<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">56931</article-id><article-id pub-id-type="doi">10.7554/eLife.56931</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>LKB1 coordinates neurite remodeling to drive synapse layer emergence in the outer retina</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-180458"><name><surname>Burger</surname><given-names>Courtney A</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund6"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-169862"><name><surname>Alevy</surname><given-names>Jonathan</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-169863"><name><surname>Casasent</surname><given-names>Anna K</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-180459"><name><surname>Jiang</surname><given-names>Danye</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-169865"><name><surname>Albrecht</surname><given-names>Nicholas E</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-8045-2290</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund7"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-169866"><name><surname>Liang</surname><given-names>Justine H</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-180460"><name><surname>Hirano</surname><given-names>Arlene A</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0001-8842-3582</contrib-id><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-153728"><name><surname>Brecha</surname><given-names>Nicholas C</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-168218"><name><surname>Samuel</surname><given-names>Melanie A</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-4804-2491</contrib-id><email>msamuel@bcm.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund9"/><xref ref-type="other" rid="fund8"/><xref ref-type="other" rid="fund2"/><xref ref-type="other" rid="fund3"/><xref ref-type="other" rid="fund4"/><xref ref-type="other" rid="fund5"/><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Neuroscience, Baylor College of Medicine</institution><addr-line><named-content content-type="city">Houston</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution>Huffington Center on Aging, Baylor College of Medicine</institution><addr-line><named-content content-type="city">Houston</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution>Department of Neurobiology, David Geffen School of Medicine at UCLA</institution><addr-line><named-content content-type="city">Los Angeles</named-content></addr-line><country>United States</country></aff><aff id="aff4"><label>4</label><institution>United States Veterans Administration Greater Los Angeles Healthcare System</institution><addr-line><named-content content-type="city">Los Angeles</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Westbrook</surname><given-names>Gary L</given-names></name><role>Reviewing Editor</role><aff><institution>Oregon Health and Science University</institution><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Westbrook</surname><given-names>Gary L</given-names></name><role>Senior Editor</role><aff><institution>Oregon Health and Science University</institution><country>United States</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>07</day><month>05</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e56931</elocation-id><history><date date-type="received" iso-8601-date="2020-03-25"><day>25</day><month>03</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2020-04-11"><day>11</day><month>04</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Burger et al</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Burger et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-56931-v2.pdf"/><abstract><p>Structural changes in pre and postsynaptic neurons that accompany synapse formation often temporally and spatially overlap. Thus, it has been difficult to resolve which processes drive patterned connectivity. To overcome this, we use the laminated outer murine retina. We identify the serine/threonine kinase LKB1 as a key driver of synapse layer emergence. The absence of LKB1 in the retina caused a marked mislocalization and delay in synapse layer formation. In parallel, LKB1 modulated postsynaptic horizontal cell refinement and presynaptic photoreceptor axon growth. Mislocalized horizontal cell processes contacted aberrant cone axons in LKB1 mutants. These defects coincided with altered synapse protein organization, and horizontal cell neurites were misdirected to ectopic synapse protein regions. Together, these data suggest that LKB1 instructs the timing and location of connectivity in the outer retina via coordinate regulation of pre and postsynaptic neuron structure and the localization of synapse-associated proteins.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>retina</kwd><kwd>synapse</kwd><kwd>axon</kwd><kwd>neuron</kwd><kwd>RIBEYE</kwd><kwd>VGLUT1</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Mouse</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000049</institution-id><institution>National Institute on Aging</institution></institution-wrap></funding-source><award-id>1R56AG061808-01</award-id><principal-award-recipient><name><surname>Samuel</surname><given-names>Melanie A</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000053</institution-id><institution>National Eye Institute</institution></institution-wrap></funding-source><award-id>R01 EY030458-01</award-id><principal-award-recipient><name><surname>Samuel</surname><given-names>Melanie A</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution>Ted Nash Long Life Foundation</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Samuel</surname><given-names>Melanie A</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000882</institution-id><institution>Brain Research Foundation</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Samuel</surname><given-names>Melanie A</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000053</institution-id><institution>National Eye Institute</institution></institution-wrap></funding-source><award-id>DP2EY027984-02</award-id><principal-award-recipient><name><surname>Samuel</surname><given-names>Melanie A</given-names></name></principal-award-recipient></award-group><award-group id="fund6"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000053</institution-id><institution>National Eye Institute</institution></institution-wrap></funding-source><award-id>T32EY007001</award-id><principal-award-recipient><name><surname>Burger</surname><given-names>Courtney A</given-names></name></principal-award-recipient></award-group><award-group id="fund7"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000057</institution-id><institution>National Institute of General Medical Sciences</institution></institution-wrap></funding-source><award-id>T32GM088129</award-id><principal-award-recipient><name><surname>Albrecht</surname><given-names>Nicholas E</given-names></name></principal-award-recipient></award-group><award-group id="fund8"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000049</institution-id><institution>National Institute on Aging</institution></institution-wrap></funding-source><award-id>R00AG044444</award-id><principal-award-recipient><name><surname>Samuel</surname><given-names>Melanie A</given-names></name></principal-award-recipient></award-group><award-group id="fund9"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100004917</institution-id><institution>Cancer Prevention Research Institute of Texas</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Samuel</surname><given-names>Melanie A</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>LKB1 instructs the timing and location of synapse layer emergence in the outer retina by coordinating the regulation of pre- and postsynaptic neuron maturation and transport of synapse-associated proteins.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>The precise spatial and temporal regulation of neuron maturation and synapse formation is crucial to ensure the fidelity of neural circuits. Many genes have been identified that regulate the initial steps of neuron maturation, including neuron fate and neurite development (<xref ref-type="bibr" rid="bib6">Bassett and Wallace, 2012</xref>; <xref ref-type="bibr" rid="bib11">Blackshaw et al., 2004</xref>; <xref ref-type="bibr" rid="bib45">Sainath and Gallo, 2015</xref>). However, we know little about how these processes contribute to the emergence of ordered connectivity. In part, this is because many neurons form a large number of synapses, and these synapses are broadly distributed along the neuron. This makes it difficult to resolve the cellular and molecular drivers of these events. To solve this problem, we use the outer retina since it is one of the few regions in the mammalian central nervous system (CNS) where neuronal cell types and their basic connectivity are known (<xref ref-type="bibr" rid="bib47">Sanes and Zipursky, 2010</xref>; <xref ref-type="bibr" rid="bib9">Behrens et al., 2016</xref>; <xref ref-type="bibr" rid="bib51">Shekhar et al., 2016</xref>). In adult animals, outer retina synapses are localized in a thin band known as the outer plexiform layer (OPL) which consists of sublamina comprised of cone and rod synapses. Because each photoreceptor forms connections at one large distal location, the relationship between the structure and maturation of both pre and postsynaptic neurons relative to their connectivity can be directly examined.</p><p>OPL development begins after birth and involves interactions between four neuron types: presynaptic rods and cones, and postsynaptic bipolar and horizontal cells (<xref ref-type="bibr" rid="bib13">Cepko, 2014</xref>). Cones and horizontal cells are the earliest born neurons in this circuit (~E12-E17), and they are the first to form contacts in the emerging OPL. Newborn cones extend axons (P0-P5), and in concert, horizontal cells restrict their arbors to form the horizontal structure for which they are named. These contacts coincide with displacement of nuclei from the cell-free nascent OPL, which is visible by P5. In parallel, synapse-specific proteins are trafficked to cell terminals, corresponding with the onset of synapse formation. OPL sublamination of rod and cone synapses begins at P14, and the OPL is mature by P30 (<xref ref-type="fig" rid="fig1">Figure 1A</xref>, <xref ref-type="bibr" rid="bib40">Olney, 1968</xref>; <xref ref-type="bibr" rid="bib12">Blanks et al., 1974</xref>; <xref ref-type="bibr" rid="bib43">Rich et al., 1997</xref>; <xref ref-type="bibr" rid="bib48">Sarin et al., 2018</xref>). These events generally mirror those of other laminated CNS regions, such as the cerebellum, where neurons remodel together to give rise to ordered connectivity (<xref ref-type="bibr" rid="bib37">Miterko et al., 2018</xref>). However, in the outer retina, as in the brain, fundamental questions remain: 1) what are the pathways that instruct synapse layer emergence; 2) how does the structure of each neural partner impact the development and connectivity of the other; and 3) how does neurite patterning influence the localization of nascent synapse proteins that may instruct ordered connectivity?</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>LKB1 is required for outer plexiform layer formation.</title><p>(<sc><bold>A</bold></sc>) Schematic of outer plexiform layer (OPL) development from P3 to P14. The outer retina contains developing rods (yellow) and cones (green) that extend axons beginning at P1. Cones form contacts with horizontal cell interneurons (blue) at P3, where nascent synapse patches emerge at sites of contact (red circles), followed by synaptogenesis beginning at P5. This corresponds with OPL formation. Rods begin to form synaptic connections with horizontal cells by P8, and bipolar cells also begin to become integrated at this time (orange, rod bipolars; dark green, cone bipolars). Ribbon synapse formation is complete and OPL sublamination begins by P14. (ONBL, outer neuroblast layer; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer). (<bold>B–D</bold>) In control animals, the nascent OPL is first visible at P3 when it appears as small discontinuous gaps in the nuclear staining (DAPI, grey; arrowheads point to patches). These patches are distinct from gaps caused by horizontal cell bodies (magenta stars). In Lkb1-Ret animals, these OPL patches are small and located closer to the apical surface (<bold>B</bold>) and are reduced in number (<bold>C,</bold> n = 322 control cells and n = 252 Lkb1-Ret cells). N = 4 control and N = 4 Lkb1-Ret animals. At P5, nascent patches converge in control animals to generate a single continuous layer, forming the OPL. In Lkb1-Ret animals, the OPL was discontinuous and patches were misaligned and located closer to the apical surface (<bold>D</bold> n = 487 control cells and n = 339 Lkb1-Ret cells). This resulted in a marked decreased in total OPL area (<bold>E</bold>). N = 4 control and N = 8 Lkb1-Ret animals. Scale bars = 25 µm. Data are represented as a distribution of the distance of patches from the apical surface (<bold>B,D</bold>, ***p&lt;0.001, unpaired two-tailed Student’s <italic>t</italic> test) or as the mean ± the s.e.m. (<bold>E,</bold> **p&lt;0.01, non-parametric Mann-Whitney Rank Sum U-test).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig1-v2.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title><italic>Stk11</italic> is highly expressed throughout the retina in early development.</title><p>In situ hybridization pattern of <italic>Stk11</italic> over retina development. (<bold>A–B</bold>) Representative fluorescent in situ hybridization images (<bold>A</bold>) and quantification (<bold>B</bold>) of <italic>Stk11</italic> expression patterns across development at P2, P5, P8, and P14 in control mice. Data in (<bold>B</bold>) are presented as a heatmap indicating the corrected total cell fluorescence of each retinal layer occupied by the signal using a gradient scale where white to blue depicts low to high levels of fluorescent intensity (0–2500, respectively), and black indicates enrichment levels higher than 2500. Scale bars = 25 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig1-figsupp1-v2.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 2.</label><caption><title>AMPK does not regulate outer retina development.</title><p>Outer retina emergence and cellular morphology were visualized in Ampk-Ret mice and littermate controls at P5. (<bold>A–C</bold>) Representative images (<bold>A</bold>) and quantification of OPL emergence (<bold>B</bold>, DAPI, grey) and distance (<bold>C</bold>) of OPL patches from the apical surface at P5 in Ampk-Ret and littermate controls. The OPL emerges at the proper time and location in Ampk-Ret animals (<bold>B</bold>) and is located the same distance from the apical surface as controls (<bold>C</bold>, n = 187 control cells and n = 182 Ampk-Ret cells). N = 3 control and Ampk-Ret animals. (<bold>D–E</bold>) Representative images (<bold>D</bold>) and quantification (<bold>E</bold>) of cone (OPN1SW, green) morphology at P5. Ampk-Ret cones extend their axons to same length as control mice. N = 3 control and Ampk-Ret animals. (<bold>F–G</bold>) Representative images (F) and quantification (G) of horizontal cell (calbindin, cyan) morphology at P5. Ampk-Ret horizontal cells restrict their arbors, spanning the same area as control mice. N = 3 control and Ampk-Ret animals. Scale bars = 25 µm. Data are represented as the mean ± the s.e.m. (<bold>B, E</bold>, p&gt;0.05, non-parametric Mann-Whitney Rank Sum U-test), as a distribution of the distance of patches from the apical surface (<bold>C,</bold> p&gt;0.05, unpaired two-tailed Student’s <italic>t</italic> test), or as the mean fluorescence relative to the distance from the apical surface (<bold>G</bold>, p&gt;0.05, unpaired two-tailed Student’s <italic>t</italic> test).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig1-figsupp2-v2.tif"/></fig></fig-group><p>To begin to resolve these questions, we focused on the serine/threonine kinase LKB1 (Liver Kinase B1, also called STK11 or Par4; encoded by <italic>Stk11</italic>). LKB1 regulates 14 kinases of the AMPK subfamily (AMPKα1/α2, SAD-A/B, NUAK1/2, SIK1-3, MARK1-4 and SNRK, <xref ref-type="bibr" rid="bib34">Lizcano et al., 2004</xref>; <xref ref-type="bibr" rid="bib25">Jaleel et al., 2005</xref>) and has cell-specific roles in polarity, neuron maturation, and axon formation (<xref ref-type="bibr" rid="bib30">Kuwako and Okano, 2018</xref>; <xref ref-type="bibr" rid="bib52">Shelly et al., 2007</xref>; <xref ref-type="bibr" rid="bib4">Barnes et al., 2007</xref>; <xref ref-type="bibr" rid="bib16">Courchet et al., 2013</xref>). However, it is unknown whether or how LKB1-driven axon emergence impacts synapse localization. Given its high levels of expression in the retina (<xref ref-type="bibr" rid="bib46">Samuel et al., 2014</xref>), we asked whether LKB1 may participate in programing outer retina connectivity and if these alterations might inform the cellular and molecular processes that drive synapse layer emergence. We show that loss of LKB1 delays formation of the OPL. This defect is accompanied by abnormal horizontal cell neurite restriction, with apical and basal processes that extend beyond the nascent synapse region. In concert, LKB1 mutants showed abnormal cone axon extension, and mislocalized axons were contacted by aberrant horizontal cell processes. Cone axon extension deficits were accompanied by specific defects in synaptic protein localization. In particular, we found that RIBEYE and VGLUT1 accumulated in the somas of LKB1 mutant cones and failed to properly reach the axon terminal. Misplaced synapse proteins were contacted by ectopic horizontal cell neurites. Together, these data suggest a model in which LKB1-mediated presynaptic axon extension and postsynaptic neurite refinement are coordinately required for precisely refining neuron structure and synapse protein localization.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>LKB1 regulates the timing of synapse layer emergence</title><p>In control animals the nascent OPL first appears as small discontinuous patches at postnatal day 3 (P3), where horizontal cell neurites and cone terminals begin to form contacts. These patches begin to align and exclude the dense nuclei that populate the outer retina at P5. A single cell-free OPL layer forms as patches fully converge by P8 and the cellular boundaries of the ONL and INL become defined (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Correspondingly, we found that the levels of <italic>Stk11</italic> mRNA are highest in early development at P5 when synapses begin to emerge (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>), with expression present in both inner and outer retina. To determine the role of LKB1 in the emergence of synaptic connectivity we generated full retina LKB1 knockout mice using the conditional allele <italic>Stk11<sup>F/F</sup></italic> (previously called <italic>Lkb1<sup>F/F</sup>,</italic> <xref ref-type="bibr" rid="bib3">Bardeesy et al., 2002</xref>) and the <italic>Vsx2-cre</italic> line (previously called <italic>Chx10-cre,</italic> <xref ref-type="bibr" rid="bib44">Rowan and Cepko, 2004</xref>) that expresses <italic>Cre</italic> in embryonic retinal progenitors to generate <italic>Stk11<sup>F/F</sup>; Vsx2-Cre</italic> animals. This line is hereafter referred to as Lkb1-Ret. Defects in LKB1 mutant retinas became apparent as the synapse layer began to emerge. While control animals displayed nuclei-free patches at P3 that are localized 39.1 ± 0.3 µm away from the apical side of the outer retina, in Lkb1-Ret mice OPL patches were small and difficult to visualize (<xref ref-type="fig" rid="fig1">Figure 1B</xref>), displaced closer to the apical retinal surface relative to control mice (29.6 ± 0.4 µm away, <italic>p</italic>&lt;0.0001), and reduced in number (40.1% reduction, <italic>p</italic>=0.0286, <xref ref-type="fig" rid="fig1">Figure 1C</xref>). At P5, these patches converged in control animals to form a single layer 54.1 ± 0.2 µm away from the apical surface of the retina, forming the OPL (<xref ref-type="fig" rid="fig1">Figure 1B, D</xref>). In contrast, the outer retina synapse layer was largely absent from Lkb1-Ret animals at this time point, appearing instead as discontinuous regions that were misaligned and located closer to the apical retina surface (36.2 ± 0.3 µm away, <italic>p</italic>&lt;0.0001, <xref ref-type="fig" rid="fig1">Figure 1B, D</xref>). These defects were accompanied by a 56.0% reduction in OPL area (<italic>p</italic>=0.004; <xref ref-type="fig" rid="fig1">Figure 1E</xref>).