<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">55965</article-id><article-id pub-id-type="doi">10.7554/eLife.55965</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Developmental Biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Evolutionary Biology</subject></subj-group></article-categories><title-group><article-title>Evolutionary expansion of apical extracellular matrix is required for the elongation of cells in a novel structure</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-149650"><name><surname>Smith</surname><given-names>Sarah Jacquelyn</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-1469-1821</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-11546"><name><surname>Davidson</surname><given-names>Lance A</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0002-2956-0437</contrib-id><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-24075"><name><surname>Rebeiz</surname><given-names>Mark</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-5731-5570</contrib-id><email>rebeiz@pitt.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Biological Sciences, University of Pittsburgh</institution><addr-line><named-content content-type="city">Pittsburgh</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution>Department of Bioengineering, University of Pittsburgh</institution><addr-line><named-content content-type="city">Pittsburgh</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Rokas</surname><given-names>Antonis</given-names></name><role>Reviewing Editor</role><aff><institution>Vanderbilt University</institution><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Eisen</surname><given-names>Michael B</given-names></name><role>Senior Editor</role><aff><institution>HHMI, University of California, Berkeley</institution><country>United States</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>27</day><month>04</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e55965</elocation-id><history><date date-type="received" iso-8601-date="2020-02-12"><day>12</day><month>02</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2020-04-06"><day>06</day><month>04</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Smith et al</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Smith et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-55965-v2.pdf"/><related-article ext-link-type="doi" id="ra1" related-article-type="commentary" xlink:href="10.7554/eLife.57668"/><abstract><p>One of the fundamental gaps in our knowledge of how novel anatomical structures evolve is understanding the origins of the morphogenetic processes that form these features. Here, we traced the cellular development of a recently evolved morphological novelty, the posterior lobe of <italic>D. melanogaster</italic>. We found that this genital outgrowth forms through extreme increases in epithelial cell height. By examining the apical extracellular matrix (aECM), we also uncovered a vast matrix associated with the developing genitalia of lobed and non-lobed species. Expression of the aECM protein Dumpy is spatially expanded in lobe-forming species, connecting the posterior lobe to the ancestrally derived aECM network. Further analysis demonstrated that Dumpy attachments are necessary for cell height increases during posterior lobe development. We propose that the aECM presents a rich reservoir for generating morphological novelty and highlights a yet unseen role for aECM in regulating extreme cell height.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>developmental evolution</kwd><kwd>genitalia</kwd><kwd>apical extracellular matrix</kwd><kwd>morphogenesis</kwd><kwd><italic>Drosophila biarmipes</italic></kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>D. melanogaster</italic></kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>GM107387</award-id><principal-award-recipient><name><surname>Rebeiz</surname><given-names>Mark</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>HD044750</award-id><principal-award-recipient><name><surname>Davidson</surname><given-names>Lance A</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>A new morphological structure evolved through extreme changes in cell height requires novel connections to an extracellular matrix network, which predates the origin of structure.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Biologists have long been mesmerized by the appearance of morphological novelties, new structures that appear to lack homologs in other species groups (<xref ref-type="bibr" rid="bib40">Moczek, 2008</xref>; <xref ref-type="bibr" rid="bib63">Wagner and Lynch, 2010</xref>). To understand the origins of these novel structures, significant effort has focused on determining how the spatial and temporal patterning of genes were altered during evolution (<xref ref-type="bibr" rid="bib46">Peter and Davidson, 2015</xref>; <xref ref-type="bibr" rid="bib49">Rebeiz et al., 2015</xref>; <xref ref-type="bibr" rid="bib62">Wagner, 2014</xref>). This research has demonstrated that morphological novelties are often associated with the redeployment of pre-existing developmental programs in new locations. However, limited attention has been directed to how novel structures form at the cellular level. Understanding how a structure physically forms is important, as it can help explain which morphogenetic processes might be targeted during evolution. In addition, because most morphological novelties arose in the distant past, it is likely that the causative genetic changes will be obscured by additional changes scattered throughout relevant gene regulatory networks (<xref ref-type="bibr" rid="bib33">Liu et al., 2019</xref>). Hence, understanding the morphogenetic basis of a novelty is critical to identifying the most important aspects of the gene regulatory networks that contributed to its origin.</p><p>Most studies of morphogenetic evolution have focused on epithelial structures subject to diversification, illuminating processes that contributed to their modification, as opposed to origination. For example, studies of tooth morphogenesis have elucidated how both internal mechanisms, such as cell shape changes (<xref ref-type="bibr" rid="bib31">Li et al., 2016</xref>), and external forces, such as the pressure from the surrounding jaw (<xref ref-type="bibr" rid="bib51">Renvoisé et al., 2017</xref>) could be contributing factors in their diversification. Furthermore, an examination of the enlarged ovipositor of <italic>Drosophila suzukii</italic> revealed how a 60% increase in length was associated with increases in apical area and anisotropic cellular rearrangement, elucidating how increases in the size of a structure might evolve (<xref ref-type="bibr" rid="bib18">Green et al., 2019</xref>). Dramatic differences in morphogenetic mechanisms have also been observed between distantly related species which contribute to the development of conserved structures, such as eggshell breathing tubes (<xref ref-type="bibr" rid="bib43">Osterfield et al., 2015</xref>) and the migration of sex comb precursors (<xref ref-type="bibr" rid="bib1">Atallah et al., 2009</xref>; <xref ref-type="bibr" rid="bib59">Tanaka et al., 2009</xref>) in <italic>Drosophila.</italic> Overall, these studies have illustrated how evolutionary comparative approaches can reveal morphogenetic processes critical to the sculpting of anatomical structures.</p><p>Morphogenesis is the product of both cell intrinsic processes, such as those conferred by the cytoskeleton or cell-cell junctions, and cell extrinsic processes from the environment in which the cell resides. Extracellular mechanics are relatively understudied compared to intracellular mechanics (<xref ref-type="bibr" rid="bib44">Paluch and Heisenberg, 2009</xref>). An important component of the microenvironment of a cell is the extracellular matrix (ECM) which can be subdivided into two populations of ECM, the basal ECM and the apical ECM (aECM) (<xref ref-type="bibr" rid="bib7">Brown, 2011</xref>; <xref ref-type="bibr" rid="bib9">Daley and Yamada, 2013</xref>; <xref ref-type="bibr" rid="bib32">Linde-Medina and Marcucio, 2018</xref>; <xref ref-type="bibr" rid="bib34">Loganathan et al., 2016</xref>). While comparatively understudied, recent work has defined vital roles for aECM in the morphogenesis of various structures in <italic>Drosophila,</italic> such as the wing (<xref ref-type="bibr" rid="bib10">Diaz-de-la-Loza et al., 2018</xref>; <xref ref-type="bibr" rid="bib14">Etournay et al., 2015</xref>; <xref ref-type="bibr" rid="bib47">Ray et al., 2015</xref>), denticles (<xref ref-type="bibr" rid="bib15">Fernandes et al., 2010</xref>), trachea (<xref ref-type="bibr" rid="bib11">Dong et al., 2014</xref>; <xref ref-type="bibr" rid="bib54">Rosa et al., 2018</xref>) and the posterior endoderm (<xref ref-type="bibr" rid="bib2">Bailles et al., 2019</xref>). In addition, roles for the aECM have been found in neuron morphogenesis in <italic>C. elegans</italic> (<xref ref-type="bibr" rid="bib20">Heiman and Shaham, 2009</xref>; <xref ref-type="bibr" rid="bib35">Low et al., 2019</xref>) and during gastrulation in beetles (<xref ref-type="bibr" rid="bib42">Münster et al., 2019</xref>). Despite recent interest in the aECM, its role in the evolution of morphogenetic processes is currently unknown.</p><p>Genital traits represent a particularly advantageous system in which to study the morphogenetic basis of novel structures. The study of morphological novelty is often difficult because most structures of interest evolved in the distant past, rendering it difficult to understand the ancestral ground state from which the novelty emerged. Genitalia are noted for their rapid evolution (<xref ref-type="bibr" rid="bib13">Eberhard, 1985</xref>), and thus bear traits among closely-related species that have recently evolved in the context of a tissue that is otherwise minimally altered. For example, the posterior lobe, a recently evolved anatomical structure present on the genitalia of male flies of the <italic>melanogaster</italic> clade (<xref ref-type="bibr" rid="bib27">Kopp and True, 2002</xref>; <xref ref-type="fig" rid="fig1">Figure 1A</xref>), is a three-dimensional outgrowth that is required for genital coupling (<xref ref-type="bibr" rid="bib16">Frazee and Masly, 2015</xref>; <xref ref-type="bibr" rid="bib23">Jagadeeshan and Singh, 2006</xref>; <xref ref-type="bibr" rid="bib30">LeVasseur-Viens, 2015</xref>). Other than the posterior lobe, the genitalia of lobed and non-lobed species are quite similar in composition, providing an excellent comparative context in which to examine the morphogenesis of the ancestral structure from which the posterior lobe emerged.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>The posterior lobe protrudes from the lateral plate.</title><p>(<bold>A</bold>) Phylogenetic tree with bright-field images of adult lateral plate cuticles from which the posterior lobe projects (arrow). (<bold>B–E</bold>) Illustration, (<bold>B’–E’</bold>) maximum projection, and (<bold>B’’–E’’</bold>) three-dimensional projection labeled with E-cadherin (Ecad) of early (28 hr APF) and late (52 hr APF) developing genitalia showing the posterior lobe projecting form the lateral plate of <italic>D. melanogaster</italic> (<bold>D’’</bold>), but absent in <italic>D. biarmipes</italic> (<bold>E’’</bold>). Relevant structures are labeled: posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), phallus (P), anal plate (AP), and hypandrium (H). All max projections are oriented with ventral side towards to the top and dorsal sides towards the bottom. (<bold>F</bold>) Zoomed in illustration of posterior lobe and (<bold>G</bold>) a cross-sectional/lateral view of the posterior lobe. The highest point of the lobe is the distal tip and the invagination between the lobe and the clasper is termed the crevice (<bold>G</bold>). Scale bar, 20 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig1-v2.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Developmental timing of lobed vs non-lobed genitalia.</title><p>Developmental time course of the lobed species <italic>D. melanogaster</italic> (<bold>A–D</bold>) and the non-lobed species <italic>D. biarmipes</italic> (<bold>E–H</bold>) with E-cadherin (Ecad) label. Location of respective cross sections indicated in yellow for lateral plate and blue for posterior lobe (<italic>D. melanogaster)</italic> or equivalent location in non-lobed species (<italic>D. biarmipes</italic>). Relevant structures are labeled: posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), and phallus (P). Scale bar, 20 μm. At 28 hr APF the genitalia looks relatively similar between <italic>D. melanogaster</italic> (<bold>A–A2</bold>) and <italic>D. biarmipes</italic> (<bold>E–E2</bold>). At 32 hr APF in <italic>D. melanogaster</italic> the clasper and lateral plate have fully begun to cleave (B1-2 red arrowhead = cleavage), the lateral plate is lower than the clasper (<bold>B1</bold>), and the hypandrium, sheath, and phallus have fully everted and are neighboring the clasper and lateral plate (B1-2). <italic>D. biarmipes</italic> lags behind approximately 4 hr. At 32 hr APF there is slight cleavage near the dorsal side of the lateral plate and clasper (F2 red arrowhead), but no cleavage has occurred at the ventral side (<bold>F1</bold>). In addition, the sheath, hypandrium, and phallus have not everted yet (F1-2). At 36 hr APF in <italic>D. biarmipes,</italic> cleavage has begun along the full length of the lateral plate and clasper (G1-2 red arrowhead), the lateral plate is lower than the clasper (G1-2), and the hypandrium, sheath, and phallus have everted and are next to the lateral plate and clasper (G1-2). As development proceeds later at 52 hr APF the lateral plate and clasper fully separate at the ventral side of the genitalia in both <italic>D. melanogaster</italic> (D1 green arrow) and <italic>D. biarmipes</italic> (H1 green arrow). Full cleavage does not span the length of the lateral plate and clasper (<bold>D2 and H2</bold>) and stops right before the posterior lobe forms (<bold>D2</bold>) and also stops before reaching the very dorsal side of the lateral plate and clasper in <italic>D. biarmipes</italic> (<bold>H2</bold>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig1-figsupp1-v2.tif"/></fig><media id="fig1video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-55965-fig1-video1.mp4"><label>Figure 1—video 1.</label><caption><title>The posterior lobe protrudes from the lateral plate.</title><p>Three-dimensional projections of <italic>D. biarmipes</italic> (left) and <italic>D. melanogaster</italic> (right) samples at 52 hr APF labeled with E-cadherin.</p></caption></media></fig-group><p>Here, we find that the posterior lobe forms through dramatic increases in cell height along the apico-basal axis as it projects out of the plane of its surrounding epithelium. We investigated internal and external factors that might contribute to this cell height increase and discovered a correlation between the aECM protein Dumpy and the height reached by posterior lobe cells. Comparisons to non-lobed species uncovered the presence of a conserved aECM network on the genitalia that has expanded to cells that form the posterior lobe. Overall, our work demonstrates how the formation of a morphological novelty is associated with changes in the aECM, which integrates posterior lobe cells into a larger pre-existing aECM network necessary for its formation.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>The posterior lobe grows from the lateral plate epithelium</title><p>The male genitalia of <italic>Drosophila</italic> is a bilaterally symmetrical anatomical structure which forms from the genital disc during pupal development. A recent consortium detailed the adult anatomy of <italic>Drosophila melanogaster</italic> males, establishing naming conventions and boundaries for adult structures (<xref ref-type="bibr" rid="bib52">Rice et al., 2019</xref>). The posterior lobe (also known as the epandrial posterior lobe) protrudes from a structure called the lateral plate (also known as the epandrial ventral lobe) (<xref ref-type="fig" rid="fig1">Figure 1A,D</xref>; <xref ref-type="video" rid="fig1video1">Figure 1—video 1</xref>). In <italic>D. melanogaster</italic>, prior to posterior lobe formation, the lateral plate is fully fused to a neighboring structure called the clasper (also known as the surstylus) (<xref ref-type="fig" rid="fig1">Figure 1B</xref>; <xref ref-type="bibr" rid="bib17">Glassford et al., 2015</xref>). The lateral plate begins to separate from the clasper around 32 hr after pupal formation (APF) in <italic>D. melanogaster</italic> (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). Approximately 4 hr later, the posterior lobe begins to project from the plane of the lateral plate and achieves its final shape by 52 hr APF (<xref ref-type="fig" rid="fig1">Figure 1D</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). During posterior lobe development, cleavage of the lateral plate from the clasper continues, separating both tissues (<xref ref-type="fig" rid="fig1">Figure 1D</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). Full separation of the lateral plate and clasper stops slightly ventral to the posterior lobe (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). By contrast, in the non-lobed species <italic>D. biarmipes,</italic> the apical surface of the lateral plate remains flat throughout development, not forming a posterior lobe (<xref ref-type="fig" rid="fig1">Figure 1C,E</xref>). However, all other morphogenetic events are very similar in <italic>D. biarmipes</italic>, forming on a schedule that is approximately 4 hr behind <italic>D. melanogaster</italic> (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>).</p></sec><sec id="s2-2"><title>The posterior lobe forms through increases in cell height</title><p>To investigate which cellular behaviors are unique to lobed species, we examined how the posterior lobe grows from the lateral plate. First, we monitored cell proliferation, which commonly contributes to morphogenesis through patterned and/or oriented cell division (<xref ref-type="bibr" rid="bib21">Heisenberg and Bellaïche, 2013</xref>). Staining for phospho-histone H3, which marks actively dividing cells, revealed widespread cell proliferation throughout the entire genital epithelium during early developmental stages prior to posterior lobe morphogenesis (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). However, proliferation declines tissue-wide and all cell proliferation is essentially absent during posterior lobe development (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). Similar dynamics in proliferation are also observed in non-lobed species (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>), suggesting that proliferation is not a major contributor to the morphogenesis of the posterior lobe.</p><p>Next we tested the possibility that oriented cell intercalation could contribute to posterior lobe morphogenesis. Such processes may play a role in tissue elongation (<xref ref-type="bibr" rid="bib19">Guirao and Bellaïche, 2017</xref>; <xref ref-type="bibr" rid="bib58">Tada and Heisenberg, 2012</xref>; <xref ref-type="bibr" rid="bib64">Walck-Shannon and Hardin, 2014</xref>). To test this, we performed manual cell tracking of time-lapse movies of posterior lobe development in a GFP-tagged armadillo line (<xref ref-type="bibr" rid="bib22">Huang et al., 2012</xref>) which labels apical cell junctions. Initial observations of the outer face of the posterior lobe revealed few cell rearrangement events. When cell rearrangements did occur, it was usually in response to a cell being removed from the apical surface (<xref ref-type="video" rid="fig2video1">Figure 2—video 1</xref>). Due to the limited number of cell rearrangement events observed during posterior lobe morphogenesis, cell intercalation did not appear to be a major driver of posterior lobe morphogenesis, causing us to instead examine changes in cell shape.</p><p>Changes to cell shape are quite common during tissue morphogenesis, as classically illustrated by the process of apical constriction which deforms tissues during numerous developmental processes (<xref ref-type="bibr" rid="bib29">Lecuit and Lenne, 2007</xref>; <xref ref-type="bibr" rid="bib39">Martin and Goldstein, 2014</xref>). To examine cell shape, we utilized the Raeppli system to label individual cells with a fluorescent marker (mTFP1) (<xref ref-type="bibr" rid="bib25">Kanca et al., 2014</xref>). We observed that cells within the posterior lobe are tall and thin, spanning from the basal to the apical surface of the epithelium (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). Because cells span the full thickness of this tissue, we can approximate the height of the tallest cells in the posterior lobe by measuring tissue thickness in samples double-stained for E-cadherin and Fasciclin III, to label apical cell junctions and lateral membranes respectively. For these measurements, we used the lateral plate as an in-sample comparison, since it represents the tissue from which the posterior lobe protrudes and should differ from the lobe in morphogenetic processes. We observed a pronounced increase in thickness of the posterior lobe compared to the lateral plate (<xref ref-type="fig" rid="fig2">Figure 2B–C,F</xref>; <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>). The posterior lobe more than doubles in thickness with an average increase of 145.3% (+ 47.5 µm), while the lateral plate only increases by 22.6% (+ 7.9 µm) overall. Interestingly, this is a dynamic process during development. During the first 12 hr of posterior lobe development, the lateral plate thickness decreases by 5.1 µm, but the posterior lobe increases in thickness by 16.5 µm on average (<xref ref-type="fig" rid="fig2">Figure 2F</xref>). By contrast, during the last 4 hr of development, rapid increases in thickness occur in both the posterior lobe and lateral plate, which increase on average by 31.0 µm and 14.6 µm respectively (<xref ref-type="fig" rid="fig2">Figure 2F</xref>). These observations reveal a slow phase of cell height increase during the first 12 hr of posterior lobe development, and a fast phase during the last four hours of posterior lobe development. In contrast, when non-lobed species are examined, no thickness changes are observed in the location where a posterior lobe would form, indicating that this increase in tissue thickness is unique to the posterior lobe (<xref ref-type="fig" rid="fig2">Figure 2B–E,G</xref>; <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>). Together, these data suggest that the cells of the posterior lobe undergo an extreme shape change to increase in length along their apico-basal axes, driving the projection of this structure out of the plane of the lateral plate.