To address our aforementioned hypothesis, we conducted broad lysine (K) screen of NEMO and substituted strategic K and D residues in tandem with alanines and asparagine, as indicated, (Figure 1A), to disrupt post-translational modifications of specific NEMO lysines, and hence, impede assembly of protein complexes and alter subsequent signaling. Wild type (WT) NEMO (NEMO^WT) and various NEMO K mutants (NEMO^K) were cloned in pMx-retroviral plasmid and expression of representative clones was confirmed in HEK293 cells (Figure 1B). Viral particles of these plasmids were produced using PLAT-E cells as described previously (Swarnkar et al., 2016). Protein expression of NEMO^WT and NEMO^K mutants was conducted in primary bone marrow macrophages (BMMs a.k.a osteoclast precursors). BMMs from WT or NEMO null cells (NM-cKO) expressing NEMO^K270A formed ample osteoclasts (OC), reminiscent of inflammatory condition, upon exposure to permissive concentration of RANKL, when compared with cell expressing NEMO^WT (NM-WT) (Figure 1C) or other forms of NEMO mutants (Figure 1—figure supplement 1A), suggesting sensitization of RANKL signaling in the absence of K270 residue in NEMO. These observations were further supported by increased OC surface area (Figure 1D), elevated expression of osteoclast differentiation markers (Figure 1E–J) and NF-κB activity (Figure 1K) in RANKL-treated NEMO^K270A expressing BMMs compared with NEMO^WT (NM-WT) and other NEMO forms. Expression of NEMO^K270A (also referred to in figure labels as NM-KA for brevity) in BMMs was robust and stable compared with NM-WT and other NEMO mutants (Figure 1—figure supplement 1B), despite infection of BMMs with equal number of viral particles. In fact, hyper osteoclastogenesis by NEMO^K270A was not due to higher expression of the transgenic NEMO protein because 1:20 dilution of viral particles which gave rise to protein expression levels approximating those of NEMO^WT and of other NEMO constructs still provoked heightened osteoclastogenesis (Figure 1—figure supplement 1A–B). These findings support the notion that intact K270 appears to be essential to restrain RANKL-induced excessive osteoclastogenesis.

To examine the functional relevance of this in vitro abnormal signaling by NEMO^K270A mutant in the in vivo state, we generated NEMO^K270A transgenic mice by cloning this construct in the Gt(ROSA)26Sor locus as described previously (Figure 2—figure supplement 1A; Otero et al., 2012; Swarnkar et al., 2014). Gt(ROSA)26Sor harboring NEMO^WT (ikbkg) was also generated as a control (Figure 2—figure supplement 1B). Mice were born at mendelian ratio, yet transgenic NEMO^K270A (ikbkg) knockin (KA) mice were significantly smaller in size compared with transgenic WT and control mice (Figure 2A). Upon closer analysis, we observed significant joint swelling (Figure 2A; arrows), splenomegaly, altered hematopoiesis (Figure 2B and Figure 3—figure supplement 1), and enhanced mortality at 6–8 weeks of age (not shown). Micro-computed tomography (uCT) scans and X-ray images revealed dramatic bone loss reaching 50% of BV/TV in severe cases (Figure 2C–I and Figure 2—figure supplement 1C–F), with no such loss in NEMO^WT transgenic mice (NM-WT-Tg) (Figure 2—figure supplement 1G–L). Notably, knee and ankle joints were severely damaged (Figure 2D:compare WT with KA, Figure 2—figure supplement 1C,E,F:arrows). Histological analysis showed that bone and joint sections contain exuberant number of TRAP-positive OCs with evidence of loss of trabecular bone and destruction of articular cartilage by osteoclasts and inflammatory cells, which may also result from synovial pannus formation containing osteoclasts (Figure 2J–K: arrows). This phenotype was further corroborated with increased circulating serum levels of TRAcP5b and carboxyl-terminal cross-linked telopeptide of type one collagen (CTX-1), both are well established markers of bone breakdown (Figure 2L–M).