</p><p>We next examined OPL segregation, which occurs as nuclei become excluded from the synaptic layer and migrate into the outer and inner nuclear layers. To define the borders of the OPL, we first stained with DAPI to visualize nuclei. The OPL is precisely segregated at P8 in control animals, and nuclei are absent from the OPL (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). In contrast, Lkb1-Ret animals display mislocalized nuclei within the OPL, with an 85.6% increase in ectopic nuclei (p=0.0294, <xref ref-type="fig" rid="fig2">Figure 2A–B</xref>). To visualize how these defects impacted neuron segregation, we labeled rods and bipolar cells whose nuclei reside at the upper and lower OPL boundaries. In control animals, cellular boundaries are clearly defined with rods appropriately localized to the ONL and bipolars localized to the INL (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). In contrast, Lkb1-Ret animals displayed defects in rod neuron segregation. This resulted in some rod nuclei remaining below the nascent OPL and a 57.8% reduction in total OPL area (p=0.0286, <xref ref-type="fig" rid="fig2">Figure 2C–D</xref>). These alterations do not appear to be due to differences in neuron numbers, as both pre and postsynaptic outer retina neuron populations are present in equal numbers in LKB1 mutants (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). These data indicate that LKB1 coordinately regulates OPL emergence and nuclear segregation.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>The outer plexiform layer is disorganized in LKB1 mutant animals.</title><p>(<bold>A-B</bold>) The OPL was visualized in Lkb1-Ret animals and control littermates at P8 following staining with DAPI. The OPL of Lkb1-Ret animals contains ectopic nuclei (arrows, <bold>A</bold>) that were increased in number relative to controls (<bold>B</bold>). (<bold>C–D</bold>) Cellular segregation was visualized using antibodies that demark the upper (rods, rhodopsin, blue) and lower (bipolar cells, Chx10, magenta) OPL boundaries. Lkb1-Ret animals displayed defects in neuron segregation with some rod nuclei remaining below the nascent OPL (<bold>C</bold>). The total area of the OPL (<bold>D</bold>) was also decreased in Lkb1-Ret animals relative to littermate controls. N = 4 control and N = 4 Lkb1-Ret animals. Scale bar = 25 µm. Data are represented as the mean ± the s.e.m. *p&lt;0.05, non-parametric Mann-Whitney Rank Sum U-test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Outer retina neuron cell numbers are normal in LKB1 mutant animals.</title><p>(<bold>A–C</bold>) The number of cone photoreceptors (<bold>A</bold>) and horizontal cells (<bold>B</bold>) were quantified at P5, and the number of bipolar cells (<bold>C</bold>) were quantified at P8. There was no difference in the total number of these neuron populations between control and Lkb1-Ret mice. N ≥ 3 control and N ≥ 3 Lkb1-Ret animals. Data are represented as the mean ± the s.e.m. p&gt;0.05, non-parametric Mann-Whitney Rank Sum U-test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig2-figsupp1-v2.tif"/></fig></fig-group><p>We next asked whether LKB1 mediated outer retina synapse emergence involves similar pathways to those in synapse decline. We previously showed in old age that AMPK acts downstream of LKB1 to regulate rod synapse maintenance (<xref ref-type="bibr" rid="bib46">Samuel et al., 2014</xref>). To test the role of AMPK in development, we generated animals in which both alpha subunits of <italic>Ampk</italic> (<italic>Prkaa1 and Prkaa2</italic>) were specifically deleted in retina (<italic>Prkaa1<sup>F/F</sup>Prkaa2<sup>F/F</sup>; Vsx2-Cre</italic>, <xref ref-type="bibr" rid="bib38">Nakada et al., 2010</xref>, hereafter referred to as Ampk-Ret). AMPK was dispensable for outer retina synapse emergence: Ampk-Ret mice showed no observable defects in OPL emergence or organization at P5, and the OPL was present at the proper location and time (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). In addition, outer retina neurons were morphologically normal at this time point (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). Thus, the downstream drivers of outer retina synapse emergence differ from those involved in synapse maintenance and aging.</p></sec><sec id="s2-2"><title>LKB1 regulates horizontal cell neurite refinement</title><p>Horizontal cells and cones are the first to arrive and form contacts in the nascent OPL in a process that involves extensive neurite remodeling (<xref ref-type="bibr" rid="bib48">Sarin et al., 2018</xref>; <xref ref-type="bibr" rid="bib24">Huckfeldt et al., 2009</xref>; <xref ref-type="bibr" rid="bib5">Barrasso et al., 2018</xref>). We thus examined the morphology of these neurons (<xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). In control animals, horizontal cells first emerge as radial neurons (<xref ref-type="bibr" rid="bib49">Schubert et al., 2010</xref>), exhibiting long apical and basal neurites (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). Between P3 and P5, horizontal cells then undergo a process of neurite refinement in which apically and basally targeted neurites become lateralized through largely unknown mechanisms to form a horizontal neural structure (<xref ref-type="bibr" rid="bib42">Poché and Reese, 2009</xref>). At P3, Lkb1-Ret horizontal cells were structurally indistinguishable from control animals (p<italic>≥</italic>0.12, <xref ref-type="fig" rid="fig3">Figure 3A–B</xref> and <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–B</xref>). However, by P5 Lkb1-Ret horizontal cells displayed marked defects, extending numerous, long branches into the outer and inner retina (<xref ref-type="fig" rid="fig3">Figure 3C</xref> and <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1C–D</xref>). This resulted in horizontal cell processes spanning a significantly increased retina area relative to controls (p&lt;0.05, <xref ref-type="fig" rid="fig3">Figure 3D</xref>). Horizontal cell neurites became largely lateralized in Lkb1-Ret animals by P8, although occasional, long apical horizontal neurites persisted at this timepoint (<xref ref-type="fig" rid="fig3">Figure 3E–F</xref>).</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Horizontal cell neurite restriction is altered with loss of LKB1.</title><p>Horizontal cells and their neurites were identified in Lkb1-Ret and littermate controls during postnatal development using an antibody to calbindin (cyan). (<bold>A–B</bold>) Representative and reconstructed images (<bold>A</bold>) and quantification (<bold>B</bold>) of horizontal cell morphology at P3. Horizontal cells in both Lkb1-Ret and control animals exhibit stellate morphologies, and no significant structural differences were observed. N = 3 littermate controls and N = 7 Lkb1-Ret animals. (<bold>C–D</bold>) Representative and reconstructed images (<bold>C</bold>) and quantification (<bold>D</bold>) of horizontal cell morphology at P5. Lkb1-Ret horizontal cells fail to restrict their arbors at P5 (arrows) and instead display a marked radial morphology that results in horizontal processes spanning a significantly increased retinal area. N = 4 control and N = 8 Lkb1-Ret animals. (<bold>E–F</bold>) Representative and reconstructed images (<bold>E</bold>) and quantification (<bold>F</bold>) of horizontal cell morphology at P8. Horizontal cells in Lkb1-Ret animals refined their arbors, though occasional extensions into the outer retina were observed (arrow). N = 4 control and N = 4 Lkb1-Ret animals. Scale bars = 25 µm. Data are represented as the mean fluorescence relative to the distance from the apical surface. *p&lt;0.05, unpaired two-tailed Student’s <italic>t</italic> test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Horizontal cells fail to restrict their neurites at the appropriate developmental time.</title><p>Horizontal cells and their neurites were reconstructed in Lkb1-Ret and littermate controls during postnatal development using an antibody to calbindin (cyan). (<bold>A–B</bold>) Reconstructed images (<bold>A</bold>) and quantification (<bold>B</bold>) of the number of apical neurites per horizontal cell at P3. No significant structural differences were observed. N = 3 control and Lkb1-Ret animals. (<bold>C–D</bold>) Reconstructed images (<bold>C</bold>) and quantification (<bold>D</bold>) of the number of apical neurites per horizontal cell at P5. There is an increase in the number of apical neurites in Lkb1-Ret horizontal cells relative to controls, signifying their failure to restrict their arbors at P5. N = 4 control and N = 4 Lkb1-Ret animals. Scale bars = 25 µm. Data are represented as the mean ± the s.e.m. *p&lt;0.05, non-parametric Mann-Whitney Rank Sum U test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig3-figsupp1-v2.tif"/></fig></fig-group><p>We next investigated whether the defects in horizontal cell refinement represented a cell-intrinsic role for LKB1 in shaping horizontal cell architecture. To examine this, we selectively deleted <italic>Stk11</italic> from horizontal cells early in development (P2, <xref ref-type="bibr" rid="bib5">Barrasso et al., 2018</xref>) using a transgenic line that expresses <italic>Cre</italic> only in these neurons (<italic>Gja10-ires-iCre,</italic> previously called <italic>Cx57-ires-iCre,</italic> <xref ref-type="bibr" rid="bib21">Hirano et al., 2016</xref>) to generate <italic>Stk11<sup>F/F</sup>;Gja10-ires-iCre </italic>animals. This line is hereafter referred to as Lkb1-HC. In situ for <italic>Stk11</italic> in Lkb1-HC retina confirmed cell-specific deletion of this transcript in horizontal cells (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). Lkb1-HC mice showed no observable defects in OPL emergence or organization at P5, and the OPL was present at the proper location and time (<xref ref-type="fig" rid="fig4">Figure 4A–C</xref>). In addition, horizontal cells were morphologically normal at this time point (<xref ref-type="fig" rid="fig4">Figure 4D</xref>), and horizontal cells properly refined their neurites to the OPL (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). These data indicate that LKB1 is dispensable in horizontal cells for the refinement of their arbors and for OPL emergence.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>LKB1 is not required in horizontal cells to restrict their neurites.</title><p>Outer retina emergence and horizontal cell restriction were visualized in Lkb1-HC and littermate controls during postnatal development at P5. (<bold>A–C</bold>) Representative images (<bold>A</bold>) and quantification (<bold>B</bold>) of OPL emergence (DAPI, grey) and (<bold>C</bold>) distance of OPL patches from the apical surface at P5 in Lkb1-HC and littermate controls. The OPL emerges in Lkb1-HC animals at the proper time and location (<bold>B</bold>) and is located the same distance from the apical surface as controls (<bold>C</bold>, n = 239 control cells and n = 235 Lkb1-HC cells). N = 4 littermate controls and N = 3 Lkb1-HC animals. (<bold>D–E</bold>) Representative images (<bold>D</bold>) and quantification (<bold>E</bold>) of horizontal cell (calbindin, cyan) morphology at P5. Lkb1-HC horizontal cells restrict their arbors, spanning the same area as control mice. N = 4 control and N = 3 Lkb1-HC animals. Scale bars = 25 µm. Data are represented as the mean ± the s.e.m. (<bold>B</bold>, p&gt;0.05, non-parametric Mann-Whitney Rank Sum U-test), as a distribution of the distance of patches from the apical surface (<bold>C</bold>, p&gt;0.05, unpaired two-tailed Student’s <italic>t</italic> test), or as the mean fluorescence relative to the distance from the apical surface (<bold>E</bold>, p&gt;0.05, unpaired two-tailed Student’s <italic>t</italic> test).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title><italic>Stk11</italic> is lost in horizontal cells in Lkb1-HC animals.</title><p>In situ hybridization of <italic>Stk11</italic> in horizontal cells. (<bold>A–B</bold>) Representative fluorescent in situ hybridization images (<bold>A</bold>) and quantification (<bold>B</bold>) of <italic>Stk11</italic> co-stained with calbindin to label horizontal cells in control and Lkb1-HC mice at P5. A significant reduction in <italic>Stk11</italic> puncta in Lkb1-HC mice compared to control is observed. N = 2 control and Lkb1-HC animals (15 and 9 cells, respectively). Scale bars = 25 µm. Data are represented as the mean ± the s.e.m. ***p&lt;0.0001, non-parametric Mann-Whitney Rank Sum U-test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig4-figsupp1-v2.tif"/></fig></fig-group></sec><sec id="s2-3"><title>Cone axon extension and maturation are disrupted in LKB1 mutant mice</title><p>What might be responsible for the defects in horizontal cell refinement? Given the high levels of LKB1 in outer retina neurons at P5, we questioned whether horizontal cell presynaptic partners might play a role in the horizontal cell defects we observed. In wild type animals, horizontal cells exclusively form contacts with developing presynaptic cone axons from P3-P5 as horizontal cells lateralize, while rod contacts occur later (&gt;P8, <xref ref-type="bibr" rid="bib6">Bassett and Wallace, 2012</xref>). We thus focused our attention on cones. To examine these cells, we used cone-specific antibodies to resolve the positioning of cone axons (<xref ref-type="table" rid="table1">Table 1</xref>). In control mice, cone axon extension was present at P1, and by P3, cones had reached 70.4% of their terminal axon length (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). Axon extension was complete by P8 when cones reached their terminal axon length (34.7 ± 0.6 µm). Lkb1-Ret cones showed marked defects in cone axon extension. Mutant cones failed to properly develop axons at P1. Instead, axon extension was reduced, resulting in a decrease in average terminal axon length throughout the first postnatal week (68.3%, 57.7%, and 56.0% reduction in axon length relative to controls at P1, P3, and P5, p≤0.02, <xref ref-type="fig" rid="fig5">Figure 5A–E</xref>). Moreover, a large number of Lkb1-Ret cones lacked axons at early time points (<xref ref-type="fig" rid="fig5">Figure 5C–E,G</xref>). By P8, the majority of Lkb1-Ret cones had extended axons (<xref ref-type="fig" rid="fig5">Figure 5F,G</xref>), but they remained shorter than control cones (83.5% of the length of controls), and a small fraction still failed to reach the OPL (3.5%, p=0.0286, <xref ref-type="fig" rid="fig5">Figure 5H</xref>). Together, these data indicate that LKB1 is coordinately required for cone axon extension and restriction of horizontal cell process to enable OPL emergence.</p><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Cone axon extension requires LKB1.</title><p>Cones and their axons were identified in Lkb1-Ret animals and littermate controls during postnatal development using an antibody to OPN1SW (green). (<bold>A–B</bold>) Representative images (<bold>A</bold>) and reconstructed cones (<bold>B</bold>) over development. (<bold>C–F</bold>) The distribution of the length of cone axons in control and Lkb1-Ret animals was quantified at P1 (<bold>C</bold>, n = 376 control cells and n = 515 Lkb1-Ret cells), P3 (<bold>D</bold>, n = 488 control cells and n = 478 Lkb1-Ret cells), and P5 (<bold>E</bold>, n = 572 control cells and n = 505 Lkb1-Ret cells). At each time point, Lkb1-Ret cones were shorter, and many also lacked axons. By P8, the distribution of length of cone axons in control and Lkb1-Ret animals was normal (<bold>F</bold>, n = 560 control cells and n = 552 Lkb1-Ret cells). (<bold>G</bold>) Quantification of cone axons over development. Lkb1-Ret animals displayed defects in cone axon extension beginning at P1 that persisted at P3 and P5, resulting in a significant decrease in axon length (N ≥ 4 control and N ≥ 5 Lkb1-Ret animals). (<bold>H</bold>) OPL localization of cone terminals was quantified at P8. There was a significant increase in the number of cones that failed to reach the OPL (N = 4 control and N = 4 Lkb1-Ret). Scale bars = 25 µm (<bold>A</bold>) and 5 µm (<bold>B</bold>). Data are represented as the mean ± the s.e.m. (<bold>G–H</bold>) or as the distribution of the length of cone axons (<bold>C–F</bold>). ***p&lt;0.001, **p&lt;0.01, *p&lt;0.05, non-parametric Mann-Whitney Rank Sum U-test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig5-v2.tif"/></fig><table-wrap id="table1" position="float"><label>Table 1.</label><caption><title>Antibodies used in LKB1 mutant tissue analysis.</title><p>Antibodies were utilized that label individual neuron populations and synapses in the outer retina.</p></caption><table frame="hsides" rules="groups"><thead><tr><th>Antibody name</th><th>Immunogen</th><th>Labeling specificity</th><th>Source</th><th>Concentration</th></tr></thead><tbody><tr><td>Calbindin D-28k</td><td>Full-length recombinant human Calbindin D-28K</td><td>Horizontal cells; amacrine cells; retinal ganglion cells</td><td>Novus biologicals; chicken polyclonal; NBP2-50028; no RRID</td><td>1:2000</td></tr><tr><td>Calbindin D-28k</td><td>Recombinant ratcalbindin D-28k (CB)</td><td>Horizontal cells; amacrine cells; retinal ganglion cells</td><td>Swant; rabbit polyclonal; CB38; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_10000340">AB_10000340</ext-link></td><td>1:10,000</td></tr><tr><td>Chx10</td><td>Recombinant protein derived from the N terminal of the human Chx10 protein conjugated to KLH (aa 1–131)</td><td>Bipolar cells</td><td>Exalpha; sheep polyclonal; X1180P; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2314191">AB_2314191</ext-link></td><td>1:300</td></tr><tr><td>OPN1SW</td><td>Peptide mapping at the N-terminus of the opsin protein encoded by OPN1SW of human origin</td><td>Cone photoreceptors</td><td>Santa Cruz; goat polyclonal; sc-14363; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2158332">AB_2158332</ext-link></td><td>1:500</td></tr><tr><td>Piccolo</td><td>Recombinant protein corresponding to AA 4439 to 4776 from rat Piccolo</td><td>Ribbon synapses</td><td>Synaptic Systems; rabbit polyclonal; 142 003; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2160182">AB_2160182</ext-link></td><td>1:500</td></tr><tr><td>Protein Kinase C alpha (PKCa)</td><td>Purified bovine brain protein kinase C</td><td>Rod bipolar cells</td><td>Abcam; mouse monoclonal; ab31; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_303507">AB_303507</ext-link></td><td>1:500</td></tr><tr><td>PSD95</td><td>Synthetic peptide corresponding to Mouse PSD95 aa1–100 (C-terminal) conjugated to keyhole limpet haemocyanin.</td><td>Photoreceptor terminals</td><td>Abcam; goat polyclonal; ab12093; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_298846">AB_298846</ext-link></td><td>1:500</td></tr><tr><td>Rhodopsin</td><td>Recombinant fragment corresponding to Bovine Rhodopsin (N terminal)</td><td>Rod photoreceptors</td><td>Abcam; mouse monoclonal; ab98887; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_10696805">AB_10696805</ext-link></td><td>1:500</td></tr><tr><td>RIBEYE</td><td>Recombinant protein corresponding to AA95 to 207 from rat Ribeye</td><td>Ribbon synapses</td><td>Synaptic Systems; rabbit polyclonal; 192 103; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2086775">AB_2086775</ext-link></td><td>1:500</td></tr><tr><td>VGLUT1</td><td>Recombinant protein corresponding to AA456 to 560 from rat VGLUT1</td><td>Photoreceptor terminals</td><td>Synaptic Systems; rabbit polyclonal; 135 302; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_887877">AB_887877</ext-link></td><td>1:500</td></tr></tbody></table></table-wrap><p>We then examined the contacts between horizontal cells and cones. We reasoned that if cone and horizontal cell interaction modulates synapse layer emergence, then: 1) normal cone axon extension should be accompanied by a coordinated reduction in horizontal cell neurite length, and 2) the axon extension deficits in LKB1 mutant cones should be followed by mislocalized contacts between horizontal cells and cones. To examine this, we co-labeled cones and horizontal cells and quantified the number of terminal contacts over time. We began our analysis in control animals at P3 when cone axons are 70.4% of their adult length and horizontal cells have yet to restrict their arbors to the OPL (<xref ref-type="fig" rid="fig3">Figure 3A</xref>; <xref ref-type="fig" rid="fig5">Figure 5A</xref>). Many horizontal cell processes were apposed to cone terminals at this time (77.8%), and terminal contacts occurred within 20.4 ± 1.4 µm of the horizontal cell soma (<xref ref-type="fig" rid="fig6">Figure 6A–C</xref>). In addition, horizontal cell contacts with cones outside of the axon terminal occurred with some frequency in controls, with 22.2% of contacts occurring at non-terminal positions. By P5, however, the fidelity and restriction of these appositions to the axon terminal increased to nearly 96.8% in controls. Their location reflected horizontal neurite restriction, with an average contact distance within 2.6 ± 0.1 µm of the horizontal cell soma (<xref ref-type="fig" rid="fig6">Figure 6D–F</xref>). At this time point and beyond, horizontal cell contacts on control cones rarely occurred outside of the axon terminal (3.2% at P5 and 4.1% at P8, <xref ref-type="fig" rid="fig6">Figure 6E,H</xref>).</p><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Horizontal cells in LKB1 mutants contact cones at terminal and non-terminal positions.