑753/1461 nt) | cls ← | cardiolipin synthetase | |||||||||||
| 1,334,535 | A→C | 100% | M126L (ATG→CTG) | cysB → | DNA‑binding transcriptional dual regulator, O‑acetyl‑L‑serine‑binding | |||||||||||
| 1,362,312 | Δ1 bp | 100% | coding (101/558 nt) | ycjC → | DNA‑binding transcriptional repressor | |||||||||||
| 1,423,903 | Δ23,962 bp | 100% | between IS3 | ECB_01341–[ydbC] | 23 genes ECB_01341, ECB_01342, ECB_01343, ECB_01344, pinR, ynaE, ynaF, ompN, insB‑10, insA‑10, ydbK, ydbJ, hslJ, ldhA, ydbH, ynbE, ydbL, feaR, feaB, tynA, insE‑2, insF‑2, [ydbC] |
|||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 1,457,389 | Δ11,725 bp | 100% | Δ | 100% | 100% | 100% | 100% | Δ | 100% | 100% | between IS150 | hrpA–insJ‑2 | hrpA, ydcF, aldA, gapC, insA‑12, insB‑12, cybB, ydcA, hokB, mokB, insK‑2, insJ‑2 | |||
| 1,457,389 | Δ13,493 bp | Δ | 100% | IS150‑mediated | hrpA–[trg] | hrpA, ydcF, aldA, gapC, insA‑12, insB‑12, cybB, ydcA, hokB, mokB, insK‑2, insJ‑2, [trg] | ||||||||||
| 1,457,389 | Δ14,145 bp | 100% | IS150‑mediated | hrpA–[ydcI] | hrpA, ydcF, aldA, gapC, insA‑12, insB‑12, cybB, ydcA, hokB, mokB, insK‑2, insJ‑2, trg, [ydcI] | |||||||||||
| 1,466,345 | Δ7,319 bp | 100% | IS1‑mediated | cybB–ydcJ | cybB, ydcA, hokB, mokB, insK‑2, insJ‑2, trg, ydcI, ydcJ | |||||||||||
| 1,528,089 | IS150 (+) +4 bp | 100% | intergenic (‑33/‑253) | yddG ← / → fdnG | predicted methyl viologen efflux pump/formate dehydrogenase‑N, alpha subunit, nitrate‑inducible | |||||||||||
| 1,536,594 | +GA :: IS3 (+) +4 bp | 100% | coding (99‑102/138 nt) | rpsV ← | 30S ribosomal subunit protein S22 | |||||||||||
| 1,536,758 | +TGA :: IS3 (+) +3 bp | 100% | intergenic (‑63/+37) | rpsV ← / ← bdm | 30S ribosomal subunit protein S22/biofilm‑dependent modulation protein | |||||||||||
| 1,567,292 | IS1 (+) +9 bp | 100% | intergenic (‑61/+265) | ydeP ← / ← ydeQ | predicted oxidoreductase/predicted fimbrial‑like adhesin protein | |||||||||||
| 1,595,625 | IS150 (+) +3 bp | 100% | coding (71‑73/900 nt) | eamA ← | cysteine and O‑acetyl‑L‑serine efflux system | |||||||||||
| 1,619,073 | IS150 (–) +3 bp | 100% | 100% | intergenic (‑71/+139) | hokD ← / ← ECB_01533 | small toxic polypeptide/conserved hypothetical protein | ||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 1,640,803 | IS150 (–) +3 bp | 100% | coding (761‑763/855 nt) | ynfH → | oxidoreductase, membrane subunit | |||||||||||
| 1,651,190 | IS150 (–) +3 bp | 100% | coding (844‑846/1035 nt) | ydgG → | predicted inner membrane protein | |||||||||||
| 1,651,192 | IS150 (–) +3 bp :: +TACA | 100% | coding (846‑848/1035 nt) | ydgG → | predicted inner membrane protein | |||||||||||
| 1,651,206 | IS150 (+) +3 bp | 100% | coding (860‑862/1035 nt) | ydgG → | predicted inner membrane protein | |||||||||||
| 1,729,737 | Δ2,150 bp | 100% | IS150‑mediated | ydhZ–[pykF] | ydhZ, [pykF] | |||||||||||
| 1,729,741 | Δ1 bp | 100% | Δ | intergenic (‑52/+698) | insJ‑2 ← / ← ydhZ | IS150 hypothetical protein/hypothetical protein | ||||||||||
| 1,776,123 | +T | 100% | intergenic (‑50/+57) | insJ‑2 ← / ← pheM | IS150 hypothetical protein/phenylalanyl‑tRNA synthetase operon leader peptide | |||||||||||