The observed joint swelling, skeletal degeneration, splenomegaly, and osteolysis point to systemic inflammation and altered hematopoiesis. Indeed, multiplex ELISA revealed that NEMO^K270A mice express copious amounts of circulating inflammatory cytokines and chemokines in the serum (Figure 3A–L. At the cellular level, FACS analysis confirmed skewing of hematopoiesis toward myelopoiesis evident by abundant frequency of CMPs and GMPs, the immediate OC progenitors, in spleen and bone marrow compartments (Figure 3—figure supplement 1A–E; arrows). In addition, we detected a spike in neutrophils frequency in NEMO^K270A knockin mice (Figure 3—figure supplement 1F–J; arrows). These observations suggest that the ensuing inflammatory microenvironment in these mice alters hematopoiesis and exacerbates osteoclastogenesis. To provide additional mechanistic support for this proposition, ex-vivo osteoclastogenesis experiments showed that BMMs derived from NEMO^K270A knockin mice readily formed osteoclasts under RANKL permissive conditions (Figure 3M). Furthermore, expression of osteoclastogenic markers (Figure 3N–R) and activation of NF-κB (p-p65/RelA) (Figure 3S) were markedly elevated in RANKL-stimulated NEMO^K270A compared with WT cells.

To glean more mechanistic insights, we examined localization and cellular distribution of NEMO in HEK293 (PLAT-E) cells and BMMs. Whereas NEMO^WT was evenly diffused in the cytoplasm, NEMO^K270A transgene formed puncta juxtaposed to nuclei (Figure 4A; arrows) in PLAT-E cells. Electron microscopy scanning of RANKL-treated BMMs (x7,500 magnification) further showed that unlike WT cells, NEMO^K270A cells (panel labeled NM-KA) exhibit cytoplasmic aggregates (Figure 4—figure supplement 1A; yellow arrows), reminiscent of cytoplasmic debris. Thus, we surmised that K270A mutation of NEMO may have altered physiologic autophagy. To this end, in vitro RANKL-primed pre-OCs expressing NEMO^WT and NEMO^K270A fixed and stained with mouse NEMO and rabbit LC3 antibodies and Alexa Fluor secondary conjugates. LC3 is a bona-fide marker of autophagy, which is lapidated and degraded during physiologic autophagy. In contrast, sustained elevated levels of LC3 are observed during dysfunctional autophagy. The data summarized in Figure 4B and Figure 4—figure supplement 1B,C, showed that NEMO^K270A and LC3 accumulation was far greater than NEMO^WT and LC3 (arrows). This result was further mirrored by LC3 immunoblots (Figure 4C), pointing to a possible defect in autophagy flux in NEMO^K270A expressing cells. Even more convincingly, quantitative flow cytometry analysis of LC3-GFP levels in NEMO^WT and NEMO^K270A BMMs revealed marked accumulation of this protein in the latter cells (black dots) compared with WT cells (black dots) 6 hr post starvation (Figure 4D). Further analysis depicted in Figure 4E showed that starvation (yellow histograms) led to accumulation of LC3 in NEMO^K270A cells (shifted to the right) but not in WT cells (shifted to the left), which was reversed in WT cells in the presence of autophagy inhibitor chloroquine (pink histograms) to mimic NEMO^K270A cells, as expected. In fact, chloroquine exacerbated osteoclastogenesis by WT just as NEMO^K270A did (Figure 4—figure supplement 1D). Finally, a change in mean fluorescence intensity (MFI) of GFP showed pronounced decrease in LC3 in NEMO^WT (NM-WT) compared with meager change in NEMO^K270A (NM-KA) cells (Figure 4F). Consistent with these observation, levels of mTOR, a well-documented autophagy regulator, were elevated in NEMO^K270A (NM-KA) cells (Figure 4—figure supplement 1E). Taken together, quantitative FACS scatters and histograms confirm that NEMO^K270A cells have a defect in autophagy flux and aggregation of mutant NEMO that lends itself to heightened signaling.

Accumulation of NEMO^K270A aggregates (puncta) suggests a potential defect in lysosomal degradation due to restriction in autophagosomes. Thus, we examined localization of NEMO with the lysosome marker LAMP1 by immunofluorescence and by EM scanning. The data show that NEMO^K270A failed to localize with lysosomes (Figure 5A–B, Figure 5—figure supplement 1A–C), suggesting a defect in delivery of NEMO^K270A in autophagosome to lysosome. In fact, careful examination in EM images, showed robust expression of NEMO^K270A which was restricted to autophagosome (AP) structures compared to NEMO^WT observed in lysosomes (L) (Figure 5B). Finaly, we show that following RANKL stimulation of BMMs and subsequent starvation, NEMO puncta accumulation persisted in NEMO^K270A cells following serum starvation (akin to defective autophagy flux) yet puncta faded in WT cells following starvation as it undergoes processing by normal autophagy flux (Figure 5C–D). In sum, our data suggest that NEMO mutation at K270A disrupts the delivery of NEMO^K270A from autophagosome to lysosomes leading to accumulation of NEMO signals and subsequent buildup of inflammatory and osteoclastogenic signals.