</title><p>Horizontal cell and cone contacts (calbindin, red; OPN1SW, green) were identified in Lkb1-Ret and littermate controls during postnatal development. (<bold>A</bold>) Representative images of horizontal cell-cone contacts at P3. Higher magnification images are displayed of the contacts (stars demarcate terminal contacts; arrows demarcate non-terminal contacts). Scale bars = 25 µm. (<bold>B–C</bold>) The location of contacts between cones and horizontal cells was quantified at P3. Lkb1-Ret animals showed a small but significant reduction in terminal contacts and an increase in non-terminal contacts relative to controls (<bold>B</bold>). The length of horizontal cell neurites that formed contacts with cones in control and Lkb1-Ret animals were measured and binned. The mean distance of the terminal contacts relative to the location of horizontal cell somas did not significantly differ between groups (<bold>C</bold>, n = 135 control cells and n = 159 Lkb1-Ret). N = 3 control and N = 5 Lkb1-Ret animals. (<bold>D</bold>) Representative images of horizontal cell-cone contacts at P5. Higher magnification images are displayed of the contacts (stars demarcate terminal contacts; arrows demarcate non-terminal contacts). (<bold>E–F</bold>) The location of contacts between cones and horizontal cells was quantified at P5. Lkb1-Ret animals showed a significant reduction in terminal contacts and an increase in non-terminal contacts relative to controls (<bold>E</bold>). The length of horizontal cell neurites that formed contacts with cones in control and Lkb1-Ret animals were measured and binned. The mean distance of the terminal contacts relative to the location of horizontal cell somas significantly increased in Lkb1-Ret animals (<bold>F</bold>). N = 4 control and N = 5 Lkb1-Ret animals. (<bold>G</bold>) Representative images of horizontal cell-cone contacts at P8. Higher magnification images are displayed of the contacts (stars demarcate terminal contacts; arrows demarcate non terminal contacts). (<bold>H–I</bold>) The location of contacts between cones and horizontal cells was quantified at P8. Lkb1-Ret animals showed a small but significant reduction in terminal contacts and an increase in non-terminal contacts relative to controls (<bold>H</bold>). The length of horizontal cell neurites that formed contacts with cones in control and Lkb1-Ret animals were measured and binned. The mean distance of the terminal contacts relative to the location of horizontal cell somas significantly increased in Lkb1-Ret animals (<bold>I</bold>). N = 4 control and N = 4 Lkb1-Ret animals. Scale bars = 25 µm. Data are represented as the mean ± the s.e.m. (<bold>B</bold>, <bold>E</bold>, <bold>H</bold>, ***p&lt;0.001, **p&lt;0.01, *p&lt;0.05, unpaired t-test across rows corrected for multiple comparisons using the Holm-Sidak method) or as the distribution of length of horizontal cell neurites that form contacts with cones (<bold>C</bold>, <bold>F</bold>, <bold>I</bold>, *p&lt;0.05, non-parametric Mann-Whitney Rank Sum U-test).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig6-v2.tif"/></fig><p>In Lkb1-Ret mice we observed three notable differences in this pattern. First, the relative frequency of horizontal cell contacts with cones differed, with more occurring at non-terminal positions. Second, the presence of these alterations corresponded with the onset of horizontal cell restriction defects. Third, the location of pre and postsynaptic contacts was corrected in concert with cone axon extension. In particular, at P3 when control and Lkb1-Ret horizontal cells are morphologically similar (<xref ref-type="fig" rid="fig3">Figure 3A</xref>), 66.2% of horizontal cell processes were apposed to cone terminals at this time, and these occurred within 22.0 ± 0.6 µm of horizontal cell soma. However, an increase in the number of non-axon contacts was observed in LKB1 mutants relative to controls (34.3% increase, <xref ref-type="fig" rid="fig6">Figure 6A–C</xref>). Furthermore, at P5, the location of Lkb1-Ret horizontal cell contacts differed significantly: the majority were 16.7 ± 0.8 µm away from the horizontal cell soma (an 84.4% increase in distance), consistent with the defects in cone axon extension and horizontal cell neurite refinement at this time (84.5% increase in horizontal cell neurite length, p=0.0159, <xref ref-type="fig" rid="fig6">Figure 6D–F</xref>). In addition, horizontal cells made more contacts with cones beyond the axon terminal (82.1% increase in non-terminal contacts), with many occurring at the soma and the cone inner and outer segment (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). These contact location errors were largely corrected by P8, as Lkb1-Ret cone axons grew (<xref ref-type="fig" rid="fig6">Figure 6G–I</xref>). Together, these data suggest cone terminal localization, horizontal neurite restriction, and contact location may be coordinately regulated.</p></sec><sec id="s2-4"><title>LKB1 is required for synapse-associated protein localization in cones</title><p>A key feature of laminated circuits is that synapse formation occurs at a restricted cellular location. This restriction is vital for circuit organization and thus function. What determines the location of these contacts? While several factors are likely to play roles, synapse-associated proteins have been shown to be required for OPL organization (<xref ref-type="bibr" rid="bib35">Matsuoka et al., 2012</xref>; <xref ref-type="bibr" rid="bib32">Li et al., 2015</xref>). Thus, we wondered how OPL emergence might impact the presence and localization of synapse-associated molecules. To assess this, we defined the timing, levels, and location of four cone terminal proteins to identify those present at the early stages of OPL formation (<xref ref-type="table" rid="table1">Table 1</xref>). In control animals, the synapse-associated proteins RIBEYE, piccolo, and PSD95 were absent prior to synapse formation but present and restricted to the OPL at P5, when synapses emerge (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). The levels and localization of these proteins increased at P8 as the OPL matured (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). This pattern of synapse protein location differed in LKB1 mutants. Consistent with the absence of the OPL at P5, the levels of synapse-associated proteins were reduced in LKB1 mutants at P5 (<xref ref-type="fig" rid="fig7">Figure 7A–C</xref>). As the OPL emerged in LKB1 mutants at P8, synapse proteins became present, though their levels were lower than those in control animals (<xref ref-type="fig" rid="fig7">Figure 7B–C</xref>).</p><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Synaptic protein distribution across development.</title><p>Outer retina synapse-associated proteins were stained and quantified over development to assess levels and localization. (<bold>A–C</bold>) Representative images (<bold>A</bold>) and quantification (<bold>B–C</bold>) of VGLUT1, RIBEYE, PSD95, and Piccolo at P1, P3, P5, and P8 in control and Lkb1-Ret animals. Data in (<bold>B</bold>) and (<bold>C</bold>) are presented as a heatmap indicating the corrected total cell fluorescence of each retinal layer occupied by the synapse protein signal using a gradient scale where white to blue depicts low to high levels of fluorescent intensity (0–3000, respectively). Scale bars = 25 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig7-v2.tif"/></fig><p>To examine LKB1-driven synapse protein disorganization in more detail, we obtained high-resolution views of RIBEYE localization in control and Lkb1-Ret cones at P5 using expansion microscopy (<xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>; <xref ref-type="bibr" rid="bib15">Chen et al., 2015</xref>). In control animals, all cone terminals displayed one or more RIBEYE puncta (<xref ref-type="fig" rid="fig8">Figure 8A–B</xref>), consistent with the numerous ribbon synapses formed by cone pedicles (<xref ref-type="bibr" rid="bib36">Mercer and Thoreson, 2011</xref>). Further, RIBEYE was largely restricted to the cone terminal. We noted two differences in RIBEYE localization in LKB1 mutant cones. First, RIBEYE was absent from cone terminals in some cases (<xref ref-type="fig" rid="fig8">Figure 8B</xref>, star). Second, RIBEYE was present at higher levels in mutant cone somas (<xref ref-type="fig" rid="fig8">Figure 8A–B</xref>, arrowhead). These data suggest outer retina synapse emergence defects are accompanied by alterations to the localization of synapse-associated proteins.</p><fig-group><fig id="fig8" position="float"><label>Figure 8.</label><caption><title>Expansion microscopy shows altered RIBEYE localization in LKB1 mutant cones.</title><p>(<bold>A</bold>) Representative reconstructions of cones from Lkb1-Ret animals and control littermates at P5 are shown following staining with RIBEYE (red) and OPN1SW (green). Samples were expanded, imaged, and reconstructed. (<bold>B</bold>) Reconstructed control and Lkb1-Ret cone terminals show RIBEYE localization defects in Lkb1-Ret animals. Unlike controls, RIBEYE is present in the cell soma (arrowhead) and can be absent from the cone terminal (star). Scale bars = 5 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig8-v2.tif"/></fig><fig id="fig8s1" position="float" specific-use="child-fig"><label>Figure 8—figure supplement 1.</label><caption><title>Expansion microscopy provides increased resolution of retinal neurons.</title><p>(<bold>A</bold>) Representative images of cones (OPN1SW, green) and VGLUT1 (magenta) at 60X magnification obtained through confocal or expansion microscopy. (<bold>B</bold>) Higher magnification images of the boxed regions in (<bold>A</bold>) of cones in confocal versus expansion microscopy reveals greater resolution of expanded cones. Scale bars = 25 µm (<bold>A</bold>) 5 µm (<bold>B</bold>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig8-figsupp1-v2.tif"/></fig></fig-group></sec><sec id="s2-5"><title>LKB1 is required for early localization of VGLUT1</title><p>We next considered the timing of synapse layer emergence relative to the presence of synapse-associated proteins. Interestingly, VGLUT1 was present in cones earlier than other synapse-associated proteins: it could be visualized as early as P1 in controls, preceding other synapse-associated proteins by at least 48 hr (<xref ref-type="fig" rid="fig7">Figure 7</xref>). In control animals at P1, VGLUT1 was predominantly found in cones in the latter third of the maturing axon and at the axon terminal (<xref ref-type="fig" rid="fig9">Figure 9A</xref>). By P5, VGLUT1 was largely restricted to cone axon terminals (99%, <xref ref-type="fig" rid="fig9">Figure 9B</xref>), and VGLUT1 staining became more pronounced from P5 to P8 where it overlapped with cone pedicles as they grew (<xref ref-type="fig" rid="fig9">Figure 9C</xref>).</p><fig id="fig9" position="float"><label>Figure 9.</label><caption><title>LKB1 regulates VGLUT1 levels and localization.</title><p>Cones were co-labeled with OPN1SW (green) and vesicular glutamate transporter 1 (VGLUT1, magenta) in Lkb1-Ret animals and control littermates. (<bold>A–C</bold>) At P1 (<bold>A</bold>), P5 (<bold>B</bold>), and P8 (<bold>C</bold>) Lkb1-Ret animals have a decreased number of cone terminals that are VGLUT1 positive and show displaced VGLUT1 localization relative to controls. (<bold>D</bold>) The number of cones that are VGLUT1 positive is significantly reduced in Lkb1-Ret animals relative to control littermates at all time points. (<bold>E</bold>) Representative images of VGLUT1 localization in single cones. In control animals, VGLUT1 is found primarily in the terminal (left panel), while Lkb1-Ret animals show cones with abnormal VGLUT1 localization within the cell soma and terminal or within the soma only (right panel). Scale bars = 5 µm. (<bold>F–H</bold>) Quantification of the number of cones that contain VGLUT1 only within the cone terminal (<bold>F</bold>), in the terminal and the soma (<bold>G</bold>), or only within the soma (<bold>H</bold>) at P1, P5, and P8. N ≥ 3 control and N ≥ 4 Lkb1-Ret animals. Scale bars = 25 µm. Data are represented as the mean ± the s.e.m. ***p&lt;0.001, **p&lt;0.01, *p&lt;0.05, unpaired t-test across rows corrected for multiple comparisons using the Holm-Sidak method.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig9-v2.tif"/></fig><p>We then asked whether the pattern of synapse-associated protein differed from that in Lkb1-Ret mice. First, fewer Lkb1-Ret cones contained VGLUT1 over time (31.3%, 12.7%, 12.7%, and 3.8% reduction at P1, P3, P5, and P8 respectively, p≤0.01, <xref ref-type="fig" rid="fig9">Figure 9D</xref>). Second, Lkb1-Ret cones that contained VGLUT1 showed abnormal protein localization. Unlike control animals, VGLUT1 could be found in the soma in addition to the axon (<xref ref-type="fig" rid="fig9">Figure 9A–C,E</xref>). Indeed, in some cases VGLUT1 was present only in the soma of Lkb1-Ret cones at P5 (15.7% of Lkb1-Ret cones and 0.1% control cones, p&lt;0.0001) even when an axon was present (5.4% of Lkb1-Ret cones and 0.8% control cones, p&lt;0.0001, <xref ref-type="fig" rid="fig9">Figure 9F–H</xref>). Together, these changes resulted in a 95.2% increase in VGLUT1 mislocalization to the soma of Lkb1-Ret animals relative to controls (p&lt;0.0001, <xref ref-type="fig" rid="fig9">Figure 9D–F</xref>). Notably abnormal VGLUT1 labeling persisted in Lkb1-Ret animals through P8 even when axon extension defects were largely corrected (p=0.0006, <xref ref-type="fig" rid="fig6">Figure 6G</xref>, <xref ref-type="fig" rid="fig9">Figure 9C,F–H</xref>).</p><p>To obtain high-resolution views of VGLUT1 localization in control and Lkb1-Ret cones, we again performed expansion microscopy (<xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>; <xref ref-type="bibr" rid="bib15">Chen et al., 2015</xref>). We reconstructed VGLUT1 localization within cones in detail and found marked quantitative differences in fluorescent intensity across different neuronal compartments (<xref ref-type="fig" rid="fig10">Figure 10A</xref>). Relative to controls, VGLUT1 levels were 76.4% and 82.6% decreased in the axon and axon terminal of Lkb1-Ret animals, respectively (p&lt;0.04, <xref ref-type="fig" rid="fig10">Figure 10B</xref>). In contrast, VGLUT1 levels in the soma of Lkb1-Ret mice exhibited a 62.5% increase in fluorescence (p&lt;0.04, <xref ref-type="fig" rid="fig10">Figure 10B</xref>). In addition, we noted morphological defects in Lkb1-Ret cones in which VGLUT1 was highly localized to the soma. In these instances, cone soma had a distal bulge in which VGLUT1 was concentrated (<xref ref-type="fig" rid="fig10">Figure 10C</xref>, associated <xref ref-type="video" rid="fig10video1">Figure 10—videos 1</xref> and <xref ref-type="video" rid="fig10video2">2</xref>). Together, these data suggest that LKB1-induced defects in axon extension impact the localization and distribution of VGLUT1 and other synapse-associated proteins, with decreased localization to the axon and axon terminal and increased localization to the soma.</p><fig-group><fig id="fig10" position="float"><label>Figure 10.</label><caption><title>VGLUT1 is mislocalized in LKB1 mutant cone somas.</title><p>(<bold>A</bold>) Representative reconstructions of cones from Lkb1-Ret animals and control littermates at P5 are shown following staining with VGLUT1 (magenta) and OPN1SW (green). Samples were expanded, imaged, and reconstructed. (<bold>B</bold>) Quantification of VGLUT1 expression in the soma, axon, and axon terminal of cones in both control and Lkb1-Ret animals. Data are presented as a line graph indicating the corrected total cell fluorescence within each neuron compartment occupied by VGLUT1 signal. (<bold>C</bold>) Reconstructed control and Lkb1-Ret cone somas show morphological defects in Lkb1-Ret animals. VGLUT1 is highly localized to a bulge associated with the cell soma (arrowhead). Scale bars = 5 µm. Data are represented as the mean ± the s.e.m.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig10-v2.tif"/></fig><media id="fig10video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-56931-fig10-video1.mp4"><label>Figure 10—video 1.</label><caption><title>Reconstructed expanded cones reveal VGLUT1 distribution in control mice.</title><p>Representative reconstructions of cones from control littermates at P5 are shown following staining with VGLUT1 (magenta) and OPN1SW (green). Samples were expanded, imaged, and reconstructed. The majority of VGLUT1 is localized to the axon terminal and axon.</p></caption></media><media id="fig10video2" mime-subtype="mp4" mimetype="video" xlink:href="elife-56931-fig10-video2.mp4"><label>Figure 10—video 2.</label><caption><title>Reconstructed cones reveal mislocalized VGLUT1 in LKB1 mutant cone soma.</title><p>Representative reconstructions of cones from Lkb1-Ret animals at P5 are shown following staining with VGLUT1 (magenta) and OPN1SW (green). Samples were expanded, imaged, and reconstructed. The majority of VGLUT1 is localized to the soma.</p></caption></media></fig-group><p>Based on the synapse protein defects we observed in Lkb1-Ret animals, we questioned whether these ectopic protein patches may correspond with the location of mislocalized neural contacts. To examine this, we used VGLUT1 staining as a readout for synapse protein mislocalization since it was the only protein we identified that was present at high levels during OPL emergence (P3-P5). We first asked whether horizontal cell neurites in Lkb1-Ret animals targeted VGLUT1 presynaptic regions. Horizontal cells and VGLUT1 were co-labeled in control and Lkb1-Ret animals at P5, and the cellular position of VGLUT1 in cones and its apposition to horizontal cell neurites were determined. In control and in Lkb1-Ret mice, the majority of horizontal cell neurites colocalized with VGLUT1 patches (98.5% and 92.7%, respectively; <xref ref-type="fig" rid="fig11">Figure 11A–B</xref>). Similarly, the majority of VGLUT1 positive regions were contacted by horizontal cell processes (98.5% and 92.9% in control and Lkb1-Ret mice, respectively; <xref ref-type="fig" rid="fig11">Figure 11C</xref>). We then asked whether the relative location of VGLUT1 patches impacted the fidelity of horizontal cell neurite contacts. Cones, horizontal cells and VGLUT1 were co-labeled in control and Lkb1-Ret animals at P5, and the cellular position of VGLUT1 in cones and its apposition to horizontal cell neurites were determined. In control mice, contacts were largely localized to the terminal (98.4%; <xref ref-type="fig" rid="fig11">Figure 11A,D</xref>). However, in Lkb1-Ret animals horizontal cell neurites targeted ectopic VGLUT1 presynaptic patches distributed along the cone soma and proximal axon (9.9 fold change in non-terminal contacts; p&lt;0.001; <xref ref-type="fig" rid="fig11">Figure 11A,D</xref>). These data suggest that synapse-associated protein localization in cones may participate in the restriction of neurite interaction to the cone terminal.</p><fig id="fig11" position="float"><label>Figure 11.</label><caption><title>Horizontal cell neurites contact ectopic VGLUT1 locations.</title><p>(<bold>A</bold>) Representative images of horizontal cells (calbindin, cyan) and VGLUT1 (magenta) contacts at P5 in Lkb1-Ret mice and littermate controls are shown. The boxed area is presented as a higher magnification image highlighting horizontal cells contacting VGLUT1 at cone terminals (star) and at non-terminal cone positions (arrow). (<bold>B–C</bold>) The percent of horizontal cell processes contacting VGLUT1 (<bold>B</bold>) and the percent of VGLUT1 regions that were contacted by horizontal cells (<bold>C</bold>) were quantified at P5. Nearly all horizontal cell processes contacted VGLUT1 and nearly all VGLUT1 positive regions were contacted by horizontal cell processes. The relative percent of contacts did not significantly differ between control and Lkb1-Ret animals. N = 4 control and N = 3 Lkb1-Ret animals. (<bold>D</bold>) The relative location of horizontal cell processes contacting VGLUT1 at cone terminals and non-terminal cone positions were quantified at P5. There is a significant increase in horizontal cell processes contacting non-terminal VGLUT1 in cones in Lkb1-Ret animals compared to control. N = 4 control and N = 3 Lkb1-Ret animals. Scale bars = 25 µm (upper panel) and 5 µm (lower panel). Data are represented as the mean ± the s.e.m. (<bold>B,C,</bold> non-parametric Mann-Whitney Rank Sum U-test; <bold>D,</bold> ***p&lt;0.001, unpaired t-test across rows corrected for multiple comparisons using the Holm-Sidak method).