<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">57572</article-id><article-id pub-id-type="doi">10.7554/eLife.57572</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Microbiology and Infectious Disease</subject></subj-group></article-categories><title-group><article-title>Evolutionarily distant I domains can functionally replace the essential ligand-binding domain of <italic>Plasmodium</italic> TRAP</article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes" id="author-59765"><name><surname>Klug</surname><given-names>Dennis</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-9108-454X</contrib-id><email>dennis.klug@sciencebridge.net</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund5"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-121673"><name><surname>Goellner</surname><given-names>Sarah</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-3300-4273</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-182982"><name><surname>Kehrer</surname><given-names>Jessica</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-5084-3485</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-121691"><name><surname>Sattler</surname><given-names>Julia</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-121675"><name><surname>Strauss</surname><given-names>Léanne</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-0680-593X</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-182981"><name><surname>Singer</surname><given-names>Mirko</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-5757-2750</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-121680"><name><surname>Lu</surname><given-names>Chafen</given-names></name><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-23128"><name><surname>Springer</surname><given-names>Timothy A</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-6627-2904</contrib-id><email>springer@crystal.harvard.edu</email><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-79613"><name><surname>Frischknecht</surname><given-names>Friedrich</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-8332-6668</contrib-id><email>freddy.frischknecht@med.uni-heidelberg.de</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund2"/><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Integrative Parasitology, Center for Infectious Diseases, Heidelberg University Medical School</institution><addr-line><named-content content-type="city">Heidelberg</named-content></addr-line><country>Germany</country></aff><aff id="aff2"><label>2</label><institution>Université de Strasbourg, CNRS UPR9022, INSERM U963, Institut de Biologie Moléculaire et Cellulaire</institution><addr-line><named-content content-type="city">Strasbourg</named-content></addr-line><country>France</country></aff><aff id="aff3"><label>3</label><institution>Department of Molecular Virology, Heidelberg University Medical School</institution><addr-line><named-content content-type="city">Heidelberg</named-content></addr-line><country>Germany</country></aff><aff id="aff4"><label>4</label><institution>Experimental Parasitology, Faculty of Veterinary Medicine, Ludwig-Maximilians-Universität München</institution><addr-line><named-content content-type="city">München</named-content></addr-line><country>Germany</country></aff><aff id="aff5"><label>5</label><institution>Program in Cellular and Molecular Medicine, Children's Hospital Boston, and Departments of Biological Chemistry and Molecular Pharmacology and of Medicine, Harvard Medical School</institution><addr-line><named-content content-type="city">Boston</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Soldati-Favre</surname><given-names>Dominique</given-names></name><role>Reviewing Editor</role><aff><institution>University of Geneva</institution><country>Switzerland</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Soldati-Favre</surname><given-names>Dominique</given-names></name><role>Senior Editor</role><aff><institution>University of Geneva</institution><country>Switzerland</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>10</day><month>07</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e57572</elocation-id><history><date date-type="received" iso-8601-date="2020-04-04"><day>04</day><month>04</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2020-06-25"><day>25</day><month>06</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Klug et al</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Klug et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-57572-v1.pdf"/><abstract><p>Inserted (I) domains function as ligand-binding domains in adhesins that support cell adhesion and migration in many eukaryotic phyla. These adhesins include integrin αβ heterodimers in metazoans and single subunit transmembrane proteins in apicomplexans such as TRAP in <italic>Plasmodium</italic> and MIC2 in <italic>Toxoplasma</italic>. Here we show that the I domain of TRAP is essential for sporozoite gliding motility, mosquito salivary gland invasion and mouse infection. Its replacement with the I domain from Toxoplasma MIC2 fully restores tissue invasion and parasite transmission, while replacement with the aX I domain from human integrins still partially restores liver infection. Mutations around the ligand binding site allowed salivary gland invasion but led to inefficient transmission to the rodent host. These results suggest that apicomplexan parasites appropriated polyspecific I domains in part for their ability to engage with multiple ligands and to provide traction for emigration into diverse organs in distant phyla.</p></abstract><abstract abstract-type="executive-summary"><title>eLife digest</title><p>Malaria is an infectious disease caused by single-celled parasites known as <italic>Plasmodium</italic>. Humans and other animals with backbones – such as birds, reptiles and rodents – can become hosts for these parasites if an infected female mosquito feeds on their blood. Likewise, healthy mosquitoes can in turn become infected with <italic>Plasmodium</italic> if they feed on the blood of an infected animal.</p><p>To complete their life cycle, <italic>Plasmodium</italic> parasites within a mosquito must become spore-like cells called sporozoites. These sporozoites are highly mobile and can get into the mosquitoes’ salivary glands, meaning they can be passed on to a new host when the insect feeds. During a mosquito bite the sporozoites are spat into the skin of the potential host, where they then need to migrate rapidly to enter the bloodstream. Once in the blood, the sporozoites can then get into liver cells and begin a new infection. One protein called TRAP, which is found on the surface of the sporozoites, is important for their migration and the infection of the salivary glands or liver. Yet it was not known how this happens at the level of the individual proteins involved.</p><p>Klug et al. have now tested how a part of the TRAP protein, called the I domain, contributes to the infection process. In the experiments, the I domain of TRAP was deleted which showed that the sporozoites need this domain to be able to move around and get into the host tissues. Without the I domain the sporozoites were stuck and could not successfully infect either the mosquitoes, the livers of mice, or human liver cells grown in the laboratory. Klug et al. then replaced the <italic>Plasmodium</italic> I domain of TRAP with the I domain from a distantly related parasite called <italic>Toxoplasma gondii</italic>, which causes a condition known as toxoplasmosis. The I domain from <italic>Toxoplasma</italic> allowed the <italic>Plasmodium</italic> parasites to infect the host tissues again. This observation was unexpected because <italic>Toxoplasma</italic> and <italic>Plasmodium</italic> parasites have evolved separately over the last 800 million years and <italic>Toxoplasma</italic> does not infect insects.</p><p>These findings suggest that the I domain of TRAP evolved to bind several other proteins in different tissues and hosts. Future studies will investigate which other parasite proteins TRAP works with to guide sporozoites to the salivary glands or liver. Knowledge of how these proteins act together may lead to new approaches for treating or preventing malaria. For example, some treatments could stop sporozoites from entering liver cells.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd><italic>Plasmodium berghei</italic></kwd><kwd>malaria</kwd><kwd>motility</kwd><kwd>invasion</kwd><kwd>integrin</kwd><kwd>adhesion</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Other</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000854</institution-id><institution>Human Frontier Science Program</institution></institution-wrap></funding-source><award-id>RGY0071/2011</award-id><principal-award-recipient><name><surname>Frischknecht</surname><given-names>Friedrich</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000781</institution-id><institution>European Research Council</institution></institution-wrap></funding-source><award-id>ERC StG 281719</award-id><principal-award-recipient><name><surname>Frischknecht</surname><given-names>Friedrich</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001659</institution-id><institution>German Research Foundation</institution></institution-wrap></funding-source><award-id>240245660 - SFB 1129</award-id><principal-award-recipient><name><surname>Frischknecht</surname><given-names>Friedrich</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>CA 31798</award-id><principal-award-recipient><name><surname>Springer</surname><given-names>Timothy A</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001659</institution-id><institution>German Research Foundation</institution></institution-wrap></funding-source><award-id>KL 3251/1-1</award-id><principal-award-recipient><name><surname>Klug</surname><given-names>Dennis</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Exchange of the I domain in the Plasmodium surface protein TRAP against evolutionary distant I domains rescues infectivity of sporozoites.