| 1,789,698 | (T)6→5 | 100% | coding (399/795 nt) | ydjO ← | hypothetical protein | |||||||||||
| 1,802,927 | IS1 (+) +9 bp | 100% | coding (941‑949/969 nt) | astE ← | succinylglutamate desuccinylase | |||||||||||
| 1,821,169 | IS150 (+) +3 bp | 100% | coding (616‑618/1041 nt) | ynjI ← | predicted inner membrane protein | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 1,867,822 | IS150 (–) +3 bp | 100% | coding (188‑190/1686 nt) | fadD ← | acyl‑CoA synthase | |||||||||||
| 1,867,855 | +CTT | 100% | coding (157/1686 nt) | fadD ← | acyl‑CoA synthase | |||||||||||
| 1,887,034 | IS150 (+) +3 bp | 100% | intergenic (‑3/‑154) | yobG ← / → ECB_01797 | hypothetical protein/hypothetical protein | |||||||||||
| 1,887,041 | IS1 (–) +9 bp | 100% | intergenic (‑10/‑141) | yobG ← / → ECB_01797 | hypothetical protein/hypothetical protein | |||||||||||
| 1,887,041 | IS1 (+) +9 bp | 100% | intergenic (‑10/‑141) | yobG ← / → ECB_01797 | hypothetical protein/hypothetical protein | |||||||||||
| 1,887,084 | IS1 (+) +9 bp | 100% | intergenic (‑53/‑98) | yobG ← / → ECB_01797 | hypothetical protein/hypothetical protein | |||||||||||
| 1,896,278 | IS150 (–) +4 bp | 100% | coding (505‑508/2634 nt) | yebT → | hypothetical protein | |||||||||||
| 1,897,614 | IS150 (–) +3 bp | 100% | coding (1841‑1843/2634 nt) | yebT → | hypothetical protein | |||||||||||
| 1,902,189 | IS150 (–) +3 bp | 100% | coding (664‑666/873 nt) | yebZ ← | predicted inner membrane protein | |||||||||||
| 1,913,929 | IS150 (–) +3 bp | 100% | coding (647‑649/1476 nt) | zwf ← | glucose‑6‑phosphate 1‑dehydrogenase | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 1,988,179 | IS150 (+) +3 bp | 100% | coding (5631‑5633/7152 nt) | yeeJ → | adhesin | |||||||||||
| 2,079,174 | IS150 (+) +3 bp | 100% | coding (613‑615/819 nt) | yegX ← | predicted hydrolase | |||||||||||
| 2,099,889 | IS150 (–) +3 bp | 100% | coding (991‑993/2280 nt) | yehM → | hypothetical protein | |||||||||||
| 2,133,554 | IS150 (+) +3 bp | 100% | ? | coding (39‑41/999 nt) | mglB ← | methyl‑galactoside transporter subunit | ||||||||||
| 2,133,567 | IS150 (+) +4 bp | 100% | ? | coding (25‑28/999 nt) | mglB ← | methyl‑galactoside transporter subunit | ||||||||||
| 2,133,582 | IS150 (+) +3 bp | ? | 100% | coding (11‑13/999 nt) | mglB ← | methyl‑galactoside transporter subunit | ||||||||||
| 2,209,801 | A→T | 100% | S351C (AGT→TGT) | atoS → | sensory histidine kinase in two‑component regulatory system with AtoC | |||||||||||
| 2,209,853 | C→A | 100% | S368Y (TCT→TAT) | atoS → | sensory histidine kinase in two‑component regulatory system with AtoC | |||||||||||
| 2,230,905 | IS150 (+) +3 bp | 100% | coding (1971‑1973/3753 nt) | yfaL ← | adhesin | |||||||||||
| 2,302,013 | G→A | 100% | A556T (GCG→ACG) | pta → | phosphate acetyltransferase | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 2,325,035 | IS150 (+) +3 bp | 100% | coding (685‑687/1179 nt) | yfcJ ← | predicted transporter | |||||||||||
| 2,331,208 | ISRSO11 (+) +4 bp | 100% | coding (775‑778/825 nt) | mepA ← | penicillin‑insensitive murein endopeptidase | |||||||||||