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Posterior lobe cells increase in height to project out from the lateral plate.</title><p>(<bold>A</bold>) A single cell in the posterior lobe labeled with Raeppli-mTFP1 (green) spans the height of the tissue labeled with lateral membrane marker Fasciclin III (Fas3; magenta). Apical side of posterior lobe identified with dotted line. Sample is 44 hr after pupal formation (APF), but was heat shocked for 1 hr at 24 hr APF causing it to develop faster and more closely resembles a 48 hr APF sample. Scale bar, 10 μm. n = 10 cells (<bold>B–E</bold>) Maximum projections of early (36 hr APF) and late (52 hr APF) genital samples labeled with Fas3 (lateral membranes, green) and E-Cadherin (Ecad; apical membranes; magenta). Location of respective cross sections indicated in yellow for lateral plate (<bold>B1–E1</bold>) and blue for posterior lobe (<italic>D. melanogaster)</italic> (<bold>B2–C2</bold>) or equivalent location in non-lobed species (<italic>D. biarmipes</italic>) (<bold>D2–E2</bold>). Scale bar, 20 μm. Relevant structures are labeled: posterior lobe (PL), lateral plate (LP), clasper (C). (<bold>F</bold>) Quantification of tissue thickness of the lateral plate (light blue) and posterior lobe (dark blue). Illustration represents approximate location of cross-section that was used for tissue height measurement. Individual data points are presented; n = 10 per each time point. (<bold>G</bold>) Quantification of tissue thickness of the posterior lobe in <italic>D. melanogaster</italic> (dark blue) and equivalent location in non-lobed species <italic>D. biarmipes</italic> (orange). Illustration represents approximate location of cross-section that was used for tissue thickness measurement. Individual data points are presented; n ≥ 9 per each time point. Statistical significance is indicated (unpaired t-test; ****p≤0.0001; n.s. = not significant p≥0.05). <italic>D. melanogaster</italic> tissue height measures in (<bold>G</bold>) are replotted from (<bold>F</bold>) to facilitate direct comparisons with <italic>D. biarmipes.</italic></p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Individual measurements of tissue thickness over time.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-55965-fig2-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Cell division dynamics do not differ between lobed and non-lobed species.</title><p>Developmental time course with Phospho-Histone H3 (Ser 10) (PH3; green) labeling actively dividing cells and E-cadherin (Ecad; magenta) labeling the apical membrane of the tissue. Only superficial slices are shown to avoid fat body signals beneath lateral plate and clasper. n ≥ 3 per each time point. Scale bar, 20 μm. In both <italic>D. melanogaster</italic> and <italic>D. biarmipes</italic> cell division is widespread at 24 hr APF (<bold>A and D</bold>). Cell division is decreased by 32 hr APF (<bold>B and E</bold>). By 40 hr APF no cell division is observed (<bold>C and F</bold>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig2-figsupp1-v2.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Extended time course of tissue thickness in lobed and non-lobed species.</title><p>Extended time course for samples quantified in <xref ref-type="fig" rid="fig2">Figure 2F–G</xref>. (<bold>A–C</bold>) Max and cross-section view of 44 hr APF (A and C) and 48 hr APF (<bold>B</bold>) genital samples with lateral membrane labeled with Fasciclin III (Fas3; green) and apical membrane labeled with E-cadherin (Ecad; magenta). Location of respective cross sections indicated in yellow for lateral plate (<bold>A1–C1</bold>) and blue for posterior lobe (<italic>D. melanogaster)</italic> or equivalent location in non-lobed species (<italic>D. biarmipes</italic>) (<bold>A2–C2</bold>). n ≥ 9 per experiment. Scale bar, 20 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig2-figsupp2-v2.tif"/></fig><media id="fig2video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-55965-fig2-video1.mp4"><label>Figure 2—video 1.</label><caption><title>Cell rearrangement during posterior lobe development.</title><p>Live imaging of posterior lobe development with GFP tagged armadillo (apical membrane marker) illustrating a cell dropping from the apical surface and a neighboring cell filling in the gap. Imaging starts at approximately 36 hr APF. Due to uncontrolled temperatures during imaging that were cooler than normal growing conditions, the posterior lobe develops slower and the time indicated is not comparable to other images in the manuscript which were all grown under temperature-controlled settings. Based on the thickness of the posterior lobe at the end of the movie, the sample is between 48 and 52 hr APF. Cells were tracked manually and indicated with colored dots. Some dots disappear towards the end of the movie as they become difficult to track due to the signal from cells on the medial side of the posterior lobe.</p></caption></media></fig-group></sec><sec id="s2-3"><title>Cytoskeletal components increase in concentration in posterior lobe cells</title><p>Apico-basal cell elongation appears to be a major contributor to posterior lobe formation. To understand potential internal forces contributing to this cell shape change, we examined the organization of cytoskeletal components. As expected for a polarized epithelium, phalloidin staining of F-actin strongly localized to the apical cortex overlapping with E-cadherin throughout the entire genitalia (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). In addition, F-actin is also concentrated along the apico-basal axis of posterior lobe cells (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). This lateral F-actin localization was unique to the posterior lobe, as it is less intense in neighboring structures, such as the lateral plate, clasper, and sheath (also known as the aedeagal sheath <xref ref-type="bibr" rid="bib52">Rice et al., 2019</xref>), as well as in non-lobed species (<xref ref-type="fig" rid="fig3">Figure 3A</xref>; <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). Next we evaluated microtubules by examining two post-translational modifications of α-tubulin: acetylation of lysine40, a stabilizing modification (<xref ref-type="bibr" rid="bib53">Roll-Mecak, 2019</xref>; <xref ref-type="bibr" rid="bib69">Xu et al., 2017b</xref>), and C-terminal tyrosination, which has been associated with rapid microtubule turnover (<xref ref-type="bibr" rid="bib53">Roll-Mecak, 2019</xref>; <xref ref-type="bibr" rid="bib66">Webster et al., 1987</xref>). In the posterior lobe, acetylated tubulin levels are highest at the distal tip of the posterior lobe and weaken towards the basal side of the lobe epithelium (<xref ref-type="fig" rid="fig3">Figure 3B–C</xref>). Compared to other structures in the genitalia, acetylated tubulin is greatly increased specifically in the posterior lobe (<xref ref-type="fig" rid="fig3">Figure 3B–C</xref>). By contrast, the levels of acetylated tubulin in non-lobed species are similar throughout the genitalia (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). We found tyrosinated tubulin has a more consistent signal along the entire apico-basal axis in the posterior lobe (<xref ref-type="fig" rid="fig3">Figure 3B&amp;D</xref>). The amount of tyrosinated tubulin in posterior lobe cells is increased compared to neighboring structures but is weaker relative to the observed differences in acetylated tubulin. In non-lobed species, the levels of tyrosinated tubulin are consistent across the entire genitalia (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). Collectively, these results suggest that changes in assembly and/or dynamics of both F-actin and microtubule cytoskeletal networks could be contributing factors in changing the shape of posterior lobe cells to increase its height along the apico-basal axis.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Cytoskeletal components are increased in posterior lobe cells.</title><p>(<bold>A–D</bold>) Maximum projection, and respective cross-sections of late (48 hr APF) genital samples of the lobed species <italic>D. melanogaster</italic> labeled with F-actin/phalloidin (actin; green) and E-cadherin (Ecad; magenta) (<bold>A</bold>), acetylated tubulin (green) (<bold>B,C</bold>), and tyrosinated tubulin (magenta) (<bold>B,D</bold>). Location of respective cross sections indicated in yellow for lateral plate (<bold>A1–D1</bold>) and blue for posterior lobe (<bold>A2–D2</bold>). Cross-sections are maximum projections of a restricted 5.434 μm thick section to provide a complete view of cytoskeletal components along the apico-basal axis. All cross-sections are oriented with apical side at the top and basal side at the bottom. Asterisk identifies bristles which have high levels of F-actin and tubulin. Bright basal signal in A1 and A2 are fat bodies. Bottom layers were removed in panel A to remove fat body signal which overwhelmed other details. (<bold>B–D2</bold>) Panels C and D show separate channels of panel B. Relevant structures labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), and sheath (S). Scale bar, 20 μm. n ≥ 3 per experiment.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Uniform level of cytoskeletal components in non-lobed species.</title><p>(<bold>A–D</bold>) Max projections of late (48 hr APF) genital samples of non-lobed species <italic>D. biarmipes</italic> labeled with F-actin/phalloidin (green) and E-cadherin (Ecad; magenta) (<bold>A</bold>), acetylated tubulin (green) (<bold>B,C</bold>), and tyrosinated tubulin (magenta) (<bold>B,D</bold>). Location of respective cross sections indicated in blue for presumptive posterior lobe cells (<bold>A1–D1</bold>). Cross-sections are maximum projection of a restricted 5.434 μm thick section to display the full view of the cytoskeleton along the apico-basal axis. All cross-sections are oriented with apical side at the top and basal side at the bottom. Asterisk identifies bristles which have high levels of F-actin and tubulin. Bright basal signal in A1 is from fat bodies. Bottom layers were removed in panel A to avoid fat body signal which masked other details. Panels C and D show separate channels of panel B. Relevant structures labeled: Lateral plate (LP), clasper (C), and sheath (S) labeled. Scale bar, 20 μm. n ≥ 3 per experiment.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig3-figsupp1-v2.tif"/></fig></fig-group></sec><sec id="s2-4"><title>An apical extracellular matrix associates with posterior lobe cells</title><p>In addition to investigating potential cell autonomous mechanisms leading to increases in tissue thickness, we also sought to identify possible sources of external mechanical processes which could play a role in posterior lobe morphogenesis. Extrinsic roles for both the basal and apical extracellular matrix have been established in pupal wing morphogenesis of <italic>D. melanogaster</italic> (<xref ref-type="bibr" rid="bib10">Diaz-de-la-Loza et al., 2018</xref>; <xref ref-type="bibr" rid="bib14">Etournay et al., 2015</xref>; <xref ref-type="bibr" rid="bib47">Ray et al., 2015</xref>). We first attempted to characterize the basal ECM by analyzing a GFP-tagged version of Collagen IV (Viking:GFP) (<xref ref-type="bibr" rid="bib41">Morin et al., 2001</xref>). We observed that Viking:GFP, while present at very early stages of genital morphogenesis, is only weakly detected across the entire genitalia as the posterior lobe forms (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>), suggesting that minimal basal ECM is present at this time point. To further test for the presence of basal ECM, we examined another basal ECM component, Perlecan (Perlecan:GFP) (<xref ref-type="bibr" rid="bib41">Morin et al., 2001</xref>), and also observed weak signal (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). Together, these data suggest that the basal ECM is globally reduced in the genitalia during early pupal development, and it thus is unlikely to have specific effects on posterior lobe morphogenesis.</p><p>We next sought to determine if an apical ECM (aECM) is associated with the posterior lobe. <italic>Dumpy</italic> encodes a gigantic (2.5 MDa) zona pellucida domain-containing glycoprotein and is a major component of the aECM in <italic>Drosophila</italic> (<xref ref-type="bibr" rid="bib67">Wilkin et al., 2000</xref>). We examined a line in which Dumpy is endogenously tagged with Yellow Fluorescent Protein (Dumpy:YFP) (<xref ref-type="bibr" rid="bib36">Lowe et al., 2014</xref>; <xref ref-type="bibr" rid="bib37">Lye et al., 2014</xref>) and found that Dumpy:YFP forms a complex three-dimensional network over the pupal genitalia and is closely associated with cells of the posterior lobe (<xref ref-type="fig" rid="fig4">Figure 4</xref>; <xref ref-type="video" rid="fig4video1">Figure 4—video 1</xref>). The intricate complex morphology of this aECM network is hard to fully appreciate in flattened images due to its three-dimensional shape and spatially varying levels of Dumpy:YFP, making it difficult to see weaker populations of Dumpy without over-saturating more concentrated deposits, and is better viewed in three dimensions (<xref ref-type="video" rid="fig4video1">Figure 4—video 1</xref>). Remarkably, at certain points in the genitalia, this aECM network of Dumpy can extend up to a mean maximal height of 39.4 μm above the cells, which is taller than the thickness of posterior lobe cells at the beginning of development (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>), demonstrating how extensive the genital aECM network is.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Dumpy deposition is correlated with posterior lobe development.</title><p>(<bold>A–D</bold>) Maximum projection and (<bold>A’–B’’</bold>) respective zoom, indicated with pink box, labeled with Dumpy:YFP (green) and E-cadherin (Ecad; magenta) for each time point. Location of respective cross sections indicated in yellow for lateral plate (<bold>A1–D1</bold>) and blue for posterior lobe (<bold>A2–D2</bold>). Arrowhead in (<bold>A2</bold>) indicates future posterior lobe cells. Cross-sections are oriented with apical side at the top and basal side at the bottom. Relevant structures labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), and phallus (P). Scale bar, 20 μm. n ≥ 4 per experiment. Images were independently brightened to show relevant structures.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Limited basal ECM present during posterior lobe morphogenesis.</title><p>Basal ECM markers Collagen IV (Viking:GFP; green)(<bold>A and C</bold>) and Perlecan (Perlecan:GFP; green) (<bold>B and D</bold>) in L3 larval genital disc (<bold>A and B</bold>) and 44 hr APF genitalia (<bold>C and D</bold>). Apical membrane labeled with E-cadherin (Ecad; cyan) and lateral membrane labeled with Fasciclin III (Fas3; magenta). Image settings were the same for each marker between larval and pupal samples. Sporadic dots observed are fat bodies (white arrows in cross section), which fill the basal lumen of the pupal genital epithelium. Location of respective cross sections indicated in white. Cross-sections for larval samples are oriented basal sides out, as the disc has not yet everted. Pupal samples are oriented with apical side at the top and basal side at the bottom. Higher amounts of basal ECM are observed in larvae compared to 44 hr APF genital samples. Relevant structures labeled: Posterior lobe (PL) and clasper (C). Scale bar, 20 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig4-figsupp1-v2.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Dumpy extends above the apical surface of the phallus.</title><p>(<bold>A</bold>) Projection of Dumpy:YFP (green) and E-cadherin:mCherry (Ecad:mCherry; magenta) imaged live at 48 hr APF. Location of respective cross sections indicated in orange. (<bold>A1</bold>) Cross section showing extent of Dumpy:YFP observed above the surface of the genitalia. Relevant structures labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), and phallus (P). Scale bar, 20 μm. n = 3.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig4-figsupp2-v2.tif"/></fig><fig id="fig4s3" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 3.</label><caption><title>A bundle of Dumpy connects the genitalia to the pupal cuticle membrane that encases the developing pupa.</title><p>(<bold>A–B</bold>) Live imaging of Dumpy:YFP (green) and Ecadherin:mCherry (Ecad:mCherry; magenta) at respective time points. Location of respective cross sections indicated in orange. (<bold>A1–B1</bold>) Cross-sections are max projection of a 4.94 μm (<bold>A1</bold>) and 1.73 μm (<bold>B1</bold>) thick section to show the full bundle (arrow) and its connection to the cuticle (arrowhead) and anal plate. All cross-sections are oriented with apical side at the top and basal side at the bottom. Relevant structures labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), phallus (P), and anal plate (AP). Scale bar, 20 μm. n = 1 per each time point.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig4-figsupp3-v2.tif"/></fig><fig id="fig4s4" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 4.</label><caption><title>Weak aECM connections extend to the lateral plate.</title><p>(<bold>A–D</bold>) Brightened images of respective cross sections from <xref ref-type="fig" rid="fig2">Figure 2</xref> of lateral plate (<bold>A1–D1</bold>) in yellow and posterior lobe in blue (<bold>A2–D2</bold>). Cross-sections are oriented with apical side at the top and basal side at the bottom. Relevant structure labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), and phallus (P). Scale bar, 20 μm. n ≥ 4 per experiment. Images were overexposed to the same extent to show relevant structures.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig4-figsupp4-v2.tif"/></fig><media id="fig4video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-55965-fig4-video1.mp4"><label>Figure 4—video 1.</label><caption><title>Three-dimensional structure of Dumpy on developing genitalia.</title><p>Part 1 of the movie shows 3D rotation of 52 hr APF genital sample with Dumpy:YFP (green) and E-cadherin (magenta) labels. Part 2 of the movie shows a cross-sectional view starting at the ventral side of the posterior lobe and moving towards the dorsal side, and part three shows the same view, but starting at the ventral tip of the lateral plate and moving towards the ventral side of the posterior lobe. In the upper-right corner, there is a guide that roughly depicts the running location of the cross section. Cross-sections are oriented with apical side at the top and basal side at the bottom. Relevant structures labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), and phallus (P).</p></caption></media><media id="fig4video2" mime-subtype="mp4" mimetype="video" xlink:href="elife-55965-fig4-video2.mp4"><label>Figure 4—video 2.</label><caption><title>A bundle of Dumpy connects the genitalia to the surrounding cuticle.</title><p>3D rotation of Dumpy:YFP (green) and Ecadherin:mCherry (magenta) imaged live at 44 hr APF. Relevant structures labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), phallus (P), and anal plate (AP).</p></caption></media></fig-group><p>In late pupal wing development, Dumpy anchors the wing to the surrounding cuticle, holding this tissue in place, which is important to properly shape the wing (<xref ref-type="bibr" rid="bib14">Etournay et al., 2015</xref>; <xref ref-type="bibr" rid="bib47">Ray et al., 2015</xref>). This same mechanism has been hypothesized to also occur in the leg and antennae (<xref ref-type="bibr" rid="bib47">Ray et al., 2015</xref>), however, in the posterior lobe we do not find discrete anchorage points to the cuticle. Instead, we observed a large bundle of Dumpy emanating from the anal plate (also known as the cercus <xref ref-type="bibr" rid="bib52">Rice et al., 2019</xref>) and connecting with the pupal cuticle that encases the entire pupa (<xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3</xref>, <xref ref-type="video" rid="fig4video2">Figure 4—video 2</xref>; <xref ref-type="bibr" rid="bib3">Bainbridge and Bownes, 1981</xref>). This bundle does not come in direct contact with posterior lobe associated Dumpy or other nearby structures such as the lateral plate, clasper, sheath, or phallus, suggesting that if Dumpy is contributing to posterior lobe evolution and morphogenesis, this likely occurs through a mechanism which does not depend on a direct mechanical linkage with the overlying pupal cuticle.</p><p>To investigate the role that Dumpy may play in posterior lobe morphogenesis, we examined its localization throughout development. Prior to posterior lobe development, future cells of the lobe lack apically localized Dumpy, and yet an intricate network associated with the presumptive clasper is observed (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). However, from the early stages of posterior lobe development, as it first protrudes from the lateral plate, we observe large deposits of Dumpy associated with future lobe cells (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). These deposits persist throughout its development (<xref ref-type="fig" rid="fig4">Figure 4</xref>), becoming more restricted to the distal tip of the posterior lobe towards the end of its formation (<xref ref-type="fig" rid="fig4">Figure 4 D2</xref>). Across all timepoints, the posterior lobe associated Dumpy population is connected to the complex network of Dumpy attached to more medial structures such as the sheath and phallus (<xref ref-type="fig" rid="fig4">Figure 4 A2–D2</xref>), indicating that the posterior lobe is interconnected via the aECM with nearby structures (<xref ref-type="fig" rid="fig4">Figure 4</xref>). In contrast to the posterior lobe, the lateral plate has minimal Dumpy associated with it (<xref ref-type="fig" rid="fig4">Figure 4 A1–D1</xref>). Only when we oversaturate the Dumpy:YFP signal can we observe a weak population of Dumpy associated with the lateral plate (<xref ref-type="fig" rid="fig4s4">Figure 4—figure supplement 4</xref>). Together, this indicates that the cells of the posterior lobe and the lateral plate substantially differ in the levels of associated Dumpy, suggesting a potential role in the morphogenesis of the posterior lobe.