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Domains with similar overall structures, initially described in von Willebrand factor A (VWA domains), are found in cell-surface proteins including integrins, extracellular matrix, and complement components, and mediate a diversity of functions including cell adhesion, migration, and signaling (<xref ref-type="bibr" rid="bib53">Whittaker and Hynes, 2002</xref>). Here, we study a subset of VWA domains termed I domains because they are inserted in other domains in integrins. I domains differ from VWA domains in the position of their ligand binding sites and in the presence of a metal ion-dependent adhesion site (MIDAS) at the center of their ligand binding site (<xref ref-type="bibr" rid="bib26">Liddington, 2014</xref>). Within integrins, I domains switch between closed and open states coordinately with conformational change in neighboring domains. This switch from closed to open conformation in the I domain alters the ligand-binding site around the MIDAS and increases affinity for ligand by ~1,000 fold (<xref ref-type="bibr" rid="bib39">Schürpf and Springer, 2011</xref>).</p><p>I domains are key modules in adhesins employed by apicomplexan pathogens. I domain-containing, membrane-spanning surface glycoproteins have been shown to be essential for tissue traversal and cell invasion by <italic>Toxoplasma gondii</italic> and <italic>Plasmodium spp.</italic> and are present in all known apicomplexans (<xref ref-type="bibr" rid="bib46">Sultan et al., 1997</xref>; <xref ref-type="bibr" rid="bib29">Morahan et al., 2009</xref>). In <italic>Plasmodium (P.)</italic>, a protein named CTRP containing six I domains is required for invasion of the mosquito midgut by the ookinete (<xref ref-type="bibr" rid="bib35">Ramakrishnan et al., 2011</xref>; <xref ref-type="bibr" rid="bib10">Dessens et al., 1999</xref>). Once the ookinete crosses the midgut epithelium it forms an oocyst wherein it differentiates into hundreds of sporozoites (<xref ref-type="bibr" rid="bib14">Frischknecht and Matuschewski, 2017</xref>). Sporozoites use proteases (<xref ref-type="bibr" rid="bib1">Aly and Matuschewski, 2005</xref>) and active motility (<xref ref-type="bibr" rid="bib24">Klug and Frischknecht, 2017</xref>) to egress from the oocyst into the hemolymph and subsequently enter the salivary glands from where they can be transmitted back to a vertebrate host. Once deposited in the skin during a blood meal by an infected mosquito, sporozoites migrate rapidly to find and enter blood vessels (<xref ref-type="bibr" rid="bib2">Amino et al., 2006</xref>). Within the blood stream parasites are passively transported to the liver, where they infect hepatocytes and develop into liver stages (<xref ref-type="bibr" rid="bib11">Douglas et al., 2015</xref>). The subsequent blood stages cause the typical symptoms of malaria by triggering a massive immune response, clogging capillaries and lysing red blood cells (<xref ref-type="bibr" rid="bib8">Cowman et al., 2016</xref>).</p><p>Sporozoites express two adhesins with I domains, TRAP (thrombospondin related anonymous protein) and TLP (TRAP-like protein). These proteins are stored in secretory vesicles called micronemes, at the apical end of the highly polarized sporozoite (<xref ref-type="bibr" rid="bib47">Tomley and Soldati, 2001</xref>). After fusion of micronemes with the plasma membrane, TRAP and TLP decorate the surface of the sporozoite and form a bridge between extracellular ligands and the membrane-subtending actin-myosin motor that drives gliding motility and invasion (<xref ref-type="bibr" rid="bib18">Heintzelman, 2015</xref>; <xref ref-type="bibr" rid="bib14">Frischknecht and Matuschewski, 2017</xref>). Deletion of <italic>tlp</italic> causes only a mild phenotype in tissue traversal while deletion of <italic>trap</italic> yields sporozoites that cannot move productively in vitro, fail to enter salivary glands, and are unable to infect mice if isolated from mosquitoes and injected intravenously (<xref ref-type="bibr" rid="bib46">Sultan et al., 1997</xref>; <xref ref-type="bibr" rid="bib30">Moreira et al., 2008</xref>; <xref ref-type="bibr" rid="bib19">Hellmann et al., 2013</xref>; <xref ref-type="bibr" rid="bib34">Quadt et al., 2016</xref>). Mutations of amino acids within the MIDAS motif of the single I domain in TRAP decreased the capacity of sporozoites to enter salivary glands and liver cells as well as to infect mice (<xref ref-type="bibr" rid="bib52">Wengelnik et al., 1999</xref>; <xref ref-type="bibr" rid="bib27">Matuschewski et al., 2002</xref>). However, these mutant sporozoites were still able to migrate in vitro. This suggests that the MIDAS is important for ligand binding but not for productive motility.</p><p>Crystal structures of the N-terminal portion of TRAP in <italic>Plasmodium spp</italic>. and a TRAP orthologue in <italic>Toxoplasma gondii,</italic> the micronemal protein 2 (MIC2), revealed the I domain in both open and closed conformations in association with a thrombospondin type-I repeat domain (<xref ref-type="bibr" rid="bib43">Song et al., 2012</xref>; <xref ref-type="bibr" rid="bib44">Song and Springer, 2014</xref>; <xref ref-type="fig" rid="fig1">Figure 1</xref>). The apicomplexan I domains structurally resemble I domains found in integrin α-subunits (αI domains) much more than I domains in integrin β-subunits (βI domains). Between the closed and open states of both apicomplexan I domains and integrin αI domains, the Mg<sup>2+</sup> ion at the MIDAS similarly moves ~2 Å closer to one coordinating sidechain and away from another. This movement is linked to essentially identical pistoning of the C-terminal, α7-helix toward the ‘bottom’ of the domain (<xref ref-type="fig" rid="fig1">Figure 1A</xref> compared to 1B and <xref ref-type="fig" rid="fig1">Figure 1D</xref> compared to 1E). The distance pistoned is equivalent to two turns of an α-helix. Uniquely in the apicomplexan I domains, a segment N-terminal to the I domain is disulfide-linked to the last helical turn of the α7-helix in its closed conformation (<xref ref-type="fig" rid="fig1">Figure 1A–C</xref>). As this segment pistons out of contact with the remainder of the I domain in the open conformation, the last two turns of the α7-helix with its cysteine unwind, the N-terminal segment with its cysteine moves in a similar direction, and these segments reshape to form a β-ribbon (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Because of close structural homology between human integrin αI- and apicomplexan adhesin I domains in the regions shown in green in <xref ref-type="fig" rid="fig1">Figure 1A–E</xref>, we were able to engineer exchanges between them in this study (<xref ref-type="fig" rid="fig1">Figure 1F</xref>). <italic>P. berghei</italic> parasites expressing TRAP without an I domain phenocopy <italic>trap(-)</italic> parasites and show that the I domain is essential for motility and invasion. Parasites expressing TRAP with the I domain of MIC2 from the related apicomplexan <italic>Toxoplasma gondii</italic>, show rescued motility and invasion. By reversing the charges of amino acid residues around the MIDAS motif we could partially uncouple the function of TRAP during salivary gland invasion and rodent infection. Our results show that I domains have the capacity to be poly-specific and permit TRAP to function as an adhesin in both vertebrate and arthropod hosts.</p><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Structural features of TRAP, MIC2, and integrin αI domains.</title><p>(<bold>A–E</bold>) Cartoon ribbon diagrams. (<bold>A</bold>), open TRAP (Protein Databank ID (PDB)) 4HQL; (<bold>B</bold>), closed TRAP, PDB 4HQF; (<bold>C</bold>), closed MIC2, PDB 4OKR chain B; (<bold>D</bold>), open αX αI domain, PDB 4NEH; (<bold>E</bold>), closed αX αI domain, PDB 5ES4. Green: the portion of the I domains exchanged between TRAP and other I domains; cyan: the TSR domain; magenta: the portion in between the I domain and TSR in TRAP and MIC2 which includes the extensible β-ribbon. The comparable regions in integrin αI domains are also colored magenta and emphasize how the α7-helix reshapes similarly to that of apicomplexan I domains. The TSR domain of closed TRAP (<bold>B</bold>) is not shown because it was disordered in crystals; it likely is positioned similarly in the closed conformation as the TSR domain of closed MIC2 (<bold>C</bold>). The MIDAS Mg<sup>2+</sup> ion is shown as a silver sphere and is present in all I domains. It is not shown in closed TRAP (<bold>B</bold>) because a lattice contact disrupted the conformation around the MIDAS. Disulfide bonds are shown as yellow sticks; for emphasis, the cysteine sulfur atoms of the extensible I domains are shown in identical orientations after superimposition. (<bold>F</bold>) The portions of the four I domains that were exchanged were aligned by sequence and structure (<xref ref-type="bibr" rid="bib43">Song et al., 2012</xref>; <xref ref-type="bibr" rid="bib44">Song and Springer, 2014</xref>). Secondary structure elements are labeled and MIDAS residues are asterisked above the alignment.