| 2,346,173 | G→A | 100% | intergenic (‑31/+150) | yfcY ← / ← yfcZ | acetyl‑CoA acetyltransferase/hypothetical protein | |||||||||||
| 2,346,183 | G→A | 100% | intergenic (‑41/+140) | yfcY ← / ← yfcZ | acetyl‑CoA acetyltransferase/hypothetical protein | |||||||||||
| 2,347,259 | IS150 (–) +3 bp | 100% | coding (287‑289/1347 nt) | fadL → | long‑chain fatty acid outer membrane transporter | |||||||||||
| 2,348,048 | IS150 (–) +3 bp | 100% | coding (1076‑1078/1347 nt) | fadL → | long‑chain fatty acid outer membrane transporter | |||||||||||
| 2,348,062 | IS3 (–) +3 bp :: +TCA | 100% | coding (1090‑1092/1347 nt) | fadL → | long‑chain fatty acid outer membrane transporter | |||||||||||
| 2,348,064 | IS150 (+) +3 bp | 100% | coding (1092‑1094/1347 nt) | fadL → | long‑chain fatty acid outer membrane transporter | |||||||||||
| 2,348,272 | IS150 (–) +3 bp | 100% | 100% | coding (1300‑1302/1347 nt) | fadL → | long‑chain fatty acid outer membrane transporter | ||||||||||
| 2,434,162 | G→T | 100% | S121R (AGC→AGA) | eutJ ← | predicted chaperonin, ethanolamine utilization protein | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 2,455,036 | A→G | 100% | intergenic (+142/‑397) | acrD → / → yffB | aminoglycoside/multidrug efflux system/hypothetical protein | |||||||||||
| 2,465,970 | IS186 (–) +8 bp | 100% | coding (584‑591/618 nt) | hyfA → | hydrogenase 4, 4Fe‑4S subunit | |||||||||||
| 2,468,533 | A→C | 100% | intergenic (+511/‑549) | hyfB → / → hyfD | NADH dehydrogenase subunit N/hydrogenase 4 membrane subunit | |||||||||||
| 2,525,967 | (CTAATTACTTCGCCAACGGCG)1→2 | 100% | coding (222/489 nt) | iscR ← | DNA‑binding transcriptional repressor | |||||||||||
| 2,526,007 | G→A | 100% | P61L (CCA→CTA) | iscR ← | DNA‑binding transcriptional repressor | |||||||||||
| 2,527,313 | C→A | 100% | R23L (CGT→CTT) | yfhQ ← | predicted methyltransferase | |||||||||||
| 2,529,490 | +ACA | 100% | intergenic (+189/‑2) | yfhR → / → csiE | predicted peptidase/stationary phase inducible protein | |||||||||||
| 2,535,008 | IS150 (+) +1 bp :: +AA | 100% | coding (44/321 nt) | hcaC → | 3‑phenylpropionate dioxygenase, predicted ferredoxin subunit | |||||||||||
| 2,549,863 | C→T | 100% | intergenic (‑299/‑29) | glyA ← / → hmpA | serine hydroxymethyltransferase/fused nitric oxide dioxygenase/dihydropteridine reductase 2 | |||||||||||
| 2,600,587 | +T | 100% | intergenic (‑51/+655) | insJ‑2 ← / ← rluD | IS150 hypothetical protein/23S rRNA pseudouridine synthase | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 2,623,300 | IS3 (–) +3 bp :: +TCA | 100% | coding (1081‑1083/1230 nt) | ECB_02509 → | Fels‑2 prophage protein | |||||||||||
| 2,630,053 | A→C | 100% | 100% | I197L (ATT→CTT) | ygaF → | predicted enzyme | ||||||||||
| 2,650,572 | G→T | 100% | M47I (ATG→ATT) | emrR → | DNA‑binding transcriptional repressor of microcin B17 synthesis and multidrug efflux | |||||||||||
| 2,663,500 | C→T | 100% | intergenic (‑69/+11) | recA ← / ← ygaD | recombinase A/competence damage‑inducible protein A | |||||||||||