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-fig11-v2.tif"/></fig></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>The events that accompany synapse formation often overlap in space and time, so it has been difficult to resolve which processes drive the formation of specific patterns of connectivity. Here, we examined the role of LKB1 in synapse layer emergence by utilizing the outer retina where synapses occur at one distinct cellular location. The OPL appears early in development as an ordered cell-free layer that is comprised of contacts between cones and horizontal cells. We show that LKB1 is a key driver of synapse layer emergence independent of AMPK, which is required for adult synapse maintenance. LKB1 deletion results in OPL disorganization and the appearance of small patches interspersed by nuclei that disrupt the synapse lamina. These alterations coincided with specific defects in horizontal cell neurite restriction, which were accompanied by defective axon extension in presynaptic cones. Furthermore, there was a failure of synapse-associated proteins to localize to the axon terminal, and horizontal cell neurites were misdirected to these ectopic synapse protein regions. Together, these data suggest an LKB1-dependent pathway that instructs the timing and location of connectivity in the outer retina via regulation of neuron structure and synapse-associated protein localization.</p><sec id="s3-1"><title>LKB1 coordinates neurite remodeling to drive outer retina synapse layer emergence</title><p>The morphological steps that characterize OPL development have been well documented (<xref ref-type="bibr" rid="bib48">Sarin et al., 2018</xref>), allowing us to focus our attention on neurons that are first to form nascent synaptic contacts in this region, cones and horizontal cells. Both are born prenatally (<xref ref-type="bibr" rid="bib13">Cepko, 2014</xref>) and then extend neurites that terminate in the future OPL. Our data are consistent with a model in which cones and horizontal cell remodeling regulate the first stages of OPL emergence. We provide several lines of evidence in support of this idea. First, cone axon extension coincides precisely with horizontal cell restriction, and this arrangement is perturbed in LKB1 mutants when axons fail to extend. Second, when horizontal cells eventually refine and cone axons extended in LKB1 mutants, OPL defects were corrected in concert. Other studies also support this model. Zebrafish mutants lacking the synapse protein synaptojanin one show delayed OPL emergence and decreased OPL area that coincided with cone morphological alterations (<xref ref-type="bibr" rid="bib22">Holzhausen et al., 2009</xref>). Notably, these processes are likely distinct from OPL sublamination mechanisms, as this occurs later in development and is regulated by Wnt signaling pathways (<xref ref-type="bibr" rid="bib48">Sarin et al., 2018</xref>). Together, these results suggest that LKB1-driven neurite maturation is important for the precise timing and organization of OPL emergence while other cell types or processes regulate later stages of OPL maturation.</p><p>How might cones and horizontal cells interact to regulate synapse layer formation? Horizontal cells undergo marked refinement in coordination with OPL emergence and reorient their organizational axis from a basal/apical orientation to a horizontal one. Several genes have been implicated in horizontal cell birth (<italic>Prox1</italic> and <italic>Foxn4</italic>, <xref ref-type="bibr" rid="bib18">Dyer et al., 2003</xref>; <xref ref-type="bibr" rid="bib31">Li et al., 2004</xref>), migration (<italic>Lhx1</italic>, <xref ref-type="bibr" rid="bib41">Poché et al., 2007</xref>) and neurite confinement in late development and adulthood (<italic>Sema6a</italic> and <italic>PlexinA4</italic>, <xref ref-type="bibr" rid="bib35">Matsuoka et al., 2012</xref>, <italic>Cacna1</italic>, <xref ref-type="bibr" rid="bib17">Dick et al., 2003</xref>, and <italic>Bassoon</italic>, <xref ref-type="bibr" rid="bib7">Bayley and Morgans, 2007</xref>). However, the mechanisms that are responsible for horizontal cell reorientation and refinement are unknown. Our data suggest a model in which LKB1-driven cone axon extension and horizontal cell arbor refinement are coordinately regulated. In support of this idea, mislaminated horizontal cell processes maintained contact with mistargeted cone axons in LKB1 mutants, and horizontal cell lamination defects were corrected in precise coordination with cone axon extension. Further, deletion of LKB1 in the retina generally, but not in horizontal cells specifically, led to horizontal cell refinement defects. Together, these data suggest that refinement of neurites from a basal/apical orientation to a horizontal orientation early in development may depend on LKB1-mediated contact with developing cone axons.</p></sec><sec id="s3-2"><title>Defective synapse-associated protein localization in LKB1 mutant mice</title><p>How might presynaptic neurite growth regulate synapse layer formation in the outer retina? Our studies suggest terminal maturation and synapse-associated protein levels or localization may participate. In particular, VGLUT1 showed early and persistent localization defects. VGLUT1 is a vesicular glutamate transporter, and cones rely on the vesicular release of glutamate for synaptic neurotransmission after axon development is complete (<xref ref-type="bibr" rid="bib53">Sherry et al., 2003</xref>; <xref ref-type="bibr" rid="bib20">Fremeau et al., 2004</xref>; <xref ref-type="bibr" rid="bib1">Andreae and Burrone, 2014</xref>). Consistent with this, VGLUT1 is required for proper glutamate transmission and photoreceptor activity (<xref ref-type="bibr" rid="bib27">Johnson et al., 2007</xref>; <xref ref-type="bibr" rid="bib54">Wojcik et al., 2004</xref>). VGLUT1 levels have also been tied to synapse emergence in the cortex downstream of MECP2 (<xref ref-type="bibr" rid="bib14">Chao et al., 2007</xref>). Other studies have also found links between synapse protein localization, axon extension, and synapse formation. For example, neurotransmitter vesicle fusion and release have been shown to be important for axon outgrowth (<xref ref-type="bibr" rid="bib19">Feng et al., 2002</xref>). Interestingly, the neuromuscular junction requires L-type calcium channels to regulate synapse formation. Loss of these calcium channels results in loss of acetylcholine receptor patterning, as well as excessive nerve branching and failure of axons to recognize postsynaptic targets (<xref ref-type="bibr" rid="bib28">Kaplan et al., 2018</xref>; <xref ref-type="bibr" rid="bib29">Kaplan and Flucher, 2019</xref>). It is also possible that LKB1 may directly regulate synapse protein localization independent of cone axon extension, as VGLUT1 and RIBEYE were mislocalized in cones even when axons were present. Consistent with this idea, LKB1 has been shown to be involved in the polarized transport of proteins in <italic>Drosophila</italic> epithelial cells (<xref ref-type="bibr" rid="bib26">Jang et al., 2008</xref>) and mouse hepatocytes (<xref ref-type="bibr" rid="bib23">Homolya et al., 2014</xref>). Together, these data suggest that axon extension, terminal maturation, and polarized synapse protein transport might be molecularly coordinated and implicate LKB1 as a regulator of these events.</p></sec><sec id="s3-3"><title>Diverse roles for LKB1</title><p>LKB1 is a serine/threonine kinase that is best known for its tumor suppressor functions (<xref ref-type="bibr" rid="bib50">Shackelford and Shaw, 2009</xref>), but it is increasingly recognized as a key regulator of the nervous system (<xref ref-type="bibr" rid="bib30">Kuwako and Okano, 2018</xref>). Though it is expressed broadly throughout the CNS, its function appears remarkably dependent upon both neuron type and maturation stage. Perhaps its best studied role is in axon development, but even here, mechanisms differ. In hippocampal and cortical neurons LKB1 deletion impairs axon initiation (<xref ref-type="bibr" rid="bib4">Barnes et al., 2007</xref>; <xref ref-type="bibr" rid="bib52">Shelly et al., 2007</xref>) and branching (<xref ref-type="bibr" rid="bib16">Courchet et al., 2013</xref>). In contrast, LKB1 is dispensable for axon formation in the brainstem and spinal cord, which depend instead on SAD kinases (<xref ref-type="bibr" rid="bib33">Lilley et al., 2013</xref>). In developing outer retina, LKB1 had no detectable effect on outer retina neuron cell numbers but was required for cone axon initiation and elongation as well as OPL emergence. Notably, both in retina and in brain, LKB1-deficient neurons do eventually grow axons that approximate the lengths reached in controls, suggesting that LKB1-independent pathways participate in axon growth in diverse neuron types. Thus, LKB1 is required at different stages of axon development that may point to distinct LKB1-dependent and independent mechanisms by which neuron subtypes generate and maintain polarity.</p><p>Our results suggest at least two additional functions for LKB1 in neurons: synapse layer formation and synapse protein localization. What mechanisms might be at play? Unlike rod aging, which requires AMPK downstream of LKB1 (<xref ref-type="bibr" rid="bib46">Samuel et al., 2014</xref>), cone-axon extension appears independent of AMPK signaling. LKB1 may instead impact developmental processes through regulation of microtubule formation or motor protein movement via its role in MARK activation (<xref ref-type="bibr" rid="bib39">Nakano et al., 2010</xref>; <xref ref-type="bibr" rid="bib10">Biernat et al., 2002</xref>). Alternatively, LKB1 also regulates energy production in response to mechanical force (<xref ref-type="bibr" rid="bib8">Bays et al., 2017</xref>), which may be important for physically anchoring pre and postsynaptic terminals together. In future studies it will be interesting to determine the distinct, neuron-specific downstream pathways that LKB1 engages.</p><p>In summary, we have uncovered a key molecular regulator responsible for the emergence of ordered connectivity in the outer retina. We have also shown how the localization of pre and postsynaptic arbors can sculpt the emergence of synapse lamina and shed light on the role of neurite remodeling and synapse-associated protein localization in these events. Particularly fascinating is the apparent cellular specificity with which LKB1 functions despite its ubiquitous expression (<xref ref-type="bibr" rid="bib46">Samuel et al., 2014</xref>). This suggests additional levels of regulation that could be inherent to the diversity in neuron developmental processes, the localization of LKB1 itself, or the presence or absence of downstream signaling molecules.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th>Reagent type <break/>(species) or resource</th><th>Designation</th><th>Source or reference</th><th>Identifiers</th><th>Additional <break/>information</th></tr></thead><tbody><tr><td>Gene (<italic>Mus musculus</italic>)</td><td><italic>Stk11</italic></td><td>Mouse Genome Informatics</td><td>MGI:1341870 <break/>NCBI Gene: 20869</td><td/></tr><tr><td>Gene (<italic>Mus musculus</italic>)</td><td><italic>Prkaa1</italic></td><td>Mouse Genome Informatics</td><td>MGI:2145955 <break/>NCBI Gene: 105787</td><td/></tr><tr><td>Gene (<italic>Mus musculus</italic>)</td><td><italic>Prkaa2</italic></td><td>Mouse Genome Informatics</td><td>MGI:1336173 <break/>NCBI Gene: 108079</td><td/></tr><tr><td>Strain, strain background (<italic>Mus musculus</italic>, male and female)</td><td><italic>Stk11<sup>F/F</sup> (</italic>previously called <italic>Lkb1<sup>F/F</sup>)</italic></td><td><xref ref-type="bibr" rid="bib3">Bardeesy et al., 2002</xref>; DOI:<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1038/nature01045">10.1038/nature01045</ext-link></td><td/><td/></tr><tr><td>Strain, strain background (<italic>Mus musculus</italic>, male and female)</td><td><italic>Prkaa1 <sup>F/F</sup> Prkaa2 <sup>F/F</sup></italic></td><td><xref ref-type="bibr" rid="bib38">Nakada et al., 2010</xref>; DOI:<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1038/nature09571">10.1038/nature09571</ext-link></td><td/><td/></tr><tr><td>Strain, strain background (<italic>Mus musculus</italic>, male and female)</td><td><italic>Vsx2-Cre</italic> (previously called<italic>Chx10-Cre</italic>)</td><td>The Jackson Laboratory</td><td>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/IMSR_JAX:005105">IMSR_JAX:005105</ext-link></td><td/></tr><tr><td>Strain, strain background (<italic>Mus musculus</italic>, male and female)</td><td><italic>Gja10-ires-iCre</italic> (previously called <italic>Cx57-ires-iCre)</italic></td><td><xref ref-type="bibr" rid="bib21">Hirano et al., 2016</xref>; DOI:<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1523/ENEURO.0148%E2%80%9315.2016">10.1523/ENEURO.0148–15.2016</ext-link></td><td/><td/></tr><tr><td>Antibody</td><td>Chicken polyclonal anti-Calbindin</td><td>Novus Biologicals</td><td>NBP2-50028</td><td>IHC (1:2000)</td></tr><tr><td>Antibody</td><td>Rabbit polyclonal anti-Calbindin</td><td>Swant</td><td>CB38; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB-100000340">AB-100000340</ext-link></td><td>IHC (1:10000)</td></tr><tr><td>Antibody</td><td>Sheep polyclonal anti-Chx10</td><td>Exalpha</td><td>X1180P; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2314191">AB_2314191</ext-link></td><td>IHC (1:300)</td></tr><tr><td>Antibody</td><td>Goat polyclonal anti-OPN1SW</td><td>Santa Crus</td><td>Sc-14363; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2158332">AB_2158332</ext-link></td><td>IHC (1:500)</td></tr><tr><td>Antibody</td><td>Rabbit polyclonal anti-Piccolo</td><td>Synaptic Systems</td><td>142003; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2160182">AB_2160182</ext-link></td><td>IHC (1:500)</td></tr><tr><td>Antibody</td><td>Mouse monoclonal anti-Protein Kinase C α</td><td>Abcam</td><td>Ab31; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_303507">AB_303507</ext-link></td><td>IHC (1:500)</td></tr><tr><td>Antibody</td><td>Goat polyclonal anti-PSD95</td><td>Abcam</td><td>Ab12093; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_298846">AB_298846</ext-link></td><td>IHC (1:500)</td></tr><tr><td>Antibody</td><td>Mouse monoclonal anti-rhodopsin</td><td>Abcam</td><td>Ab98887; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_10696805">AB_10696805</ext-link></td><td>IHC (1:500)</td></tr><tr><td>Antibody</td><td>Rabbit polyclonal anti-RIBEYE</td><td>Synaptic Systems</td><td>192103; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2086775">AB_2086775</ext-link></td><td>IHC (1:500)</td></tr><tr><td>Antibody</td><td>Rabbit polyclonal anti-VGLUT1</td><td>Synaptic Systems</td><td>135302; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_887877">AB_887877</ext-link></td><td>IHC (1:500)</td></tr><tr><td>Commercial assay or kit</td><td>RNeasy Mini Kit</td><td>Qiagen</td><td>Cat. No. 74104</td><td/></tr><tr><td>Commercial assay or kit</td><td>RNAscope Multiplex Fluorescent v2</td><td>ACDbio</td><td>Cat. No. 323120</td><td/></tr><tr><td>Other</td><td>RNAscope Probe-Mm-Stk11</td><td>ACDbio</td><td>Cat. No. 469211</td><td/></tr><tr><td>Chemical compound, drug</td><td>Acryloyl-X, SE</td><td>Thermofisher</td><td>Cat. No. A20770</td><td/></tr><tr><td>Chemical compound, drug</td><td>TEMED</td><td>Thermofisher</td><td>Cat. No. 17919</td><td/></tr><tr><td>Chemical compound, drug</td><td>APS</td><td>Sigma Aldrich</td><td>Cat. No. 248614</td><td/></tr><tr><td>Chemical compound, drug</td><td>4-Hydroxy-TEMPO</td><td>Sigma Aldrich</td><td>Cat. No. 176141</td><td/></tr><tr><td>Chemical compound, drug</td><td>Sodium Acrylate</td><td>Sigma Aldrich</td><td>Cat. No. 408220</td><td/></tr><tr><td>Chemical compound, drug</td><td>Acrylamide</td><td>Sigma Aldrich</td><td>Cat. No. A9099</td><td/></tr><tr><td>Chemical compound, drug</td><td>N-N’-Methylenebisacrylamide</td><td>Sigma Aldrich</td><td>Cat. No. M7279</td><td/></tr><tr><td>Chemical compound, drug</td><td>Sodium Chloride</td><td>Sigma Aldrich</td><td>Cat. No. S9888</td><td/></tr><tr><td>Software, algorithm</td><td>ImageJ</td><td>NIH</td><td><ext-link ext-link-type="uri" xlink:href="https://imagej.nih.gov/ij/">https://imagej.nih.gov/ij/</ext-link>; <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_003070">SCR_003070</ext-link></td><td/></tr><tr><td>Software, algorithm</td><td>Imaris 7</td><td>Oxford Instruments</td><td>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_007370">SCR_007370</ext-link></td><td/></tr><tr><td>Software, algorithm</td><td>Prism7</td><td>Graphpad</td><td><ext-link ext-link-type="uri" xlink:href="http://www.graphpad.com">http://www.graphpad.com</ext-link>; RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_002798">SCR_002798</ext-link></td><td/></tr></tbody></table></table-wrap><sec id="s4-1"><title>Mouse strains</title><p>Mouse strain names were modified as per eLife’s gene nomenclature policy. The <italic>Stk11</italic> (<italic>Lkb1</italic>) conditional null mutant <italic>Stk11<sup>F/F</sup></italic> has been described previously (<xref ref-type="bibr" rid="bib3">Bardeesy et al., 2002</xref>) and was provided by R. DePinho, MD Anderson Cancer Center. In this strain, <italic>loxP</italic> sequences flank exons 2–6, resulting in a complete loss of LKB1 function. To broadly delete LKB1 in the retina, <italic>Stk11<sup>F/F</sup></italic> mice were crossed to <italic>Vsx2-Cre</italic> (<xref ref-type="bibr" rid="bib44">Rowan and Cepko, 2004</xref>), provided by C. Cepko, Harvard University) to generate animals referred to here as Lkb1-Ret mice. To delete LKB1 in horizontal cells we crossed <italic>Stk11<sup>F/F</sup></italic> animals to the <italic>Gja10-ires-iCre</italic> line (<xref ref-type="bibr" rid="bib21">Hirano et al., 2016</xref>) to generate animals referred to here as Lkb1-HC mice. For these lines, <italic>Stk11<sup>F/F</sup></italic> littermates were used as controls. To look at the role of AMPK, we used the conditional null mutant <italic>Prkaa1<sup>F/F</sup>Prkaa2<sup>F/F</sup></italic> which has been previously described (<xref ref-type="bibr" rid="bib38">Nakada et al., 2010</xref>) and was provided by Dr. Daisuke Nakada, Baylor College of Medicine. To broadly delete both alpha subunits of <italic>Ampk</italic> (<italic>Prkaa1 and Prkaa2</italic>) in the retina, <italic>Prkaa1<sup>F/F</sup>Prkaa2<sup>F/F</sup></italic> mice were crossed to <italic>Vsx2-Cre</italic> to generate animals referred to here as Ampk-Ret. For these lines, <italic>Prkaa1<sup>F/F</sup>Prkaa2<sup>F/F</sup></italic> littermates were used as controls. Experiments were carried out in male and female mice in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the NIH under protocols approved by the BCM Institutional Animal Care and Use Committee.</p></sec><sec id="s4-2"><title>Immunohistochemistry</title><p>Eyes were collected from animals at P1, P3, P5, P8, and P14. The day of birth was designated as postnatal day 0 (P0). Whole eyes were fixed for 45 min in 4% paraformaldehyde and then rinsed with PBS. Retina cross sections were prepared as described (<xref ref-type="bibr" rid="bib46">Samuel et al., 2014</xref>). Briefly, eye cups were dissected, and the cornea and lens were removed. The samples were then cryoprotected in 30% sucrose, embedded in Optimal Cutting Temperature (OCT) compound (Sakura, Torrance, CA), frozen in methyl butane on dry ice, sectioned at 20 μm, and then mounted on Superfrost Plus slides (VWR). Slides were incubated with blocking solution (3% normal donkey serum and 0.3% Triton X-100 in PBS) for 1 hr, and then with primary antibodies (<xref ref-type="table" rid="table1">Table 1</xref>) O/N at 4°C. Slides were washed with PBS three times for 10 min and incubated with secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA) for 1 hr at room temperature. Slides were then washed with PBS three times for 10 min. All samples were mounted in Vectashield (Vector Laboratories, Burlingame, CA). The images were acquired on an Olympus Fluoview FV1200 confocal microscope and processed using Fiji. For cone and horizontal cell neuron reconstruction, 3D rendered images of cones were generated using Imaris.</p></sec><sec id="s4-3"><title>Expansion microscopy</title><p>Expansion microscopy was performed as previously described (<xref ref-type="bibr" rid="bib2">Asano et al., 2018</xref>). In brief, tissue samples were prepared for immunohistochemistry as described above. After the final PBS wash, samples were fully immersed in a 0.1 mg/mL solution of Acryloyl-X, SE (Thermofisher #A20770) for four hours at room temperature. Following this, samples were washed three times in 1X PBS for 10 min prior to proceeding with gelation to remove unreacted reagents. To form the hydrophilic gel around the samples, a 47:1:1:1 solution of Stock X (see below): TEMED (0.1 mg/mL, Thermo Fisher #17919): APS (0.1 mg/mL, Sigma Aldrich #248614–5G): 4-Hydroxy-TEMPO (5.0 mg/mL, Sigma Aldrich #176141–1G) was placed within chambers surrounding the tissue slices. Stock X solution was made using the following proportions: 38 grams of sodium acrylate (Sigma Aldrich #408220–5G), 50 grams of acrylamide (Sigma Aldrich #A9099-25G), 2 grams of N,N’-Methylenebisacrylamide (Sigma Aldrich #M7279-25G), and 29.2 grams of sodium chloride (S9888-25G) in a total volume of 100 mL using 10X PBS stock. Slides were then incubated at 4°C for one hour followed by incubation at 37°C for an additional three hours to allow the gel to fully set. Once solidified, slides were trimmed of excess gel and placed into deionized water for one hour. To allow the samples to fully expand, the water bath was exchanged every fifteen minutes with fresh deionized water. Individual gels were then mounted in deep chambers with fresh deionized water surrounding the sample and imaged on an Olympus Fluoview FV1200 confocal microscope and processed using Fiji. For neuron reconstruction, 3D rendered images were generated using Imaris.