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig1-v1.tif"/></fig></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>The I domain of TRAP is crucial for <italic>Plasmodium</italic> transmission</title><p>The importance of the I domain for TRAP function was tested using the <italic>trapΔI</italic> parasite line (<xref ref-type="fig" rid="fig2">Figure 2A</xref>, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). In several independent experiments in which mosquitoes fed on infected mice, only few <italic>trapΔI</italic> or <italic>trap(-)</italic> sporozoites could be observed within the mosquito salivary glands, whereas for <italic>trap</italic> wild type ~10,000 sporozoites were observed per mosquito (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, <xref ref-type="table" rid="table1">Table 1</xref>). Thus, <italic>trapΔI</italic> sporozoites are similarly impaired in salivary gland invasion as <italic>trap(-)</italic> sporozoites. To determine whether mutant parasites retained the ability to migrate steadily on microscope slides, that is to glide in circles (<xref ref-type="bibr" rid="bib48">Vanderberg, 1974</xref>), sporozoites were isolated from hemolymph and activated by addition of 3% bovine serum albumin (BSA). Hemolymph sporozoites, like midgut sporozoites, were present in all mutants studied here (<xref ref-type="table" rid="table1">Table 1</xref>). Sporozoites were defined as gliding and productively motile if they were able to complete at least one circle within 3 or 5 min, depending on the experiment. Sporozoites exhibiting other types of motion were classified as unproductively motile, while sporozoites that were attached but were not moving or were not attached were classified as non-motile (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>; <xref ref-type="bibr" rid="bib31">Münter et al., 2009</xref>). Hemolymph sporozoites were ~19% productively motile in wild type while none were motile in <italic>trapΔI</italic> (<xref ref-type="fig" rid="fig2">Figure 2C</xref>) and <italic>trap(-)</italic> mutants (<xref ref-type="bibr" rid="bib31">Münter et al., 2009</xref>; <xref ref-type="bibr" rid="bib17">Hegge et al., 2010</xref>; <xref ref-type="fig" rid="fig2">Figure 2C</xref>). These results show that the I domain is required for productive motility.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>The I domain of TRAP is essential for salivary gland invasion and gliding motility of sporozoites.</title><p>(<bold>A</bold>) Domain architecture of full-length TRAP and the mutant TRAP∆I lacking the I domain denoting signal peptide (SP), I domain (I, green), thrombospondin type-I repeat (TSR, blue), repeats, transmembrane domain (TMD) and cytoplasmic tail domain (CTD). (<bold>B</bold>) Sporozoite numbers in the salivary glands of mosquitoes infected with <italic>trap∆I</italic>, <italic>trap(-)</italic> and wild type (<italic>wt</italic>) 14–22 days post infection. Shown is the mean ± SEM of at least seven counts of three different feeding experiments. ***p&lt;0.0001 one-way-ANOVA (Kruskal-Wallis-test). (<bold>C</bold>) Motility of hemolymph sporozoites isolated 13–16 days post infection. Sporozoites moving in at least one full circle within five minutes were considered to be productively moving while all sporozoites that behaved differently were classified as unproductively moving/non motile. The number of analyzed sporozoites is indicated above each bar. (<bold>D</bold>) Immunofluorescence images of permeabilized and unpermeabilized <italic>trap∆I</italic>, wild type and <italic>trap(-)</italic> midgut sporozoites using αTRAP-repeat and anti CSP antibodies as well as Hoechst to stain DNA. Note that intracellular TRAP is stained after permeabilization as indicated in the schematic (grey box). Scale bars: 10 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig2-v1.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Generation of <italic>trap∆I</italic> and <italic>trap(-)</italic> parasites.</title><p>(<bold>A</bold>) Strategy to generate parasites that lack the I domain of TRAP (<italic>trap∆I</italic>) (top) and a <italic>trap</italic>(-) (bottom) line without resistance marker by double crossover homologous recombination. For the generation of <italic>trap∆I</italic> parasites the <italic>trap</italic> locus in wild type (<italic>wt</italic>) parasites was replaced with a gene copy that lacks the I domain and a positive resistance marker (<italic>hdhfr</italic>) driven by the <italic>ef1α</italic> promoter. Note that the inserted copy was codon modified for <italic>E. coli K12</italic> (the codon modified gene copy is indicated in white while the wild type allele is shown in grey) to avoid unwanted crossover events with the C-terminus of the <italic>trap</italic> open reading frame (ORF). The deleted sequence encoding the I domain is indicated by stripes. The TRAP knockout was generated with a Plasmogem vector (see Materials and methods) by replacing the <italic>trap</italic> locus with a selection cassette that enables positive and negative selection. The resulting <italic>trap(-)</italic> parasites were treated with 5-fluorocytosine to select for parasites that lost the resistance cassette. Primer and predicted length of PCR products are indicated by arrowheads and black lines below the scheme. (<bold>B</bold>) PCR analysis of isogenic populations of <italic>trap∆I</italic>, <italic>trap</italic>(-) in comparison to wild type (<italic>wt</italic>). Sizes of PCR products are indicated below the images.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig2-figsupp1-v1.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Movement patterns exhibited by sporozoites.</title><p>Sporozoites placed on solid substrates can exhibit different types of movement. Gliding, sporozoites migrate continuously in circles. Patch gliding sporozoites move back and forth over a single adhesion site. Twitching sporozoites are attached to the surface and bend back and forth continuously. Waving sporozoites are attached on one end and turn their body around this adhesion. Attached sporozoites stay fixed on the substrate. Floating sporozoites are not attached and drift with the flow of the medium. Gliding results in directed forward movement and was classified as productive motility. Other types of movements (patch gliding, twitching, and waving) lead to persistence of sporozoites at a single site and were classified as unproductive motility. Attached and floating sporozoites were classified as non-motile. Scale bars: 10 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig2-figsupp2-v1.tif"/></fig><fig id="fig2s3" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 3.</label><caption><title><italic>trap∆I</italic> sporozoites are not infective to mice.</title><p>Mice were either exposed to 10 infected mosquitoes (<bold>A</bold>) or injected intravenously with 10,000 hemolymph sporozoites (<bold>B</bold>) of <italic>trap∆I</italic> or wild type (<italic>wt</italic>). Parasite growth and survival of infected mice was monitored for 10 days post infection. Survival graphs correspond to the growth curve shown above. Shown is the mean parasitemia ± SEM of four mice for each parasite line from a representative experiment.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig2-figsupp3-v1.tif"/></fig></fig-group><p>Infectivity of mutant sporozoites was tested by exposing naive mice to infected mosquitoes or by intravenously injecting sporozoites obtained from the midgut, hemolymph or even salivary glands (<xref ref-type="table" rid="table1">Table 1</xref>). Upon infection with wild type sporozoites, the first blood stage parasites were visible as expected after 3 to 8 days; in contrast, no infections could be observed for <italic>trapΔI</italic> and <italic>trap(-)</italic> parasites (<xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3</xref>, <xref ref-type="table" rid="table2">Table 2</xref>, <xref ref-type="table" rid="table3">Table 3</xref>). Immunofluorescence assays on midgut sporozoites using an antibody recognizing the repeat region of TRAP showed specific fluorescence in most sporozoites at one end with no recognizable difference between <italic>trapΔI</italic> and wild type sporozoites. This suggests that the mutated TRAP is also localized in the secretory micronemes. In contrast, TRAP-specific fluorescence was absent in <italic>trap(-)</italic> sporozoites. TRAP could also be observed on the surface of unpermeabilized <italic>trapΔI</italic> sporozoites indicating that micronemal secretion is not abolished in these parasites (<xref ref-type="fig" rid="fig2">Figure 2D</xref>).</p></sec><sec id="s2-2"><title>Structurally conserved I domains of other species partially rescue salivary gland invasion</title><p>We next tested whether the lack of productive motility and infectivity as well as the severely impaired salivary gland invasion rate in <italic>trapΔI</italic> parasites could be rescued by replacing the deleted TRAP I domain with an I domain from a foreign species. We selected structurally characterized I domains of MIC2 from <italic>Toxoplasma gondii</italic> and the I domains of the human integrin α-subunits αX (CD11c) and αL (CD11a) (<xref ref-type="fig" rid="fig1">Figure 1C–E</xref>). Sequence identity among I domains is 36% between αL and αX, 18% between these integrins and <italic>P. berghei</italic> TRAP, and 28% between TRAP and MIC2 (<xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>). The I domains from TRAP and αX are basic, with pI values of 9.7 and 8.9, respectively, while those of MIC2 and αL are acidic, with pI values of 6.1 and 5.8, respectively (<xref ref-type="bibr" rid="bib43">Song et al., 2012</xref>; <xref ref-type="bibr" rid="bib44">Song and Springer, 2014</xref>). Furthermore, the αX I domain is poly-specific as shown by binding to multiple glycoproteins and proteolytic fragments as well as heparin (<xref ref-type="bibr" rid="bib50">Vorup-Jensen et al., 2005</xref>; <xref ref-type="bibr" rid="bib51">Vorup-Jensen et al., 2007</xref>), while the αL I domain is highly specific for the ligand intercellular adhesion molecule (ICAM-1) and its homologues ICAM-2, ICAM-3, and ICAM-5 (<xref ref-type="bibr" rid="bib16">Grakoui et al., 1999</xref>).