| 2,720,682 | Δ1 bp | 100% | 100% | intergenic (‑49/+200) | insJ‑3 ← / ← cysH | IS150 hypothetical protein/phosphoadenosine phosphosulfate reductase | ||||||||||
| 2,769,779 | G→A | 100% | R415* (CGA→TGA) | ECB_02649 ← | protein similar to L‑ribulokinase AraB | |||||||||||
| 2,845,864 | Δ2,335 bp | 100% | IS150‑mediated | yqeC–[ygfK] | yqeC, ygfJ, [ygfK] | |||||||||||
| 2,897,655 | IS1 (+) +8 bp | 100% | coding (854‑861/1479 nt) | ygfH → | propionyl‑CoA:succinate‑CoA transferase | |||||||||||
| 2,914,014 | IS150 (+) +3 bp | 100% | coding (102‑104/759 nt) | yggG → | predicted peptidase | |||||||||||
| 2,938,642 | IS150 (–) +3 bp | 100% | coding (1019‑1021/1257 nt) | nupG → | nucleoside transporter | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 2,957,887 | IS150 (+) +3 bp | 100% | intergenic (‑78/‑494) | ECB_02812 ← / → ECB_02813 | conserved hypothetical protein/hypothetical protein | |||||||||||
| 2,963,466 | Δ13,009 bp | 100% | IS150‑mediated | ECB_02837–[yghK] | ECB_02837, ECB_02838, yghF, yghG, pppA, yghJ, [yghK] | |||||||||||
| 3,109,394 | IS150 (–) +3 bp | 100% | 100% | coding (245‑247/663 nt) | yqjA → | conserved inner membrane protein | ||||||||||
| 3,109,394 | IS150 (–) +4 bp | 100% | 100% | coding (245‑248/663 nt) | yqjA → | conserved inner membrane protein | ||||||||||
| 3,110,349 | IS3 (–) +3 bp :: +TCA | 100% | coding (4‑6/369 nt) | yqjC → | hypothetical protein | |||||||||||
| 3,172,495 | Δ1 bp | 100% | coding (7/885 nt) | nlpI ← | hypothetical protein | |||||||||||
| 3,172,540 | IS150 (–) +3 bp | 100% | 100% | intergenic (‑39/+68) | nlpI ← / ← pnp | hypothetical protein/polynucleotide phosphorylase/polyadenylase | ||||||||||
| 3,196,333 | Δ59 bp | 100% | ? | IS150‑mediated | yhbE ← / → insJ‑2 | conserved inner membrane protein/IS150 hypothetical protein | ||||||||||
| 3,242,824 | A→C | 100% | I148L (ATT→CTT) | argR → | arginine repressor | |||||||||||
| 3,290,790 | Δ1 bp | 100% | coding (459/1125 nt) | smf ← | hypothetical protein | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 3,393,071 | IS150 (–) +3 bp | 100% | coding (1263‑1265/1353 nt) | envZ ← | osmolarity sensor protein | |||||||||||
| 3,402,005 | IS150 (–) +1 bp :: +ATC | 100% | coding (391/879 nt) | yhgA → | predicted transposase | |||||||||||
| 3,427,815 | T→C | 100% | N2D (AAT→GAT) | glgP ← | glycogen phosphorylase | |||||||||||
| 3,429,542 | C→A | 100% | G349C (GGT→TGT) | glgC ← | glucose‑1‑phosphate adenylyltransferase | |||||||||||
| 3,501,352 | +A :: IS150 (+) +3 bp | 100% | coding (188‑190/336 nt) | yhiO ← | universal stress protein UspB | |||||||||||
| 3,501,576 | IS150 (–) +3 bp | 100% | intergenic (‑35/‑354) | yhiO ← / → uspA | universal stress protein UspB/universal stress global response regulator | |||||||||||
| 3,501,576 | IS150 (+) +3 bp | 100% | 100% | 100% | 100% | 100% | 100% | 100% | intergenic (‑35/‑354) | yhiO ← / → uspA | universal stress protein UspB/universal stress global response regulator | |||||
| 3,501,576 | IS150 (+) +3 bp :: +C | 100% | intergenic (‑35/‑354) | yhiO ← / → uspA | universal stress protein UspB/universal stress global response regulator | |||||||||||