</p></sec><sec id="s4-4"><title>In situ hybridization</title><p>In situ hybridization was performed by the RNA In Situ Hybridization Core at BCM using an automated robotic platform as previously described (<xref ref-type="bibr" rid="bib55">Yaylaoglu et al., 2005</xref>). In brief, we prepared digoxigenin (DIG)-labeled riboprobes using cDNA from E15 and P7 mouse brain RNA using a RNeasy Mini Kit (Qiagen, Germany). DNase treatment was performed to digest genomic DNA. The following LKB1 forward and reverse PCR primers were used to generate cDNA fragments corresponding to the desired ribo-probes: <named-content content-type="sequence">GCGATTTAGGTGACACTATAGCTTTTCAGGTTTCAAGGTGGAC</named-content> and <named-content content-type="sequence">GCGTAATACGACTCACTATAGGGACCCTCATAGCCATAGCTCAAA</named-content>. DIG-labeled riboprobes were synthesized using a DIG RNA labeling kit (Roche, Switzerland), diluted in hybridization buffer at a concentration of 100 ng/uL, and stored at −20°C until use.</p><p>Eyes were enucleated, and the lens was dissected out. Eyecups were cryoprotected in 30% sucrose, frozen in OCT (VWR), and stored at −80°C before sectioning. Retina cryosections (20 μm) were mounted on Superfrost Plus Slides (VWR). Sections were fixed and acetylated before the hybridization procedure, which was performed on a high-throughput platform. The slides were developed using tyramide labeled with Cy3 directly (TSA-Plus system; Perkin-Elmer Life Sciences, Waltham, MA) for 15 min, followed by staining with 4’−6-diamindino-2-phenlindole (DAPI) before mounting in Prolong Diamond (Invitrogen, Carlsbad, CA).</p></sec><sec id="s4-5"><title>RNAScope</title><p>To confirm deletion of <italic>Stk11</italic>, RNAScope was performed using RNAscope Probe-Mm-Stk11 (cat. # 469211) on 20 μm tissue sections collected as described above for immunohistochemistry. After sectioning, 4% paraformaldehyde was applied to each slide for an additional 30 min at room temperature. Fluorescent in situ hybridization (FISH) was performed using the commercially available RNAscope fluorescent multiplex assay according to the manufacturer’s instructions (ACDbio, Newark, CA) with the following with minor modifications. Tissue was dehydrated using an ethanol gradient of 10%, 30%, 50%, 70% and 100% (3 minutes each), and the boiling time in target retrieval solution was shortened to 5 min. After FISH, slides were co-stained for calbindin to visualize horizontal cell bodies.</p></sec><sec id="s4-6"><title>Histological quantification</title><p>All quantification was performed using retinal sections prepared from Lkb1-Ret, Lkb1-HC, and control animals at early postnatal ages (P1, P3, P5, P8). Littermate controls were used in all experiments, and all images were acquired at equivalent retinal eccentricities from the optic nerve head. For all experiments, data were collected from 3 to 8 mice per group, and three to four images per animal were obtained. To quantify the number of ectopic nuclei in the OPL, DAPI was used to label nuclei at P8, and antibodies to rhodopsin (rods) and Chx10 (bipolar cells) were used to demarcate the OPL boundaries. The number of nuclei within the OPL was counted in each image (211.97 × 211.97 µm<sup>2</sup>), and values were averaged. To quantify the number of OPL patches relative to cone terminals and horizontal cell contacts, nuclei were stained with DAPI while cones were stained with anti-OPN1SW. Patches were defined as the location of a cone terminal that coincided with a gap in the nuclear plexus. The distance of both patches and cone terminals were quantified from the apical retina surface as the shortest line that encompassed the apical surface and the top of the OPL patch. To quantify fluorescent intensity for in situ hybridization and synapse-associated proteins, retinal, layer boundaries were manually defined using the corresponding DAPI images. For P5, P8, and P14 retinas, the boundaries of the ONL, OPL, INL, IPL, and GCL were marked. For P1-P3, the ONBL was divided into equal sublayers to allow for more spatial definition of the expression pattern. The relative levels of the signal averaged over three randomly selected regions of the same size within each layer were computed, and a background subtraction was applied to remove background noise. To quantify the number of bipolar cells, cones, and horizontal cells, antibodies against Chx10, OPN1SW, and calbindin were used, respectively. The number of cells within an image (211.97 × 211.97 µm<sup>2</sup>) were counted and values were averaged. To quantify the number of apical neurites per horizontal cell, horizontal cells were stained with an antibody to calbindin. The number of neurites coming from the top half of each horizontal cell soma was counted, and values for each horizontal cell in each image were averaged. To quantify cone axon length, sections were stained with an OPN1SW antibody to label cone photoreceptors. The length of each axon terminal was defined as the shortest line that encompassed the base of the nuclei and the end of the axon terminal. All cones in a z-stack were analyzed. To quantify the levels and location of VGLUT1, sections were stained with an antibody to VGLUT1 and colabeled with OPN1SW to mark cone cell bodies and terminals. A cone with VGLUT1 staining present within the cell body was quantified as a soma VGLUT1 containing cell, while a cell with VGLUT1 staining that overlapped with the terminal was quantified as a terminal VGLUT1 containing cell. To quantify the corrected total cell fluorescence of VGLUT1 in different neuronal compartments, the area of the cell multiplied by the mean fluorescence of background readings was subtracted from the integrated density. The number of horizontal cell contacts made with cones was determined in a single optical section, and the distance of this contact was measured from the end of the horizontal cell neurite to the center of the horizontal cell soma. Contacts with terminals were denoted by horizontal cell neurites overlapping with cone terminals, while contacts with non-terminal regions were denoted by horizontal cell neurites overlapping with either the cone soma, axon shaft, or inner and outer segments. Horizontal cell colocalization with VGLUT1 was determined by examining the overlap between calbindin and VGLUT1. Horizontal contacts with VGLUT1 at neuron terminals were denoted by calbindin positive neurites overlapping with terminal restricted VGLUT1, while contacts with non-terminal regions were denoted by horizontal cell neurites overlapping with VGLUT1 localized in either the cone soma or along the axon shaft. Analysis of RNAscope was conducted by counting <italic>Stk11</italic> positive puncta within horizontal cell bodies across sections where samples were blinded for identity.</p></sec><sec id="s4-7"><title>Quantification algorithms</title><p>The area of the OPL and horizontal cell terminal restriction were measured using algorithms developed for this purpose in Fiji. All algorithms were validated by manual quantification of representative data sets prior to use. OPL area was measured by selecting the DAPI channel and normalizing the saturation using the normalize equalize function set at 0.3 to remove noise in individual cells. Gaussian blur was then applied with sigma = 5. The image was then converted to binary and inverted to count the empty OPL space using the analyze particles function. For each animal, images of 211.97 × 211.97 µm<sup>2</sup> from 2 to 4 different locations were included, and for each image 3 individual Z slices at least 3 µm apart were analyzed. All data were then averaged across each sample and converted from pixels to microns before statistical analysis. Horizontal cell terminal restriction was measured in Z stacks that were condensed using the maximum intensity function. Outliers within one radius and over a brightness threshold of 50 were removed. The image was then rotated 90 degrees, and the intensity across each region was summed in bins following alignment to the highest intensity as the center of the restriction. For each animal, images from 2 to 4 different locations were analyzed.</p></sec><sec id="s4-8"><title>Statistical analysis</title><p>Analyses of the number of ectopic nuclei, number of outer retina neurons, OPL area, number of apical neurites per horizontal cells, total number of patches, axon length, number of contacts between horizontal cells and cones or VGLUT1, number of <italic>Stk11</italic> puncta per horizontal cell, and the length of horizontal cell neurites that contact cones were performed using a non-parametric Mann-Whitney Rank Sum U-test. Analyses of the distance of patches from apical surface were performed using an unpaired two-tailed Student’s t test. Horizontal cell restriction, VGLUT1 localization and expression, and the position of horizontal cell and cone or VGLUT1 contacts were analyzed using an unpaired t-test across rows, with VGLUT1 quantifications and position of contacts corrected for multiple comparisons using the Holm-Sidak method. Statistical differences were evaluated using GraphPad Prism seven software. p&lt;0.05 was considered statistically significant.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Jeannie Chin, Matthew Rasband, Ross Poché, Kartik Venkatachalam, Elizabeth Zuniga-Sanchez, and members of our laboratory for scientific discussions and advice. We thank Hui Zheng’s laboratory for the use of Imaris. This work was supported by the National Institutes of Health (NIH, R00AG044444, DP2EY02798, 1R56AG061808-01, and R01 EY030458-01 to MAS), the Cancer Prevention Research Institute of Texas, and the Brain Research Foundation. CAB was supported by the NIH and the National Eye Institute under award number T32EY007001. NEA was supported by the NIH and the National Institute of General Medical Sciences under award number T32GM088129. This project was also supported by the RNA In Situ Hybridization Core facility at BMC with the expert assistance of Cecilia Ljungberg, Ph.D., and funding from the NIH (1S10 OD016167, IDDRC grant 1U54 HD083092, and the Eunice Kennedy Shriver National Institute of Child Health and Human Development).</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Investigation, Visualization</p></fn><fn fn-type="con" id="con3"><p>Data curation, Software, Formal analysis</p></fn><fn fn-type="con" id="con4"><p>Data curation, Formal analysis, Investigation</p></fn><fn fn-type="con" id="con5"><p>Data curation, Formal analysis, Investigation</p></fn><fn fn-type="con" id="con6"><p>Investigation, Visualization</p></fn><fn fn-type="con" id="con7"><p>Resources, Writing - review and editing</p></fn><fn fn-type="con" id="con8"><p>Resources, Writing - review and editing</p></fn><fn fn-type="con" id="con9"><p>Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other" id="fn1"><p>Animal experimentation: Experiments were carried out in male and female mice in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the NIH under protocols approved by the BCM Institutional Animal Care and Use Committee (AN6785). Every effort was made to minimize animal suffering.</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="scode1"><label>Source code 1.</label><caption><title>OPL area quantification script.</title></caption><media mime-subtype="octet-stream" mimetype="application" xlink:href="elife-56931-code1-v2.r"/></supplementary-material><supplementary-material id="scode2"><label>Source code 2.</label><caption><title>Neurite quantificaiton script.</title></caption><media mime-subtype="octet-stream" mimetype="application" xlink:href="elife-56931-code2-v2.ijm"/></supplementary-material><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="pdf" mimetype="application" xlink:href="elife-56931-transrepform-v2.pdf"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>Source data analysis code have been provided from Figures 1-4.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Andreae</surname> <given-names>LC</given-names></name><name><surname>Burrone</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>The role of neuronal activity and transmitter release on synapse formation</article-title><source>Current Opinion in Neurobiology</source><volume>27</volume><fpage>47</fpage><lpage>52</lpage><pub-id pub-id-type="doi">10.1016/j.conb.2014.02.008</pub-id><pub-id pub-id-type="pmid">24632375</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Asano</surname> <given-names>SM</given-names></name><name><surname>Gao</surname> <given-names>R</given-names></name><name><surname>Wassie</surname> <given-names>AT</given-names></name><name><surname>Tillberg</surname> <given-names>PW</given-names></name><name><surname>Chen</surname> <given-names>F</given-names></name><name><surname>Boyden</surname> <given-names>ES</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Expansion microscopy: protocols for imaging proteins and RNA in cells and tissues</article-title><source>Current Protocols in Cell Biology</source><volume>80</volume><elocation-id>e56</elocation-id><pub-id pub-id-type="doi">10.1002/cpcb.56</pub-id><pub-id pub-id-type="pmid">30070431</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bardeesy</surname> <given-names>N</given-names></name><name><surname>Sinha</surname> <given-names>M</given-names></name><name><surname>Hezel</surname> <given-names>AF</given-names></name><name><surname>Signoretti</surname> <given-names>S</given-names></name><name><surname>Hathaway</surname> <given-names>NA</given-names></name><name><surname>Sharpless</surname> <given-names>NE</given-names></name><name><surname>Loda</surname> <given-names>M</given-names></name><name><surname>Carrasco</surname> <given-names>DR</given-names></name><name><surname>DePinho</surname> <given-names>RA</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Loss of the Lkb1 tumour suppressor provokes intestinal polyposis but resistance to transformation</article-title><source>Nature</source><volume>419</volume><fpage>162</fpage><lpage>167</lpage><pub-id pub-id-type="doi">10.1038/nature01045</pub-id><pub-id pub-id-type="pmid">12226664</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barnes</surname> <given-names>AP</given-names></name><name><surname>Lilley</surname> <given-names>BN</given-names></name><name><surname>Pan</surname> <given-names>YA</given-names></name><name><surname>Plummer</surname> <given-names>LJ</given-names></name><name><surname>Powell</surname> <given-names>AW</given-names></name><name><surname>Raines</surname> <given-names>AN</given-names></name><name><surname>Sanes</surname> <given-names>JR</given-names></name><name><surname>Polleux</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>LKB1 and SAD kinases define a pathwayrequired for the polarization of cortical neurons</article-title><source>Cell</source><volume>129</volume><fpage>549</fpage><lpage>563</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2007.03.025</pub-id><pub-id pub-id-type="pmid">17482548</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barrasso</surname> <given-names>AP</given-names></name><name><surname>Wang</surname> <given-names>S</given-names></name><name><surname>Tong</surname> <given-names>X</given-names></name><name><surname>Christiansen</surname> <given-names>AE</given-names></name><name><surname>Larina</surname> <given-names>IV</given-names></name><name><surname>Poché</surname> <given-names>RA</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Live imaging of developing mouse retinal slices</article-title><source>Neural Development</source><volume>13</volume><elocation-id>23</elocation-id><pub-id pub-id-type="doi">10.1186/s13064-018-0120-y</pub-id><pub-id pub-id-type="pmid">30219109</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bassett</surname> <given-names>EA</given-names></name><name><surname>Wallace</surname> <given-names>VA</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Cell fate determination in the vertebrate retina</article-title><source>Trends in Neurosciences</source><volume>35</volume><fpage>565</fpage><lpage>573</lpage><pub-id pub-id-type="doi">10.1016/j.tins.2012.05.004</pub-id><pub-id pub-id-type="pmid">22704732</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bayley</surname> <given-names>PR</given-names></name><name><surname>Morgans</surname> <given-names>CW</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Rod bipolar cells and horizontal cells form displaced synaptic contacts with rods in the outer nuclear layer of the nob2 retina</article-title><source>The Journal of Comparative Neurology</source><volume>500</volume><fpage>286</fpage><lpage>298</lpage><pub-id pub-id-type="doi">10.1002/cne.21188</pub-id><pub-id pub-id-type="pmid">17111373</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bays</surname> <given-names>JL</given-names></name><name><surname>Campbell</surname> <given-names>HK</given-names></name><name><surname>Heidema</surname> <given-names>C</given-names></name><name><surname>Sebbagh</surname> <given-names>M</given-names></name><name><surname>DeMali</surname> <given-names>KA</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Linking E-cadherin mechanotransduction to cell metabolism through force-mediated activation of AMPK</article-title><source>Nature Cell Biology</source><volume>19</volume><fpage>724</fpage><lpage>731</lpage><pub-id pub-id-type="doi">10.1038/ncb3537</pub-id><pub-id pub-id-type="pmid">28553939</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Behrens</surname> <given-names>C</given-names></name><name><surname>Schubert</surname> <given-names>T</given-names></name><name><surname>Haverkamp</surname> <given-names>S</given-names></name><name><surname>Euler</surname> <given-names>T</given-names></name><name><surname>Berens</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Connectivity map of bipolar cells and photoreceptors in the mouse retina</article-title><source>eLife</source><volume>5</volume><elocation-id>e20041</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.20041</pub-id><pub-id pub-id-type="pmid">27885985</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Biernat</surname> <given-names>J</given-names></name><name><surname>Wu</surname> <given-names>YZ</given-names></name><name><surname>Timm</surname> <given-names>T</given-names></name><name><surname>Zheng-Fischhöfer</surname> <given-names>Q</given-names></name><name><surname>Mandelkow</surname> <given-names>E</given-names></name><name><surname>Meijer</surname> <given-names>L</given-names></name><name><surname>Mandelkow</surname> <given-names>EM</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Protein kinase MARK/PAR-1 is required for neurite outgrowth and establishment of neuronal polarity</article-title><source>Molecular Biology of the Cell</source><volume>13</volume><fpage>4013</fpage><lpage>4028</lpage><pub-id pub-id-type="doi">10.1091/mbc.02-03-0046</pub-id><pub-id pub-id-type="pmid">12429843</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Blackshaw</surname> <given-names>S</given-names></name><name><surname>Harpavat</surname> <given-names>S</given-names></name><name><surname>Trimarchi</surname> <given-names>J</given-names></name><name><surname>Cai</surname> <given-names>L</given-names></name><name><surname>Huang</surname> <given-names>H</given-names></name><name><surname>Kuo</surname> <given-names>WP</given-names></name><name><surname>Weber</surname> <given-names>G</given-names></name><name><surname>Lee</surname> <given-names>K</given-names></name><name><surname>Fraioli</surname> <given-names>RE</given-names></name><name><surname>Cho</surname> <given-names>SH</given-names></name><name><surname>Yung</surname> <given-names>R</given-names></name><name><surname>Asch</surname> <given-names>E</given-names></name><name><surname>Ohno-Machado</surname> <given-names>L</given-names></name><name><surname>Wong</surname> <given-names>WH</given-names></name><name><surname>Cepko</surname> <given-names>CL</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Genomic analysis of mouse retinal development</article-title><source>PLOS Biology</source><volume>2</volume><elocation-id>e247</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pbio.0020247</pub-id><pub-id pub-id-type="pmid">15226823</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Blanks</surname> <given-names>JC</given-names></name><name><surname>Adinolfi</surname> <given-names>AM</given-names></name><name><surname>Lolley</surname> <given-names>RN</given-names></name></person-group><year iso-8601-date="1974">1974</year><article-title>Synaptogenesis in the photoreceptor terminal of the mouse retina</article-title><source>The Journal of Comparative Neurology</source><volume>156</volume><fpage>81</fpage><lpage>93</lpage><pub-id pub-id-type="doi">10.1002/cne.901560107</pub-id><pub-id pub-id-type="pmid">4836656</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cepko</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Intrinsically