</p><p>The <italic>fluo</italic> line, with eGFP constitutively expressed in all parasite stages and mCherry specifically expressed in sporozoites, was used to generate some of the respective transgenic parasite lines to simplify analysis of TRAP I domain replacements throughout the parasite life cycle (<xref ref-type="bibr" rid="bib4">Bane et al., 2016</xref>). Parasite lines expressing either codon modified wild type TRAP (TRAP-I) or codon modified TRAP with foreign I domains (MIC2-I, αX-I or αL-I) replacing the <italic>P. berghei</italic> TRAP I domain (<xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>) were generated with both <italic>fluo</italic> and <italic>non-fluo trap(-)</italic> parasite lines by homologous recombination (<xref ref-type="fig" rid="fig3">Figure 3A</xref> and <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). TRAP shows the same localization in <italic>MIC2-I</italic>, <italic>αX-I</italic> and <italic>αL-I</italic> midgut sporozoites as in <italic>TRAP-I</italic> midgut sporozoites (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). Western blots showed similar expression levels of TRAP in hemolymph sporozoites of <italic>TRAP-I</italic>, <italic>trapΔI</italic>, <italic>αX-I</italic> and <italic>αL-I</italic> while no TRAP could be detected for <italic>trap(-)</italic> (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). Similar localization and expression of TRAP was also observed for <italic>MIC2-I</italic> and <italic>TRAP-I</italic> salivary gland sporozoites (<xref ref-type="fig" rid="fig3">Figure 3D,E</xref>). <italic>MIC2-I fluo</italic> and <italic>non-fluo</italic> lines entered salivary glands at similar rates as wild type sporozoites (<xref ref-type="fig" rid="fig3">Figure 3F,G,H</xref>, <xref ref-type="table" rid="table1">Table 1</xref>). <italic>αX-I</italic> and <italic>αL-I</italic> sporozoites were capable of invading the salivary glands, albeit at very low rates (<xref ref-type="table" rid="table1">Table 1</xref> and <xref ref-type="fig" rid="fig3">Figure 3F and G</xref>, note the log scale of the y axis). The numbers for <italic>αX-I</italic> ranged from ~100 (<italic>fluo</italic>) to ~200 (<italic>non-fluo</italic>) and for <italic>αL-I</italic> from ~30 (<italic>non-fluo</italic>) to ~90 (<italic>fluo</italic>) sporozoites per gland (<xref ref-type="fig" rid="fig3">Figure 3F,G</xref> and <xref ref-type="table" rid="table1">Table 1</xref>) compared to 0–200 for <italic>trap(-)</italic> sporozoites and 0–800 for <italic>trapΔI</italic>. These small numbers might also be due to contaminants from the hemolymph and hence need to be treated with caution. Yet in all (8/8) <italic>αX-I</italic> mosquito infections sporozoites were detected in salivary glands, whereas this was only the case in 50% (4/8) of <italic>αL-I</italic> infections. In contrast for mosquitoes infected with <italic>trap(-)</italic> or <italic>trapΔI</italic> sporozoites were only detected in 13% (1/8) and 21% (3/14) experiments, respectively. (<xref ref-type="table" rid="table1">Table 1</xref>). In line with this observation, <italic>αX-I</italic> but not <italic>αL-I</italic> sporozoites could be detected in isolated salivary glands by live fluorescence microscopy (<xref ref-type="fig" rid="fig3">Figure 3H</xref> and <xref ref-type="video" rid="video1">Video 1</xref>) that indeed sporozoites expressing <italic>αX-I</italic> can enter this organ more efficiently than those expressing <italic>αL-I</italic>.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Sporozoites expressing TRAP with I domains from <italic>T. gondii</italic> or humans invade salivary glands at different levels.</title><p>(<bold>A</bold>) Domain architecture of full-length TRAP (see <xref ref-type="fig" rid="fig2">Figure 2A</xref> legend) indicating the exchanged I domain. (<bold>B</bold>) Immunofluorescence assay (IFA) using antibodies against TRAP and CSP on non-fluorescent permeabilized <italic>TRAP-I</italic>, <italic>MIC2-I</italic>, <italic>aX-I</italic> and <italic>aL-I</italic> midgut sporozoites. Scale bars: 10 µm. (<bold>C</bold>) Western blot probing TRAP from control (<italic>TRAP-I</italic>), <italic>trap(-)</italic>, <italic>trapΔI</italic>, <italic>aX-I</italic> and <italic>aL-I</italic> hemolymph sporozoites. Anti-CSP antibodies were used as loading control. The asterisks mark an unspecific band observed in lysates of hemolymph sporozoites but not in lysates of salivary gland sporozoites (see panel E for TRAP-I). Repeated PCR of genomic DNA from the parasite lines also suggested that this band is not due to a TRAP fragment. (<bold>D</bold>) IFA using anti-TRAP antibodies on non-fluorescent <italic>TRAP-I</italic> and <italic>MIC2-I</italic> salivary gland sporozoites. Scale bars: 10 µm. (<bold>E</bold>) Western blot probing TRAP and CSP of <italic>TRAP-I</italic> and <italic>MIC2-I</italic> salivary gland sporozoites. (<bold>F, G</bold>) Quantification of salivary gland sporozoites of fluorescent (<italic>fluo</italic>) (<bold>F</bold>) and non-fluorescent (<italic>non-fluo</italic>) (<bold>G</bold>) I domain mutants 17–24 days post infection. The pictogram below each graph indicates the genotype of the tested parasite lines. Shown is the mean ± SEM of at least three (<bold>F</bold>) or two (<bold>G</bold>) countings from three (<bold>F</bold>) and one (<bold>G</bold>) independent feeding experiments. **p&lt;0.05 one-way-ANOVA (Kruskal-Wallis-test). Note that mosquitoes infected with <italic>non-fluo</italic> lines were not preselected for fluorescent parasites before dissection potentially yielding smaller numbers. No significance test for (<bold>G</bold>) as data derived from one experiment. (<bold>H</bold>) Salivary gland colonization by sporozoites expressing the different I domains shown above each image. The fluorescence of mCherry expressing sporozoites is coded for intensity. The small image inset depicts the respective salivary gland in differential interference contrast (DIC). Scale bar: 200 µm. Invasion of the salivary glands by <italic>αX-I</italic> sporozoites is also shown in <xref ref-type="video" rid="video1">Video 1</xref>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig3-v1.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Generation of <italic>P. berghei</italic> strains expressing TRAP with different I domains.</title><p>(<bold>A</bold>) Cartoon illustrating the generation of transgenic parasites expressing <italic>trap</italic> genes with exchanged I domains in <italic>fluo</italic> and <italic>trap(-)</italic> parasites. Transgenic parasites were generated by double crossover homologous recombination replacing the endogenous <italic>trap</italic> gene (<italic>fluo line</italic>) or complementing the <italic>trap</italic> locus in <italic>trap(-)</italic> parasites: <italic>TRAP-I</italic>, expressing the wild type allele of TRAP from a codon-modified gene and thus serving as a control line; <italic>MIC2-I</italic>, chimeric TRAP expressing the I domain of micronemal protein 2 (MIC2) from <italic>Toxoplasma gondii; αX-I</italic>, chimera expressing the I domain of the human integrin αX; <italic>αL-I</italic>, chimera expressing the I domain of the human integrin αL; <italic>RevCharge</italic>, containing seven mutations that shift the surface charge of the TRAP I domain from a pI of 9.7 to 6.8 (see <xref ref-type="fig" rid="fig6">Figure 6A</xref>). The <italic>trap</italic> coding sequence in all generated lines was codon modified for <italic>E. coli K12</italic> to avoid unwanted crossover events and to distinguish chimeras from wild type (<italic>wt</italic>). Binding sites and numbers of primers used for genotyping as well as the length of amplified PCR products are indicated with arrowheads and black lines below the scheme. Note that the illustration is not drawn to scale. (<bold>B</bold>) To control for correct integration of the transfected DNA sequences, three different PCRs were performed. The 5'INT PCR amplifies the 5' end of the integrated sequence with a primer that binds upstream of the integration site matching a primer that binds specifically to the sequence encoding the I domain. The 3'INT PCR amplifies the 3' end of the integrated sequence with a primer that binds downstream of the integration site matching a primer in the selection cassette. The control PCR (Con or KO) uses primers that are specific for the recipient lines <italic>fluo</italic> or <italic>trap(-)</italic>. The length of the expected PCR products is depicted below the gel images. Shown are only PCR results of isogenic populations cloned by limiting dilution.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig3-figsupp1-v1.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>Transmission efficacy of salivary gland sporozoites expressing TRAP with different I domains transmitted either by mosquito bite or by intravenous injection.