</p></sec><sec id="s2-5"><title>Expansion of <italic>dumpy</italic> expression is correlated with the evolution of the posterior lobe</title><p>The association of the posterior lobe with Dumpy suggests that changes in its expression pattern may have occurred during evolution of the lobe. To test if posterior lobe-associated Dumpy is a unique feature of species which produce a posterior lobe, we compared the spatial distribution of its mRNA in <italic>D. melanogaster</italic> with <italic>D. biarmipes,</italic> a species which lacks this structure. Early in pupal genital development at 32 hr APF, we observe very similar expression patterns of <italic>dumpy</italic> between <italic>D. melanogaster</italic> and <italic>D. biarmipes</italic> with expression at the base of the presumptive lateral plate-clasper (<xref ref-type="fig" rid="fig5">Figure 5A–B</xref>, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). From 36 to 40 hr APF, when the posterior lobe begins to develop, this pattern becomes restricted to a small region at the base of the lateral plate and clasper, near the anal plate in <italic>D. biarmipes</italic>, but is expanded in <italic>D. melanogaster</italic> (<xref ref-type="fig" rid="fig5">Figure 5A–B</xref>, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). By 44 hr APF, expression of <italic>dumpy</italic> is reduced in the posterior lobe, as well as in non-lobed species, with strongest expression associated with the clasper in <italic>D. biarmipes</italic> (<xref ref-type="fig" rid="fig5">Figure 5A–B</xref>, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). Overall, these results indicate that expression of <italic>dumpy</italic> is expanded in a lobed species and correlates with the developmental timing of the posterior lobe’s formation.</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>aECM is spatially expanded in lobed species compared to non-lobed species.</title><p>(<bold>A–B</bold>) in situ hybridization for <italic>dumpy</italic> mRNA in the lobed species <italic>D. melanogaster</italic> (<bold>A</bold>) and the non-lobed species <italic>D. biarmipes</italic> (<bold>B</bold>). Pink box outlines location of zoomed in images presented in A1 and B1. Relevant expression highlighted with arrow (purple/white) for strong expression, asterisk for weak expression, and arrowhead for clasper-specific expression. Expression observed in <italic>D. melanogaster</italic> at 44 hr APF is not present in all samples (see <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). (<bold>C–D</bold>) aECM is labeled with <italic>Vicia villosa</italic> lectin (VVA; green) and apical membrane labeled with E-cadherin (Ecad; magenta) at 44 hr APF in <italic>D. melanogaster</italic> (<bold>C</bold>) and <italic>D. biarmipes</italic> (<bold>D</bold>). Location of respective cross sections indicated in yellow for lateral plate (<bold>C2–D2</bold>) and blue for posterior lobe in <italic>D. melanogaster</italic> (<bold>C1</bold>) and corresponding position in <italic>D. biarmipes</italic> (<bold>D1</bold>). All cross-sections are oriented with apical side at the top and basal side at the bottom. White arrows highlight the crevice localization between the lateral plate and clasper, which the aECM fills in <italic>D. melanogaster</italic> (<bold>C1</bold>), but only a weakly stained strand-like structure of aECM appears in <italic>D. biarmipes</italic> (<bold>D1</bold>). Tendrils of aECM can also be observed connecting to the lateral plate in both species (red arrowheads). Relevant structures labeled: Posterior lobe (PL), lateral plate (LP), clasper (C), sheath (S), and phallus (P). Scale bar, 20 μm. n = at least five per experiment.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig5-v2.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>aECM spatially expanded in lobed species compared to non-lobed species.</title><p>(<bold>A–B</bold>) Additional in situ hybridization samples for <italic>dumpy</italic> mRNA in lobed species <italic>D. melanogaster</italic> (<bold>A</bold>) and non-lobed species <italic>D. biarmipes</italic> (<bold>B</bold>) to show full range of expression observed in experiment. Outlines are approximations as details of structures. Samples without outlines on one side are due to the tissue being damaged on that side. Green circle in first image highlights relevant location at the base of the lateral plate, but not included in the remaining images to leave images unobstructed. Asterisk indicates the expression is deep in the sample and not expressed in lateral plate or clasper cells. n = 4 per experiment.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig5-figsupp1-v2.tif"/></fig><fig id="fig5s2" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 2.</label><caption><title>VVA staining mimics Dumpy:YFP localization.</title><p>(<bold>A</bold>) Dumpy:YFP (green) or (<bold>B</bold>) VVA (green) localization with apical membrane labeled with E-cadherin (Ecad; magenta) at 44 hr APF in <italic>D. melanogaster</italic>. Gross similarities in the structure of Dumpy:YFP and VVA can be observed across the genitalia (A’ and B’). In addition, both Dumpy:YFP and VVA can be observed spanning from the clasper to the sheath (arrow), creating an region where neither is present (asterisks). Some tissue deformation occurs in the VVA samples due to treatment with trichloroacetic acid, which is used to help precipitate the sugar molecules attached to the ECM and give a more refined appearance. All cross-sections are oriented with apical side at the top and basal side at the bottom. Relevant structures labeled: Posterior lobe (PL), clasper (C), and sheath (S), Scale bar, 20 μm. n = at least five per experiment.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig5-figsupp2-v2.tif"/></fig><fig id="fig5s3" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 3.</label><caption><title>aECM is expanded in the lobed <italic>D. sechellia</italic> but not in the non-lobed species <italic>D. ananassae.</italic></title><p>(<bold>A–B</bold>) aECM labeled with VVA (green) and apical membrane labeled with E-cadherin (Ecad; magenta) at 40 hr APF in the lobed species <italic>D. sechellia</italic> (<bold>A</bold>) and the non-lobed species <italic>D. ananassae</italic> (<bold>B</bold>). Location of respective cross-sections indicated in yellow for lateral plate and blue for posterior lobe. In <italic>D. sechellia</italic> a ‘strand’ of VVA can be observed connecting the clasper to the lateral plate (<bold>A1</bold>), in addition to a large accumulation of VVA associated with the poster lobe (<bold>A2</bold>), similar to what is observed in <italic>D. melanogaster.</italic> (<bold>B1</bold>) Top cross-section displayed with normal brightness to show details and bottom cross-section has been brightened to show where all populations of aECM are located. All cross-sections are oriented with apical side at the top and basal side at the bottom. White arrow highlights the ‘crevice’ between the lateral plate and clasper, which is not pronounced at 40 hr APF in <italic>D. ananassae</italic>. Relevant structures labeled: lateral plate (LP), posterior lobe (PL), and clasper (C). Scale bar, 20 μm. n = at least two per experiment.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig5-figsupp3-v2.tif"/></fig></fig-group><p>Although, it appears that the expression of <italic>dumpy</italic> has expanded in <italic>D. melanogaster</italic>, Dumpy is an extracellular protein, and cells expressing its mRNA may not correlate with its ultimate protein abundance or localization. Since an antibody for Dumpy is not available, we adapted lectin staining protocols which can detect glycosylated proteins like Dumpy in order to compare the distribution of aECM in species which lack posterior lobes. We found that fluorescein conjugated <italic>Vicia villosa</italic> lectin (VVA), which labels <italic>N</italic>-acetylgalactosamine (<xref ref-type="bibr" rid="bib60">Tian and Ten Hagen, 2007</xref>), roughly mirrors the complex three-dimensional shape of the Dumpy aECM network covering the center of the genitalia and strongly associates with the posterior lobe (<xref ref-type="fig" rid="fig5">Figure 5C</xref>, <xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>). When we examined VVA in the non-lobed species <italic>D. biarmipes</italic>, we observed strong VVA signal over the center of the genitalia with weak connections to the tip of the lateral plate, similar to what we observe in <italic>D. melanogaster</italic> (<xref ref-type="fig" rid="fig5">Figure 5C–D</xref>). In contrast, where the presumptive posterior lobe would form, we only found a weak strand-like structure emanating from the clasper and connecting to the crevice between the lateral plate and clasper (<xref ref-type="fig" rid="fig5">Figure 5D1</xref>). These results correlate with our <italic>dumpy</italic> in situ hybridization results, where we observe high expression at the center of the genitalia and weak expression at the base between the clasper and lateral plate in <italic>D. biarmipes</italic>, which may be responsible for forming the weak aECM connection from the clasper to the clasper/lateral plate crevice. Further, we observed similar VVA patterns in non-lobed species <italic>D. ananassae</italic> (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3</xref>). In addition, in the lobed species, <italic>D. sechellia</italic>, we note a similar accumulation of VVA associated with the developing lobe as seen in <italic>D. melanogaster</italic> (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3</xref>), suggesting that this mechanism is common to other lobe-bearing species. Collectively, these data suggest that an ancestral aECM network exists on the developing genitalia, associated with the central genital structures, including the phallus, sheath, and clasper, and extends weak connections to the crevice between the lateral plate and clasper. During the course of evolution, expression of <italic>dumpy</italic> expanded to cells of the posterior lobe, creating prominent associations of the lobe cells with this ancestral aECM network.</p></sec><sec id="s2-6"><title>Dumpy is required for proper posterior lobe formation</title><p>Thus far, we observed a strong association of the aECM with cells that form the posterior lobe, an attribute which is much less pronounced in non-lobed species. To determine if Dumpy plays a role in posterior lobe formation, we next employed transgenic RNAi to knock down its expression. Previous studies of <italic>dumpy</italic> characterized a VDRC RNAi line that is effective at reducing its activity (<xref ref-type="bibr" rid="bib47">Ray et al., 2015</xref>). We used a driver from the <italic>Pox neuro</italic> gene (<xref ref-type="bibr" rid="bib6">Boll and Noll, 2002</xref>) to target the RNAi to posterior lobe cells. This resulted in a drastic decrease in the size of the posterior lobe and also caused changes to its shape (<xref ref-type="fig" rid="fig6">Figure 6</xref>). In <italic>dumpy</italic> knockdown, we observe a variable phenotype between the left and right posterior lobes, even within a single individual (<xref ref-type="fig" rid="fig6">Figure 6A</xref>; <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). Knockdown was completed at both 25°C and 29°C, as higher temperatures increase the efficacy of the Gal4/UAS system (<xref ref-type="bibr" rid="bib12">Duffy, 2002</xref>). At these higher temperatures, the <italic>dumpy</italic> knockdown phenotype trended towards more severe defects (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). Together, these results suggest that posterior lobe development is sensitive to levels of <italic>dumpy</italic>, and that <italic>dumpy</italic> plays a vital role in shaping the posterior lobe.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Dumpy is required for proper posterior lobe formation.</title><p>(<bold>A</bold>) Range of adult posterior lobe phenotypes produced by control (<italic>mCherry</italic> RNAi) and <italic>dumpy</italic> RNAi animals. Phenotypic classes defined from wild type (I) to most severe (V). Scale bar, 20 μm. (<bold>B</bold>) Percentage of posterior lobes in each class for control, <italic>dumpy</italic> RNAi at 25°C, and <italic>dumpy</italic> RNAi at 29°C. (<bold>C</bold>) Quantification of area of adult posterior lobes of <italic>mCherry</italic> RNAi (control) and <italic>dumpy</italic> RNAi at 25°C and 29°C. Statistical significance is indicated (unpaired t-test; ****p≤0.0001).</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>Individual measurements of <italic>dumpy</italic>-RNAi adult cuticle phenotypes.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-55965-fig6-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig6-v2.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Increased left-right variability of posterior lobe phenotype upon <italic>dumpy</italic> knockdown.</title><p>(<bold>A</bold>) Comparison of <italic>dumpy</italic> knockdown (purple circles) and control knockdown (green squares) of left and right adult posterior lobes in single individuals grown at 29°C measuring height at the ventral side of the posterior lobe (single individual represented as a single dot or square). Black line represents predicted perfect correlation in height. <italic>dumpy</italic> knockdown individuals appear less correlated, indicating that the height of the posterior lobe varies more in the <italic>dumpy</italic> knockdown. (<bold>B</bold>) Percentage of <italic>dumpy</italic> knockdown individuals plotted in (<bold>A</bold>) in which both posterior lobes were categorized into the same or different phenotypes classes (as defined in <xref ref-type="fig" rid="fig6">Figure 6</xref>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig6-figsupp1-v2.tif"/></fig></fig-group></sec><sec id="s2-7"><title>Correlation of Dumpy deposition and cell height in the posterior lobe</title><p>We next sought to determine when during development <italic>dumpy</italic> knockdown influences the morphogenetic progression of the posterior lobe. This was important because the posterior lobe emerges over 16 hr of development (<xref ref-type="fig" rid="fig1">Figure 1F</xref>), after which cells of the genital epithelium secrete a rigid cuticle, and any of these phases could represent a critical Dumpy-dependent stage of development. We found that <italic>dumpy</italic> knockdown individuals manifest phenotypes by the midpoint of posterior lobe development (<xref ref-type="fig" rid="fig7">Figure 7A</xref>) and continue to show abnormal lobe development through the end of its formation (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). Defects in posterior lobe development may occur earlier, but the exact ventral and dorsal boundaries of the posterior lobe are difficult to define for quantification purposes at early time points. Interestingly, while defects in cell height are observed on the dorsal side, we do not see differences in cell height in the ventral cells of the lobe (<xref ref-type="fig" rid="fig7">Figure 7A–B</xref>). This correlates with the phenotypes of adult <italic>dumpy</italic> knockdown individuals, which usually display a ventral tip of normal height with defects observed towards the dorsal side (<xref ref-type="fig" rid="fig6">Figure 6A</xref>).</p><fig-group><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Correlation between the deposition of Dumpy and knockdown phenotype.</title><p>(<bold>A–B</bold>) Comparison of <italic>mCherry</italic> RNAi (control) and <italic>dumpy</italic> RNAi at 44 hr APF (<bold>A</bold>) and 52 hr APF (<bold>B</bold>). Images are rotated in 3D to visualize the full shape of the posterior lobe labeled with E-cadherin (Ecad). Quantification of tissue height at the ventral tip (dark blue) and dorsal base (light blue) of the posterior lobe. Cartoon represents relative locations of cross-sections used for tissue thickness measurements. Individual data points presented; n = at least 10 per time point. The ventral tip is defined as the location where the posterior lobe is at its maximum height. The base was determined by moving 19.76 μm dorsally from the ventral tip. Statistical significance for each time point is indicated (unpaired t-test; ***p≤0.001; n.s. = not significant p≥0.05). (<bold>C–F</bold>) Comparison of <italic>mCherry</italic> RNAi (control) (C and E) and <italic>dumpy</italic> RNAi (D and F) at 44 hr APF and 52 hr APF labeled with with Dumpy:YFP (Green) and E-cadherin(Ecad; Magenta). GFP antibody was used to increase YFP signal. All cross-sections are oriented with apical side at the top and basal side at the bottom. Relevant structures labeled: Lateral plate (LP) posterior lobe (PL), and clasper (C). Cross-sections are max projections of 5.434 μm sections to show full Dumpy connection. Images were independently brightened to show relevant structures. Scale bar, 20 μm. n = at least five per experiment.</p><p><supplementary-material id="fig7sdata1"><label>Figure 7—source data 1.</label><caption><title>Individual measurements of <italic>dumpy</italic>-RNAi effects on the posterior lobe during its development.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-55965-fig7-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig7-v2.tif"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 1.</label><caption><title>Variability in height of adult posterior lobe in <italic>dumpy</italic> knockdown.</title><p>Comparison of <italic>mCherry</italic> RNAi (control) and <italic>dumpy</italic> RNAi adults. Quantification of height of cuticle at the ventral side of the posterior lobe. (unpaired t-test; ***p≤0.001; ****p≤0.0001; n ≥ 28).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig7-figsupp1-v2.tif"/></fig><fig id="fig7s2" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 2.</label><caption><title>Remaining strands of Dumpy in <italic>dumpy</italic> knockdown.</title><p>(<bold>A and B</bold>) <italic>dumpy</italic> RNAi at 44 hr APF with Dumpy:YFP (green) and apical membrane labeled with E-cadherin (Ecad; magenta) showing strands of Dumpy connecting to the crevice between the lateral plate and clasper (arrow). Relevant structures labeled: Lateral plate (LP) posterior lobe (PL), and clasper (C). Cross-sections are max projection of 5.434 μm section to show full Dumpy connection. Scale bar, 20 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig7-figsupp2-v2.tif"/></fig><fig id="fig7s3" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 3.</label><caption><title>Correlation between VVA signal and <italic>dumpy</italic> knockdown phenotype.</title><p>Comparison of <italic>mCherry</italic> RNAi (control) (<bold>A</bold>) and <italic>dumpy</italic> RNAi (B and C) at 44 hr APF with VVA (Green) and E-cadherin (Ecad; Magenta). All cross-sections are oriented with apical side at the top and basal side at the bottom. Relevant structures labeled: posterior lobe (PL) and clasper (C). Cross-sections are max projections of 5.434 μm sections to show full Dumpy connection. Images were independently brightened to show relevant structures. Scale bar, 20 μm. n = 3 per experimental condition.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig7-figsupp3-v2.tif"/></fig></fig-group><p>Why would dorsal cells of the posterior lobe be more affected in a <italic>dumpy</italic> knockdown? We hypothesized that our posterior lobe specific driver is not strong enough to remove all deposits of Dumpy associated with the posterior lobe. To better understand this, we examined Dumpy:YFP localization in the <italic>dumpy</italic> knockdown background, in which both <italic>dumpy</italic> and <italic>dumpy:yfp</italic> should be targeted by the RNAi treatment. In the <italic>dumpy</italic> RNAi background, we observed an association of Dumpy:YFP with the tallest cells on the ventral side of the posterior lobe in both mid (<xref ref-type="fig" rid="fig7">Figure 7D</xref> n = 5/5 samples) and late (<xref ref-type="fig" rid="fig7">Figure 7F</xref> n = 4/5 samples) stages of development compared to control animals. In contrast, no Dumpy was observed in contact with the shorter cells on the dorsal side (<xref ref-type="fig" rid="fig7">Figure 7D</xref> and F n = 5/5 samples). In addition, it should be noted that one of our late samples lacks a Dumpy connection to the ventral cells, correlating with our observation that not all adult samples are fully extended on the ventral side (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). Furthermore, we also observed highly variable strands of Dumpy:YFP in the middle of the lobe (between the ventral and dorsal sides) (<xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2</xref>). These strands visually resembled the weak strands of VVA observed in <italic>D. biarmipes</italic> (<xref ref-type="fig" rid="fig5">Figure 5D</xref>), in that they emanate from the clasper and connect to the crevice between the posterior lobe and clasper, indicating that this ‘strand’ like connection in the crevice alone is not able to elongate cells.</p><p>To further confirm the effect of aECM in the <italic>dumpy</italic> knockdown background, we examined VVA during mid stages of development when defects in posterior lobe formation are evident. We observed a single thin strand of VVA at the ventral tip (<xref ref-type="fig" rid="fig7s3">Figure 7—figure supplement 3</xref> n = 3/3) in <italic>dumpy</italic> knockdown individuals. In addition, no VVA was observed at the dorsal side of the posterior lobe (<xref ref-type="fig" rid="fig7s3">Figure 7—figure supplement 3</xref> n = 2/3), with exception of one sample where a small strand of VVA was observed (<xref ref-type="fig" rid="fig7s3">Figure 7—figure supplement 3C</xref> n = 1/3). This small tether correlates with dorsal spikes observed in some adult individuals (<xref ref-type="fig" rid="fig6">Figure 6</xref>). Overall, these data demonstrate that the most pronounced phenotypic defects manifest in regions with the strongest reduction in Dumpy deposition, implying that Dumpy’s presence is required for posterior lobe cells to elongate and project from the lateral plate.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Here, we investigated how a morphological novelty forms at the cellular level, and in doing so, revealed distinctive cell and aECM interactions underlying its development and evolution. We identified how an extreme change in the shape of cells in the developing posterior lobe accounts for its novel morphology. While intrinsic cytoskeletal components appear to contribute to this process, our results indicate a critical role played by a vast extrinsic network of ECM on the apical side of the epithelium. It was unexpected that such an elaborate supercellular matrix structure would participate in the evolution of a novel morphological structure. Below, we consider the potential roles played by the aECM in posterior lobe development and diversification, and discuss how studies of morphogenesis can illuminate the simple origins of structures that might otherwise seem impossibly complex to evolve.