different retinal progenitor cells produce specific types of progeny</article-title><source>Nature Reviews Neuroscience</source><volume>15</volume><fpage>615</fpage><lpage>627</lpage><pub-id pub-id-type="doi">10.1038/nrn3767</pub-id><pub-id pub-id-type="pmid">25096185</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chao</surname> <given-names>HT</given-names></name><name><surname>Zoghbi</surname> <given-names>HY</given-names></name><name><surname>Rosenmund</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>MeCP2 controls excitatory synaptic strength by regulating glutamatergic synapse number</article-title><source>Neuron</source><volume>56</volume><fpage>58</fpage><lpage>65</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2007.08.018</pub-id><pub-id pub-id-type="pmid">17920015</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname> <given-names>F</given-names></name><name><surname>Tillberg</surname> <given-names>PW</given-names></name><name><surname>Boyden</surname> <given-names>ES</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Optical imaging. expansion microscopy</article-title><source>Science</source><volume>6221</volume><fpage>543</fpage><lpage>548</lpage><pub-id pub-id-type="doi">10.1126/science.1260088</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Courchet</surname> <given-names>J</given-names></name><name><surname>Lewis</surname> <given-names>TL</given-names></name><name><surname>Lee</surname> <given-names>S</given-names></name><name><surname>Courchet</surname> <given-names>V</given-names></name><name><surname>Liou</surname> <given-names>DY</given-names></name><name><surname>Aizawa</surname> <given-names>S</given-names></name><name><surname>Polleux</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Terminal axon branching is regulated by the LKB1-NUAK1 kinase pathway via presynaptic mitochondrial capture</article-title><source>Cell</source><volume>153</volume><fpage>1510</fpage><lpage>1525</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2013.05.021</pub-id><pub-id pub-id-type="pmid">23791179</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dick</surname> <given-names>O</given-names></name><name><surname>tom Dieck</surname> <given-names>S</given-names></name><name><surname>Altrock</surname> <given-names>WD</given-names></name><name><surname>Ammermüller</surname> <given-names>J</given-names></name><name><surname>Weiler</surname> <given-names>R</given-names></name><name><surname>Garner</surname> <given-names>CC</given-names></name><name><surname>Gundelfinger</surname> <given-names>ED</given-names></name><name><surname>Brandstätter</surname> <given-names>JH</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>The presynaptic active zone protein bassoon is essential for photoreceptor ribbon synapse formation in the retina</article-title><source>Neuron</source><volume>37</volume><fpage>775</fpage><lpage>786</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(03)00086-2</pub-id><pub-id pub-id-type="pmid">12628168</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dyer</surname> <given-names>MA</given-names></name><name><surname>Livesey</surname> <given-names>FJ</given-names></name><name><surname>Cepko</surname> <given-names>CL</given-names></name><name><surname>Oliver</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Prox1 function controls progenitor cell proliferation and horizontal cell genesis in the mammalian retina</article-title><source>Nature Genetics</source><volume>34</volume><fpage>53</fpage><lpage>58</lpage><pub-id pub-id-type="doi">10.1038/ng1144</pub-id><pub-id pub-id-type="pmid">12692551</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Feng</surname> <given-names>J</given-names></name><name><surname>Chi</surname> <given-names>P</given-names></name><name><surname>Blanpied</surname> <given-names>TA</given-names></name><name><surname>Xu</surname> <given-names>Y</given-names></name><name><surname>Magarinos</surname> <given-names>AM</given-names></name><name><surname>Ferreira</surname> <given-names>A</given-names></name><name><surname>Takahashi</surname> <given-names>RH</given-names></name><name><surname>Kao</surname> <given-names>HT</given-names></name><name><surname>McEwen</surname> <given-names>BS</given-names></name><name><surname>Ryan</surname> <given-names>TA</given-names></name><name><surname>Augustine</surname> <given-names>GJ</given-names></name><name><surname>Greengard</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Regulation of neurotransmitter release by synapsin III</article-title><source>The Journal of Neuroscience</source><volume>22</volume><fpage>4372</fpage><lpage>4380</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.22-11-04372.2002</pub-id><pub-id pub-id-type="pmid">12040043</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fremeau</surname> <given-names>RT</given-names></name><name><surname>Kam</surname> <given-names>K</given-names></name><name><surname>Qureshi</surname> <given-names>T</given-names></name><name><surname>Johnson</surname> <given-names>J</given-names></name><name><surname>Copenhagen</surname> <given-names>DR</given-names></name><name><surname>Storm-Mathisen</surname> <given-names>J</given-names></name><name><surname>Chaudhry</surname> <given-names>FA</given-names></name><name><surname>Nicoll</surname> <given-names>RA</given-names></name><name><surname>Edwards</surname> <given-names>RH</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Vesicular glutamate transporters 1 and 2 target to functionally distinct synaptic release sites</article-title><source>Science</source><volume>304</volume><fpage>1815</fpage><lpage>1819</lpage><pub-id pub-id-type="doi">10.1126/science.1097468</pub-id><pub-id pub-id-type="pmid">15118123</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hirano</surname> <given-names>AA</given-names></name><name><surname>Liu</surname> <given-names>X</given-names></name><name><surname>Boulter</surname> <given-names>J</given-names></name><name><surname>Grove</surname> <given-names>J</given-names></name><name><surname>Pérez de Sevilla Müller</surname> <given-names>L</given-names></name><name><surname>Barnes</surname> <given-names>S</given-names></name><name><surname>Brecha</surname> <given-names>NC</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Targeted deletion of vesicular GABA transporter from retinal horizontal cells eliminates feedback modulation of photoreceptor calcium channels</article-title><source>Eneuro</source><volume>3</volume><elocation-id>ENEURO.0148-15.2016</elocation-id><pub-id pub-id-type="doi">10.1523/ENEURO.0148-15.2016</pub-id><pub-id pub-id-type="pmid">27022629</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Holzhausen</surname> <given-names>LC</given-names></name><name><surname>Lewis</surname> <given-names>AA</given-names></name><name><surname>Cheong</surname> <given-names>KK</given-names></name><name><surname>Brockerhoff</surname> <given-names>SE</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Differential role for synaptojanin 1 in rod and cone photoreceptors</article-title><source>The Journal of Comparative Neurology</source><volume>517</volume><fpage>633</fpage><lpage>644</lpage><pub-id pub-id-type="doi">10.1002/cne.22176</pub-id><pub-id pub-id-type="pmid">19827152</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Homolya</surname> <given-names>L</given-names></name><name><surname>Fu</surname> <given-names>D</given-names></name><name><surname>Sengupta</surname> <given-names>P</given-names></name><name><surname>Jarnik</surname> <given-names>M</given-names></name><name><surname>Gillet</surname> <given-names>JP</given-names></name><name><surname>Vitale-Cross</surname> <given-names>L</given-names></name><name><surname>Gutkind</surname> <given-names>JS</given-names></name><name><surname>Lippincott-Schwartz</surname> <given-names>J</given-names></name><name><surname>Arias</surname> <given-names>IM</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>LKB1/AMPK and PKA control ABCB11 trafficking and polarization in hepatocytes</article-title><source>PLOS ONE</source><volume>9</volume><elocation-id>e91921</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0091921</pub-id><pub-id pub-id-type="pmid">24643070</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huckfeldt</surname> <given-names>RM</given-names></name><name><surname>Schubert</surname> <given-names>T</given-names></name><name><surname>Morgan</surname> <given-names>JL</given-names></name><name><surname>Godinho</surname> <given-names>L</given-names></name><name><surname>Di Cristo</surname> <given-names>G</given-names></name><name><surname>Huang</surname> <given-names>ZJ</given-names></name><name><surname>Wong</surname> <given-names>RO</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Transient neurites of retinal horizontal cells exhibit columnar tiling via homotypic interactions</article-title><source>Nature Neuroscience</source><volume>12</volume><fpage>35</fpage><lpage>43</lpage><pub-id pub-id-type="doi">10.1038/nn.2236</pub-id><pub-id pub-id-type="pmid">19060895</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jaleel</surname> <given-names>M</given-names></name><name><surname>McBride</surname> <given-names>A</given-names></name><name><surname>Lizcano</surname> <given-names>JM</given-names></name><name><surname>Deak</surname> <given-names>M</given-names></name><name><surname>Toth</surname> <given-names>R</given-names></name><name><surname>Morrice</surname> <given-names>NA</given-names></name><name><surname>Alessi</surname> <given-names>DR</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Identification of the sucrose non-fermenting related kinase SNRK, as a novel LKB1 substrate</article-title><source>FEBS Letters</source><volume>579</volume><fpage>1417</fpage><lpage>1423</lpage><pub-id pub-id-type="doi">10.1016/j.febslet.2005.01.042</pub-id><pub-id pub-id-type="pmid">15733851</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jang</surname> <given-names>C</given-names></name><name><surname>Lee</surname> <given-names>G</given-names></name><name><surname>Chung</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>LKB1 induces apical trafficking of Silnoon, a monocarboxylate transporter, in <italic>Drosophila melanogaster</italic></article-title><source>Journal of Cell Biology</source><volume>183</volume><fpage>11</fpage><lpage>17</lpage><pub-id pub-id-type="doi">10.1083/jcb.200807052</pub-id><pub-id pub-id-type="pmid">18838551</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Johnson</surname> <given-names>J</given-names></name><name><surname>Fremeau</surname> <given-names>RT</given-names></name><name><surname>Duncan</surname> <given-names>JL</given-names></name><name><surname>Rentería</surname> <given-names>RC</given-names></name><name><surname>Yang</surname> <given-names>H</given-names></name><name><surname>Hua</surname> <given-names>Z</given-names></name><name><surname>Liu</surname> <given-names>X</given-names></name><name><surname>LaVail</surname> <given-names>MM</given-names></name><name><surname>Edwards</surname> <given-names>RH</given-names></name><name><surname>Copenhagen</surname> <given-names>DR</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Vesicular glutamate transporter 1 is required for photoreceptor synaptic signaling but not for intrinsic visual functions</article-title><source>Journal of Neuroscience</source><volume>27</volume><fpage>7245</fpage><lpage>7255</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.0815-07.2007</pub-id><pub-id pub-id-type="pmid">17611277</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kaplan</surname> <given-names>MM</given-names></name><name><surname>Sultana</surname> <given-names>N</given-names></name><name><surname>Benedetti</surname> <given-names>A</given-names></name><name><surname>Obermair</surname> <given-names>GJ</given-names></name><name><surname>Linde</surname> <given-names>NF</given-names></name><name><surname>Papadopoulos</surname> <given-names>S</given-names></name><name><surname>Dayal</surname> <given-names>A</given-names></name><name><surname>Grabner</surname> <given-names>M</given-names></name><name><surname>Flucher</surname> <given-names>BE</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Calcium influx and release cooperatively regulate AChR patterning and motor axon outgrowth during neuromuscular junction formation</article-title><source>Cell Reports</source><volume>23</volume><fpage>3891</fpage><lpage>3904</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2018.05.085</pub-id><pub-id pub-id-type="pmid">29949772</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kaplan</surname> <given-names>MM</given-names></name><name><surname>Flucher</surname> <given-names>BE</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Postsynaptic Ca<sub>v</sub>1.1-driven calcium signaling coordinates presynaptic signaling coordinates presynaptic diffferentiation at the developing neuromuscular junction</article-title><source>Scientific Reports</source><volume>1</volume><elocation-id>18450</elocation-id><pub-id pub-id-type="doi">10.1038/s41598-019-54900-w</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kuwako</surname> <given-names>KI</given-names></name><name><surname>Okano</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Versatile roles of LKB1 kinase signaling in neural development and homeostasis</article-title><source>Frontiers in Molecular Neuroscience</source><volume>11</volume><elocation-id>354</elocation-id><pub-id pub-id-type="doi">10.3389/fnmol.2018.00354</pub-id><pub-id pub-id-type="pmid">30333724</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>S</given-names></name><name><surname>Mo</surname> <given-names>Z</given-names></name><name><surname>Yang</surname> <given-names>X</given-names></name><name><surname>Price</surname> <given-names>SM</given-names></name><name><surname>Shen</surname> <given-names>MM</given-names></name><name><surname>Xiang</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Foxn4 controls the genesis of amacrine and horizontal cells by retinal progenitors</article-title><source>Neuron</source><volume>43</volume><fpage>795</fpage><lpage>807</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2004.08.041</pub-id><pub-id pub-id-type="pmid">15363391</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>S</given-names></name><name><surname>Sukeena</surname> <given-names>JM</given-names></name><name><surname>Simmons</surname> <given-names>AB</given-names></name><name><surname>Hansen</surname> <given-names>EJ</given-names></name><name><surname>Nuhn</surname> <given-names>RE</given-names></name><name><surname>Samuels</surname> <given-names>IS</given-names></name><name><surname>Fuerst</surname> <given-names>PG</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>DSCAM promotes refinement in the mouse retina through cell death and restriction of exploring dendrites</article-title><source>Journal of Neuroscience</source><volume>35</volume><fpage>5640</fpage><lpage>5654</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.2202-14.2015</pub-id><pub-id pub-id-type="pmid">25855178</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lilley</surname> <given-names>BN</given-names></name><name><surname>Pan</surname> <given-names>YA</given-names></name><name><surname>Sanes</surname> <given-names>JR</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>SAD kinases sculpt axonal arbors of sensory neurons through long- and short-term responses to neurotrophin signals</article-title><source>Neuron</source><volume>79</volume><fpage>39</fpage><lpage>53</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2013.05.017</pub-id><pub-id pub-id-type="pmid">23790753</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lizcano</surname> <given-names>JM</given-names></name><name><surname>Göransson</surname> <given-names>O</given-names></name><name><surname>Toth</surname> <given-names>R</given-names></name><name><surname>Deak</surname> <given-names>M</given-names></name><name><surname>Morrice</surname> <given-names>NA</given-names></name><name><surname>Boudeau</surname> <given-names>J</given-names></name><name><surname>Hawley</surname> <given-names>SA</given-names></name><name><surname>Udd</surname> <given-names>L</given-names></name><name><surname>Mäkelä</surname> <given-names>TP</given-names></name><name><surname>Hardie</surname> <given-names>DG</given-names></name><name><surname>Alessi</surname> <given-names>DR</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>LKB1 is a master kinase that activates 13 kinases of the AMPK subfamily, including MARK/PAR-1</article-title><source>The EMBO Journal</source><volume>23</volume><fpage>833</fpage><lpage>843</lpage><pub-id pub-id-type="doi">10.1038/sj.emboj.7600110</pub-id><pub-id pub-id-type="pmid">14976552</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Matsuoka</surname> <given-names>RL</given-names></name><name><surname>Jiang</surname> <given-names>Z</given-names></name><name><surname>Samuels</surname> <given-names>IS</given-names></name><name><surname>Nguyen-Ba-Charvet</surname> <given-names>KT</given-names></name><name><surname>Sun</surname> <given-names>LO</given-names></name><name><surname>Peachey</surname> <given-names>NS</given-names></name><name><surname>Chédotal</surname> <given-names>A</given-names></name><name><surname>Yau</surname> <given-names>KW</given-names></name><name><surname>Kolodkin</surname> <given-names>AL</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Guidance-cue control of horizontal cell morphology, lamination, and synapse formation in the mammalian outer retina</article-title><source>Journal of Neuroscience</source><volume>32</volume><fpage>6859</fpage><lpage>6868</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.0267-12.2012</pub-id><pub-id pub-id-type="pmid">22593055</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mercer</surname> <given-names>AJ</given-names></name><name><surname>Thoreson</surname> <given-names>WB</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The dynamic architecture of photoreceptor ribbon synapses: cytoskeletal, extracellular matrix, and intramembrane proteins</article-title><source>Visual Neuroscience</source><volume>28</volume><fpage>453</fpage><lpage>471</lpage><pub-id pub-id-type="doi">10.1017/S0952523811000356</pub-id><pub-id pub-id-type="pmid">22192503</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miterko</surname> <given-names>LN</given-names></name><name><surname>Lackey</surname> <given-names>EP</given-names></name><name><surname>Heck</surname> <given-names>DH</given-names></name><name><surname>Sillitoe</surname> <given-names>RV</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Shaping diversity into the brain's Form and Function</article-title><source>Frontiers in Neural Circuits</source><volume>12</volume><elocation-id>83</elocation-id><pub-id pub-id-type="doi">10.3389/fncir.2018.00083</pub-id><pub-id pub-id-type="pmid">30364100</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nakada</surname> <given-names>D</given-names></name><name><surname>Saunders</surname> <given-names>TL</given-names></name><name><surname>Morrison</surname> <given-names>SJ</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Lkb1 regulates cell cycle and energy metabolism in haematopoietic stem cells</article-title><source>Nature</source><volume>468</volume><fpage>653</fpage><lpage>658</lpage><pub-id pub-id-type="doi">10.1038/nature09571</pub-id><pub-id pub-id-type="pmid">21124450</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nakano</surname> <given-names>A</given-names></name><name><surname>Kato</surname> <given-names>H</given-names></name><name><surname>Watanabe</surname> <given-names>T</given-names></name><name><surname>Min</surname> <given-names>KD</given-names></name><name><surname>Yamazaki</surname> <given-names>S</given-names></name><name><surname>Asano</surname> <given-names>Y</given-names></name><name><surname>Seguchi</surname> <given-names>O</given-names></name><name><surname>Higo</surname> <given-names>S</given-names></name><name><surname>Shintani</surname> <given-names>Y</given-names></name><name><surname>Asanuma</surname> <given-names>H</given-names></name><name><surname>Asakura</surname> <given-names>M</given-names></name><name><surname>Minamino</surname> <given-names>T</given-names></name><name><surname>Kaibuchi</surname> <given-names>K</given-names></name><name><surname>Mochizuki</surname> <given-names>N</given-names></name><name><surname>Kitakaze</surname> <given-names>M</given-names></name><name><surname>Takashima</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>AMPK controls the speed of microtubule polymerization and directional cell migration through CLIP-170 phosphorylation</article-title><source>Nature Cell Biology</source><volume>12</volume><fpage>583</fpage><lpage>590</lpage><pub-id pub-id-type="doi">10.1038/ncb2060</pub-id><pub-id pub-id-type="pmid">20495555</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Olney</surname> <given-names>JW</given-names></name></person-group><year iso-8601-date="1968">1968</year><article-title>An