</title><p>Mice were either exposed to 10 infected mosquitoes (<bold>A</bold>) or injected intravenously (i.v.) with 10,000 salivary gland sporozoites (<bold>B</bold>). Shown is the parasitemia of four infected mice per parasite line as mean ± SEM from day 3 to day 10. The survival of infected mice was monitored for 12 days post infection. The survival graphs correspond to the growth curves shown above. Per parasite line and experiment four mice were infected. Note that only growth curves and survival graphs of fluorescent parasite lines are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig3-figsupp2-v1.tif"/></fig><fig id="fig3s3" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 3.</label><caption><title>Transmission efficacy of intravenously injected hemolymph sporozoites expressing TRAP with different I domains.</title><p>Mice were either injected intravenously (i.v.) with 10,000 (<bold>A</bold>) or 25,000 (<bold>B</bold>) hemolymph sporozoites. Injections with 25,000 hemolymph sporozoites were only performed with <italic>αX-I fluo</italic> and <italic>αL-I fluo</italic> parasites. Shown is the parasitemia of four infected mice per parasite line as mean ± SEM from day 3 to day 9 respectively 10. The survival of infected mice was monitored for 10 respectively 12 days post infection. Survival graphs correspond to the growth curves shown above. Per parasite line and experiment two to four mice were infected. (<bold>A</bold>) Represents a single experiment with four infected mice per parasite line. (<bold>B</bold>) Represents two experiments with eight (<italic>αX-I</italic>) respectively six (<italic>αL-I</italic>) mice. Note that only growth curves and survival graphs for fluorescent parasite lines are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig3-figsupp3-v1.tif"/></fig><fig id="fig3s4" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 4.</label><caption><title>Sporozoites expressing the integrin I domains αX or αL are infective to mice.</title><p>(<bold>A</bold>) Primers were designed to bind specific to sequences encoding for the different I domains TRAP-I, MIC2-I, αX-I and αL-I. (<bold>B</bold>) Cartoon to illustrate the genotype analysis of parasites isolated from selected mice infected with αX<italic>-I</italic> or α<italic>L-I</italic> determined by PCR with three different primer combinations: control (con); amplification of the 5'UTR including the N-terminal end of the TRAP wild type ORF, 5'INT; amplification of the 5'UTR including the N-terminal end of the codon modified TRAP ORF, 3'INT; amplification of the 3'UTR including the C-terminal part of the selection cassette. Illustration is not drawn to scale. (<bold>C</bold>) PCR genotyping of mice that became blood stage positive after injection of 10,000 or 25,000 αX<italic>-I</italic> or α<italic>L-I</italic> hemolymph sporozoites. In addition to the PCR data shown here, sequencing of the <italic>trap</italic> locus revealed the correct identity of the used parasite line in all tested mice.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig3-figsupp4-v1.tif"/></fig></fig-group><table-wrap id="table1" position="float"><label>Table 1.</label><caption><title>Absolute sporozoite numbers in midgut (MG), hemolymph (HL) and salivary glands (SG) of all analyzed parasite strains.</title><p>Sporozoites in the midgut, hemolymph and the salivary glands of infected mosquitoes were counted between day 14 and day 24 post infection of each feeding experiment. Shown is the mean ± SD of all performed experiments per parasite line. Mosquitoes infected with fluorescent parasite lines were pre-selected for fluorescence in the abdomen using a fluorescence binocular microscope while mosquitoes infected with non-fluorescent parasites were not. Hence sporozoite numbers per infected mosquito for fluorescent parasite lines should be higher compared to non-fluorescent lines. n.d. – not determined; bold numbers indicate lower levels of salivary gland invasion.</p></caption><table frame="hsides" rules="groups"><thead><tr><th valign="top">Parasite line</th><th valign="top">No. of MG sporozoites</th><th valign="top">No. of HL sporozoites</th><th valign="top">No. of SG sporozoites</th><th valign="top">SGS pos./total counts</th><th valign="top">SGS/MGS</th></tr></thead><tbody><tr><td valign="top"><italic>trap(-)</italic></td><td valign="top">26,000 <break/>(±24.000)</td><td valign="top">6000 <break/>(±7,000)</td><td valign="top"><bold>20</bold></td><td valign="top"><bold>1/8</bold></td><td valign="top"><bold>0.0009</bold></td></tr><tr><td valign="top"><italic>wt</italic></td><td valign="top">10,000 <break/>(±3,000)</td><td valign="top">n.d.</td><td valign="top">8000 <break/>(±7,000)</td><td valign="top">4/4</td><td valign="top">0.8</td></tr><tr><td valign="top"><italic>fluo</italic></td><td valign="top">108,000 <break/>(±70,000)</td><td valign="top">n.d.</td><td valign="top">21,000 <break/>(±4,000)</td><td valign="top">6/6</td><td valign="top">0.2</td></tr><tr><td valign="top"><italic>TRAP-I</italic></td><td valign="top">26,000 <break/>(±7,000)</td><td valign="top">8,000*</td><td valign="top">16,000 <break/>(±4,000)</td><td valign="top">2/2</td><td valign="top">0.6</td></tr><tr><td valign="top"><italic>MIC2-I</italic></td><td valign="top">38,000 <break/>(±16,000)</td><td valign="top">6,000*</td><td valign="top">18,000 <break/>(±3,000)</td><td valign="top">2/2</td><td valign="top">0.5</td></tr><tr><td valign="top"><italic>αX-I</italic></td><td valign="top">35,000 <break/>(±13,000)</td><td valign="top">4,000*</td><td valign="top"><bold>210</bold></td><td valign="top">2/2</td><td valign="top"><bold>0.006</bold></td></tr><tr><td valign="top"><italic>αL-I</italic></td><td valign="top">42,000 <break/>(±16,000)</td><td valign="top">7,000*</td><td valign="top"><bold>30</bold></td><td valign="top"><bold>1/2</bold></td><td valign="top"><bold>0.0006</bold></td></tr><tr><td valign="top"><italic>RevCharge</italic></td><td valign="top">70,700 <break/>(±12,000)</td><td valign="top">n.d.</td><td valign="top">13,000 <break/>(±6,000)</td><td valign="top">7/7</td><td valign="top">0.2</td></tr><tr><td valign="top"><italic>trapΔI</italic></td><td valign="top">24,000 <break/>(±20,000)</td><td valign="top">4000 <break/>(±5.000)</td><td valign="top"><bold>60</bold>†</td><td valign="top"><bold>3/14</bold></td><td valign="top"><bold>0.003</bold></td></tr><tr><td valign="top"><italic>TRAP-I fluo</italic></td><td valign="top">22,000 <break/>(±13,000)</td><td valign="top">2000 <break/>(±2.000)</td><td valign="top">17,000 <break/>(±6,000)</td><td valign="top">8/8</td><td valign="top">0.8</td></tr><tr><td valign="top"><italic>MIC2-I fluo</italic></td><td valign="top">21,000 <break/>(±17,000)</td><td valign="top">1000 <break/>(±700)</td><td valign="top">7000 <break/>(±4,000)</td><td valign="top">7/7</td><td valign="top">0.3</td></tr><tr><td valign="top"><italic>αX-I fluo</italic></td><td valign="top">37,000 <break/>(±7,000)</td><td valign="top">6000 <break/>(±2,000)</td><td valign="top"><bold>120</bold></td><td valign="top">6/6</td><td valign="top"><bold>0.003</bold></td></tr><tr><td valign="top"><italic>αL-I fluo</italic></td><td valign="top">34,000 <break/>(±9,000)</td><td valign="top">5000 <break/>(±3,000)</td><td valign="top"><bold>90</bold></td><td valign="top"><bold>3/6</bold></td><td valign="top"><bold>0.003</bold></td></tr></tbody></table><table-wrap-foot><fn><p>*hemolymph sporozoites of the non-fluorescent lines <italic>TRAP-I</italic>, <italic>MIC2-I</italic>, <italic>αX-I</italic> and <italic>αL-I</italic> were only counted once.</p><p>†in one infection 800 SG sporozoites could be counted. Intravenous injection of 5000 salivary gland sporozoites into each of four mice did not lead to infection.</p></fn></table-wrap-foot></table-wrap><media id="video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-57572-video1.mp4"><label>Video 1.</label><caption><title>Z-projection through salivary gland infected with <italic>aX-I fluo</italic> sporozoites.</title><p>Shown is an image series in Z-direction of a salivary gland infected with <italic>aX-I fluo</italic> sporozoites. Images were taken on an Axiovert 200M (Zeiss) with a 63x (N.A. 1.3) objective.</p></caption></media></sec><sec id="s2-3"><title>Divergent I domains can partially restore gliding motility and infectivity of sporozoites</title><p>We next analyzed motility of the parasite lines in vitro using the classification scheme shown in <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>. Gliding assays of hemolymph sporozoites revealed that ~24% of <italic>TRAP-I</italic> but only ~4% of <italic>MIC2-I</italic> sporozoites were productively motile (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). As expected, a higher proportion of salivary gland sporozoites were productively motile;~53% for <italic>TRAP-I</italic> and ~15% for <italic>MIC2-I</italic> sporozoites (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). Among hemolymph sporozoites,~1% of <italic>αX-I</italic> (<xref ref-type="video" rid="video2">Video 2</xref>) but none of the &gt;3000 observed <italic>αL-I</italic> sporozoites showed productive movement (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). Motile <italic>TRAP-I</italic> and <italic>MIC2-I</italic> salivary gland sporozoites moved with a similar speed of ~1.5 µm/s (<xref ref-type="fig" rid="fig4">Figure 4C</xref>), showed similar trajectories (<xref ref-type="fig" rid="fig4">Figure 4D</xref>), and showed similarly persistent gliding (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). Owing to the low numbers of <italic>αX-I</italic> and <italic>αL-I</italic> sporozoites in the glands (<xref ref-type="fig" rid="fig3">Figure 3</xref>), similar quantitation of sporozoite motility was not possible.</p><media id="video2" mime-subtype="mp4" mimetype="video" xlink:href="elife-57572-video2.mp4"><label>Video 2.