</p><sec id="s3-1"><title>Mechanisms for aECM-mediated control of cell height in the posterior lobe</title><p>Our work demonstrates an important role for the aECM protein Dumpy in the development of the posterior lobe, as exhibited by the dramatic phenotypes in the <italic>dumpy</italic> RNAi background and the strong association of Dumpy:YFP with only the tallest cells in these experiments. The presence of Dumpy:YFP at the ventral tip of the defective posterior lobe in <italic>dumpy</italic> RNAi individuals indicated that our driver does not supply sufficient RNAi in ventral tip cells to remove all of the Dumpy-YFP, though a strong reduction in florescence is observed at the ventral tip. We hypothesize that this ventral tip would not fully form if Dumpy is completely removed, however, we currently do not have a driver that can test this prediction.</p><p>Overall, our data are consistent with three possible mechanisms that could allow Dumpy to regulate cell height. First, Dumpy could serve as a structural support while autonomous cell mechanical processes drive apico-basal elongation, such as by altering the cytoskeleton, which is observed in posterior lobe cells. Second, the cells of the posterior lobe could be pulled mechanically through their connection to the Dumpy aECM. This process could operate passively, deforming cells of the lobe, but could also drive changes in the cytoskeleton in response to external tensions. Finally, the aECM could alter cell signaling dynamics, as has been exhibited by the basal ECM (<xref ref-type="bibr" rid="bib26">Kirkpatrick et al., 2004</xref>; <xref ref-type="bibr" rid="bib28">Kreuger et al., 2004</xref>; <xref ref-type="bibr" rid="bib65">Wang et al., 2008</xref>). Previous research has shown that the JAK/STAT pathway is important for posterior lobe development (<xref ref-type="bibr" rid="bib17">Glassford et al., 2015</xref>), and the ability for a signal to reach its target cells could be altered in the absence of Dumpy. Of course, these models are not mutually exclusive and some combination of these mechanisms may be integrated to shape the posterior lobe. Our observations of increased cytoskeletal components in posterior lobe cells and the reduced height of cells that lack Dumpy in our knockdown experiments are consistent with all three mechanisms, which are difficult to differentiate experimentally.</p></sec><sec id="s3-2"><title>The role of aECM in the diversification of genital structures</title><p>Genitalia represents some of the most rapidly diversifying structures in the animal kingdom, and our results suggest the aECM may participate in the modification of <italic>Drosophila</italic> genital structures. The shape of the posterior lobe is extremely diverse among species of the <italic>melanogaster</italic> clade (<xref ref-type="bibr" rid="bib8">Coyne, 1989</xref>). We confirmed that the extended posterior lobe of <italic>D. sechellia</italic> is associated with a similar aECM to <italic>D. melanogaster</italic> (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3</xref>), confirming that this mechanism is likely common to other lobed species. Our results demonstrate that reducing the levels of Dumpy can affect the shape of the posterior lobe, with extreme knockdown phenotypes approximating the posterior lobe of <italic>D. mauritiana</italic>. Furthermore, the sheath and phallus show dense deposits of Dumpy, suggesting that the aECM could play important roles in diversifying these remarkably variable structures. During the course of evolution, one could imagine that by altering which cells are connected to the aECM, the physical nature of those connections, and the mechanical properties of those cells and/or their associated ECM could lead to changes in morphological shape. Hence, identifying genes that have evolved to differentiate these structures could uncover novel mechanisms for genetically controlling the behavior of this aECM and behaviors of cells bound to this dynamic scaffold.</p></sec><sec id="s3-3"><title>Integrating cells into a pre-existing aECM network to generate morphological novelty</title><p>Evolution is thought to act through the path of least resistance. When confronted with the remarkable diversity of genital morphologies present in insects, one must wonder how the intricate projections, bumps, and divots form through the action of epithelial rudiments. Traditionally the field of evo-devo research has focused on cell intrinsic processes that contribute to tissue morphogenesis, but here we show that the extrinsic forces from the aECM may be important for the evolution of a novelty. The aECM, while understudied, has been implicated in the morphogenesis of many structures (<xref ref-type="bibr" rid="bib2">Bailles et al., 2019</xref>; <xref ref-type="bibr" rid="bib10">Diaz-de-la-Loza et al., 2018</xref>; <xref ref-type="bibr" rid="bib11">Dong et al., 2014</xref>; <xref ref-type="bibr" rid="bib14">Etournay et al., 2015</xref>; <xref ref-type="bibr" rid="bib15">Fernandes et al., 2010</xref>; <xref ref-type="bibr" rid="bib20">Heiman and Shaham, 2009</xref>; <xref ref-type="bibr" rid="bib35">Low et al., 2019</xref>; <xref ref-type="bibr" rid="bib42">Münster et al., 2019</xref>; <xref ref-type="bibr" rid="bib47">Ray et al., 2015</xref>; <xref ref-type="bibr" rid="bib54">Rosa et al., 2018</xref>), making it a promising target for evolution. We find a conserved aECM network associated with central genital structures (clasper, sheath, and phallus) in both lobed and non-lobed species. However, on the dorsal side of the lateral plate we observed differences, with lobed species having substantial deposits of aECM that fill this area between the lateral plate and clasper and non-lobed species forming only thin strand-like connections (<xref ref-type="fig" rid="fig8">Figure 8</xref>). Because a complex network of aECM already existed on the genitalia to potentially pattern other structures, such as the phallus and its multiple elaborations (<xref ref-type="bibr" rid="bib24">Kamimura, 2010</xref>; <xref ref-type="bibr" rid="bib45">Peluffo et al., 2015</xref>; <xref ref-type="bibr" rid="bib52">Rice et al., 2019</xref>), we hypothesize that this spatial expansion of aECM to the posterior lobe cells allowed them to be integrated into the ancestral aECM network (<xref ref-type="fig" rid="fig8">Figure 8</xref>), a step which was likely significant to its evolution. Overall, this suggests that the aECM could be an unexpected target for generating novel anatomical structures. On the other hand, tissues which lack such an ancestral aECM network may be less likely to evolve projections through this mechanism. In addition, while Dumpy may be required for the development of the posterior lobe, additional components of the aECM, including factors that remodel the aECM or receptors that anchor the aECM to the cells, are likely also needed. Furthermore, we envision that additional processes may also be contributing to the full morphogenesis of the posterior lobe, including potential intrinsic processes that may contribute to the cell shape changes we observe, such as the elevated concentrations of cytoskeletal components (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><fig-group><fig id="fig8" position="float"><label>Figure 8.</label><caption><title>Expansion of aECM associated with the evolution of a morphological novelty.</title><p>(Top) Illustration of non-lobed species, <italic>D. biarmipes</italic>, with ancestral aECM network covering central genital structures (2B) including the clasper (C), sheath, and phallus. Weak connections of aECM span from the clasper to the lateral plate (LP) during early development (1 and 2A - top). (Bottom) Illustration of lobed species, <italic>D. melanogaster</italic>. The aECM network has expanded to fill the crevice between the lateral plate and clasper (1-bottom) integrating these cells into the ancestral aECM network (2-bottom). This aECM population is needed for cells to properly project from the lateral plate, forming the posterior lobe.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig8-v2.tif"/></fig><fig id="fig8s1" position="float" specific-use="child-fig"><label>Figure 8—figure supplement 1.</label><caption><title>Dumpy anchors posterior spiracles to surrounding cuticle.</title><p>Live imaging of Dumpy:YFP (green) and Armadillo:GFP (ARM:GFP; magenta) in the embryonic posterior spiracles. Posterior spiracle (dotted line) is connected to the cuticle (arrowhead) via a tether of dumpy (arrow). Scale bar, 10 μm. n = 4.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-55965-fig8-figsupp1-v2.tif"/></fig></fig-group><p>The expanded <italic>dumpy</italic> expression we discovered caused us to consider how the posterior lobe gained this aECM attachment. Models of gene network co-option have been appealing because they establish pre-existing mechanisms in place that can be rapidly ported to new locations to generate massive changes in a tissue. Interestingly, our previous work uncovered a gene regulatory network (GRN) that regulates development of an ancestral embryonic structure, the posterior spiracles, which was co-opted during the evolution of the posterior lobe and regulates its development (<xref ref-type="bibr" rid="bib17">Glassford et al., 2015</xref>). Along these lines, <italic>dumpy</italic> is expressed in the developing posterior spiracles (<xref ref-type="bibr" rid="bib67">Wilkin et al., 2000</xref>), and we have observed a thin strand of Dumpy:YFP connecting the posterior spiracles to the surrounding embryonic cuticle, known as the vitelline membrane (<xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>; <xref ref-type="bibr" rid="bib38">Margaritis et al., 1980</xref>). Identification of regulatory elements which activate <italic>dumpy</italic> in the posterior lobe will be necessary to determine whether its role in the posterior spiracle was relevant to the evolution of expanded genital expression.</p><p>Identifying the genetic changes that regulate cellular processes required for the evolution of new structures represents a major looming challenge in evo-devo research. Taken as a whole, the posterior lobe offers a promising model to begin to understand how gene regulatory networks and terminal effectors are connected, in addition to understanding how these networks become associated with novelties during evolution. As our understanding of the patterning of these tissues both at the level of transcriptional regulators (<xref ref-type="bibr" rid="bib61">Vincent et al., 2019</xref>) and terminal effectors (such as Dumpy) becomes more complete, we can begin to connect the regulation of gene expression with the developmental behaviors of different cell types. The mapping of regulatory enhancers through reporter assays will allow us to trace the evolutionary history of these connections (<xref ref-type="bibr" rid="bib17">Glassford et al., 2015</xref>). Furthermore, in systems where sophisticated genetic modifications are possible, CRISPR/Cas9 can be used to test the phenotypic consequences of genetic variation in these regulatory enhancers by exchanging regions between species (<xref ref-type="bibr" rid="bib68">Xu et al., 2017a</xref>). Coupling such manipulations to quantitative measures of morphogenesis will illuminate the root causes of differences in tissue architecture (<xref ref-type="bibr" rid="bib57">Smith et al., 2018</xref>).</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type <break/>(species) or resource</th><th valign="top">Designation</th><th valign="top">Source or reference</th><th valign="top">Identifiers</th><th valign="top">Additional information</th></tr></thead><tbody><tr><td valign="top">Antibody</td><td valign="top">Monoclonal rat anti-alpha tubulin (tyrosinated)</td><td valign="top">MilliporeSigma</td><td valign="top">Millipore Cat# MAB1864, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2210391">AB_2210391</ext-link></td><td valign="top">IHC (1:500)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Monoclonal mouse anti-alpha tubulin (acetylated)</td><td valign="top">Sigma-Aldrich</td><td valign="top">Sigma-Aldrich Cat# T6793, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_477585">AB_477585</ext-link></td><td valign="top">IHC (1:500)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Monoclonal rat anti-Ecadherin</td><td valign="top">DSHB</td><td valign="top">DSHB Cat# DCAD2, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_528120">AB_528120</ext-link></td><td valign="top">IHC (1:500)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Monoclonal mouse anti-Fasciclin III</td><td valign="top">DSHB</td><td valign="top">DSHB Cat# 7G10 anti-Fasciclin III, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_528238">AB_528238</ext-link></td><td valign="top">IHC (1:500)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Polyclonal rabbit anti-histone H3 (phospho S10)</td><td valign="top">Abcam</td><td valign="top">Abcam Cat# ab5176, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_304763">AB_304763</ext-link></td><td valign="top">IHC (1:50)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Polyclonal goat anti-GFP</td><td valign="top">Abcam</td><td valign="top">Abcam Cat# ab6662, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_305635">AB_305635</ext-link></td><td valign="top">IHC (1:300)</td></tr><tr><td valign="top">Lectin</td><td valign="top">fluoresceinVicia Villosa Lectin (VVA)</td><td valign="top">Vector Laboratories</td><td valign="top">Vector Laboratories Cat# FL-1231, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2336856">AB_2336856</ext-link></td><td valign="top">IHC (1:200)</td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">rhodamine phalloidin</td><td valign="top">Thermo Fisher Scientific</td><td valign="top">Thermo Fisher Scientific Cat# R415, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2572408">AB_2572408</ext-link></td><td valign="top">IHC (1:200)</td></tr><tr><td valign="top">Strain, strain background (<italic>Drosophila melanogaster</italic>)</td><td valign="top">y<sup>1</sup>w<sup>1</sup><italic>Drosophila melanogaster</italic></td><td valign="top">Bloomington<italic>Drosophila</italic>Stock Center</td><td valign="top">BDSC Cat# 1495, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/BDSC_1495">BDSC_1495</ext-link></td><td valign="top"/></tr><tr><td valign="top">Strain, strain background (<italic>Drosophila biarmipes</italic>)</td><td valign="top">wild type</td><td valign="top">National<italic>Drosophila</italic>Species Stock Center (NDSSC)</td><td valign="top">NDSSC Stock #:14023–0361.10 <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/FlyBase_FBst0203870">FlyBase_FBst0203870</ext-link></td><td valign="top"/></tr><tr><td valign="top">Strain, strain background (<italic>Drosophila ananassae</italic>)</td><td valign="top">wild type</td><td valign="top">National<italic>Drosophila</italic>Species Stock Center (NDSSC)</td><td valign="top">NDSSC Stock #:14024–0371.13 <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/FlyBase_FBst0201380">FlyBase_FBst0201380</ext-link></td><td valign="top">No longer available</td></tr><tr><td valign="top">Strain, strain background (<italic>Drosophila pseudoobscura</italic>)</td><td valign="top">wild type</td><td valign="top">National<italic>Drosophila</italic>Species Stock Center (NDSSC)</td><td valign="top">NDSSC Stock #:14011–0121.87 <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/FlyBase_FBst0200074">FlyBase_FBst0200074</ext-link></td><td valign="top">No longer available</td></tr><tr><td valign="top">Strain, strain background (<italic>Drosophila sechellia</italic>)</td><td valign="top">Wild type</td><td valign="top">National<italic>Drosophila</italic>Species Stock Center (NDSSC)</td><td valign="top">NDSSC Stock #: #14021–0248.03 <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/FlyBase_FBst0201190">FlyBase_FBst0201190</ext-link></td><td valign="top">No longer available</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top"><italic>UAS</italic>-Raeppli-CAAX</td><td valign="top">Bloomington <italic>Drosophila</italic> <break/>Stock Center (BDSC)</td><td valign="top">BDSC Cat# 55084, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/BDSC_55084">BDSC_55084</ext-link></td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top"> <italic>Pox neuro-Gal4</italic></td><td valign="top">(<xref ref-type="bibr" rid="bib6">Boll and Noll, 2002</xref>)</td><td valign="top"/><td valign="top">Construct #13</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top"><italic>D. simulans Pox neuro</italic>-Gal4</td><td valign="top">This paper</td><td valign="top"/><td valign="top">Can be obtained from Mark Rebeiz,<ext-link ext-link-type="uri" xlink:href="https://rebeiz@pitt.edu">rebeiz@pitt.edu</ext-link></td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">hs – flippase<sup>122</sup></td><td valign="top">Gift from Erika A. Bach</td><td valign="top">Flybase: FBtp0001101</td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top"><italic>armadillo-GFP</italic></td><td valign="top">(<xref ref-type="bibr" rid="bib22">Huang et al., 2012</xref>)</td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Dumpy:YFP</td><td valign="top"><italic>Drosophila</italic> Genomics and Genetic Resources</td><td valign="top">DGGR Cat# 115238, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/DGGR_115238">DGGR_115238</ext-link></td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Viking:GFP</td><td valign="top"><italic>Drosophila</italic> Genomics and Genetic Resources</td><td valign="top">DGGR Cat# 110626, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/DGGR_110626">DGGR_110626</ext-link></td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Perlecan:GFP</td><td valign="top"><italic>Drosophila</italic> Genomics and Genetic Resources</td><td valign="top">DGGR Cat# 110807, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/DGGR_">DGGR_</ext-link> 110807</td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">E-cadherin:mCherry</td><td valign="top">Bloomington <italic>Drosophila</italic> stock center</td><td valign="top">BDSC Cat# 59014, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/BDSC_59014">BDSC_59014</ext-link></td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top"><italic>UAS</italic>-dumpyRNAi</td><td valign="top">Vienna<italic>Drosophila</italic>Resource Center</td><td valign="top">VDRC Cat#44029, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/FlyBase_FBst0465370">FlyBase_FBst0465370</ext-link></td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top"><italic>UAS</italic>-mCherryRNAi</td><td valign="top">Bloomington <italic>Drosophila</italic> stock center</td><td valign="top">BDSC Cat# 35785, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/BDSC_35785">BDSC_35785</ext-link></td><td valign="top"/></tr><tr><td valign="top">Recombinant <break/>DNA reagent</td><td valign="top">pS3aG4</td><td valign="top">Gift from Benjamin Prud'homme</td><td valign="top"/><td valign="top">Gal4 vector used to make <italic>D. simulans Pox neuro</italic> gal4 line</td></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top"><named-content content-type="sequence">GCCACTAACAATCCATGCGGTT</named-content></td><td valign="top">This paper</td><td valign="top"/><td valign="top"><italic>dumpy</italic> probe forward primer. Obtained from Integrated DNA Technologies.</td></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top"><named-content content-type="sequence">TAATACGACTCACTATAGGGAGAAATAGCCCTGTCCTTGGAATCC</named-content></td><td valign="top">This paper</td><td valign="top"/><td valign="top"><italic>dumpy</italic> probe reverse primer with T7 primer. Obtained from Integrated DNA Technologies.</td></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top"><named-content content-type="sequence">TTCCGGGCGCGCCTCGGTGGCTTAACACGCGCATT</named-content></td><td valign="top">This paper</td><td valign="top"/><td valign="top"><italic>D. simulans Pox neuro</italic> forward primer for gal four line. Obtained from Integrated DNA Technologies.</td></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top"><named-content content-type="sequence">TTGCCCCTGCAGGATCGCTGATTCCATGGCCCAGT</named-content></td><td valign="top">This paper</td><td valign="top"/><td valign="top"><italic>D. simulans Pox neuro</italic> reverse primer for gal four line. Obtained from Integrated DNA Technologies.</td></tr><tr><td valign="top">Software algorithm</td><td valign="top">Fiji (ImageJ v2.0)</td><td valign="top">(<xref ref-type="bibr" rid="bib55">Schindelin et al., 2012</xref>)</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_002285">SCR_002285</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software algorithm</td><td valign="top">GenePalette</td><td valign="top">(<xref ref-type="bibr" rid="bib50">Rebeiz and Posakony, 2004</xref>; <xref ref-type="bibr" rid="bib56">Smith et al., 2017</xref>)</td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Software algorithm</td><td valign="top">Leica Application Suite X</td><td valign="top">Leica</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_013673">SCR_013673</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software algorithm</td><td valign="top">Microsoft Excel</td><td valign="top">Microsoft</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_016137">SCR_016137</ext-link></td><td valign="top"/></tr><tr><td valign="top">Software algorithm</td><td valign="top">MorphoGraphX</td><td valign="top">(<xref ref-type="bibr" rid="bib4">Barbier de Reuille et al., 2015</xref>)</td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Software algorithm</td><td valign="top">Prism 8</td><td valign="top">GraphPad</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_002798">SCR_002798</ext-link></td><td valign="top"/></tr></tbody></table></table-wrap><sec id="s4-1"><title>Fly stocks and genetics</title><p>Fly stocks were reared using standard culture conditions. Wild type species used in this study were obtained from the University of California, San Diego <italic>Drosophila</italic> Stock Center (now known as The National <italic>Drosophila </italic>Species Stock Center at Cornell University) (<italic>Drosophila biarmipes</italic> #14024–0361.10, <italic>Drosophila ananassae</italic> #14024–0371.13, <italic>Drosophila pseudoobscura</italic> #14011–0121.87) and from the Bloomington <italic>Drosophila </italic>Stock Center (<italic>Drosophila melanogaster</italic> [<italic>y</italic><sup>1</sup><italic>w</italic><sup>1</sup>] #1495). <italic>Pox neuro</italic>-Gal4 (construct #13) was obtained from Werner Boll (<xref ref-type="bibr" rid="bib6">Boll and Noll, 2002</xref>). The following were obtained from the Bloomington<italic>Drosophila</italic>stock center: <italic>UAS</italic>-Raeppli-CAAX (#55084), <italic>armadillo-GFP</italic> (#8556), Ecadherin:mCherry (#59014), and <italic>UAS</italic>-mCherryRNAi (control for RNAi experiments, as mCherry is not present in the <italic>Drosophila</italic> genome) (#35785). <italic>UAS</italic>-<italic>dumpy-</italic>RNAi was obtained from the Vienna <italic>Drosophila </italic>Resource Center (#44029) and Dumpy:YFP was obtained from the <italic>Drosophila </italic>Genomics and Genetic Resources (#115238).