Intact NEMO K270 residue is essential for post-translational modification (PTM) to regulate autophagy and osteoclastogenesis. To further elucidate the mechanisms underpinning inflammation and osteolysis in NEMO^K270A transgenic mice, we conducted proteomics on NEMO^WT and NEMO^K270A immunoprecipitates. Proteomic analysis revealed that expression of autophagy and PTM proteins, especially the ubiquitin-like protein ISG15, is altered in cells expressing NEMO^K270A mutant compared with WT cells (Figure 6A). Note that ISG15 is an IFN-stimulated gene and a ubiquitin-like protein that modulate cellular signals through a process termed ISGylation analogous to ubiquitination, but its function during osteoclastogenesis has not been described. Indeed, immunofluorescence images displayed NEMO(red)-ISG15(green) co-localization in vacuolar structures in NEMO^WT cells, yet such colocalization was markedly reduced in NEMO^K270A cells (Figure 6B). This observation was further confirmed using immunogold EM imaging demonstrating NEMO(18 nm)-ISG15(12 nm) interaction in autophagosome in NEMO^WT cells, which is then delivered into the lysosome structure following cell 6 hr serum starvation (Figure 6—figure supplement 1). In contrast, neither NEMO^K270A-ISG15 interaction nor the delivery of NEMO^K270A to lysosomes were detected in NEMO^K270A cells (Figure 6—figure supplement 1). Next, we provide biochemical evidence that whereas RANKL induced robust ISGylation in WT cells, this PTM was markedly reduced in NEMO^K270A lysates (Figure 6C), affirming the key role of NEMO post translational ISGylation in osteoclastogenesis, a novel finding that has not be described previously. Indeed, supporting its role as regulator of osteoclastogenesis, BMMs derived from ISG15 null mice generated far more osteoclasts than their WT counterparts (Figure 6D–E). This observation was further supported by in vivo data showing that bone mass (BV/TV) of mice lacking ISG15 is significantly lower than WT littermates, a finding further confirmed by increased levels of serum levels of TRAPc5b and CTX-1, both markers of bone resorption (data not shown).

Our findings thus far suggest that ISGylation of NEMO at K270 occurs in response to stimulation of BMMs with RANKL and appears essential for proper autophagy-regulation of NEMO. In addition, exuberant osteoclastogenesis in the absence of ISG15 or in NEMO^K270A, which is presumably hypo-ISGylated, events that we show lead to defective autophagy, strongly suggest that proper ISGylation of NEMO is required to turn-off NEMO signaling through autophagy to restrain osteoclastogenesis at the opportune time. To offer further support for this paradigm, retroviral expression of ISG15 inhibited osteoclastogenesis in WT cells. In contrast, exuberant osteoclastogenesis by NEMO^K270A cells, which we showed irresponsive to ISG15 and exhibit defective autophagy, remained unabated (Figure 7A–B). Mechanistically, we conducted flow cytometry analysis of LC3-GFP levels in NEMO^WT and NEMO^K270A BMMs overexpressing retroviral (pMX)-ISG15 in response to serum starvation-induced autophagy. The data show that LC3I/II levels were significantly reduced in ISG15-infected WT cells compared with minimal reduction in ISG15-infected NEMO^K270A cells (Figure 7C; compare black dots in top scatters of NM-WT and NM-KA; also compare shift to the left of yellow histogram (arrow) depicting NM-WT compared to negligible shift in orange histograms depicting NM-KA, both overexpressing ISG15). These changes are further quantified in Figure 7D, confirming significant reduction of LC3 levels in ISG15 overexpressing WT cells compared with ISG15 overexpressing NEMO^K270A cells, an indicative of defective autophagy in the latter cells. These observations suggest that failure of ISG15 to inhibit osteoclastogenesis in NEMO^K270A is likely due to its inability to properly tether NEMO^K270A to the autophagy-lysosomal machinery. To overcome this predicament, we fused ISG15 to RFP-NEMO^K270A and to RFP-NEMO^WT. Unlike NEMO^K270A alone, the ISG15::NEMO^K270A fused constructs inhibited osteoclastogenesis (Figure 7E–F; fusion construct) and corrected the autophagy flux evident by disappearance of punctate in NEMO^K270A cells (Figure 7G), reduced LC3 positive puncta and protein (Figure 7H–I, Figure 7—figure supplement 1), and co-localization of ISG15-NEMO^K270A with LAMP1 (lysosomes)(Figure 7J). Taken together, forced fusion of ISG15 to NEMO^K270A facilitates autophagy and inhibits exuberant osteoclastogenesis.