electron microscopic study of synapse formation, receptor outer segment development, and other aspects of developing mouse retina</article-title><source>Investigative Ophthalmology</source><volume>7</volume><fpage>250</fpage><lpage>268</lpage><pub-id pub-id-type="pmid">5655873</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Poché</surname> <given-names>RA</given-names></name><name><surname>Kwan</surname> <given-names>KM</given-names></name><name><surname>Raven</surname> <given-names>MA</given-names></name><name><surname>Furuta</surname> <given-names>Y</given-names></name><name><surname>Reese</surname> <given-names>BE</given-names></name><name><surname>Behringer</surname> <given-names>RR</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Lim1 is essential for the correct laminar positioning of retinal horizontal cells</article-title><source>Journal of Neuroscience</source><volume>27</volume><fpage>14099</fpage><lpage>14107</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.4046-07.2007</pub-id><pub-id pub-id-type="pmid">18094249</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Poché</surname> <given-names>RA</given-names></name><name><surname>Reese</surname> <given-names>BE</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Retinal horizontal cells: challenging paradigms of neural development and Cancer biology</article-title><source>Development</source><volume>136</volume><fpage>2141</fpage><lpage>2151</lpage><pub-id pub-id-type="doi">10.1242/dev.033175</pub-id><pub-id pub-id-type="pmid">19502480</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rich</surname> <given-names>KA</given-names></name><name><surname>Zhan</surname> <given-names>Y</given-names></name><name><surname>Blanks</surname> <given-names>JC</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>Migration and synaptogenesis of cone photoreceptors in the developing mouse retina</article-title><source>The Journal of Comparative Neurology</source><volume>388</volume><fpage>47</fpage><lpage>63</lpage><pub-id pub-id-type="doi">10.1002/(SICI)1096-9861(19971110)388:1&lt;47::AID-CNE4&gt;3.0.CO;2-O</pub-id><pub-id pub-id-type="pmid">9364238</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rowan</surname> <given-names>S</given-names></name><name><surname>Cepko</surname> <given-names>CL</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Genetic analysis of the homeodomain transcription factor Chx10 in the retina using a novel multifunctional BAC transgenic mouse reporter</article-title><source>Developmental Biology</source><volume>271</volume><fpage>388</fpage><lpage>402</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2004.03.039</pub-id><pub-id pub-id-type="pmid">15223342</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sainath</surname> <given-names>R</given-names></name><name><surname>Gallo</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Cytoskeletal and signaling mechanisms of neurite formation</article-title><source>Cell and Tissue Research</source><volume>359</volume><fpage>267</fpage><lpage>278</lpage><pub-id pub-id-type="doi">10.1007/s00441-014-1955-0</pub-id><pub-id pub-id-type="pmid">25080065</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Samuel</surname> <given-names>MA</given-names></name><name><surname>Voinescu</surname> <given-names>PE</given-names></name><name><surname>Lilley</surname> <given-names>BN</given-names></name><name><surname>de Cabo</surname> <given-names>R</given-names></name><name><surname>Foretz</surname> <given-names>M</given-names></name><name><surname>Viollet</surname> <given-names>B</given-names></name><name><surname>Pawlyk</surname> <given-names>B</given-names></name><name><surname>Sandberg</surname> <given-names>MA</given-names></name><name><surname>Vavvas</surname> <given-names>DG</given-names></name><name><surname>Sanes</surname> <given-names>JR</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>LKB1 and AMPK regulate synaptic remodeling in old age</article-title><source>Nature Neuroscience</source><volume>17</volume><fpage>1190</fpage><lpage>1197</lpage><pub-id pub-id-type="doi">10.1038/nn.3772</pub-id><pub-id pub-id-type="pmid">25086610</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sanes</surname> <given-names>JR</given-names></name><name><surname>Zipursky</surname> <given-names>SL</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Design principles of insect and vertebrate visual systems</article-title><source>Neuron</source><volume>66</volume><fpage>15</fpage><lpage>36</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2010.01.018</pub-id><pub-id pub-id-type="pmid">20399726</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sarin</surname> <given-names>S</given-names></name><name><surname>Zuniga-Sanchez</surname> <given-names>E</given-names></name><name><surname>Kurmangaliyev</surname> <given-names>YZ</given-names></name><name><surname>Cousins</surname> <given-names>H</given-names></name><name><surname>Patel</surname> <given-names>M</given-names></name><name><surname>Hernandez</surname> <given-names>J</given-names></name><name><surname>Zhang</surname> <given-names>KX</given-names></name><name><surname>Samuel</surname> <given-names>MA</given-names></name><name><surname>Morey</surname> <given-names>M</given-names></name><name><surname>Sanes</surname> <given-names>JR</given-names></name><name><surname>Zipursky</surname> <given-names>SL</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Role for wnt signaling in retinal neuropil development: analysis via RNA-Seq and in Vivo Somatic CRISPR Mutagenesis</article-title><source>Neuron</source><volume>98</volume><fpage>109</fpage><lpage>126</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2018.03.004</pub-id><pub-id pub-id-type="pmid">29576390</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schubert</surname> <given-names>T</given-names></name><name><surname>Huckfeldt</surname> <given-names>RM</given-names></name><name><surname>Parker</surname> <given-names>E</given-names></name><name><surname>Campbell</surname> <given-names>JE</given-names></name><name><surname>Wong</surname> <given-names>RO</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Assembly of the outer retina in the absence of GABA synthesis in horizontal cells</article-title><source>Neural Development</source><volume>5</volume><elocation-id>15</elocation-id><pub-id pub-id-type="doi">10.1186/1749-8104-5-15</pub-id><pub-id pub-id-type="pmid">20565821</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shackelford</surname> <given-names>DB</given-names></name><name><surname>Shaw</surname> <given-names>RJ</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>The LKB1-AMPK pathway: metabolism and growth control in tumour suppression</article-title><source>Nature Reviews Cancer</source><volume>9</volume><fpage>563</fpage><lpage>575</lpage><pub-id pub-id-type="doi">10.1038/nrc2676</pub-id><pub-id pub-id-type="pmid">19629071</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shekhar</surname> <given-names>K</given-names></name><name><surname>Lapan</surname> <given-names>SW</given-names></name><name><surname>Whitney</surname> <given-names>IE</given-names></name><name><surname>Tran</surname> <given-names>NM</given-names></name><name><surname>Macosko</surname> <given-names>EZ</given-names></name><name><surname>Kowalczyk</surname> <given-names>M</given-names></name><name><surname>Adiconis</surname> <given-names>X</given-names></name><name><surname>Levin</surname> <given-names>JZ</given-names></name><name><surname>Nemesh</surname> <given-names>J</given-names></name><name><surname>Goldman</surname> <given-names>M</given-names></name><name><surname>McCarroll</surname> <given-names>SA</given-names></name><name><surname>Cepko</surname> <given-names>CL</given-names></name><name><surname>Regev</surname> <given-names>A</given-names></name><name><surname>Sanes</surname> <given-names>JR</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Comprehensive classification of retinal bipolar neurons by Single-Cell transcriptomics</article-title><source>Cell</source><volume>166</volume><fpage>1308</fpage><lpage>1323</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2016.07.054</pub-id><pub-id pub-id-type="pmid">27565351</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shelly</surname> <given-names>M</given-names></name><name><surname>Cancedda</surname> <given-names>L</given-names></name><name><surname>Heilshorn</surname> <given-names>S</given-names></name><name><surname>Sumbre</surname> <given-names>G</given-names></name><name><surname>Poo</surname> <given-names>MM</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>LKB1/STRAD promotes axon initiation during neuronal polarization</article-title><source>Cell</source><volume>129</volume><fpage>565</fpage><lpage>577</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2007.04.012</pub-id><pub-id pub-id-type="pmid">17482549</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sherry</surname> <given-names>DM</given-names></name><name><surname>Wang</surname> <given-names>MM</given-names></name><name><surname>Bates</surname> <given-names>J</given-names></name><name><surname>Frishman</surname> <given-names>LJ</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Expression of vesicular glutamate transporter 1 in the mouse retina reveals temporal ordering in development of rod vs. cone and ON vs. OFF circuits</article-title><source>The Journal of Comparative Neurology</source><volume>465</volume><fpage>480</fpage><lpage>498</lpage><pub-id pub-id-type="doi">10.1002/cne.10838</pub-id><pub-id pub-id-type="pmid">12975811</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wojcik</surname> <given-names>SM</given-names></name><name><surname>Rhee</surname> <given-names>JS</given-names></name><name><surname>Herzog</surname> <given-names>E</given-names></name><name><surname>Sigler</surname> <given-names>A</given-names></name><name><surname>Jahn</surname> <given-names>R</given-names></name><name><surname>Takamori</surname> <given-names>S</given-names></name><name><surname>Brose</surname> <given-names>N</given-names></name><name><surname>Rosenmund</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>An essential role for vesicular glutamate transporter 1 (VGLUT1) in postnatal development and control of quantal size</article-title><source>PNAS</source><volume>101</volume><fpage>7158</fpage><lpage>7163</lpage><pub-id pub-id-type="doi">10.1073/pnas.0401764101</pub-id><pub-id pub-id-type="pmid">15103023</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yaylaoglu</surname> <given-names>MB</given-names></name><name><surname>Titmus</surname> <given-names>A</given-names></name><name><surname>Visel</surname> <given-names>A</given-names></name><name><surname>Alvarez-Bolado</surname> <given-names>G</given-names></name><name><surname>Thaller</surname> <given-names>C</given-names></name><name><surname>Eichele</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Comprehensive expression atlas of fibroblast growth factors and their receptors generated by a novel robotic in situ hybridization platform</article-title><source>Developmental Dynamics</source><volume>234</volume><fpage>371</fpage><lpage>386</lpage><pub-id pub-id-type="doi">10.1002/dvdy.20441</pub-id><pub-id pub-id-type="pmid">16123981</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.56931.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Westbrook</surname><given-names>Gary L</given-names></name><role>Reviewing Editor</role><aff><institution>Oregon Health and Science University</institution><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>The manuscript by Burger et al. explores the role of the serine/threonine kinase LKB1 in neuronal remodeling during the development of the mouse retina. The experiments here are well designed and executed, and the manuscript is clearly written. The take-home lesson is that defects in cone extension, caused by an absence of LKB1 in cones in the LKB1RET knockout mice and most obvious at P1-P5, cause defects in synapse localization and HC remodeling. This suggests that in the WT animals, normal cone extension drives HC neurite remodeling.</p><p><bold>Decision letter after peer review:</bold></p><p>[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]</p><p>Thank you for submitting your work entitled &quot;LKB1 coordinates neurite remodeling to drive synapse layer emergence in the outer retina&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Senior Editor. The reviewers have opted to remain anonymous. Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in <italic>eLife</italic>.</p><p>Summary:</p><p>As you will see, the reviewers were very interested in role of LKB1 in neurite remodeling in the retina, and the generally high quality of your work. One of the reviewers was generally satisfied with the manuscript. However, the other two reviewers had concerns that focus around the impact of this work compared to your prior paper in 2014; a number of specific technical questions; and concerns with the evidence to support some of your conclusions. In particular, they thought the role of VGlut1 was overstated and would require substantially more evidence, and they were unconvinced by the experiments showing that LKB1 acts non-cell autonomously in horizontal cells. The full original comments of the reviewers are below.</p><p><italic>Reviewer #1:</italic></p><p>A very nice study exploring the cellular and molecular mechanisms of synapse and layer formation in the outer mammalian retina. This is an excellent model for parsing these processes more generally. Overall the study appears carefully done and clearly shows a role for LKB1 in horizontal cell neurite restriction and the timing of layer formation.</p><p>I have 2 questions that I hope the authors can address in the Discussion or Results.</p><p>1) Do they think (or have evidence for the idea) that horizontal cells are targeting VGLUT1 per se, or their terminals?</p><p>2) Is there anything about the sequence or structure of VGLUT1 that makes this a real possibility? Similar mechanisms have, after all, been observed for L-Type Ca<sup>2+</sup> channels at NMJs.</p><p><italic>Reviewer #2:</italic></p><p>This manuscript by Burger et al. explores the role of the serine/threonine kinase LKB1 in the development of the mouse retina. LKB1 has been previously shown to be important in a number of aspects of neuronal development generally, and has been shown to be widely expressed in retinal cells in aging animals, but LKB1's role in the refinement of retinal cell architecture and synapse localization is a novel finding of this manuscript. Overall, the work is generally interesting to the field, though its impact could be improved with some additional experiments.</p><p>1) I am perplexed/alarmed by the many reported p-values of p=0.0286. Specifically Figure 1C is reported as showing a 40.1% reduction in number of patches at P3, p = 0.0286; Figure 2A, B is reported as showing an 85.6% increase in the number of ectopic nuclei at P8, p = 0.0286; Figure 2C, D is reported as showing a 57.8% reduction in total OPL area in um2 at P8, p = 0.0286; and Figure 5H is reported as showing the 3.5% of axons that failed to reach the OPL at P8, p = 0.0286. It seems highly unlikely that all these 4 different measurements of different things, at 2 different developmental stages, would all result in p-values that are exactly identical.</p><p>2) The authors use 2 main Cre lines to knockout LKB1, one that is widely expressed in the retina, and another that is expressed only in the horizontal cells.</p><p>2a) The authors conclude that LKB1 is not acting cell-autonomously in the horizontal cells, because the HC knockout mice do not show the same defects as the pan-retinal KO mice (Figure 4). The authors should demonstrate that LKB1 is in fact gone in the HCs in those mice (possibly by immunostaining for LKB1 to show that there is no protein in the HCs in those mice), before they interpret the absence of a phenotype.</p><p>2b) Is LKB1 acting cell autonomously in the cones? Is there a Cre line that would KO LKB1 in the cone cells, to demonstrate where LKB1 is functionally required? Based on the temporal sequence of events, it seems like the cone axon extension defects at P1 precede the P5 HC defects, which along with the lack of a phenotype in the LKB1HC mice, would suggest that the cone cells are driving this process. A new mouse line is beyond the existing resources of the manuscript. However, the Introduction suggests that they'll demonstrate what cells are driving this refinement process, but in the absence of a cone-specific LKB1 KO mouse, they can't really back up that claim.</p><p>3) There are some processes that show defects at P5 which are resolved by P8 in LKB1 mutants, but other defects persist at or past P8. Temporary defects include the HC remodeling from radial to planar morphology (Figure 3), and most of the cone axon extension defects (Figure 5). Persistent defects include the OPL disorganization in OPL area per FOV and rod soma localization in the INL (Figure 2), ectopic contacts between HCs and non-terminal parts of cone cells (Figure 6), and VGLUT1 localization in cone somas (Figure 8). Given that the title claims that LKB1 coordinates these processes, please comment on why LKB1 is necessary for some of these processes but not others, and why some of them but not others can eventually be resolved in the absence of LKB1.</p><p>4) Please explain how you identified where the patches are in Figure 1B-D. Looking by eye, I see a number of patches, both more apical patches in the control and deeper patches in the LBK1RET, that are not labeled with a magenta arrowhead. How did you determine what met the size/shape criteria to be called a patch?</p><p>5) The authors show the mislocalization of VGLUT1 in the Lkb1-Ret KO animals in Figure 8-10, but do not test any other synaptic markers to see if they are also mislocalized. While VGLUT1 may be the only marker that was easily visible at P1, as shown in Figure 7, some of the other markers, including the synapse marker PSD95, are visible at P5, when VGLUT1 mislocalization is still very obvious. Is PSD95 also mislocalized at P5, like VGLUT1, and/or at P8?</p><p><italic>Reviewer #3:</italic></p><p>The manuscript by Burger et al. examines the role of the serine/threonine kinase Lkb1 in regulating formation of the outer plexiform layer (OPL) in the retina. Previous work from Dr. Samuel identified a role for the Lkb1-AMPK pathway in synaptic remodeling of horizontal cells in the OPL of the aging retina (Samuel et al., 2014). However, it was unknown if Lkb1 function during the development or maintenance of these retinal neurons and their synapses. The present study addresses this by using conditional deletion of Lkb1 and observing the development of cones, horizontal cells, and their synapses throughout their development. Horizontal cells normal remodel their dendrites from an AP polarity to a lateral one between P3 and P5; this process is delayed in Lkb1 mutants. They nicely show that this is a non-cell autonomous effect that arises due to a delay in cone photoreceptor axon extension towards the nascent OPL. Interestingly, horizontal projections extend into the outer nuclear layer and make ectopic contacts on cone cell bodies and stunted axons in the Lkb1 mutants. These ectopic contact sites co-localize with presynaptic Vglut1, suggesting they may identify synapses.</p><p>The authors are commended for the quality of their imaging data and the robust quantification methods employed. In addition, the manuscript is very well written and organized, leading to understandable conclusions. The main issue is whether the findings in this paper are novel enough for publication in <italic>eLife</italic>. The horizontal cell phenotypes observed here are largely the same as what the same group previously reported in older animals. There is not really any new information on the upstream or downstream signals related to Lkb1 that provide insight into its function or how the cone axon extension phenotype arises. In addition, Lkb1 has previously been shown to have a role in axon extension, so the delay in cone axon growth in the retina is not entirely unexpected. While the notion that cone axon contacts may be important for horizontal dendrites to remodel from AP to lateral projections is interesting, it is not entirely unprecedented: horizontal dendrite remodeling frequently occurs in response to photoreceptor axon retraction in a number of contexts. Finally, in the Discussion the authors seem to imply that Vglut1 mislocalization (in cones) may play a key role in the horizontal cell phenotypes (subsection “Defective VGLUT1 localization in LKB1 mutant mice”), going as far as to suggest that &quot;Vglut1 may act as a contact guidance cue&quot;. However, they do not have any data that directly support this idea. Isn't it just as likely that the ectopic horizontal contacts on cones recruit presynaptic receptors and associated scaffolding proteins that could result in the ectopic Vglut1 localization in cones?