</p><p>For the Raeppli experiments, stable lines of hs-flippase;;<italic>UAS</italic>-Raeppli-CAAX/<italic>UAS</italic>-Raeppli-CAAX and <italic>D. simulans Pox neuro</italic>-gal4/<italic>D. simulans Pox neuro</italic>-Gal4;<italic>UAS</italic>-Raeppli-CAAX/<italic>UAS</italic>-Raeppli-CAAX were generated. <italic>D. simulans Pox neuro</italic>-Gal4 was used as opposed to <italic>Pox neuro</italic>-Gal4 because a Gal4 driver on the second chromosome was required. Virgin females from the first line were crossed to males from the second line to ensure hs-flippase was inherited by all offspring. Offspring were collected and grown as normal, heat shocked at 37°C for 1 hr around 24 to 28 hr APF, and allowed to finish development at 25°C. Although this system is designed to label cells with multiple colors (<xref ref-type="bibr" rid="bib25">Kanca et al., 2014</xref>), we could only detect mTFP1 in heat-shocked tissues which we suspect is caused by insufficient activation of the other fluorescent reporters to detectible levels.</p></sec><sec id="s4-2"><title>Sample preparation</title><p>Pupal samples were prepared following the protocol in <xref ref-type="bibr" rid="bib17">Glassford et al. (2015)</xref>. Briefly, samples were incubated at 25°C unless otherwise noted (<xref ref-type="bibr" rid="bib17">Glassford et al., 2015</xref>). Dissections were performed in cold PBS, pupae were cut in half, removed from their pupal cases, and fat bodies removed by flushing, leaving the genitalia connected to the surrounding pupal cuticle. Larval samples were dissected in cold PBS by cutting the larva in half, and flipping the posterior end of the larva inside out. All samples were fixed for 30 min at room temperature in PBS with 0.1% Triton X-100% and 4% paraformaldehyde. Samples stained with phalloidin had Triton X-100 concentrations increased to 0.3%. Samples used for VVA staining were removed from pupal cuticle before being fixed in PBS with 0.1% Triton X-100, 4% paraformaldehyde, and 1% trichloroacetic acid on ice for 1 hr followed by 30 min at room temperature. The trichloroacetic acid method causes some slight tissue distortion, as the precipitation treatment utilized to refine the VVA signal causes the posterior lobe to become slightly deformed and curve in towards the clasper. However, similar defects were not observed in the other structures such as the lateral plate or in <italic>D. biarmipes</italic>. Samples were stored in PBT for immunostaining at 4°C for up to two days. For in situ hybridization, samples were rinsed twice in methanol and rinsed twice in ethanol. Samples were stored at −20°C in ethanol.</p></sec><sec id="s4-3"><title>Immunostaining and in situ hybridization</title><p>For immunostaining, genital samples were removed from the surrounding pupal cuticle and incubated overnight at 4°C with primary antibodies diluted in PBS with 0.1% Triton-X (PBT). VVA and phalloidin samples were placed on a rocker. The following primary antibodies were used: rat anti-alpha tubulin (tyrosinated) 1:500 (MAB 1864-I, MilliporeSigma), mouse anti-alpha tubulin (acetylated) 1:500 (T6793, Sigma-Aldrich), rat anti-Ecadherin 1:500 (DCAD2, DSHB), mouse anti-Fasciclin III 1:500 (7G10, DSHB), rabbit anti-histone H3 (phospho S10) 1:50 (ab5176, Abcam), goat anti-GFP 1:300 (ab6662, Abcam), fluorescein Vicia Villosa Lectin (VVA) 1:200 (FL-1231, Vector Laboratories). The goat anti-GFP was used to increase signal of Dumpy:YFP in the knockdown experiments only. Primary antibody was removed by performing two quick rinses and two long washes (at least 5 min) in PBT. Samples were incubated overnight at 4°C in secondary antibodies diluted in PBT. The following secondary antibodies were used: donkey anti-rat Alexa 594 1:500 (A21209, Invitrogen), donkey anti-mouse Alexa 488 1:500 (A21202, Thermo Fisher Scientific), donkey anti-rat Alexa 488 1:500 (A21208, Thermo Fisher Scientific), goat anti-mouse Alexa 594 1:500 (A-11005, Thermo Fisher Scientific), goat anti-rabbit Alexa 594 1:500 (A-11012, Thermo Fisher Scientific), donkey anti-goat Cy2 1:500 (705-225-147, Jackson ImmunoResearch). Rhodamine phalloidin (R415, Thermo Fisher Scientific) stain was performed with secondary antibody. Samples were washed out of secondary antibody by performing two quick rinses and two long washes (at least 5 min) in PBT. Samples were then incubated in 50% PBT/50% glycerol solution for at least 5 min. Pupal samples were mounted on glass slides coated with Poly-L-Lysine Solution. Glass slides had 1 to 2 layers of double sided tape with a well cut out in which the sample was placed and covered with a cover slip. in situ hybridization was performed following the protocol in <xref ref-type="bibr" rid="bib48">Rebeiz et al. (2009)</xref> with modifications to perform in situs in the InsituPro VSi robot (Intavis Bioanalytical Instruments) as done by Glassford et al., with the exception that the genital samples were removed from the surrounding pupal cuticle before placing in the InsituPro VSi robot (<xref ref-type="bibr" rid="bib17">Glassford et al., 2015</xref>; <xref ref-type="bibr" rid="bib48">Rebeiz et al., 2009</xref>).</p></sec><sec id="s4-4"><title>Microscopy and live imaging</title><p>Cuticles of adult posterior lobes and in situ hybridization samples were imaged on a Leica DM2000 microscope with a 40x objective for cuticles and a 10x objective for in situ samples. Samples with fluorescent antibodies and fluorescently tagged proteins were imaged using a Leica TCS SP5 Confocal microscope with either a 40x or 63x oil immersion objective.</p><p>To live-image genital development, a 2% agar solution was poured into a small petri dish, filling the dish half way. A 0.1–10 µL pipette tip was used to make small wells in the agar for pupal samples. Timed pupal samples were inserted head first into the small well and a 20–200 µL pipette tip was used to push samples into agar by placing the tip around the posterior spiracles on the pupal case. To better image the developing genitalia, the pupal case at the posterior end was removed with forceps. Deionized water was used to cover the samples and imaged on a Leica TCS SP5 Confocal microscope using a 63x water objective.</p><p>To live-image embryos, Dumpy:YFP flies were grown in egg-laying chamber with grape agar plates (Genesee Scientific). Embryos were removed from plates using forceps and rolled on a piece of double sided tape to remove the chorion. Embryos then were positioned on a glass coverslip coated with embryo glue. A glass slide was covered with double sided tape and a well was made and filled with halocarbon 27 oil. The cover slip with the embryos was then placed on the glass slide, submerging the embryos in halocarbon oil. Embryos were imaged on a Leica TCS SP8 confocal with a 63x oil objective.</p></sec><sec id="s4-5"><title>Image analysis</title><p>Images were processed with Fiji (<xref ref-type="bibr" rid="bib55">Schindelin et al., 2012</xref>) and Photoshop. Three-dimensional views were rotated and captured in MorphoGraphX (<xref ref-type="bibr" rid="bib4">Barbier de Reuille et al., 2015</xref>) or Leica Application Suite X. Movies were processed in Fiji and cell rearrangements were tracked using the manual tracking plugin. Tissue thickness/cell height during development was measured in cross-sections by drawing a line centered between the two sides (based on apical membrane) of the lobe until the basal side was reached. Area of adult posterior lobe cuticles and height of the adult lobe were measured by using the lateral plate as a guide for determining the bottom boundary of the posterior lobe. To prevent any possible bias for one lobe vs the other (i.e. left vs right) which lobe was used in statistical analysis was randomly decided, except for <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref> where both posterior lobes were considered.</p></sec><sec id="s4-6"><title>Transgenic constructs</title><p>To make the <italic>D. simulans Pox neuro</italic>-Gal4 driver, the posterior lobe enhancer of <italic>Pox neuro</italic> in <italic>D. simulans,</italic> identified in <xref ref-type="bibr" rid="bib17">Glassford et al. (2015)</xref>, was cloned using primers listed in the key resources table from genomic DNA purified with the DNeasy Blood and Tissue Kit (QIAGEN). Primers were designed using sequence conservation with the GenePalette software tool (<xref ref-type="bibr" rid="bib50">Rebeiz and Posakony, 2004</xref>; <xref ref-type="bibr" rid="bib56">Smith et al., 2017</xref>). The cloned sequence was inserted into the pS3aG4 (Gal4) using <italic>AscI</italic> and <italic>SbfI</italic> restriction sites. The final construct was inserted into the 51D landing site on the second chromosome (<xref ref-type="bibr" rid="bib5">Bischof et al., 2007</xref>).</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>The authors thank the members of the M.R. laboratory for comments and discussion on the manuscript. We thank Werner Boll and Markus Noll for the <italic>Pox neuro</italic>-gal4 line, the Bloomington stock center, VDRC, and DGGR stock centers for fly stocks, Benjamin Prud'homme for the s3aG4 vector, Erika A, Bach for the hs-flippase line, and Winslow Johnson for the <italic>D. simulans Pox neuro</italic>-gal4 line. This work was supported by the National Institutes of Health (GM107387 to M.R. and HD044750 to LAD).</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Supervision, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Conceptualization, Supervision, Funding acquisition, Methodology, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="docx" mimetype="application" xlink:href="elife-55965-transrepform-v2.docx"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>All data generated or analyzed during this study are included in the manuscript and supporting files. Source data files have been provided for Figures 2, 6, 7.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Atallah</surname> <given-names>J</given-names></name><name><surname>Liu</surname> <given-names>NH</given-names></name><name><surname>Dennis</surname> <given-names>P</given-names></name><name><surname>Hon</surname> <given-names>A</given-names></name><name><surname>Larsen</surname> <given-names>EW</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Developmental constraints and convergent evolution in <italic>Drosophila</italic> sex comb formation</article-title><source>Evolution &amp; Development</source><volume>11</volume><fpage>205</fpage><lpage>218</lpage><pub-id pub-id-type="doi">10.1111/j.1525-142X.2009.00320.x</pub-id><pub-id pub-id-type="pmid">19245551</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bailles</surname> <given-names>A</given-names></name><name><surname>Collinet</surname> <given-names>C</given-names></name><name><surname>Philippe</surname> <given-names>JM</given-names></name><name><surname>Lenne</surname> <given-names>PF</given-names></name><name><surname>Munro</surname> <given-names>E</given-names></name><name><surname>Lecuit</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Genetic induction and mechanochemical propagation of a morphogenetic wave</article-title><source>Nature</source><volume>572</volume><fpage>467</fpage><lpage>473</lpage><pub-id pub-id-type="doi">10.1038/s41586-019-1492-9</pub-id><pub-id pub-id-type="pmid">31413363</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bainbridge</surname> <given-names>SP</given-names></name><name><surname>Bownes</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="1981">1981</year><article-title>Staging the metamorphosis of <italic>Drosophila melanogaster</italic></article-title><source>Journal of Embryology and Experimental Morphology</source><volume>66</volume><fpage>57</fpage><lpage>80</lpage><pub-id pub-id-type="pmid">6802923</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barbier de Reuille</surname> <given-names>P</given-names></name><name><surname>Routier-Kierzkowska</surname> <given-names>AL</given-names></name><name><surname>Kierzkowski</surname> <given-names>D</given-names></name><name><surname>Bassel</surname> <given-names>GW</given-names></name><name><surname>Schüpbach</surname> <given-names>T</given-names></name><name><surname>Tauriello</surname> <given-names>G</given-names></name><name><surname>Bajpai</surname> <given-names>N</given-names></name><name><surname>Strauss</surname> <given-names>S</given-names></name><name><surname>Weber</surname> <given-names>A</given-names></name><name><surname>Kiss</surname> <given-names>A</given-names></name><name><surname>Burian</surname> <given-names>A</given-names></name><name><surname>Hofhuis</surname> <given-names>H</given-names></name><name><surname>Sapala</surname> <given-names>A</given-names></name><name><surname>Lipowczan</surname> <given-names>M</given-names></name><name><surname>Heimlicher</surname> <given-names>MB</given-names></name><name><surname>Robinson</surname> <given-names>S</given-names></name><name><surname>Bayer</surname> <given-names>EM</given-names></name><name><surname>Basler</surname> <given-names>K</given-names></name><name><surname>Koumoutsakos</surname> <given-names>P</given-names></name><name><surname>Roeder</surname> <given-names>AH</given-names></name><name><surname>Aegerter-Wilmsen</surname> <given-names>T</given-names></name><name><surname>Nakayama</surname> <given-names>N</given-names></name><name><surname>Tsiantis</surname> <given-names>M</given-names></name><name><surname>Hay</surname> <given-names>A</given-names></name><name><surname>Kwiatkowska</surname> <given-names>D</given-names></name><name><surname>Xenarios</surname> <given-names>I</given-names></name><name><surname>Kuhlemeier</surname> <given-names>C</given-names></name><name><surname>Smith</surname> <given-names>RS</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>MorphoGraphX: a platform for quantifying morphogenesis in 4D</article-title><source>eLife</source><volume>4</volume><elocation-id>05864</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.05864</pub-id><pub-id pub-id-type="pmid">25946108</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bischof</surname> <given-names>J</given-names></name><name><surname>Maeda</surname> <given-names>RK</given-names></name><name><surname>Hediger</surname> <given-names>M</given-names></name><name><surname>Karch</surname> <given-names>F</given-names></name><name><surname>Basler</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>An optimized transgenesis system for <italic>Drosophila</italic> using germ-line-specific phiC31 integrases</article-title><source>PNAS</source><volume>104</volume><fpage>3312</fpage><lpage>3317</lpage><pub-id pub-id-type="doi">10.1073/pnas.0611511104</pub-id><pub-id pub-id-type="pmid">17360644</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Boll</surname> <given-names>W</given-names></name><name><surname>Noll</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>The <italic>Drosophila</italic> pox neuro gene: control of male courtship behavior and fertility as revealed by a complete dissection of all enhancers</article-title><source>Development</source><volume>129</volume><fpage>5667</fpage><lpage>5681</lpage><pub-id pub-id-type="doi">10.1242/dev.00157</pub-id><pub-id pub-id-type="pmid">12421707</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brown</surname> <given-names>NH</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Extracellular matrix in development: insights from mechanisms conserved between invertebrates and vertebrates</article-title><source>Cold Spring Harbor Perspectives in Biology</source><volume>3</volume><elocation-id>a005082</elocation-id><pub-id pub-id-type="doi">10.1101/cshperspect.a005082</pub-id><pub-id pub-id-type="pmid">21917993</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Coyne</surname> <given-names>JA</given-names></name></person-group><year iso-8601-date="1989">1989</year><article-title>The genetics of an isolating mechanism between two sibling species of <italic>Drosophila</italic></article-title><source>Evolution</source><volume>47</volume><fpage>778</fpage><lpage>888</lpage><pub-id pub-id-type="doi">10.1111/j.1558-5646.1993.tb01233.x</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Daley</surname> <given-names>WP</given-names></name><name><surname>Yamada</surname> <given-names>KM</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>ECM-modulated cellular dynamics as a driving force for tissue morphogenesis</article-title><source>Current Opinion in Genetics &amp; Development</source><volume>23</volume><fpage>408</fpage><lpage>414</lpage><pub-id pub-id-type="doi">10.1016/j.gde.2013.05.005</pub-id><pub-id pub-id-type="pmid">23849799</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Diaz-de-la-Loza</surname> <given-names>MD</given-names></name><name><surname>Ray</surname> <given-names>RP</given-names></name><name><surname>Ganguly</surname> <given-names>PS</given-names></name><name><surname>Alt</surname> <given-names>S</given-names></name><name><surname>Davis</surname> <given-names>JR</given-names></name><name><surname>Hoppe</surname> <given-names>A</given-names></name><name><surname>Tapon</surname> <given-names>N</given-names></name><name><surname>Salbreux</surname> <given-names>G</given-names></name><name><surname>Thompson</surname> <given-names>BJ</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Apical and basal matrix remodeling control epithelial morphogenesis</article-title><source>Developmental Cell</source><volume>46</volume><fpage>23</fpage><lpage>39</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2018.06.006</pub-id><pub-id pub-id-type="pmid">29974861</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dong</surname> <given-names>B</given-names></name><name><surname>Hannezo</surname> <given-names>E</given-names></name><name><surname>Hayashi</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Balance between apical membrane growth and luminal matrix resistance determines epithelial tubule shape</article-title><source>Cell Reports</source><volume>7</volume><fpage>941</fpage><lpage>950</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2014.03.066</pub-id><pub-id pub-id-type="pmid">24794438</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Duffy</surname> <given-names>JB</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>GAL4 system in <italic>Drosophila</italic>: a fly geneticist's Swiss army knife</article-title><source>Genesis</source><volume>34</volume><fpage>1</fpage><lpage>15</lpage><pub-id pub-id-type="doi">10.1002/gene.10150</pub-id><pub-id pub-id-type="pmid">12324939</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Eberhard</surname> <given-names>WG</given-names></name></person-group><year iso-8601-date="1985">1985</year><source>Sexual Selection and Animal Genitalia</source><publisher-loc>Cambridge</publisher-loc><publisher-name>Harvard University Press</publisher-name></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Etournay</surname> <given-names>R</given-names></name><name><surname>Popović</surname> <given-names>M</given-names></name><name><surname>Merkel</surname> <given-names>M</given-names></name><name><surname>Nandi</surname> <given-names>A</given-names></name><name><surname>Blasse</surname> <given-names>C</given-names></name><name><surname>Aigouy</surname> <given-names>B</given-names></name><name><surname>Brandl</surname> <given-names>H</given-names></name><name><surname>Myers</surname> <given-names>G</given-names></name><name><surname>Salbreux</surname> <given-names>G</given-names></name><name><surname>Jülicher</surname> <given-names>F</given-names></name><name><surname>Eaton</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Interplay of cell dynamics and epithelial tension during morphogenesis of the <italic>Drosophila</italic> pupal wing</article-title><source>eLife</source><volume>4</volume><elocation-id>e07090</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.07090</pub-id><pub-id pub-id-type="pmid">26102528</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernandes</surname> <given-names>I</given-names></name><name><surname>Chanut-Delalande</surname> <given-names>H</given-names></name><name><surname>Ferrer</surname> <given-names>P</given-names></name><name><surname>Latapie</surname> <given-names>Y</given-names></name><name><surname>Waltzer</surname> <given-names>L</given-names></name><name><surname>Affolter</surname> <given-names>M</given-names></name><name><surname>Payre</surname> <given-names>F</given-names></name><name><surname>Plaza</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Zona pellucida domain proteins remodel the apical compartment for localized cell shape changes</article-title><source>Developmental Cell</source><volume>18</volume><fpage>64</fpage><lpage>76</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2009.11.009</pub-id><pub-id pub-id-type="pmid">20152178</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Frazee</surname> <given-names>SR</given-names></name><name><surname>Masly</surname> <given-names>JP</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Multiple sexual selection pressures drive the rapid evolution of complex morphology in a male secondary genital structure</article-title><source>Ecology and Evolution</source><volume>5</volume><fpage>4437</fpage><lpage>4450</lpage><pub-id pub-id-type="doi">10.1002/ece3.1721</pub-id><pub-id pub-id-type="pmid">26664690</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Glassford</surname> <given-names>WJ</given-names></name><name><surname>Johnson</surname> <given-names>WC</given-names></name><name><surname>Dall</surname> <given-names>NR</given-names></name><name><surname>Smith</surname> <given-names>SJ</given-names></name><name><surname>Liu</surname> <given-names>Y</given-names></name><name><surname>Boll</surname> <given-names>W</given-names></name><name><surname>Noll</surname> <given-names>M</given-names></name><name><surname>Rebeiz</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Co-option of an ancestral Hox-Regulated network underlies a recently evolved morphological novelty</article-title><source>Developmental Cell</source><volume>34</volume><fpage>520</fpage><lpage>531</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2015.08.005</pub-id><pub-id pub-id-type="pmid">26343453</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Green</surname> <given-names>JE</given-names></name><name><surname>Cavey</surname> <given-names>M</given-names></name><name><surname>Médina