Ikbkg (Nemo)-floxed (NM-f/f) mice on a C57BL/6 background were provided by Dr. Manolis Pasparakis (Cologne, Germany). The NEMO-K270A-floxed and NEMO-WT-Tg-floxed mice were generated at the Mouse Genetics Core, Washington University (St. Louis, MO). To generate NEMO-K270A and NEMO-WT-floxed transgenic mice; cDNA encoding NEMO-K270A mutation and NEMO-WT preceded by a loxP-flanked STOP cassette was cloned into the ubiquitously expressed Gt(ROSA)26Sor locus (Figure 2—figure supplement 1A–B). In order to conditionally delete NEMO and express NEMO-K270A or NEMO-WT-Tg in myeloid cells, the NEMO f/f, NEMO-K270A-f/f and NEMO-WT-Tg f/f mice were crossed with Lyz2 (LysozymeM)-cre mice to generate LysM-cre-NEMO-flox (NM-cKO), LysM-cre-NEMO-K270A-f/f (NM-KA) and LysM-cre-NEMO-WT-f/f (NM-WT-Tg) respectively. RELA (NF-ĸB)-GFP-luciferase reporter mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). ISG15 (ISG15) knock-out mice were provided by Dr. Deborah Lenschow (Washington University in St. Louis, MO, USA). All the animals were housed at the Washington University School of Medicine barrier facility. All experimental protocols were carried out in accordance with the ethical guidelines approved by the Washington University School of Medicine Institutional Animal Care and Use Committee.

6–7 weeks old mice were sacrificed and Intact long bones (femur and tibia) from different animals were isolated. The bones were fixed overnight in 10% neutral buffered formalin. After fixation, they were washed with Phosphate Buffer Saline (PBS) and transferred to 70% ethanol (v/v). After fixation, bones were then scanned using Scanco Medical micro-CT systems (Scanco, Wayne, PA, USA) at the core facility at the Musculoskeletal Research Center at Washington University (St. Louis, MO). Briefly, Images were scanned at a resolution of 20 μm, slice increment 20 μm, voltage 55 kV, current 145 μA and exposure time of 200 ms. After scanning, contours were drawn from the growth plate toward trabecular regions of femur. Approximately 150 slices were analyzed. Later contours were drawn and 3D images were constructed. X-ray analysis of whole body and isolated knee joints were performed using Faxitron Ultra Focus 100 on automatic settings and at 3X and 5X magnification, respectively.

6–7 weeks old mice were sacrificed and long bones (femur and tibia) from different animals were isolated. The bones were fixed overnight in 10% neutral buffered formalin. After fixation, bones were then decalcified for 2 weeks in decalcification buffer (14% (w/v) EDTA, NH4OH, pH 7.2), dehydrated in graded ethanol (30–70%), cleared through xylene, and embedded in paraffin. Paraffin sections were stained for TRAP to visualize osteoclasts in the bone sections.

For exogenous expression studies, various constructs (cDNA) were cloned in retroviral pMX- retroviral vector (Cell biolabs, San Diego, CA). For different studies we generated pMX-GFP, pMX-flag-NEMO-WT, pMX-flag-NEMO-K270A-RFP, pMX-flag-NEMO-D304N, pMX-flag-NEMO-K319A, pMX-flag-NEMO-WT-GFP, pMX-HA-ISG15, pMX-flag-NEMO-WT-ISG15-GFP, pMX-flag-NEMO-K270A-ISG15-GFP. To generate retroviral production pMX-vectors were first transfected into PLAT-E cells (Cell biolabs, San Diego, CA) using xtreme gene 9 (Roche, San Francisco, CA, USA), followed by collection of virus containing media for next 2 days. This virus containing media with Polybrene (0.8 mg/ml) was used to transduce primary bone marrow cells.