| 3,501,577 | IS150 (–) +2 bp | 100% | intergenic (‑36/‑354) | yhiO ← / → uspA | universal stress protein UspB/universal stress global response regulator | |||||||||||
| 3,536,960 | IS150 (–) +3 bp | 100% | coding (2028‑2030/2076 nt) | yhjG ← | predicted outer membrane biogenesis protein | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 3,538,891 | IS150 (+) +3 bp | 100% | coding (97‑99/2076 nt) | yhjG ← | predicted outer membrane biogenesis protein | |||||||||||
| 3,544,110 | A→G | 100% | intergenic (‑39/+144) | dctA ← / ← yhjK | C4‑dicarboxylate transport protein/predicted diguanylate cyclase | |||||||||||
| 3,561,766 | IS150 (–) +3 bp | 100% | intergenic (‑89/‑385) | ldrD ← / → yhjV | toxic polypeptide, small/predicted transporter | |||||||||||
| 3,577,388 | Δ4,835 bp | 100% | IS150‑mediated | [bisC]–hokA | [bisC], yiaD, tkrA, yiaF, yiaG, cspA, hokA | |||||||||||
| 3,583,666 | Δ100 bp | 100% | IS150‑mediated | insK‑4 → / ← glyS | IS150 putative transposase/glycyl‑tRNA synthetase subunit beta | |||||||||||
| 3,583,667 | Δ1 bp | Δ | 100% | intergenic (+28/+251) | insK‑4 → / ← glyS | IS150 putative transposase/glycyl‑tRNA synthetase subunit beta | ||||||||||
| 3,687,738 | Δ1 bp :: IS186 (+) +9 bp | 100% | coding (306‑314/864 nt) | yicC → | hypothetical protein | |||||||||||
| 3,700,202 | IS1 (–) +8 bp | 100% | intergenic (‑94/‑179) | gltS ← / → yicE | glutamate transporter/predicted transporter | |||||||||||
| 3,748,889 | IS150 (–) +3 bp | 100% | coding (142‑144/450 nt) | yidI → | predicted inner membrane protein | |||||||||||
| 3,756,769 | IS1 (–) +8 bp | 100% | intergenic (‑325/+598) | glvBC ← / ← yidE | arbutin specific enzyme IIBC component of PTS/hypothetical protein | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 3,764,589 | IS150 (+) +3 bp | 100% | intergenic (‑97/+21) | dgoT ← / ← dgoD | D‑galactonate transporter/galactonate dehydratase | |||||||||||
| 3,825,949 | Δ1 bp | 100% | intergenic (+3/‑51) | kup → / → insJ‑5 | potassium transporter/IS150 hypothetical protein | |||||||||||
| 3,888,290 | IS150 (–) +3 bp | 100% | coding (586‑588/903 nt) | ECB_03690 ← | conserved hypothetical protein | |||||||||||
| 3,932,217 | IS150 (+) +3 bp | 100% | coding (865‑867/1164 nt) | fadA ← | acetyl‑CoA acetyltransferase | |||||||||||
| 3,975,518 | IS150 (–) +3 bp | 100% | 100% | coding (322‑324/1242 nt) | yihS ← | predicted glucosamine isomerase | ||||||||||
| 3,975,518 | IS150 (+) +3 bp | 100% | coding (322‑324/1242 nt) | yihS ← | predicted glucosamine isomerase | |||||||||||
| 4,035,958 | Δ220 bp | 100% | IS150‑mediated | metB → / ← insK‑2 | cystathionine gamma‑synthase/IS150 putative transposase | |||||||||||
| 4,090,512 | G→A | 100% | R758H (CGT→CAT) | rpoB → | DNA‑directed RNA polymerase subunit beta | |||||||||||
| 4,091,274 | A→C | 100% | E1012A (GAA→GCA) | rpoB → | DNA‑directed RNA polymerase subunit beta | |||||||||||
| 4,122,754 | IS150 (–) +3 bp | 100% | coding (448‑450/1602 nt) | aceB → | malate synthase | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 4,134,638 | T→C | 100% | L198P (CTG→CCG) | yjbB → | predicted transporter | |||||||||||