Caturegli</surname> <given-names>E</given-names></name><name><surname>Aigouy</surname> <given-names>B</given-names></name><name><surname>Gompel</surname> <given-names>N</given-names></name><name><surname>Prud'homme</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Evolution of ovipositor length in <italic>Drosophila suzukii</italic> is driven by enhanced cell size expansion and anisotropic tissue reorganization</article-title><source>Current Biology</source><volume>29</volume><fpage>2075</fpage><lpage>2082</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2019.05.020</pub-id><pub-id pub-id-type="pmid">31178315</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guirao</surname> <given-names>B</given-names></name><name><surname>Bellaïche</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Biomechanics of cell rearrangements in <italic>Drosophila</italic></article-title><source>Current Opinion in Cell Biology</source><volume>48</volume><fpage>113</fpage><lpage>124</lpage><pub-id pub-id-type="doi">10.1016/j.ceb.2017.06.004</pub-id><pub-id pub-id-type="pmid">28732313</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heiman</surname> <given-names>MG</given-names></name><name><surname>Shaham</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>DEX-1 and DYF-7 establish sensory dendrite length by anchoring dendritic tips during cell migration</article-title><source>Cell</source><volume>137</volume><fpage>344</fpage><lpage>355</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2009.01.057</pub-id><pub-id pub-id-type="pmid">19344940</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heisenberg</surname> <given-names>CP</given-names></name><name><surname>Bellaïche</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Forces in tissue morphogenesis and patterning</article-title><source>Cell</source><volume>153</volume><fpage>948</fpage><lpage>962</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2013.05.008</pub-id><pub-id pub-id-type="pmid">23706734</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huang</surname> <given-names>J</given-names></name><name><surname>Huang</surname> <given-names>L</given-names></name><name><surname>Chen</surname> <given-names>Y-J</given-names></name><name><surname>Austin</surname> <given-names>E</given-names></name><name><surname>Devor</surname> <given-names>CE</given-names></name><name><surname>Roegiers</surname> <given-names>F</given-names></name><name><surname>Hong</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Differential regulation of adherens junction dynamics during apical-basal polarization</article-title><source>Development</source><volume>139</volume><fpage>4001</fpage><lpage>4013</lpage><pub-id pub-id-type="doi">10.1242/dev.078147</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jagadeeshan</surname> <given-names>S</given-names></name><name><surname>Singh</surname> <given-names>RS</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>A time-sequence functional analysis of mating behaviour and genital coupling in <italic>Drosophila</italic>: role of cryptic female choice and male sex-drive in the evolution of male genitalia</article-title><source>Journal of Evolutionary Biology</source><volume>19</volume><fpage>1058</fpage><lpage>1070</lpage><pub-id pub-id-type="doi">10.1111/j.1420-9101.2006.01099.x</pub-id><pub-id pub-id-type="pmid">16780507</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kamimura</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Copulation anatomy of <italic>Drosophila melanogaster</italic> (Diptera: Drosophilidae): wound-making organs and their possible roles</article-title><source>Zoomorphology</source><volume>129</volume><fpage>163</fpage><lpage>174</lpage><pub-id pub-id-type="doi">10.1007/s00435-010-0109-5</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kanca</surname> <given-names>O</given-names></name><name><surname>Caussinus</surname> <given-names>E</given-names></name><name><surname>Denes</surname> <given-names>AS</given-names></name><name><surname>Percival-Smith</surname> <given-names>A</given-names></name><name><surname>Affolter</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Raeppli: a whole-tissue labeling tool for live imaging of <italic>Drosophila</italic> development</article-title><source>Development</source><volume>141</volume><fpage>472</fpage><lpage>480</lpage><pub-id pub-id-type="doi">10.1242/dev.102913</pub-id><pub-id pub-id-type="pmid">24335257</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kirkpatrick</surname> <given-names>CA</given-names></name><name><surname>Dimitroff</surname> <given-names>BD</given-names></name><name><surname>Rawson</surname> <given-names>JM</given-names></name><name><surname>Selleck</surname> <given-names>SB</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Spatial regulation of wingless morphogen distribution and signaling by Dally-like protein</article-title><source>Developmental Cell</source><volume>7</volume><fpage>513</fpage><lpage>523</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2004.08.004</pub-id><pub-id pub-id-type="pmid">15469840</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kopp</surname> <given-names>A</given-names></name><name><surname>True</surname> <given-names>JR</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Evolution of male sexual characters in the oriental <italic>Drosophila</italic> melanogaster species group</article-title><source>Evolution and Development</source><volume>4</volume><fpage>278</fpage><lpage>291</lpage><pub-id pub-id-type="doi">10.1046/j.1525-142X.2002.02017.x</pub-id><pub-id pub-id-type="pmid">12168620</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kreuger</surname> <given-names>J</given-names></name><name><surname>Perez</surname> <given-names>L</given-names></name><name><surname>Giraldez</surname> <given-names>AJ</given-names></name><name><surname>Cohen</surname> <given-names>SM</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Opposing activities of Dally-like glypican at high and low levels of wingless morphogen activity</article-title><source>Developmental Cell</source><volume>7</volume><fpage>503</fpage><lpage>512</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2004.08.005</pub-id><pub-id pub-id-type="pmid">15469839</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lecuit</surname> <given-names>T</given-names></name><name><surname>Lenne</surname> <given-names>PF</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Cell surface mechanics and the control of cell shape, tissue patterns and morphogenesis</article-title><source>Nature Reviews. Molecular Cell Biology</source><volume>8</volume><fpage>633</fpage><lpage>644</lpage><pub-id pub-id-type="doi">10.1038/nrm2222</pub-id><pub-id pub-id-type="pmid">17643125</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>LeVasseur-Viens</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>No evidence for external genital morphology affecting cryptic female choice and reproductive isolation in <italic>Drosophila</italic></article-title><source>Evolution</source><volume>69</volume><fpage>1797</fpage><lpage>1807</lpage><pub-id pub-id-type="doi">10.1111/evo.12685</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>L</given-names></name><name><surname>Tang</surname> <given-names>Q</given-names></name><name><surname>Nakamura</surname> <given-names>T</given-names></name><name><surname>Suh</surname> <given-names>JG</given-names></name><name><surname>Ohshima</surname> <given-names>H</given-names></name><name><surname>Jung</surname> <given-names>HS</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Fine tuning of Rac1 and RhoA alters cuspal shapes by remolding the cellular geometry</article-title><source>Scientific Reports</source><volume>6</volume><elocation-id>37828</elocation-id><pub-id pub-id-type="doi">10.1038/srep37828</pub-id><pub-id pub-id-type="pmid">27892530</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Linde-Medina</surname> <given-names>M</given-names></name><name><surname>Marcucio</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Living tissues are more than cell clusters: the extracellular matrix as a driving force in morphogenesis</article-title><source>Progress in Biophysics and Molecular Biology</source><volume>137</volume><fpage>46</fpage><lpage>51</lpage><pub-id pub-id-type="doi">10.1016/j.pbiomolbio.2018.01.009</pub-id><pub-id pub-id-type="pmid">29398066</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>Y</given-names></name><name><surname>Ramos-Womack</surname> <given-names>M</given-names></name><name><surname>Han</surname> <given-names>C</given-names></name><name><surname>Reilly</surname> <given-names>P</given-names></name><name><surname>Brackett</surname> <given-names>KL</given-names></name><name><surname>Rogers</surname> <given-names>W</given-names></name><name><surname>Williams</surname> <given-names>TM</given-names></name><name><surname>Andolfatto</surname> <given-names>P</given-names></name><name><surname>Stern</surname> <given-names>DL</given-names></name><name><surname>Rebeiz</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Changes throughout a genetic network mask the contribution of Hox gene evolution</article-title><source>Current Biology </source><volume>29</volume><fpage>2157</fpage><lpage>2166</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2019.05.074</pub-id><pub-id pub-id-type="pmid">31257142</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Loganathan</surname> <given-names>R</given-names></name><name><surname>Rongish</surname> <given-names>BJ</given-names></name><name><surname>Smith</surname> <given-names>CM</given-names></name><name><surname>Filla</surname> <given-names>MB</given-names></name><name><surname>Czirok</surname> <given-names>A</given-names></name><name><surname>Bénazéraf</surname> <given-names>B</given-names></name><name><surname>Little</surname> <given-names>CD</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Extracellular matrix motion and early morphogenesis</article-title><source>Development</source><volume>143</volume><fpage>2056</fpage><lpage>2065</lpage><pub-id pub-id-type="doi">10.1242/dev.127886</pub-id><pub-id pub-id-type="pmid">27302396</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Low</surname> <given-names>IIC</given-names></name><name><surname>Williams</surname> <given-names>CR</given-names></name><name><surname>Chong</surname> <given-names>MK</given-names></name><name><surname>McLachlan</surname> <given-names>IG</given-names></name><name><surname>Wierbowski</surname> <given-names>BM</given-names></name><name><surname>Kolotuev</surname> <given-names>I</given-names></name><name><surname>Heiman</surname> <given-names>MG</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Morphogenesis of neurons and Glia within an epithelium</article-title><source>Development</source><volume>146</volume><elocation-id>dev171124</elocation-id><pub-id pub-id-type="doi">10.1242/dev.171124</pub-id><pub-id pub-id-type="pmid">30683663</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lowe</surname> <given-names>N</given-names></name><name><surname>Rees</surname> <given-names>JS</given-names></name><name><surname>Roote</surname> <given-names>J</given-names></name><name><surname>Ryder</surname> <given-names>E</given-names></name><name><surname>Armean</surname> <given-names>IM</given-names></name><name><surname>Johnson</surname> <given-names>G</given-names></name><name><surname>Drummond</surname> <given-names>E</given-names></name><name><surname>Spriggs</surname> <given-names>H</given-names></name><name><surname>Drummond</surname> <given-names>J</given-names></name><name><surname>Magbanua</surname> <given-names>JP</given-names></name><name><surname>Naylor</surname> <given-names>H</given-names></name><name><surname>Sanson</surname> <given-names>B</given-names></name><name><surname>Bastock</surname> <given-names>R</given-names></name><name><surname>Huelsmann</surname> <given-names>S</given-names></name><name><surname>Trovisco</surname> <given-names>V</given-names></name><name><surname>Landgraf</surname> <given-names>M</given-names></name><name><surname>Knowles-Barley</surname> <given-names>S</given-names></name><name><surname>Armstrong</surname> <given-names>JD</given-names></name><name><surname>White-Cooper</surname> <given-names>H</given-names></name><name><surname>Hansen</surname> <given-names>C</given-names></name><name><surname>Phillips</surname> <given-names>RG</given-names></name><name><surname>Lilley</surname> <given-names>KS</given-names></name><name><surname>Russell</surname> <given-names>S</given-names></name><name><surname>St Johnston</surname> <given-names>D</given-names></name><collab>UK Drosophila Protein Trap Screening Consortium</collab></person-group><year iso-8601-date="2014">2014</year><article-title>Analysis of the expression patterns, subcellular localisations and interaction partners of <italic>Drosophila</italic> proteins using a pigP protein trap library</article-title><source>Development</source><volume>141</volume><fpage>3994</fpage><lpage>4005</lpage><pub-id pub-id-type="doi">10.1242/dev.111054</pub-id><pub-id pub-id-type="pmid">25294943</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lye</surname> <given-names>CM</given-names></name><name><surname>Naylor</surname> <given-names>HW</given-names></name><name><surname>Sanson</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Subcellular localisations of the CPTI collection of YFP-tagged proteins in <italic>Drosophila</italic> embryos</article-title><source>Development</source><volume>141</volume><fpage>4006</fpage><lpage>4017</lpage><pub-id pub-id-type="doi">10.1242/dev.111310</pub-id><pub-id pub-id-type="pmid">25294944</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Margaritis</surname> <given-names>LH</given-names></name><name><surname>Kafatos</surname> <given-names>FC</given-names></name><name><surname>Petri</surname> <given-names>WH</given-names></name></person-group><year iso-8601-date="1980">1980</year><article-title>The eggshell of <italic>Drosophila melanogaster</italic> fine structure of the layers and regions of the wild-type eggshell</article-title><source>Journal of Cell Science</source><volume>43</volume><fpage>1</fpage><lpage>35</lpage><pub-id pub-id-type="pmid">6774986</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martin</surname> <given-names>AC</given-names></name><name><surname>Goldstein</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Apical constriction: themes and variations on a cellular mechanism driving morphogenesis</article-title><source>Development</source><volume>141</volume><fpage>1987</fpage><lpage>1998</lpage><pub-id pub-id-type="doi">10.1242/dev.102228</pub-id><pub-id pub-id-type="pmid">24803648</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moczek</surname> <given-names>AP</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>On the origins of novelty in development and evolution</article-title><source>BioEssays : News and Reviews in Molecular, Cellular and Developmental Biology</source><volume>30</volume><fpage>432</fpage><lpage>447</lpage><pub-id pub-id-type="doi">10.1002/bies.20754</pub-id><pub-id pub-id-type="pmid">18404691</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Morin</surname> <given-names>X</given-names></name><name><surname>Daneman</surname> <given-names>R</given-names></name><name><surname>Zavortink</surname> <given-names>M</given-names></name><name><surname>Chia</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>A protein trap strategy to detect GFP-tagged proteins expressed from their endogenous loci in <italic>Drosophila</italic></article-title><source>PNAS</source><volume>98</volume><fpage>15050</fpage><lpage>15055</lpage><pub-id pub-id-type="doi">10.1073/pnas.261408198</pub-id><pub-id pub-id-type="pmid">11742088</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Münster</surname> <given-names>S</given-names></name><name><surname>Jain</surname> <given-names>A</given-names></name><name><surname>Mietke</surname> <given-names>A</given-names></name><name><surname>Pavlopoulos</surname> <given-names>A</given-names></name><name><surname>Grill</surname> <given-names>SW</given-names></name><name><surname>Tomancak</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Attachment of the blastoderm to the vitelline envelope affects gastrulation of insects</article-title><source>Nature</source><volume>568</volume><fpage>395</fpage><lpage>399</lpage><pub-id pub-id-type="doi">10.1038/s41586-019-1044-3</pub-id><pub-id pub-id-type="pmid">30918398</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Osterfield</surname> <given-names>M</given-names></name><name><surname>Schüpbach</surname> <given-names>T</given-names></name><name><surname>Wieschaus</surname> <given-names>E</given-names></name><name><surname>Shvartsman</surname> <given-names>SY</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Diversity of epithelial morphogenesis during eggshell formation in drosophilids</article-title><source>Development</source><volume>142</volume><fpage>1971</fpage><lpage>1977</lpage><pub-id pub-id-type="doi">10.1242/dev.119404</pub-id><pub-id pub-id-type="pmid">25953345</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Paluch</surname> <given-names>E</given-names></name><name><surname>Heisenberg</surname> <given-names>CP</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Biology and physics of cell shape changes in development</article-title><source>Current Biology</source><volume>19</volume><fpage>R790</fpage><lpage>R799</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2009.07.029</pub-id><pub-id pub-id-type="pmid">19906581</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peluffo</surname> <given-names>AE</given-names></name><name><surname>Nuez</surname> <given-names>I</given-names></name><name><surname>Debat</surname> <given-names>V</given-names></name><name><surname>Savisaar</surname> <given-names>R</given-names></name><name><surname>Stern</surname> <given-names>DL</given-names></name><name><surname>Orgogozo</surname> <given-names>V</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>A major locus controls a genital shape difference involved in reproductive isolation between <italic>Drosophila yakuba</italic> and <italic>Drosophila santomea</italic></article-title><source>G3: Genes|Genomes|Genetics</source><volume>5</volume><fpage>2893</fpage><lpage>2901</lpage><pub-id pub-id-type="doi">10.1534/g3.115.023481</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Peter</surname> <given-names>IS</given-names></name><name><surname>Davidson</surname> <given-names>EH</given-names></name></person-group><year iso-8601-date="2015">2015</year><source>Genomic Control Process: Development and Evolution</source><publisher-name>Academic Press</publisher-name></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ray</surname> <given-names>RP</given-names></name><name><surname>Matamoro-Vidal</surname> <given-names>A</given-names></name><name><surname>Ribeiro</surname> <given-names>PS</given-names></name><name><surname>Tapon</surname> <given-names>N</given-names></name><name><surname>Houle</surname> <given-names>D</given-names></name><name><surname>Salazar-Ciudad</surname> <given-names>I</given-names></name><name><surname>Thompson</surname> <given-names>BJ</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Patterned anchorage to the apical extracellular matrix defines tissue shape in the developing appendages of <italic>Drosophila</italic></article-title><source>Developmental Cell</source><volume>34</volume><fpage>310</fpage><lpage>322</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2015.06.019</pub-id><pub-id pub-id-type="pmid">26190146</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rebeiz</surname> <given-names>M</given-names></name><name><surname>Pool</surname> <given-names>JE</given-names></name><name><surname>Kassner</surname> <given-names>VA</given-names></name><name><surname>Aquadro</surname> <given-names>CF</given-names></name><name><surname>Carroll</surname> <given-names>SB</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Stepwise modification of a modular enhancer underlies adaptation in a <italic>Drosophila</italic> population</article-title><source>Science</source><volume>326</volume><fpage>1663</fpage><lpage>1667</lpage><pub-id pub-id-type="doi">10.1126/science.1178357</pub-id><pub-id pub-id-type="pmid">20019281</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rebeiz</surname> <given-names>M</given-names></name><name><surname>Patel</surname> <given-names>NH</given-names></name><name><surname>Hinman</surname> <given-names>VF</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Unraveling the tangled skein: the evolution of transcriptional regulatory networks in development</article-title><source>Annual Review of Genomics and Human Genetics</source><volume>16</volume><fpage>103</fpage><lpage>131</lpage><pub-id pub-id-type="doi">10.1146/annurev-genom-091212-153423</pub-id><pub-id pub-id-type="pmid">26079281</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rebeiz</surname> <given-names>M</given-names></name><name><surname>Posakony</surname> <given-names>JW</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>GenePalette: a universal software tool for genome sequence visualization and analysis</article-title><source>Developmental Biology</source><volume>271</volume><fpage>431</fpage><lpage>438</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2004.04.011</pub-id><pub-id pub-id-type="pmid">15223345</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Renvoisé</surname> <given-names>E</given-names></name><name><surname>Kavanagh</surname> <given-names>KD</given-names></name><name><surname>Lazzari</surname> <given-names>V</given-names></name><name><surname>Häkkinen</surname> <given-names>TJ</given-names></name><name><surname>Rice</surname> <given-names>R</given-names></name><name><surname>Pantalacci</surname> <given-names>S</given-names></name><name><surname>Salazar-Ciudad</surname> <given-names>I</given-names></name><name><surname>Jernvall</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Mechanical constraint from growing jaw facilitates mammalian dental diversity</article-title><source>PNAS</source><volume>114</volume><fpage>9403</fpage><lpage>9408</lpage><pub-id pub-id-type="doi">10.1073/pnas.1707410114</pub-id><pub-id pub-id-type="pmid">28808032</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rice</surname> <given-names>G</given-names></name><name><surname>David</surname> <given-names>JR</given-names></name><name><surname>Kamimura</surname> <given-names>Y</given-names></name><name><surname>Masly</surname> <given-names>JP</given-names></name><name><surname>Mcgregor</surname> <given-names>AP</given-names></name><name><surname>Nagy</surname> <given-names>O</given-names></name><name><surname>Noselli</surname> <given-names>S</given-names></name><name><surname>Nunes</surname> <given-names>MDS</given-names></name><name><surname>O'Grady</surname> <given-names>P</given-names></name><name><surname>Sánchez-Herrero</surname> <given-names>E</given-names></name><name><surname>Siegal</surname> <given-names>ML</given-names></name><name><surname>Toda</surname> <given-names>MJ</given-names></name><name><surname>Rebeiz</surname> <given-names>M</given-names></name><name><surname>Courtier-Orgogozo</surname> <given-names>V</given-names></name><name><surname>Yassin</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>A