Total bone marrow cells were isolated from the long bones (femur and tibia) and cultured in α-MEM media supplemented with 100 units/mL penicillin/streptomycin and 10% FBS (v/v) with 10 ng/mL M-CSF overnight to separate the adherent cells. One day after isolation, the non-adherent cells were collected and used as enriched bone marrow–derived macrophage (BMMs). BMMs were further cultured with M-CSF (20 ng/mL) and RANKL (50 ng/mL) for 4 days followed by fixation and TRAP staining using TRAP-Leukocyte kit (Sigma, St Louis, MO, USA). To investigate changes in autophagy, BMMs were cultured in M-CSF (20 ng/mL) and RANKL (50 ng/mL) for 2 days and used as pre-osteoclast (preOC) for different experiments. To investigate the effect of exogenous expression of different NEMO, NEMO mutants and ISG15, the BMMs after one day of isolation, were transduced with retroviral particles (generated using PLAT-E cells) and osteoclast differentiation was initiated after 2 day of viral transduction.

BMMs isolated form NF-ĸB-GFP-luciferase reporter mice were transduced with different pMX-retroviral particles. One day after transduction, the cells were cultured in the presence of M-CSF for two days, followed by RANKL treatment. Post RANKL transfection, cells were lysed and RelA-luciferase activity was measured using luciferase assay system (GoldBio, St. Louis, MO). The luciferase activity was normalized with total protein concentration (BCA assay, Pierce, Invitrogen).

BMMs and/or pre-OC (BMMs treated with RANKL for 2 days) were lysed in cell lysis buffer (Cell Signaling Technology, Danvers, MA, USA) post treatments. Protein concentration was determined using BCA (Pierce, Invitrogen) and equal amounts of protein was loaded onto SDS-PAGE. After transfer, and blocking in 5% BSA for 1 hr at room temperature, membranes were probed with primary antibodies in 5% BSA in PBS-Tween (1% v/v) for overnight and then washed with PBS-Tween (3x) and probed with secondary antibodies from LI-COR (Odyssey Imager; donkey anti-rabbit and anti-mouse) for 1 hr at room temperature. Membranes were then with PBST (3x) and scanned by using LI-COR Odyssey Imager (LI-COR Biosciences, Lincoln, NE, USA). Western blots were also performed (for LC3 and actin) using capillary-based immunoassay using the Wes-Simple Western method with the anti-rabbit detection module (Protein Simple). Protein expression was measured by chemiluminescence. The NEMO and ISG15 antibody were purchased from Santa Cruz, Dallas, TX, USA; phos-p65, p65 and LC3 antibodies were purchased from Cell Signaling Technology, Danvers, MA, USA; Flag and β-actin was purchased from Sigma, St. Louis, MO, USA.

Single cell suspensions from bone marrow were prepared by flushing the marrow out of femur and tibia of mice injected with BrdU (100 µl of 10 mg/mL solution of BrdU in sterile 1X DPBS) 1 days before sacrifice. Following red blood cell lysis, whole bone marrow cells were stained by Zombie UV dye to distinguish live/dead cells. Then bone marrow cells were resuspended in PBS with 2% FBS (FACS buffer), and further stained with biotin-conjugated lineage Ab cocktail (anti-B220, anti-CD3e, anti-Gr1, anti-Ter119). LSK⁺ (Lin^-Sca1⁺ckit^-) cells were stained with Ab cocktail (anti-Sca1 PerCP Cy5.5, anti-c-Kit APC eFluor 780, anti-CD34 FITC, and CD16/32 eFluor450). All FACS antibodies were purchased from either eBioscience, BioLegend (San Diego, CA, USA) or BD Bioscience (San Diego, CA, USA). Following incubation on ice for 45 min, Ab-labeled cells were washed with FACS buffer and subjected to flow cytometric analysis (BD X-20). Data were analyzed with FlowJo software (Tree Star Inc). To measure autophagy flux, flow cytometry analysis of LC3-GFP levels in NEMO WT and NEMO K270A preOC was performed, in response to autophagy induction by serum starvation. preOC were transduced with PMRX-GFP-LC3-RFP retrovirus generated in PLAT-E packing cells. Cells were serum starved for 6 hr and a flow cytometry analysis was done to detect GFP signal. Data were analyzed using FlowJo V10.1 software.