</label><caption><title><italic>TRAP-I</italic> and <italic>αX-I</italic> hemolymph sporozoites gliding in vitro.</title><p>Movie showing hemolymph sporozoites expressing mCherry of <italic>TRAP-I</italic> (shown on the left with a white background) and <italic>αX-I</italic> (shown on the right with a black background) productively gliding in vitro. Imaging was performed on an Axiovert 200M (Zeiss) with a 10x (NA 0.25) objective. Shown is a three-minute movie with three seconds between frames.</p></caption></media><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Impaired in vitro gliding of I domain mutant sporozoites.</title><p>(<bold>A, B</bold>) Ratio of productively and unproductively moving/non motile hemolymph (<bold>A</bold>) and salivary gland (<bold>B</bold>) sporozoites of the indicated parasite lines. Sporozoites were classified as productively moving if they were able to glide at least one complete circle during a three-minute movie. All sporozoites that behaved differently were classified as unproductively moving/non motile. Data were generated from three independent experiments per parasite line. The number of analyzed sporozoites is depicted above each column. For further details about movement pattern of sporozoites see <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>. Note that salivary gland sporozoites from the lines <italic>αX-I</italic> and <italic>αL-I</italic> could not be analyzed because of their low number. (<bold>C</bold>) Average speed of salivary gland sporozoites continuously gliding for 150 s. Shown are the mean speeds of 50 salivary gland sporozoites per line generated from two (<italic>MIC2-I</italic>) and three (<italic>TRAP-I</italic>) independent experiments. Red bars show the mean ± SEM; unpaired t-test. (<bold>D</bold>) Trajectories of the sporozoites tracked in (<bold>C</bold>). (<bold>E</bold>) Persistence of gliding <italic>TRAP-I</italic> and <italic>MIC2-I</italic> sporozoites. The graph illustrates the number of circles salivary gland sporozoites were able to glide during a three-minute movie. Data were generated from two (<italic>MIC2-I</italic>; 107 sporozoites) and three (<italic>TRAP-I</italic>; 111 sporozoites) independent experiments.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig4-v1.tif"/></fig><p>To probe the infectivity of mutant sporozoites, mice were exposed to infected mosquitoes. This revealed infection rates of 100% with a similar prepatent period (time until an infection could be detected in the blood) for <italic>TRAP-I</italic> and <italic>MIC2-I</italic> sporozoites (<xref ref-type="table" rid="table2">Table 2</xref>, <xref ref-type="table" rid="table3">Table 3</xref>). In contrast, no transmission could be observed for <italic>αX-I</italic> and <italic>αL-I</italic> sporozoites (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>, <xref ref-type="table" rid="table2">Table 2</xref>). Intravenous injection of 10,000 <italic>TRAP-I</italic> or <italic>MIC2-I</italic> salivary gland sporozoites also infected all mice with a prepatency of three days. Unfortunately, the numbers of <italic>αX-I</italic> and <italic>αL-I</italic> salivary gland sporozoites were too low for comparative tests (<xref ref-type="table" rid="table1">Table 1</xref>). We therefore injected 10,000 hemolymph sporozoites, which again resulted in similar infection rates as seen for <italic>TRAP-I</italic> and <italic>MIC2-I</italic> sporozoites with a slightly longer prepatency when compared to salivary gland sporozoites (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>, <xref ref-type="table" rid="table2">Table 2</xref>). Interestingly, 50% (4/8) of mice injected with 10,000 <italic>αX-I</italic> hemolymph sporozoites became blood stage patent after a delayed prepatency of &gt;5 days, while no infection was observed for the same number of <italic>αL-I</italic> hemolymph sporozoites (0/8) (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>, <xref ref-type="table" rid="table2">Table 2</xref>). When injecting 25,000 hemolymph sporozoites, 5 of 8 mice injected with <italic>αX-I</italic> sporozoites became blood stage patent and additionally, 1 of 6 mice injected with <italic>αL-I</italic> sporozoites became infected (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>, <xref ref-type="table" rid="table2">Table 2</xref>, <xref ref-type="table" rid="table3">Table 3</xref>). Finally, we injected mice with 500,000 midgut sporozoites to compare <italic>αX-I</italic> and <italic>αL-I</italic> side by side with <italic>trap(-)</italic> and <italic>trapΔI</italic>. Injections of <italic>αX-I</italic> midgut sporozoites infected 2 out of 4 mice with a prepatent period of 8 days. In contrast no infections in mice could be observed when <italic>αL-I</italic> (0/2), <italic>trap(-)</italic> (0/4) or <italic>trapΔI</italic> (0/6) midgut sporozoites were injected (<xref ref-type="table" rid="table2">Table 2</xref>). Mice infected with the same number of wild type or wild type-like midgut sporozoites become blood stage patent after 6–8 days (<xref ref-type="table" rid="table2">Table 2</xref>; <xref ref-type="bibr" rid="bib24">Klug and Frischknecht, 2017</xref>). To exclude spurious results from contamination with other parasite lines, some of the transmitted parasites were propagated in mice and analyzed via PCR for the correct genotype (<xref ref-type="fig" rid="fig3s4">Figure 3—figure supplement 4</xref>). Additionally, the TRAP locus of these parasites was sequenced to ensure that the correct I domain was present. In all tested cases, the expected <italic>αX-I</italic> and <italic>αL-I</italic> genotype was confirmed. Thus, <italic>TRAP-I</italic> and <italic>MIC2-I</italic> sporozoites are comparably infectious to mice, <italic>αX-I</italic> sporozoites are moderately infectious and <italic>αL-I</italic>, while nearly completely deficient in infectivity, could in one case still cause an infection.</p><table-wrap id="table2" position="float"><label>Table 2.</label><caption><title>Determination of transmission efficacy in vivo.</title><p>Transmission efficacy of <italic>trap(-)</italic>, <italic>trapΔI, TRAP-I</italic>, <italic>MIC2-I</italic>, <italic>αX-I</italic>, <italic>αL-I</italic> and <italic>RevCharge</italic> as well as the wild type (<italic>wt</italic>) reference line. Prepatency is the time between sporozoite infection and the first observance of blood stages and is given as the mean of all positive mice of the respective experiment(s). C57BL/6 mice were either injected intravenously (i.v.) with 10,000 salivary gland sporozoites (SGS) or 10,000 hemolymph sporozoites (HLS) or exposed to 10 mosquitoes that received an infected blood meal. Note that mosquitoes infected with fluorescent parasite lines were pre-selected while mosquitoes infected with non-fluorescent parasites were not pre-selected but dissected afterwards to ensure that all mice were bitten by at least one infected mosquito. For strains with strongly decreased salivary gland invasion capacity (<italic>aX-I</italic> and <italic>aL-I</italic>) no SGS but 25,000 HLS were injected.</p></caption><table frame="hsides" rules="groups"><thead><tr><th valign="top">Parasite line</th><th valign="top">Route of inoculation</th><th valign="top">Infected Mice<sup>‡</sup></th><th valign="top">Prepatency <break/>(days)</th></tr></thead><tbody><tr><td valign="top"><italic>wild type ANKA</italic></td><td valign="top">by mosquito bite<sup>§</sup></td><td valign="top">4/4</td><td valign="top">3.0</td></tr><tr><td valign="top"><italic>wild type ANKA</italic></td><td valign="top">10,000 HLS</td><td valign="top">4/4</td><td valign="top">3.0</td></tr><tr><td valign="top"><italic>TRAP-I fluo</italic></td><td valign="top">by mosquito bite<sup>§</sup></td><td valign="top">4/4</td><td valign="top">3.0</td></tr><tr><td valign="top"><italic>TRAP-I fluo</italic></td><td valign="top">500,000 MGS</td><td valign="top">1/1<sup>†</sup></td><td valign="top">8.0</td></tr><tr><td valign="top"><italic>TRAP-I fluo</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">4/4</td><td valign="top">4.0</td></tr><tr><td valign="top"><italic>TRAP-I fluo</italic></td><td valign="top">10,000 SGS (i.v.)</td><td valign="top">4/4</td><td valign="top">3.0</td></tr><tr><td valign="top"><italic>MIC2-I fluo</italic></td><td valign="top">by mosquito bite<sup>§</sup></td><td valign="top">4/4</td><td valign="top">3.0</td></tr><tr><td valign="top"><italic>MIC2-I fluo</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">4/4</td><td valign="top">3.8</td></tr><tr><td valign="top"><italic>MIC2-I fluo</italic></td><td valign="top">10,000 SGS (i.v.)</td><td valign="top">8/8</td><td valign="top">3.1</td></tr><tr><td valign="top"><italic>αX-I fluo</italic></td><td valign="top">by mosquito bite<sup>§</sup></td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>αX-I fluo</italic></td><td valign="top">500,000 MGS (i.v.)</td><td valign="top">2/4</td><td valign="top">8.0</td></tr><tr><td valign="top"><italic>αX-I fluo</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">1/4</td><td valign="top">6.0</td></tr><tr><td valign="top"><italic>αX-I fluo</italic></td><td valign="top">25,000 HLS (i.v.)</td><td valign="top">5/8</td><td valign="top">5.5</td></tr><tr><td valign="top"><italic>αL-I fluo</italic></td><td valign="top">by mosquito bite<sup>§</sup></td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>αL-I fluo</italic></td><td valign="top">500,000 MGS (i.v.)</td><td valign="top">0/2</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>αL-I fluo</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>αL-I fluo</italic></td><td valign="top">25,000 HLS (i.v.)