standardized nomenclature and atlas of the male terminalia of <italic>Drosophila melanogaster</italic></article-title><source>Fly</source><volume>13</volume><fpage>51</fpage><lpage>64</lpage><pub-id pub-id-type="doi">10.1080/19336934.2019.1653733</pub-id><pub-id pub-id-type="pmid">31401934</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Roll-Mecak</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>How cells exploit tubulin diversity to build functional cellular microtubule mosaics</article-title><source>Current Opinion in Cell Biology</source><volume>56</volume><fpage>102</fpage><lpage>108</lpage><pub-id pub-id-type="doi">10.1016/j.ceb.2018.10.009</pub-id><pub-id pub-id-type="pmid">30466050</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rosa</surname> <given-names>JB</given-names></name><name><surname>Metzstein</surname> <given-names>MM</given-names></name><name><surname>Ghabrial</surname> <given-names>AS</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>An Ichor-dependent apical extracellular matrix regulates seamless tube shape and integrity</article-title><source>PLOS Genetics</source><volume>14</volume><elocation-id>e1007146</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.1007146</pub-id><pub-id pub-id-type="pmid">29309404</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schindelin</surname> <given-names>J</given-names></name><name><surname>Arganda-Carreras</surname> <given-names>I</given-names></name><name><surname>Frise</surname> <given-names>E</given-names></name><name><surname>Kaynig</surname> <given-names>V</given-names></name><name><surname>Longair</surname> <given-names>M</given-names></name><name><surname>Pietzsch</surname> <given-names>T</given-names></name><name><surname>Preibisch</surname> <given-names>S</given-names></name><name><surname>Rueden</surname> <given-names>C</given-names></name><name><surname>Saalfeld</surname> <given-names>S</given-names></name><name><surname>Schmid</surname> <given-names>B</given-names></name><name><surname>Tinevez</surname> <given-names>JY</given-names></name><name><surname>White</surname> <given-names>DJ</given-names></name><name><surname>Hartenstein</surname> <given-names>V</given-names></name><name><surname>Eliceiri</surname> <given-names>K</given-names></name><name><surname>Tomancak</surname> <given-names>P</given-names></name><name><surname>Cardona</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Fiji: an open-source platform for biological-image analysis</article-title><source>Nature Methods</source><volume>9</volume><fpage>676</fpage><lpage>682</lpage><pub-id pub-id-type="doi">10.1038/nmeth.2019</pub-id><pub-id pub-id-type="pmid">22743772</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname> <given-names>AF</given-names></name><name><surname>Posakony</surname> <given-names>JW</given-names></name><name><surname>Rebeiz</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Automated tools for comparative sequence analysis of genic regions using the GenePalette application</article-title><source>Developmental Biology</source><volume>429</volume><fpage>158</fpage><lpage>164</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2017.06.033</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname> <given-names>SJ</given-names></name><name><surname>Rebeiz</surname> <given-names>M</given-names></name><name><surname>Davidson</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>From pattern to process: studies at the interface of gene regulatory networks, morphogenesis, and evolution</article-title><source>Current Opinion in Genetics &amp; Development</source><volume>51</volume><fpage>103</fpage><lpage>110</lpage><pub-id pub-id-type="doi">10.1016/j.gde.2018.08.004</pub-id><pub-id pub-id-type="pmid">30278289</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tada</surname> <given-names>M</given-names></name><name><surname>Heisenberg</surname> <given-names>CP</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Convergent extension: using collective cell migration and cell intercalation to shape embryos</article-title><source>Development</source><volume>139</volume><fpage>3897</fpage><lpage>3904</lpage><pub-id pub-id-type="doi">10.1242/dev.073007</pub-id><pub-id pub-id-type="pmid">23048180</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tanaka</surname> <given-names>K</given-names></name><name><surname>Barmina</surname> <given-names>O</given-names></name><name><surname>Kopp</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Distinct developmental mechanisms underlie the evolutionary diversification of <italic>Drosophila</italic> sex combs</article-title><source>PNAS</source><volume>106</volume><fpage>4764</fpage><lpage>4769</lpage><pub-id pub-id-type="doi">10.1073/pnas.0807875106</pub-id><pub-id pub-id-type="pmid">19255422</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tian</surname> <given-names>E</given-names></name><name><surname>Ten Hagen</surname> <given-names>KG</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>O-linked glycan expression during <italic>Drosophila</italic> development</article-title><source>Glycobiology</source><volume>17</volume><fpage>820</fpage><lpage>827</lpage><pub-id pub-id-type="doi">10.1093/glycob/cwm056</pub-id><pub-id pub-id-type="pmid">17522109</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vincent</surname> <given-names>BJ</given-names></name><name><surname>Rice</surname> <given-names>GR</given-names></name><name><surname>Wong</surname> <given-names>GM</given-names></name><name><surname>Glassford</surname> <given-names>WJ</given-names></name><name><surname>Downs</surname> <given-names>KI</given-names></name><name><surname>Shastay</surname> <given-names>JL</given-names></name><name><surname>Charles-Obi</surname> <given-names>K</given-names></name><name><surname>Natarajan</surname> <given-names>M</given-names></name><name><surname>Gogol</surname> <given-names>M</given-names></name><name><surname>Zeitlinger</surname> <given-names>J</given-names></name><name><surname>Rebeiz</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>An atlas of transcription factors expressed in male pupal terminalia of <italic>Drosophila melanogaster</italic></article-title><source>G3: Genes|Genomes|Genetics</source><volume>9</volume><fpage>3961</fpage><lpage>3972</lpage><pub-id pub-id-type="doi">10.1534/g3.119.400788</pub-id><pub-id pub-id-type="pmid">31619460</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Wagner</surname> <given-names>GP</given-names></name></person-group><year iso-8601-date="2014">2014</year><source>Homology, Genes, and Evolutionary Innovation</source><publisher-name>Princeton University Press</publisher-name><pub-id pub-id-type="doi">10.5860/choice.52-0829</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wagner</surname> <given-names>GP</given-names></name><name><surname>Lynch</surname> <given-names>VJ</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Evolutionary novelties</article-title><source>Current Biology</source><volume>20</volume><fpage>R48</fpage><lpage>R52</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2009.11.010</pub-id><pub-id pub-id-type="pmid">20129035</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Walck-Shannon</surname> <given-names>E</given-names></name><name><surname>Hardin</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Cell intercalation from top to bottom</article-title><source>Nature Reviews Molecular Cell Biology</source><volume>15</volume><fpage>34</fpage><lpage>48</lpage><pub-id pub-id-type="doi">10.1038/nrm3723</pub-id><pub-id pub-id-type="pmid">24355988</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>X</given-names></name><name><surname>Harris</surname> <given-names>RE</given-names></name><name><surname>Bayston</surname> <given-names>LJ</given-names></name><name><surname>Ashe</surname> <given-names>HL</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Type IV collagens regulate BMP signalling in <italic>Drosophila</italic></article-title><source>Nature</source><volume>455</volume><fpage>72</fpage><lpage>77</lpage><pub-id pub-id-type="doi">10.1038/nature07214</pub-id><pub-id pub-id-type="pmid">18701888</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Webster</surname> <given-names>DR</given-names></name><name><surname>Gundersen</surname> <given-names>GG</given-names></name><name><surname>Bulinski</surname> <given-names>JC</given-names></name><name><surname>Borisy</surname> <given-names>GG</given-names></name></person-group><year iso-8601-date="1987">1987</year><article-title>Differential turnover of tyrosinated and detyrosinated microtubules</article-title><source>PNAS</source><volume>84</volume><fpage>9040</fpage><lpage>9044</lpage><pub-id pub-id-type="doi">10.1073/pnas.84.24.9040</pub-id><pub-id pub-id-type="pmid">3321065</pub-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wilkin</surname> <given-names>MB</given-names></name><name><surname>Becker</surname> <given-names>MN</given-names></name><name><surname>Mulvey</surname> <given-names>D</given-names></name><name><surname>Phan</surname> <given-names>I</given-names></name><name><surname>Chao</surname> <given-names>A</given-names></name><name><surname>Cooper</surname> <given-names>K</given-names></name><name><surname>Chung</surname> <given-names>HJ</given-names></name><name><surname>Campbell</surname> <given-names>ID</given-names></name><name><surname>Baron</surname> <given-names>M</given-names></name><name><surname>MacIntyre</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title><italic>Drosophila</italic> dumpy is a gigantic extracellular protein required to maintain tension at epidermal-cuticle attachment sites</article-title><source>Current Biology</source><volume>10</volume><fpage>559</fpage><lpage>567</lpage><pub-id pub-id-type="doi">10.1016/S0960-9822(00)00482-6</pub-id><pub-id pub-id-type="pmid">10837220</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname> <given-names>XS</given-names></name><name><surname>Gantz</surname> <given-names>VM</given-names></name><name><surname>Siomava</surname> <given-names>N</given-names></name><name><surname>Bier</surname> <given-names>E</given-names></name></person-group><year iso-8601-date="2017">2017a</year><article-title>CRISPR/Cas9 and active genetics-based trans-species replacement of the endogenous <italic>Drosophila</italic> kni-L2 CRM reveals unexpected complexity</article-title><source>eLife</source><volume>6</volume><elocation-id>e30281</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.30281</pub-id><pub-id pub-id-type="pmid">29274230</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname> <given-names>Z</given-names></name><name><surname>Schaedel</surname> <given-names>L</given-names></name><name><surname>Portran</surname> <given-names>D</given-names></name><name><surname>Aguilar</surname> <given-names>A</given-names></name><name><surname>Gaillard</surname> <given-names>J</given-names></name><name><surname>Marinkovich</surname> <given-names>MP</given-names></name><name><surname>Théry</surname> <given-names>M</given-names></name><name><surname>Nachury</surname> <given-names>MV</given-names></name></person-group><year iso-8601-date="2017">2017b</year><article-title>Microtubules acquire resistance from mechanical breakage through intralumenal acetylation</article-title><source>Science</source><volume>356</volume><fpage>328</fpage><lpage>332</lpage><pub-id pub-id-type="doi">10.1126/science.aai8764</pub-id><pub-id pub-id-type="pmid">28428427</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.55965.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Rokas</surname><given-names>Antonis</given-names></name><role>Reviewing Editor</role><aff><institution>Vanderbilt University</institution><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>The manuscript by Smith and colleagues examines the developmental basis of a novel structure and how it may have evolved. The authors focus on the posterior lobe of <italic>Drosophila melanogaster</italic>, a structure that recently evolved in this species and that is absent from closely related Drosophilids. Through a series of experiments, the authors show that the posterior lobe is formed largely through increases in the height of cells, rather than through cell proliferation or cell intercalation. Furthermore, the authors are able to attribute this change in cell size to the presence of the apical extracellular matrix (aECM) and in particular to the aECM protein Dumpy. These results suggest an important role for aECM in the evolution of genital structures in Drosophilids.</p><p><bold>Decision letter after peer review:</bold></p><p>[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]</p><p>Thank you for submitting your work entitled &quot;Expansion of apical extracellular matrix underlies the morphogenesis of a recently evolved structure&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.</p><p>Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in <italic>eLife</italic> in its present form. As you will see from the reviews, there was consensus that the topic addressed is of importance and that the work presented is an important first step toward elucidating the molecular basis of posterior lobe diversity. The key concern is that the data presented don't yet &quot;prove&quot; that the Dumpy aECM causes the posterior lobe diversity. For example, either reviewer #2's fourth point (how does the VVA-labeled aECM differ in other lobed species versus <italic>melanogaster</italic>?) or reviewer's #3 suggestion (doing the complementary gain-of-function experiment) would allow you to explore in more depth the connection between the aECM and posterior-lobe diversity. Recognizing that these experiments entail a lot more experimental<italic>eLife</italic>, we have opted to reject the manuscript. But we would be open to considered a revised manuscript that addresses this key concern as well as the reviewers' other concerns.</p><p><italic>Reviewer #1:</italic></p><p>The manuscript by Smith and colleagues examines the developmental basis of a novel structure and how it may have evolved. The authors focus on the posterior lobe of <italic>Drosophila melanogaster</italic>, a structure that recently evolved in this species and that is absent from closely related Drosophilids. Through a series of experiments, the authors show that the posterior lobe is formed largely through increases in the height of cells, rather than through cell proliferation or cell intercalation. Furthermore, the authors are able to attribute this change in cell size to the presence of the apical extracellular matrix (aECM) and in particular to the aECM protein Dumpy. These results suggest an important role for aECM in the evolution of genital structures in Drosophilids.</p><p>The manuscript seems well written, the experiments appear to be well done, and the topic and question are of importance to evolutionary developmental biology.</p><p><italic>Reviewer #2:</italic></p><p>In this manuscript, Smith et al., investigate the morphological basis for a recently evolved and novel structure, the male posterior lobe in <italic>Drosophila melanogaster</italic>. The posterior lobe (PL), an outgrowth of the genitalia required for copulation, only appears in the <italic>melanogaster</italic> clade of <italic>Drosophila</italic>, and not in more distantly related species. The authors image the PL from the lateral plate at specific stages in <italic>D. melanogaster</italic> versus a non-lobed species, <italic>D. biarmipes</italic>. The growth of the PL during development and splitting from the lateral plate does not come from cell proliferation or cell intercalation. Instead, the authors propose that PL growth derives from cell lengthening; a membrane marker shows that cells span the length of the basal to apical surface of the PL. Thickness of the PL changes during development, suggesting that PL tissue development is dynamic. Next, the authors investigate the cellular and extracellular basis for PL morphogenesis. The PL is enriched for F-actin and microtubules, suggesting that the cytoskeleton may contribute to the shape and growth. However, the authors discover that a Dumpy-YFP-enriched apical extracellular matrix (aECM) is associated with the developing PL, particularly at the apex of the PL at late stages. Further, Dumpy RNA expression is expanded to the developing PL in lobed but not non-lobed species. The authors then show that VVA lectin resembles Dumpy-YFP aECM. This aECM network differs in non-lobed species compared to <italic>D. melanogaster</italic>, suggesting that the Dumpy-aEM helps shape PL morphogenesis. Lastly, the authors demonstrate that the PL is reduced and changes shape when Dumpy is knocked down by RNAi in <italic>D. melanogaster</italic>. PL changes correlate with altered Dumpy-YFP aECM organization. The authors conclude that the aECM is required for PL development in lobed species, but may have different functions in genital morphogenesis of non-lobed species.</p><p>Overall, this is a well-written manuscript, with very clear imaging data and videos. This is an important topic of general interest to developmental biologists, especially those interested in the evolutionary basis of tissue morphology. To strengthen the conclusions, however, clarification of several points would be helpful.</p><p>First, the authors use the Raeppli system to label cells with a membrane marker and show that the PL is one-cell thick, which continues to grow/lengthen. The authors could clarify why they used this technique specifically, rather than a regular FLP-out clone of a membrane-tethered GFP (e.g. UAS-PLCδPH-GFP or UAS-mCD8-GFP). I'm also concerned that the N's are low (n=4 clones). Did the authors label and image additional cells of the PL, and at different stages of development, to more convincingly show that the epithelium is only one cell layer thick throughout the breadth of the tissue?</p><p>Second, the authors use VVA-FITC to label the aECM in other <italic>Drosophila</italic> species. Can the authors confirm that VVA labels the same aECM structures as Dumpy-YFP in <italic>D. melanogaster</italic>? If so, this would go a long way to validate VVA as a great proxy for Dumpy. It looks like there is one commercial source of VVL/VVA-TRITC (Glycomatrix.com) that could be used.</p><p>Third, the authors look at Dumpy-YFP in a Dumpy RNAi background (Figure 7C-F). Shouldn't the RNAi target Dumpy-YFP and thus reduce its expression? This could change the interpretation of how the aECM associates with the ventral portion of the PL. Visualizing VVA here could strengthen this association.</p><p>Fourth, the PL appears quite different within the <italic>melanogaster</italic> clade (e.g. Glassford et al., 2015 shows the simulans has a very large PL and mauritiana a very small PL). How does the VVA-labeled aECM differ in these (or another) lobed species versus <italic>melanogaster</italic>? The similarities/differences could really strengthen the association of aECM organization and how the PL shape develops in lobed versus non-lobed species.</p><p>Fifth, the authors conclude that Dumpy is required for proper posterior lobe formation. The data seems to support a role for Dumpy in sculpting and shaping the lobe, as the PL still forms in the dumpy RNAi animals. Or do the authors think that there is residual Dumpy in the RNAi condition that may account for the PL still forming, albeit as a smaller tissue with altered shape? Alternatively, does the GAL4 driver used to knockdown Dumpy have variable expression that can account for the variability in the PL phenotypes?</p><p>Lastly, the authors could further discuss the possibility that intrinsic factors such as the cytoskeleton may contribute to PL morphogenesis. The phenotypes caused by Dumpy RNAi are not completely penetrant (e.g. the PL still forms, but has a cleft). Do the authors think that a combination of extrinsic aECM along with cytoskeletal changes contribute? Is there any role for apical cell constriction of the epithelia, for example, in forming the crevice between the PL and clasper, and that this could help the PL form in these species?</p><p><italic>Reviewer #3:</italic></p><p>Smith et al., present a thorough analysis of the morphogenesis of the posterior lobe of the <italic>Drosophila melanogaster</italic> male genitalia, and compare this morphogenetic process with non-lobed yet relatively closely related species. They find that the posterior lobe forms by a major increase in cell height; that the developing genitalia associate with an intricate apical extracellular matrix; and that a component of this matrix, Dumpy, has expanded in expression in lobed species and is required for lobe development in <italic>D. melanogaster</italic>. This work joins other recent work (reviewed in the Introduction) that is beginning to reveal the cellular-developmental basis of evolutionary change, and as the authors note their work is an important addition because of its focus on a novel structure rather than diversification of an ancestral structure.</p><p>The experiments appear to have been well conceived and rigorously executed, and the information they provide is an important starting point for understanding the evolution of this model novelty (both its origin and its subsequent diversification).</p><p>Although this is solid work, I do have reservations about its ultimate impact. It is not clear whether changes in Dumpy expression were at all causative in the evolution of the posterior lobe. It is not entirely surprising that disrupting Dumpy, which attaches to the developing lobe, disrupts its ultimate morphology. What is missing is the complementary gain-of-function experiment: does expanding Dumpy expression in a non-lobed species create anything akin to a new lobe? Granted, this kind of experiment might not be feasible in a non-model fly, and if it could be done it might yield a hard-to-interpret negative result. But then the question remains: how do we solve the &quot;major looming challenge in evo-devo research&quot; that the authors note in their final sentence Discussion section) – what are the genetic changes underlying the cellular changes? Moving in that direction would indeed be a major advance, and it seems to me that the ultimate impact of the present work lies in how possible it will be to uncover the relevant genetic changes underlying the novelty. I don't have any specific experiments to suggest (and I'd be reluctant to suggest major new experiments anyway), but the uncertainty about making progress does constrain my enthusiasm somewhat. And in the meantime, the title (&quot;Expansion of aECM underlies the morphogenesis.