Blood from NM-WT and NM-KA mice were collected from submandibular vein and serum was separated using BD-Microtainer tubes. The serum inflammatory cytokine levels were measured using multiplex mouse cytokine kits (R and D Systems [Minneapolis, MN, USA] and Millipore [San Diego, CA, USA]). Serum cross‐linked telopeptide of type I collagen (CTX‐I) and TRAP levels were measured using the RatLaps (CTX-1) EIA and Mouse TRAP (TRAcP 5b) kits (Immunodiagnostic Systems, Boldon, UK) using manufacturer's protocol.

BMMs were cultured in presence of M-CSF (20 ng/mL) and RANKL (50 ng/mL) for 3 or 4 days as indicated in the figures. mRNA was isolated using PureLink RNA mini kit (Ambion, Grand Island, NY, USA) and cDNA were prepared using high capacity cDNA reverse transcription kit (Applied Biosystems). Realtime PCR was carried out on BioRad CFX96 real time system using iTaq universal SYBR green super-mix (BioRad, Hercules, CA, USA). mRNA expressions were normalized using β-actin as a housekeeping gene. The following primers were used for qPCR analysis. (ACP5) TRAP-F: CGACCATTGTTAGCCACATACG, TRAP-R: CACATAGCCCACACCGTTCTC, CTSK (CathepsinK)-F: ATGTGGGTGTTCAAGTTTCTGC, CTSK-R: CCACAAGATTCTGGGGACTC, MMP9-F: ACTGGGCTTAGATCATTCCAGCGT, MMP9-R: ACACCCACATTTGACGTCCAGAGA, NFATC1-F: CCGGGACGCCCATGCAATCTGTTAGT, NFATC1-R: GCGGGTGCCCTGAGAAAGCTACTCTC.

For immunolocalization at the ultrastructural level, preOC from NM-WT and NM-KA mice were fixed in 4% paraformaldehyde/0.05% glutaraldehyde (Polysciences Inc, Warrington, PA) in 100 mM PIPES/0.5 mM MgCl2, pH 7.2 for 1 hr at 4°C. Samples were then embedded in 10% gelatin and infiltrated overnight with 2.3M sucrose/20% polyvinyl pyrrolidone in PIPES/MgCl2 at 4°C. Samples were trimmed, frozen in liquid nitrogen, and sectioned with a Leica Ultra cut UCT7 cryo-ultramicrotome (Leica Microsystems Inc, Bannockburn, IL). Ultrathin sections of 50 nm were blocked with 5% FBS/5% NGS for 30 min and subsequently incubated with indicated primary antibodies for 1 hr at room temperature (Note that I tried some of the labeling with primary antibody overnight at 4°C). Following washes in block buffer, sections were incubated by the appropriate colloidal gold conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, Inc, West Grove, PA) for 1 hr. Sections were stained with 0.3% uranyl acetate/2% methyl cellulose and viewed on a JEOL 1200 EX transmission electron microscope (JEOL USA Inc, Peabody, MA) equipped with an AMT eight megapixel digital camera and AMT Image Capture Engine V602 software (Advanced Microscopy Techniques, Woburn, MA). All labeling experiments were conducted in parallel with controls omitting the primary antibody. These controls were consistently negative at the concentration of colloidal gold conjugated secondary antibodies used in these studies.

Post-treatments preOCs were fixed using 4% para-formaldehyde and 0.1% glutaraldehyde for 20 min at room temperature. Post-fixation the cells were washed using PBS (3x) followed by blocking and permeabilization using 0.5% Goat serum and 0.1% saponin (in PBS). Permeabilized cells were later incubated with Primary antibodies (LC3, NEMO, ISG15 and LAMP1 at 1:200 dilution) and Alexa-Fluor secondary antibodies diluted (1:2000) in antibody incubation buffer (1% BSA in 0.1% Saponin in PBS). Fluorescent images were taken at 40X magnification. The images were analyzed using Image-J software.

Statistical analyses were performed by using Student t test and Mann Whitney U test. Multiple treatments were analyzed by using one-way ANOVA. For Serum-cytokines analysis outliers were identified using ROUT method. Values are expressed as mean ± SD. P values are indicated where applicable. All the statistical analyses were done using GraphPad Prism software. Double-blind analysis was performed to analyze the IF and EM images. Number of experiment repeats, biological replicates and P values are indicted in figure legends.