</td><td valign="top">1/6</td><td valign="top">5.0</td></tr><tr><td valign="top"><italic>trap(-)</italic></td><td valign="top">500,000 MGS (i.v.)</td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>trap(-)</italic></td><td valign="top">25,000 HLS (i.v.)</td><td valign="top">0/6</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>trap∆I</italic></td><td valign="top">by mosquito bite<sup>¶</sup></td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>trap∆I</italic></td><td valign="top">500,000 MGS (i.v.)</td><td valign="top">0/6</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>trap∆I</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>trap∆I</italic></td><td valign="top">25,000 HLS (i.v.)</td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>trap∆I</italic></td><td valign="top">5,000 SGS (i.v.)</td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>TRAP-I</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">4/4</td><td valign="top">3.0</td></tr><tr><td valign="top"><italic>MIC2-I</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">4/4</td><td valign="top">4.0</td></tr><tr><td valign="top"><italic>αX-I</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">3/4</td><td valign="top">5.3</td></tr><tr><td valign="top"><italic>αL-I</italic></td><td valign="top">10,000 HLS (i.v.)</td><td valign="top">0/4</td><td valign="top">/*</td></tr><tr><td valign="top"><italic>RevCharge</italic></td><td valign="top">by mosquito bite<sup>¶</sup></td><td valign="top">2/8</td><td valign="top">5.5</td></tr><tr><td valign="top"><italic>RevCharge</italic></td><td valign="top">10,000 SGS (i.v.)</td><td valign="top">9/9</td><td valign="top">3.9</td></tr></tbody></table><table-wrap-foot><fn><p>*mice did not become positive within ≥10 days post infection.</p><p><sup>† </sup>three mice had to be sacrificed due to tail infections that occurred after injection.</p></fn><fn><p><sup>‡</sup> Infected mice/inoculated (exposed) mice.</p><p><sup>§</sup> mosquitoes were pre-selected for parasites.</p></fn><fn><p><sup>¶</sup> mosquitoes were not pre-selected for parasites.</p></fn></table-wrap-foot></table-wrap><table-wrap id="table3" position="float"><label>Table 3.</label><caption><title>Clustered summary of in vivo infections.</title><p>Comparison of the sporozoite infectivity to mice of the different lines by adding the data from <xref ref-type="table" rid="table2">Table 2</xref> where the respective controls were 100% infective. Data for wild type controls, <italic>MIC2-I</italic> domain and <italic>RevCharge</italic> parasites are from infections with hemolymph and salivary glands sporozoites as well as by bite experiments. All others summarize infections with hemolymph sporozoites only, as these parasites did not colonize the salivary glands efficiently.</p></caption><table frame="hsides" rules="groups"><thead><tr><th valign="top">Parasite lines</th><th valign="top">Infected mice<sup>*</sup></th></tr></thead><tbody><tr><td valign="top"><italic>wild type controls</italic></td><td valign="top">24/24</td></tr><tr><td valign="top"><italic>MIC2-I domain</italic> <break/><italic>RevCharge</italic></td><td valign="top">20/20 <break/>11/17</td></tr><tr><td valign="top"><italic>αX-I domain</italic></td><td valign="top">9/16</td></tr><tr><td valign="top"><italic>αL-I domain</italic> <break/><italic>trap∆I</italic> <break/><italic>trap(-)</italic></td><td valign="top">1/14 <break/>0/8<sup>†</sup> <break/>0/6</td></tr></tbody></table><table-wrap-foot><fn><p><sup>*</sup> Infected mice/inoculated (exposed) mice.</p><p><sup>†</sup> Four additional mice injected with 5000 salivary gland sporozoites also remained uninfected.</p></fn></table-wrap-foot></table-wrap></sec><sec id="s2-4"><title>Sporozoites expressing the MIC2 I domain are impaired in hepatocyte invasion but do not show altered host cell tropism</title><p>While <italic>Plasmodium</italic> sporozoites can infect different types of cells they have a strong tropism for the liver. In contrast, <italic>Toxoplasma gondii</italic> can infect any nucleated cell from a warm-blooded animal (<xref ref-type="bibr" rid="bib6">Boothroyd, 2009</xref>). Hence, we tested whether an exchange of the I domain affected host cell invasion or tissue tropism of sporozoites. First, we tested the capacity of <italic>TRAP-I</italic> and <italic>MIC2-I</italic> salivary gland sporozoites to invade HepG2 cells. After exposure for 1.5 hr, 2-fold fewer <italic>MIC2-I</italic> sporozoites than <italic>TRAP-I</italic> sporozoites were intracellular (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). At 48 hr after infection, 5-fold fewer <italic>MIC2-I</italic> sporozoites had developed into liver stage parasites when compared to <italic>TRAP-I</italic> sporozoites (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). However, the size of liver stage parasites after 48 hr was comparable implying that an exchange of the I domain affects parasite invasion but not intracellular development (<xref ref-type="fig" rid="fig5">Figure 5C,D</xref>).</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title><italic>MIC2-I</italic> sporozoites are impaired in hepatocyte invasion but not in liver stage development.</title><p>(<bold>A</bold>) Invasion assay. Confluent HepG2 monolayers exposed to sporozoites for 1.5 hr were fixed and stained with CSP antibodies before and after permeabilization with methanol; anti-IgG secondary antibodies conjugated to different fluorochromes were used before and after permeabilization. The illustration on the right depicts the staining of intracellular and extracellular sporozoites. (<bold>B</bold>) Number of liver stages after challenge with 10,000 salivary gland sporozoites. Experiments were performed with sporozoites obtained from two different feeding experiments with 2–3 technical replicates per parasite line and experiment. The red line indicates the median. *** depicts a p-value of 0.005; unpaired t test. (<bold>C, D</bold>) Liver stage development of <italic>TRAP-I</italic> and <italic>MIC2-I</italic> parasites. (<bold>C</bold>) Immunofluorescence images of <italic>TRAP-I</italic> and <italic>MIC2-I</italic> liver stages 48 hr post infection. The expression of <italic>Pb</italic>HSP70 is shown in red while DNA is shown in cyan. Scale bars: 10 µm. (<bold>D</bold>) Area of liver stages 48 hr post infection. The red line shows the median. Data were tested for significance with an unpaired t test. (<bold>E</bold>) Liver load in mice challenged with <italic>MIC2-I</italic> as % of load with the control <italic>TRAP-I</italic>. Shown is the relative expression of parasite-specific 18 s rRNA determined by qRT-PCR and normalized to mouse-specific GAPDH. Data display the mean of three measurements generated from pooled cDNA of four challenged mice per parasite strain.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig5-v1.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title><italic>MIC2-I</italic> sporozoites show no altered tissue tropism compared to <italic>TRAP-I</italic>.</title><p>Parasite load in lung, spleen, small intestine and liver of mice infected with 20,000 <italic>MIC2-I</italic> or <italic>TRAP-I</italic> salivary gland sporozoites. Organs were harvested 42 hr post infection to isolate RNA. Per organ and parasite line equal amounts of RNA were pooled from four infected mice to generate one <italic>TRAP-I</italic> and one <italic>MIC2-I</italic> sample per harvested organ. qRT-PCR was performed in technical triplicates. The mean CT of <italic>Plasmodium berghei</italic> specific 18 s rRNA was subtracted from the mean CT of mouse specific GAPDH. Subsequently the ΔCT was plotted as single value. For further details please see Material and methods.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig5-figsupp1-v1.tif"/></fig></fig-group><p>To test in vivo tropism of sporozoites, mice were infected by intravenous injection of 20,000 <italic>TRAP-I</italic> and <italic>MIC2-I</italic> salivary gland sporozoites and after 42 hr liver, spleen, lung and a part of the small intestine were harvested. Parasite load was measured by quantitative RT-PCR. Liver tropism of both <italic>TRAP-I</italic> and <italic>MIC2-I</italic> salivary gland sporozoites was pronounced, with ~16 fold more parasites localizing to the liver than to any other organ (<xref ref-type="fig" rid="fig5">Figure 5E</xref>, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). However, the liver burden of <italic>MIC2-I</italic> parasites was reduced by ~40% relative to <italic>TRAP-I</italic> parasites, reflecting the similar decrease observed during in vitro infection experiments.