…&quot;) is a bit misleading and should reflect more this uncertainty.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.55965.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]</p><p>The paper has been greatly improved in response to the reviewer feedback. We have performed additional experiments and added significant data to address nearly</p><p>every reviewer comment and concern. Although one requested experiment was not</p><p>addressable, we detail in our response how this suggested experiment is infeasible, and</p><p>describe the current practices and theoretical frameworks of the evo-devo field upon which our conclusions are soundly based.</p><disp-quote content-type="editor-comment"><p>Reviewer #1:</p><p>The manuscript by Smith and colleagues examines the developmental basis of a novel structure and how it may have evolved. The authors focus on the posterior lobe of <italic>Drosophila melanogaster</italic>, a structure that recently evolved in this species and that is absent from closely related Drosophilids. Through a series of experiments, the authors show that the posterior lobe is formed largely through increases in the height of cells, rather than through cell proliferation or cell intercalation. Furthermore, the authors are able to attribute this change in cell size to the presence of the apical extracellular matrix (aECM) and in particular to the aECM protein Dumpy. These results suggest an important role for aECM in the evolution of genital structures in Drosophilids.</p><p>The manuscript seems well written, the experiments appear to be well done, and the topic and question are of importance to evolutionary developmental biology.</p></disp-quote><p>We thank the reviewer for their comments and perspective on our work.</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>In this manuscript, Smith et al., investigate the morphological basis for a recently evolved and novel structure, the male posterior lobe in <italic>Drosophila melanogaster</italic>. The posterior lobe (PL), an outgrowth of the genitalia required for copulation, only appears in the melanogaster clade of Drosophila, and not in more distantly related species. The authors image the PL from the lateral plate at specific stages in <italic>D. melanogaster</italic> versus a non-lobed species, <italic>D. biarmipes</italic>. The growth of the PL during development and splitting from the lateral plate does not come from cell proliferation or cell intercalation. Instead, the authors propose that PL growth derives from cell lengthening; a membrane marker shows that cells span the length of the basal to apical surface of the PL. Thickness of the PL changes during development, suggesting that PL tissue development is dynamic. Next, the authors investigate the cellular and extracellular basis for PL morphogenesis. The PL is enriched for F-actin and microtubules, suggesting that the cytoskeleton may contribute to the shape and growth. However, the authors discover that a Dumpy-YFP-enriched apical extracellular matrix (aECM) is associated with the developing PL, particularly at the apex of the PL at late stages. Further, Dumpy RNA expression is expanded to the developing PL in lobed but not non-lobed species. The authors then show that VVA lectin resembles Dumpy-YFP aECM. This aECM network differs in non-lobed species compared to D. melanogaster, suggesting that the Dumpy-aEM helps shape PL morphogenesis. Lastly, the authors demonstrate that the PL is reduced and changes shape when Dumpy is knocked down by RNAi in D. melanogaster. PL changes correlate with altered Dumpy-YFP aECM organization. The authors conclude that the aECM is required for PL development in lobed species, but may have different functions in genital morphogenesis of non-lobed species.</p><p>Overall, this is a well-written manuscript, with very clear imaging data and videos. This is an important topic of general interest to developmental biologists, especially those interested in the evolutionary basis of tissue morphology. To strengthen the conclusions, however, clarification of several points would be helpful.</p></disp-quote><p>Thank you for the very careful reading of our manuscript and appreciation of the topic and our conclusions. We have addressed all of the comments raised below with additional experiments and modifications.</p><disp-quote content-type="editor-comment"><p>First, the authors use the Raeppli system to label cells with a membrane marker and show that the PL is one-cell thick, which continues to grow/lengthen. The authors could clarify why they used this technique specifically, rather than a regular FLP-out clone of a membrane-tethered GFP (e.g. UAS-PLCδPH-GFP or UAS-mCD8-GFP). I'm also concerned that the N's are low (n=4 clones). Did the authors label and image additional cells of the PL, and at different stages of development, to more convincingly show that the epithelium is only one cell layer thick throughout the breadth of the tissue?</p></disp-quote><p>We have increased our N for this experiment to 10. We had initially sought to use the Raeppli system to label multiple cells in different colors. While this did not pan out in our hands (likely due to insufficient activation of the reporters such that only one color was detected), it did allow us to measure the height of single cells. We also note that our staining of microtubules across a variety of timepoints shows apicobasal polarity consistent with observations from the Raeppli experiment. We explain the rationale for our approach in the Methods section:</p><p>“Although this system is designed to label cells with multiple colors (Kanca et al., 2014), we could only detect mTFP1 in heat-shocked tissues which we suspect is caused by insufficient activation of the other fluorescent reporters to detectible levels.” (subsection “Immunostaining and in situ hybridization”).</p><disp-quote content-type="editor-comment"><p>Second, the authors use VVA-FITC to label the aECM in other Drosophila species. Can the authors confirm that VVA labels the same aECM structures as Dumpy-YFP in <italic>D. melanogaster</italic>? If so, this would go a long way to validate VVA as a great proxy for Dumpy. It looks like there is one commercial source of VVL/VVA-TRITC (Glycomatrix.com) that could be used.</p></disp-quote><p>We tried a variety of lectins, including VVA-Texas Red and carefully compared these to DumpyYFP. Of these, VVA-FITC showed the most sharp/reproducible pattern that matched the Dumpy-YFP experiment. We now document more completely how this was determined in Figure 5, supplement 2, where we show how diagnostic aspects of the Dumpy pattern are mirrored by VVA-FITC. We also show in Figure 7—figure supplement 3 how the VVA signal is altered during Dumpy knockdown, further confirming that these signals are related by more than just a simple correlation. We acknowledge that the aECM is likely complex, and VVA almost certainly labels more than just Dumpy protein. However, our experiments suggest that VVA is a useful proxy for aECM, a previously unseen feature of genital development that can now be compared between species using this method.</p><disp-quote content-type="editor-comment"><p>Third, the authors look at Dumpy-YFP in a Dumpy RNAi background (Figure 7C-F). Shouldn't the RNAi target Dumpy-YFP and thus reduce its expression? This could change the interpretation of how the aECM associates with the ventral portion of the PL. Visualizing VVA here could strengthen this association.</p></disp-quote><p>We agree that Dumpy RNAi will target both wildtype and YFP tagged Dumpy in this experiment, and we realize that the previous wording had not made this point completely clear. Indeed, we sought to image Dumpy-YFP in the RNAi background to more carefully assess how the phenotype of Dumpy-RNAi manifests. That we see remaining connections in the knockdown confirms that the knockdown is not absolute, and shows how the tallest cells of the defective lobe are nevertheless those which maintain a connection with Dumpy-positive aECM. We modified the text as such to make the setup of this experiment more clear:</p><p>“Why would dorsal cells of the posterior lobe be more affected in a dumpy knockdown? We hypothesized that our posterior lobe specific driver is not strong enough to remove all deposits of Dumpy associated with the posterior lobe. To better understand this, we examined Dumpy:YFP localization in the dumpy knockdown background, in which both dumpy and dumpy:yfp should be targeted by the RNAi treatment.” (Subsection “Correlation of Dumpy deposition and cell height in the posterior lobe”.)</p><p>To address the reviewer’s point, we now show the VVA stain of Dumpy-RNAi in Figure 7 supplement 3. This experiment confirms that these remaining connections between the tallest portion of the posterior lobe and the aECM are the only obvious connections in the Dumpy-RNAi experiment.</p><disp-quote content-type="editor-comment"><p>Fourth, the PL appears quite different within the melanogaster clade (e.g. Glassford et al., 2015 shows the simulans has a very large PL and mauritiana a very small PL). How does the VVA-labeled aECM differ in these (or another) lobed species versus melanogaster? The similarities/differences could really strengthen the association of aECM organization and how the PL shape develops in lobed versus non-lobed species.</p></disp-quote><p>This is a great point. We see such an experiment as a useful demonstration that this mechanism is likely common to all lobed species, representing a morphogenetic process that coincides with the origin of this structure. As per the reviewer’s request, we have added an experimental stain of VVA to show that it is associated with the posterior lobe of another species (<italic>D. sechellia</italic>) whose morphology differs from <italic>D. melanogaster</italic> (Figure 5—figure supplement 3). Although the association correlates with the unique shape of the lobe in this species, we do feel that it would be an over-interpretation to conclude that this demonstrates that the aECM causes differences in lobe morphology. Studying such a problem would require a very different type of study of the genetic variants between these species, which is ongoing. However, the data do demonstrate that this is not a mechanism that only evolved in <italic>D. melanogaster</italic>.</p><disp-quote content-type="editor-comment"><p>Fifth, the authors conclude that Dumpy is required for proper posterior lobe formation. The data seems to support a role for Dumpy in sculpting and shaping the lobe, as the PL still forms in the dumpy RNAi animals. Or do the authors think that there is residual Dumpy in the RNAi condition that may account for the PL still forming, albeit as a smaller tissue with altered shape? Alternatively, does the GAL4 driver used to knockdown Dumpy have variable expression that can account for the variability in the PL phenotypes?</p></disp-quote><p>This is exactly what we think – when we knock down Dumpy, there are still Dumpy-YFP connections between the remaining tallest cells of the lobe and the centrally localized deposits of aECM (Figure 7D). These deposits of Dumpy in the genitalia are highly concentrated, and we have been unable to fully eliminate them by RNAi using a variety of drivers. We thus interpret the variability in <italic>dumpy-RNAi</italic> phenotype to be most consistent with variable efficiency of knockdown. We have revised the text to clarify this view:</p><p>“Why would dorsal cells of the posterior lobe be more affected in a dumpy knockdown? We hypothesized that our posterior lobe specific driver is not strong enough to remove all deposits of Dumpy associated with the posterior lobe.” (subsection “Correlation of Dumpy deposition and cell height in the posterior lobe”)</p><disp-quote content-type="editor-comment"><p>Lastly, the authors could further discuss the possibility that intrinsic factors such as the cytoskeleton may contribute to PL morphogenesis. The phenotypes caused by Dumpy RNAi are not completely penetrant (e.g. the PL still forms, but has a cleft). Do the authors think that a combination of extrinsic aECM along with cytoskeletal changes contribute? Is there any role for apical cell constriction of the epithelia, for example, in forming the crevice between the PL and clasper, and that this could help the PL form in these species?</p></disp-quote><p>We agree with the reviewer that multiple mechanisms are likely acting. We recognize the possible roles for intrinsic factors at multiple places: Results section, Discussion section:</p><p>“Furthermore, we envision that additional processes may also be contributing to the full morphogenesis of the posterior lobe, including potential intrinsic processes that may contribute to the cell shape changes we observe, such as the concentrations of cytoskeletal components we observed (Figure 3).”(subsection “Integrating cells into a pre-existing aECM network to generate morphological novelty”)</p><p>However, we focused our discussion primarily on the aECM, as very few studies have investigated extrinsic factors in the morphogenesis of epithelial structures, and comparative evolutionary studies of extrinsic factors are particularly rare. Thus, we felt that the focus on the aECM best emphasized the significance of our work, while fully acknowledging the existence of intrinsic mechanisms.</p><disp-quote content-type="editor-comment"><p>Reviewer #3:</p><p>Smith et al., present a thorough analysis of the morphogenesis of the posterior lobe of the <italic>Drosophila melanogaster</italic> male genitalia, and compare this morphogenetic process with non-lobed yet relatively closely related species. They find that the posterior lobe forms by a major increase in cell height; that the developing genitalia associate with an intricate apical extracellular matrix; and that a component of this matrix, Dumpy, has expanded in expression in lobed species and is required for lobe development in <italic>D. melanogaster</italic>. This work joins other recent work (reviewed in the Introduction) that is beginning to reveal the cellular-developmental basis of evolutionary change, and as the authors note their work is an important addition because of its focus on a novel structure rather than diversification of an ancestral structure.</p><p>The experiments appear to have been well conceived and rigorously executed, and the information they provide is an important starting point for understanding the evolution of this model novelty (both its origin and its subsequent diversification).</p></disp-quote><p>We thank the reviewer for their comment on the rigor and importance of our studies, as well as the thoughtful reactions and suggestions below.</p><disp-quote content-type="editor-comment"><p>Although this is solid work, I do have reservations about its ultimate impact. It is not clear whether changes in Dumpy expression were at all causative in the evolution of the posterior lobe. It is not entirely surprising that disrupting Dumpy, which attaches to the developing lobe, disrupts its ultimate morphology. What is missing is the complementary gain-of-function experiment: does expanding Dumpy expression in a non-lobed species create anything akin to a new lobe? Granted, this kind of experiment might not be feasible in a non-model fly, and if it could be done it might yield a hard-to-interpret negative result. But then the question remains: how do we solve the &quot;major looming challenge in evo-devo research&quot; that the authors note in their final sentence Discussion section) – what are the genetic changes underlying the cellular changes? Moving in that direction would indeed be a major advance, and it seems to me that the ultimate impact of the present work lies in how possible it will be to uncover the relevant genetic changes underlying the novelty. I don't have any specific experiments to suggest (and I'd be reluctant to suggest major new experiments anyway), but the uncertainty about making progress does constrain my enthusiasm somewhat. And in the meantime, the title (&quot;Expansion of aECM underlies the morphogenesis.…&quot;) is a bit misleading and should reflect more this uncertainty.</p></disp-quote><p>The comments above address several interconnected issues, which will be responded to in sequence below:</p><disp-quote content-type="editor-comment"><p>1) It is not clear whether changes in Dumpy expression were at all causative in the evolution of the posterior lobe.</p></disp-quote><p>We agree that it would be difficult to conclusively state that changes in Dumpy expression (either by <italic>cis</italic> or <italic>trans</italic> changes) were causative for generating the posterior lobe. However, that is not the main conclusion of this paper – our results show how the expansion of an apical ECM is associated with and required for the novel posterior lobe structure. It is important to recognize that the logic of our conclusions follow well-accepted practices in the study of novelty on macroevolutionary scales in the evo-devo field. Specifically, one describes a feature of an evolved trait (e.g. a gene expression pattern), shows how it is unique to the species bearing the trait, and then demonstrates (in the best case scenario) that the feature is required for trait formation. Similar inferences have been made to varying extents in the cases of beetle horns (Moczek and Rose, 2009), treehopper helmets (Fisher et al., 2019; Prud’homme et al., 2011), and butterfly pigment patterns (Kunte et al., 2014; Mazo-Vargas et al., 2017; Reed et al., 2011).</p><disp-quote content-type="editor-comment"><p>2) It is not entirely surprising that disrupting Dumpy, which attaches to the developing lobe, disrupts its ultimate morphology.</p></disp-quote><p>We agree that it is not surprising to see a phenotype once one knows about the vast aECM network associated with the posterior lobe that we uncovered. We would assert that what <italic>is</italic> surprising is the existence of this complex aECM network, which shows signs of evolving connections to cells of the posterior lobe.</p><disp-quote content-type="editor-comment"><p>3) What is missing is the complementary gain-of-function experiment: does expanding Dumpy expression in a non-lobed species create anything akin to a new lobe?</p></disp-quote><p>We would love to test the sufficiency of changes at Dumpy. However, there are three reasons that this would be nearly impossible to perform.</p><p>First, we strongly suspect the aECM is composed of multiple proteins in addition to Dumpy. This may include receptors, other ZP proteins, enzymes which modify these proteins and additional components that await discovery as the cell biology of the aECM is largely unexplored. Hence, we agree with the reviewer that the misexpression of just Dumpy is unlikely to drive a substantial response on its own. We discuss this possibility in more detail:</p><p>“In addition, while Dumpy may be required for the development of the posterior lobe, additional components of the aECM, including factors that remodel the aECM or receptors that anchor the aECM to the cells, are likely also needed.” (subsection “Integrating cells into a pre-existing aECM network to generate morphological novelty”)</p><p>Second, as the reviewer astutely notes, this experiment is technically difficult. We would need validated enhancer-Gal4 drivers to express Dumpy in a non-lobed species. Not just any driver would suffice, but one that has the correct spatiotemporal dynamics to connect lateral plate cells to other parts of the aECM network to mechanically couple these elements together.</p><p>Third, generating a UAS construct for dumpy itself is challenging. Dumpy encodes a 2.5 megadalton protein, and its CDNAs are 40-50 kilobases long. Thus generation of a UAS construct for this protein would likely require BAC-scale transgenic manipulations that have not been commonplace in <italic>Drosophila</italic> species outside of <italic>D. melanogaster</italic>, and in fact have not even been performed to our knowledge for <italic>dumpy</italic> in <italic>D. melanogaster</italic>. Given these limitations, we hope that the reviewers and editors can see how this is a massive project that would take several years for any group to accomplish, and may not lead to positive results for good reasons that do not invalidate our conclusions.</p><disp-quote content-type="editor-comment"><p>4) But then the question remains: how do we solve the &quot;major looming challenge in evo-devo research&quot; that the authors note in their final sentence (Discussion section) -- what are the genetic changes underlying the cellular changes? Moving in that direction would indeed be a major advance, and it seems to me that the ultimate impact of the present work lies in how possible it will be to uncover the relevant genetic changes underlying the novelty.</p></disp-quote><p>This is a comment on our final sentence of the discussion, which we wrote for the purpose of highlighting the future of this system. We are therefore excited about the reviewer’s enthusiasm for our stated vision. What we disagree with is the question of whether the work presented here represents a “major advance”. Clearly we think so (for several reasons):</p><p>- The posterior lobe is the only trait that can physically distinguish the most extensively studied multicellular species on the planet from its close relatives, and yet the cellular basis of its formation had not been studied.</p><p>- We find that the lobe is a single cell tall. This was unexpected to us and colleagues that we have discussed our findings with.</p><p>- The molecular basis of extreme apico-basal cell elongation is poorly understood.</p><p>- The apical ECM is also a poorly understood participant in epithelial morphogenesis, and has not been thus far implicated in morphological evolution.</p><p>- The genital aECM that we describe is unique among apical ECMs in its complexity (connecting to multiple structures), and for its previously undescribed role in extreme apico-basal elongation of epithelial cells.</p><disp-quote content-type="editor-comment"><p>5) And in the meantime, the title (&quot;Expansion of aECM underlies the morphogenesis.…&quot;) is a bit misleading and should reflect more this uncertainty.</p></disp-quote><p>We have revised the title to better reflect our conclusions:</p><p>”Evolutionary expansion of apical extracellular matrix is required for the elongation of cells in a novel structure”</p></body></sub-article></article>