</p><p>There are a few other points for consideration:</p><p>1) Have the authors looked at mosaic arrangement of horizontal cells and cones in the Lkb1 mutants? Do the defects in the Lkb1 mutants lead to uneven axon/dendrite coverage in the OPL plexus?</p><p>2) In Figure 3E, can the authors quantify the frequency of ectopic horizontal cell projections in Lkb1 mutants at P8?</p><p>3) Lkb1 mutants show a delayed axon extension from the cone photoreceptors; is this just an axon phenotype, or are cone outer segments also delayed in the Lkb1 mutants?</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.56931.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]</p><disp-quote content-type="editor-comment"><p>Summary:</p><p>As you will see, the reviewers were very interested in role of LKB1 in neurite remodeling in the retina, and the generally high quality of your work. One of the reviewers was generally satisfied with the manuscript. However, the other two reviewers had concerns that focus around the impact of this work compared to your prior paper in 2014; a number of specific technical questions; and concerns with the evidence to support some of your conclusions. In particular, they thought the role of VGlut1 was overstated and would require substantially more evidence, and they were unconvinced by the experiments showing that LKB1 acts non-cell autonomously in horizontal cells. The full original comments of the reviewers are below.</p></disp-quote><p>Summary responses to primary concerns:</p><p>1) Impact of this work relative to previous data.</p><p>Several key distinctions set this work apart from our previous data and that of the field. First, it is impactful because we demonstrate a defined molecular process that links pre and postsynaptic neuron structure to synapse formation. Second, we show that synapse layer emergence differs from synapse decline in three important ways: (i) it involves unique cellular processes; (ii) it employs different neurons and synapses; and (iii) it utilizes distinct downstream molecular pathways. We explain these points below.</p><p>a) We directly link neuron structure to synapse formation. The relationship between the structure and location of neuron development and precise synapse formation has remained opaque in most systems. This is because many neurons form a large number of synapses, and these synapses are broadly distributed along the neuron. In the retina, we can precisely interrogate the relationship between presynaptic structure, postsynaptic refinement, and synapse emergence. We use this organization and leverage LKB1 induced changes in neuron shape to show that cone axon extension and synapse protein localization coordinately regulates post-synaptic neuron refinement and synapse emergence.</p><p>b) Synapse formation involves district cellular processes. This study focuses on how neurons acquire their paired shapes and connectivity, not how they lose them. We show here that synapse emergence and decline involve fundamentally different cellular attributes and drivers. Horizontal cells provide an excellent example of this difference. In development, these neurons need to arrive, mature, and then transform from a widely dispersed migrating cell into a highly lateralized neuron with a dendrite and an axon. In aging, horizontal cells dendrite are unaffected, while axons that were happily lateralized for ~2 years begin to extend neurites (Samuel et al., 2014). Thus, developmental <italic>refinement</italic> is biologically distinct from the <italic>confinement</italic> defects observed in aging.</p><p>c) Synapse layer emergence is driven by different presynaptic neurons than synapse aging. We show here that synapse emergence in retina involves cone-horizontal interactions. In contrast, aging is driven by rods. Cone and rod synapses have vastly different structures and even laminate in distinct regions of the OPL. It has long been a mystery what sets up synaptic organization at this first synapse in vision, and we shed light on that important problem here.</p><p>d) Molecular drivers of synapse emergence differ from drivers of synapse aging. In aging, LKB1 functions in rods via AMPK while cones are unaltered (Samuel et al., 2014). We now show that developmental synapse emergence is independent of AMPK (Figure 1—figure supplement 2). These data support the idea that aging cannot simply be viewed as a ‘reversal of development’ even when similar upstream molecules are involved. In our view, this is a strength of our manuscript. It should also be noted that in aging LKB1 signaling does not impact synaptic protein localization, as it does in development. This again supports the idea that the mechanisms differ.</p><p>2) Overstating the role of VGLUT1. Thanks for this comment, and we apologize if our data were overinterpreted. This was not our intent. We agree with the reviewers that we cannot conclude from this data alone that VGLUT1 drives this process. We have revised our language accordingly. In addition, since submission we also have collected additional data regarding other synaptic protein defects, which we have included in the revised manuscript.</p><p>First, we’ve now shown that other synapse proteins are altered in cone terminal localization in addition to VGLUT1, and generally show low levels in LKB1 mutants relative to controls (Figure 7). Notably, however, unlike VGLUT1, these other synapse proteins are not present at high levels even in control animals until at or after OPL emergence and therefore would be unlikely to drive alterations in cone-horizontal cell contacts.</p><p>Second, we have conducted expansion microscopy to highlight differences in levels and location of Ribeye as a representative additional synapse component (Figure 8).</p><p>3) Unconvinced of the role of LKB1 in horizontal cells. To confirm that LKB1 is indeed missing from horizontal cells in the LKB1F/F:Cx57iCre animals, we have conducted preliminary RNAscope for LKB1 in this line together with staining for horizontal cells and include this data here (Figure 4—figure supplement 1). These data support that LKB1 transcript levels are decreased in LKB1F/F: Cx57iCre horizontal cells, and we would be happy to provide additional quantitative analysis. Previous papers have also confirmed that Cx57iCre is active by P2, before horizontal cell defects are observed (Barasso et al., 2018).</p><disp-quote content-type="editor-comment"><p>Reviewer #1:</p><p>[…] I have 2 questions that I hope the authors can address in the Discussion or Results.</p><p>1) Do they think (or have evidence for the idea) that horizontal cells are targeting VGLUT1 per se, or their terminals?</p></disp-quote><p>Given that VGLUT1 is mislocalized in cone photoreceptors, we quantified the number of terminal and non-terminal contacts that horizontal cells make onto cones. Of those at non-terminal contacts, we then quantified those that contacted mislocalized VGLUT1. Nearly all mistargeted horizontal processes made contacts with ectopic VGLUT1 locations (Figure 10). However, we agree that this is supportive but not direct evidence that VGLUT1 (which is the primary transporter for glutamate in cones) regulates the location of cone-horizontal cell contacts. As noted above, we will be happy to revise our language accordingly. However, since submission we also have collected additional data to bolster the role of VGLUT1 in this process, which we would also be happy to include in a revised manuscript. First, we’ve now shown that other synapse proteins are altered in cone terminal localization in addition to VGLUT1, and generally show low levels in LKB1 mutants relative to controls. Notably, however, unlike VGLUT1, these other synapse proteins are not present at high levels even in control animals until at or after OPL emergence and therefore would be unlikely to drive alterations in cone-horizontal cell contacts (Figure 7). Second, we have conducted expansion microscopy to highlight differences in levels and location of Ribeye as a representative additional synapse component (Figure 8).</p><disp-quote content-type="editor-comment"><p>2) Is there anything about the sequence or structure of VGLUT1 that makes this a real possibility? Similar mechanisms have, after all, been observed for L-Type Ca<sup>2+</sup> channels at NMJs.</p></disp-quote><p>Thank you for this comment. Indeed, similar mechanisms are involved with L-type calcium channels in synapse formation at the NMJ. Loss of these channels results in loss of acetycholine receptor patterning as well as excessive nerve branching and failure of axons to recognize postsynaptic targets (Kaplan et al., 2018; Kaplan and Flucher, 2019). This will be a good point to address in the Discussion. Given that VGLUT1 is a transporter found on synaptic vesicles, it itself is unlikely directly involved with targeting, but rather glutamate signaling could be a driver of the phenotypes that we observe, just as calcium at the NMJ regulates similar processes.</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>[…] Overall, the work is generally interesting to the field, though its impact could be improved with some additional experiments.</p><p>1) I am perplexed/alarmed by the many reported p-values of p=0.0286. Specifically Figure 1C is reported as showing a 40.1% reduction in number of patches at P3, p = 0.0286; Figure 2A, B is reported as showing an 85.6% increase in the number of ectopic nuclei at P8, p = 0.0286; Figure 2C, D is reported as showing a 57.8% reduction in total OPL area in um2 at P8, p = 0.0286; and Figure 5H is reported as showing the 3.5% of axons that failed to reach the OPL at P8, p = 0.0286. It seems highly unlikely that all these 4 different measurements of different things, at 2 different developmental stages, would all result in p-values that are exactly identical.</p></disp-quote><p>The reviewer is correct that there were several P-values that were similar. We have double checked our numbers and our statistical methods and find the reported numbers to be accurate with one exception, where the correct calculated value is 0.0294. We used the Mann-Whitney Rank-Sum test in Prism6 to determine the significance of differences quantified, given that we cannot assume a normal distribution of the data. We also employed an in-house biostatistician to verify our calculations in R.</p><disp-quote content-type="editor-comment"><p>2) The authors use 2 main Cre lines to knockout LKB1, one that is widely expressed in the retina, and another that is expressed only in the horizontal cells.</p><p>2a) The authors conclude that LKB1 is not acting cell-autonomously in the horizontal cells, because the HC knockout mice do not show the same defects as the pan-retinal KO mice (Figure 4). The authors should demonstrate that LKB1 is in fact gone in the HCs in those mice (possibly by immunostaining for LKB1 to show that there is no protein in the HCs in those mice), before they interpret the absence of a phenotype.</p></disp-quote><p>Previous papers have confirmed that Cx57iCre is active by P2, before horizontal cell defects are observed (Barasso et al., 2018). To confirm the loss of LKB1 in these cells, we have conducted preliminary RNA-scope for LKB1 in this line together with staining for horizontal cells and include this data here (Figure 4—figure supplement 1). These data suggest that LKB1 transcripts are absent from horizontal cells in these mice. Unfortunately, IHC for LKB1 is not possible due to lack of compatible antibodies (we’ve tested five so far). We would also be happy to perform a time course analysis of Cx57iCre; Ai14 expression to show when the Cre is active and how many cells it effects.</p><disp-quote content-type="editor-comment"><p>2b) Is LKB1 acting cell autonomously in the cones? Is there a Cre line that would KO LKB1 in the cone cells, to demonstrate where LKB1 is functionally required? Based on the temporal sequence of events, it seems like the cone axon extension defects at P1 precede the P5 HC defects, which along with the lack of a phenotype in the LKB1HC mice, would suggest that the cone cells are driving this process. A new mouse line is beyond the existing resources of the manuscript. However, the Introduction suggests that they'll demonstrate what cells are driving this refinement process, but in the absence of a cone-specific LKB1 KO mouse, they can't really back up that claim.</p></disp-quote><p>Deleting LKB1 from cones early in development is a challenge given the available resources. We have considered 4 approaches in good faith but none are suitable. The first is a mouse line. The only Cone-specific cre that has been widely used is HRGP-Cre. We have this line, but unfortunately the Cre is not active until P8, after OPL emergence has occurred. A second approach is electroporation, but this too spares cones because cones are done dividing by birth and therefore do not receive the constructs (Sarin et al., 2018). Third, we have tried electroporation at E15 but find that GFP dilutes out in subsequent cell divisions, making it difficult to discern what cells our electroporation targeted. Finally, we have considered injecting AAV. However, given that AAV takes 21 days for full expression we are unable to visualize transduction by P5 even if viruses are injected early.</p><disp-quote content-type="editor-comment"><p>3) There are some processes that show defects at P5 which are resolved by P8 in LKB1 mutants, but other defects persist at or past P8. Temporary defects include the HC remodeling from radial to planar morphology (Figure 3), and most of the cone axon extension defects (Figure 5). Persistent defects include the OPL disorganization in OPL area per FOV and rod soma localization in the INL (Figure 2), ectopic contacts between HCs and non-terminal parts of cone cells (Figure 6), and VGLUT1 localization in cone somas (Figure 8). Given that the title claims that LKB1 coordinates these processes, please comment on why LKB1 is necessary for some of these processes but not others, and why some of them but not others can eventually be resolved in the absence of LKB1.</p></disp-quote><p>We thank the reviewer for these comments. While many defects are still present at P8, cone axons have largely extended (though their final length is shorter than controls) so there appear to be some redundant mechanisms at play here. However, it is worth noting that this does not mean that the circuit is functioning normally. Indeed, we’ve shown that adult LKB1 mutants display defective rod and cone visual signaling (Samuel et al., 2014).</p><disp-quote content-type="editor-comment"><p>4) Please explain how you identified where the patches are in Figure 1B-D. Looking by eye, I see a number of patches, both more apical patches in the control and deeper patches in the LBK1RET, that are not labeled with a magenta arrowhead. How did you determine what met the size/shape criteria to be called a patch?</p></disp-quote><p>We appreciate this suggestion, and we would be happy to clarify how patches are delineated. To define a patch, we asked whether a gap in the nuclear stain overlapped with the location of either a horizontal cell terminal, a cone terminal, or both, since the neurites of these cells are first to form contacts in development. The gaps to which the reviewers refer are caused by horizontal cell soma and do not reflect points of contact. We have now clarified how patches were identified and quantified in the text (subsections “Cone axon extension and maturation are disrupted in LKB1 mutant mice” and “LKB1 is required for early localization of VGLUT1).</p><disp-quote content-type="editor-comment"><p>5) The authors show the mislocalization of VGLUT1 in the LKB1RET KO animals in Figure 8-10, but do not test any other synaptic markers to see if they are also mislocalized. While VGLUT1 may be the only marker that was easily visible at P1, as shown in Figure 7, some of the other markers, including the synapse marker PSD95, are visible at P5, when VGLUT1 mislocalization is still very obvious. Is PSD95 also mislocalized at P5, like VGLUT1, and/or at P8?</p></disp-quote><p>We have included in this revised manuscript additional data on other synapse proteins in LKB1 mutants (Figure 7). We show that other synapse proteins are indeed altered in their localization to the cone terminal. To illustrate this, we have completed additional expansion microscopy showing differences in levels and location of Ribeye (Figure 8). Notably, however, unlike VGLUT1, these other synapse proteins are present at or after OPL emergence so are unlikely to contribute to OPL formation.</p><disp-quote content-type="editor-comment"><p>Reviewer #3:</p><p>[…] The authors are commended for the quality of their imaging data and the robust quantification methods employed. In addition, the manuscript is very well written and organized, leading to understandable conclusions. The main issue is whether the findings in this paper are novel enough for publication in eLife. The horizontal cell phenotypes observed here are largely the same as what the same group previously reported in older animals. There is not really any new information on the upstream or downstream signals related to Lkb1 that provide insight into its function or how the cone axon extension phenotype arises. In addition, Lkb1 has previously been shown to have a role in axon extension, so the delay in cone axon growth in the retina is not entirely unexpected. While the notion that cone axon contacts may be important for horizontal dendrites to remodel from AP to lateral projections is interesting, it is not entirely unprecedented: horizontal dendrite remodeling frequently occurs in response to photoreceptor axon retraction in a number of contexts.</p></disp-quote><p>We thank the reviewer for these comments and apologize that we did not make the distinction clearer between our previous work and this manuscript. In fact, they are different at the cellular, synaptic, and molecular level. We have clarified these points in the section above entitled “Impact of this work relative to previous data”.</p><disp-quote content-type="editor-comment"><p>Finally, in the Discussion the authors seem to imply that Vglut1 mislocalization (in cones) may play a key role in the horizontal cell phenotypes (subsection “Defective VGLUT1 localization in LKB1 mutant mice”), going as far as to suggest that &quot;Vglut1 may act as a contact guidance cue&quot;. However, they do not have any data that directly support this idea. Isn't it just as likely that the ectopic horizontal contacts on cones recruit presynaptic receptors and associated scaffolding proteins that could result in the ectopic Vglut1 localization in cones?</p></disp-quote><p>Please refer to point 3 in our general responses above. It was not our intent to overstate our findings and agree with the reviewers that we cannot conclude from this data alone that VGLUT1 drives this process (though it may indeed contribute). We will be happy to revise our language accordingly. However, since submission we also have collected additional data, which we would be happy to include in a revised manuscript. First, we’ve now shown that other synapse proteins are altered in cone terminal localization in addition to VGLUT1, and generally show low levels in LKB1 mutants relative to controls. Notably, however, unlike VGLUT1, these other synapse proteins are not present at high levels even in control animals until at or after OPL emergence and therefore would be unlikely to drive alterations in cone- horizontal cell contacts (Figure 7). Second, we have conducted expansion microscopy to highlight differences in levels and location of Ribeye as a representative additional synapse component (Figure 8).</p><disp-quote content-type="editor-comment"><p>There are a few other points for consideration:</p><p>1) Have the authors looked at mosaic arrangement of horizontal cells and cones in the Lkb1 mutants? Do the defects in the Lkb1 mutants lead to uneven axon/dendrite coverage in the OPL plexus?</p></disp-quote><p>Thank you for this suggestion. We have examined mosaic spacing in the LKB1 mutants and see no difference in spacing or OPL coverage (<xref ref-type="fig" rid="respfig1">Author response image 1</xref>).</p><fig id="respfig1"><label>Author response image 1.</label><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-resp-fig1-v2.tif"/></fig><p>2) In Figure 3E, can the authors quantify the frequency of ectopic horizontal cell projections in Lkb1 mutants at P8?Thank you for this suggestion. We have provided quantifications as <xref ref-type="fig" rid="respfig2">Author response image 2</xref> but would be happy to include this data as a supplementary figure if deemed necessary.</p><fig id="respfig2"><label>Author response image 2.</label><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-56931-resp-fig2-v2.tif"/></fig><p>3) Lkb1 mutants show a delayed axon extension from the cone photoreceptors; is this just an axon phenotype, or are cone outer segments also delayed in the Lkb1 mutants?Cone outer segments appear normal during development. They can be observed in Figure 5.</p></body></sub-article></article>