| 4,135,292 | A→C | 100% | D416A (GAT→GCT) | yjbB → | predicted transporter | |||||||||||
| 4,188,718 | C→T | 100% | M225I (ATG→ATA) | yjcF ← | hypothetical protein | |||||||||||
| 4,191,720 | IS150 (+) +4 bp | 100% | intergenic (‑190/+7) | yjcH ← / ← acs | conserved inner membrane protein involved in acetate transport/acetyl‑coenzyme A synthetase | |||||||||||
| 4,203,100 | IS150 (–) +3 bp | 100% | coding (230‑232/690 nt) | yjcO ← | hypothetical protein | |||||||||||
| 4,234,238 | IS150 (+) +3 bp | 100% | coding (1006‑1008/2229 nt) | yjdA → | conserved protein with nucleoside triphosphate hydrolase domain | |||||||||||
| 4,256,901 | (CGCGG)3→2 | 100% | intergenic (‑768/‑1042) | dcuR ← / → yjdI | DNA‑binding response regulator in two‑component regulatory system with DcuS/hypothetical protein | |||||||||||
| 4,260,611 | IS150 (–) +4 bp | 100% | coding (208‑211/1518 nt) | lysU ← | lysine tRNA synthetase, inducible | |||||||||||
| 4,260,612 | IS150 (–) +3 bp | 100% | coding (208‑210/1518 nt) | lysU ← | lysine tRNA synthetase, inducible | |||||||||||
| 4,307,583 | Δ61 bp | 100% | coding (7‑67/1260 nt) | hflK → | modulator for HflB protease specific for phage lambda cII repressor | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 4,343,095 | +T | 100% | intergenic (+1157/+28) | fklB → / ← insK‑2 | FKBP‑type peptidyl‑prolyl cis‑trans isomerase (rotamase)/IS150 putative transposase | |||||||||||
| 4,343,098 | Δ1,446 bp | 100% | 100% | 100% | IS150‑mediated | insK‑2–insJ‑2 | insK‑2, insJ‑2 | |||||||||
| 4,356,267 | C→T | 100% | N433N (AAC→AAT) | ytfM → | predicted outer membrane protein and surface antigen | |||||||||||
| 4,364,778 | IS150 (+) +4 bp | 100% | coding (127‑130/1023 nt) | ytfT → | predicted sugar transporter subunit: membrane component of ABC superfamily | |||||||||||
| 4,446,620 | IS150 (–) +3 bp | 100% | intergenic (‑60/+3) | yjhS ← / ← yjhT | hypothetical protein/hypothetical protein | |||||||||||
| 4,456,967 | IS150 (–) +3 bp | 100% | intergenic (‑29/+19) | yjiX ← / ← yjiY | hypothetical protein/predicted inner membrane protein | |||||||||||
| 4,456,970 | IS150 (–) +3 bp | 100% | intergenic (‑32/+16) | yjiX ← / ← yjiY | hypothetical protein/predicted inner membrane protein | |||||||||||
| 4,478,024 | IS150 (–) +3 bp | 100% | coding (534‑536/2292 nt) | mdoB ← | phosphoglycerol transferase I | |||||||||||
| 4,478,040 | IS150 (+) +3 bp | 100% | 100% | coding (518‑520/2292 nt) | mdoB ← | phosphoglycerol transferase I | ||||||||||
| 4,501,612 | C→T | 100% | E202K (GAG→AAG) | lplA ← | lipoate‑protein ligase A | |||||||||||
| position | mutation | ZDBp871_minus_CZB151 | ZDBp875_minus_CZB151 | ZDBp877_minus_CZB152 | ZDBp880_minus_CZB152 | ZDBp883_minus_CZB154 | ZDBp886_minus_CZB154 | ZDBp889_minus_ZDB67 | ZDBp892_minus_ZDB67 | ZDBp895_minus_ZDB68 | ZDBp898_minus_ZDB68 | ZDBp901_minus_ZDB69 | ZDBp904_minus_ZDB69 | annotation | gene | description |
| 4,502,903 | +A | 100% | 100% | intergenic (‑16/‑50) | smp ← / → insJ‑2 | hypothetical protein/IS150 hypothetical protein | ||||||||||