</p></sec><sec id="s2-5"><title>Charge reversal mutations of the TRAP I domain differentially impact infectivity</title><p>Based on the results with different I domains, we sought a common pattern explaining the observed phenotypes. One parameter important for protein-protein interactions is surface charge. Interestingly, the surface of the TRAP I domain is very basic, with a pI of 9.7 (<xref ref-type="fig" rid="fig6">Figure 6A</xref>), while the surface of the second best functioning I domain, MIC2, is acidic (pI 6.1) (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). Of the human integrin I domains, the one from αX has a basic charge (pI 8.9), similar to the TRAP I domain (<xref ref-type="fig" rid="fig6">Figure 6C</xref>), while the one of αL is even slightly more negatively charged (pI 5.8) (<xref ref-type="fig" rid="fig6">Figure 6D</xref>) than the I domain of MIC2. To test if surface charge could be important for <italic>P. berghei</italic> TRAP I-domain function, we rendered it anionic (pI of 6.8) with seven charge reversal mutations (H56E, H62E, H123E, K164Q, K165D, R195E and K202E) around the perimeter of the putative ligand binding site, distal from the MIDAS (<xref ref-type="fig" rid="fig6">Figure 6E</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). Secretion of TRAP to the surface was not altered in these <italic>RevCharge</italic> sporozoites and no difference in protein sub-cellular distribution or expression was observed (<xref ref-type="fig" rid="fig6">Figure 6F,G</xref>). Strikingly, salivary gland invasion was also not affected (<xref ref-type="fig" rid="fig6">Figure 6H</xref>, <xref ref-type="table" rid="table1">Table 1</xref>). However, only ~1% of <italic>RevCharge</italic> salivary gland derived sporozoites were productively motile in gliding assays compared to ~53% of <italic>TRAP-I</italic> parasites (<xref ref-type="fig" rid="fig6">Figure 6I</xref>). Infection by mosquito bite revealed that only 2 out of 8 mice in two independent experiments became blood stage positive with a delay in prepatency of &gt;2 days (<xref ref-type="fig" rid="fig6">Figure 6J</xref>, <xref ref-type="table" rid="table2">Table 2</xref>, <xref ref-type="table" rid="table3">Table 3</xref>) indicating a decreased infectivity of salivary gland sporozoites by over 99%. In contrast, injection of 10,000 salivary gland sporozoites in three independent experiments (nine mice in total) led to an infection of all mice with the prepatency period of the <italic>RevCharge</italic> mutant being delayed by 0.5–1 day compared to controls (wild type<italic>/TRAP-I</italic>) (<xref ref-type="fig" rid="fig6">Figure 6K</xref>, <xref ref-type="table" rid="table2">Table 2</xref>). This corresponds to a decreased infectivity of 50–90%.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Sporozoites expressing an I domain with a negatively charged MIDAS perimeter invade salivary glands normally but show decreased motility and infectivity to mice.</title><p>(<bold>A–E</bold>) Electrostatic surfaces around the MIDAS metal ion of I domains in the open conformation. Structures are of (<bold>A</bold>), <italic>P. berghei</italic> TRAP modeled on <italic>P. vivax</italic>, PDB 4HQL; (<bold>B</bold>), MIC2, modeled on closed MIC2 (PDB 4OKR chain B) and open TRAP (PDB 4HQL); (<bold>C</bold>), integrin αX, PDB 4NEH; (<bold>D</bold>), integrin αL, PDB 1MQ8; and (<bold>E</bold>), <italic>P. berghei</italic> RevCharge modeled on <italic>P. vivax</italic>, (PDB 4HQL). The X marks the MIDAS. The color code refers to the electrostatic potential of the surface ranging from −5 to +5 kT/e. <bold>F</bold>) IFA on unpermeabilized salivary gland sporozoites of <italic>RevCharge</italic> and wild type (<italic>wt</italic>); cyan: TRAP, red: DNA, CSP: black. Scale bars: 10 µm. (<bold>G</bold>) anti-TRAP western blot of salivary gland control (<italic>TRAP-I</italic>) and <italic>RevCharge</italic> sporozoites; loading control: CSP. (<bold>H</bold>) Sporozoite numbers in salivary glands of mosquitoes infected with <italic>TRAP-I</italic> (<italic>fluo</italic>) and <italic>RevCharge</italic> (<italic>non-fluo</italic>) from three independent feeding experiments; Mann-Whitney test. Note that data for the control <italic>TRAP-I</italic> (<italic>fluo</italic>) are shown in <xref ref-type="fig" rid="fig3">Figure 3F</xref>. (<bold>I</bold>) Movement pattern of <italic>TRAP-I</italic> and <italic>RevCharge</italic> salivary gland sporozoites from three different feeding experiments. Sporozoites were classified as productively moving if they were able to perform ≥1 circle during a three minutes movie. All sporozoites that behaved differently were classified as unproductively moving or non-motile. Note that data for the control TRAP-I were shown previously in <xref ref-type="fig" rid="fig4">Figure 4B</xref>. (<bold>J, K</bold>) In vivo infectivity of <italic>TRAP-I</italic> and <italic>RevCharge</italic> salivary gland sporozoites. C57BL/6 mice were either exposed to infected mosquitoes or injected with 10,000 salivary gland sporozoites/mouse intravenously (i.v.) (see also <xref ref-type="table" rid="table2">Table 2</xref>). (<bold>J</bold>) The percentage of parasite-free mice over time after injection of 10,000 salivary gland sporozoites (TRAP-I, n = 4; RevCharge, n = 9). (<bold>K</bold>) The percentage of parasite-free mice over time after exposure to infected mosquitoes (TRAP-I, n = 4; RevCharge, n = 8). p.i. – post infection.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig6-v1.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Alignment of TRAP I domain homologues of different <italic>Plasmodium</italic> species in comparison to the I domain of the <italic>PbRevCharge</italic> mutant.</title><p>The I domain of the <italic>RevCharge</italic> mutant was aligned with the I domains of TRAP homologues found in the five human infecting <italic>Plasmodium</italic> species <italic>P. falciparum</italic> (Pf), <italic>P. malariae</italic> (Pm), <italic>P. ovale</italic> (Po), <italic>P. vivax</italic> (Pv) and <italic>P. knowlesi</italic> (Pk) as well as the three rodent malaria parasites <italic>P. chabaudi</italic> (Pc), <italic>P. yoelii</italic> (Py) and <italic>P. berghei</italic> (Pb) and the bird infecting species <italic>P. relictum</italic> (Pr). Residues part of the MIDAS motif are indicated in red while residues mutated in the <italic>PbRevCharg</italic>e mutant are highlighted in turquoise. Residues in I domains of other <italic>Plasmodium</italic> species matching mutations in the <italic>RevCharge</italic> mutant are marked in green. Note that the positions S90 and I154 (<italic>Pb</italic>TRAP) of the MIDAS motif are not strictly conserved in all aligned <italic>Plasmodium</italic> species. An asterik indicates a position with a single, fully conserved residue. A colon indicates conservation of functional groups with strongly similar properties. A period indicates conservation of functional groups with weakly similar properties.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig6-figsupp1-v1.tif"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 2.</label><caption><title><italic>RevCharge</italic> sporozoites show impaired hepatocyte invasion but normal liver stage development.</title><p>(<bold>A</bold>) Invasion assay of <italic>RevCharge</italic> and control (<italic>TRAP-I</italic>) sporozoites showing sporozoites that entered (black) or not (white) hepatocytes. Cells were fixed and stained with CSP antibodies as well as two anti-IgG secondary antibodies conjugated to different fluorochromes before and after permeabilization with methanol, respectively. The illustration on the right shows the staining pattern of invaded and non-invaded sporozoites. (<bold>B</bold>) Number of liver stages after incubation with 10,000 salivary gland sporozoites. Experiments were performed with sporozoites obtained from two feeding experiments with at least two technical replicates per parasite line and experiment. The red line indicates the median. *** depicts a p-value of 0.005; unpaired t test. (<bold>C</bold>) Immunofluorescence images of <italic>TRAP-I</italic> and <italic>RevCharge</italic> liver stages 48 hr post infection. The expression of <italic>Pb</italic>HSP70 is shown in red while DNA is shown in blue. Scale bars: 8 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-fig6-figsupp2-v1.tif"/></fig></fig-group><p>In vitro invasion of liver cells also showed a severe impairment of the <italic>RevCharge</italic> mutant compared to <italic>TRAP-I</italic>. While after 2 hr 54% of <italic>TRAP-I</italic> sporozoites showed an intracellular localization only 3% of <italic>RevCharge</italic> sporozoites were observed inside cells (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A</xref>). In line with this result very few growing liver stages of the <italic>RevCharge</italic> mutant were observed while on average &gt;250 liver stages per well were counted for <italic>TRAP-I</italic> (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2B</xref>). However, liver stages of the <italic>RevCharge</italic> mutant developed normally (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2C</xref>). These results suggest that the basic charge around the MIDAS of the TRAP I domain is a key determinant of sporozoite motility and infectivity during natural transmission from mosquito to mammal. Most intriguingly, the introduced mutations appear to uncouple the capacity of the <italic>P. berghei</italic> sporozoite to infect insect salivary glands from efficiently infecting the rodent host.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><sec id="s3-1"><title>Structurally related I domains can rescue TRAP function</title><p>Previous studies on the function of the TRAP I domain focused on invariant residues that coordinate the MIDAS metal ion in the I domain (<xref ref-type="bibr" rid="bib52">Wengelnik et al., 1999</xref>; <xref ref-type="bibr" rid="bib27">Matuschewski et al., 2002</xref>). The sidechains of these five invariant I domain residues coordinate the MIDAS Mg<sup>2+</sup> ion either directly or indirectly through water molecules. In contrast to the closed conformation, in the open conformation of TRAP and integrin αI domains, neither of the two Asp residues directly coordinate the MIDAS metal ion. The metal ion is therefore thought to have high propensity in the open conformation to bind an acidic residue in the ligand. The MIDAS residues and their bound water molecules occupy five of the six coordination positions around the MIDAS Mg<sup>2+</sup> ion. The remaining, sixth coordination position is occupied when a critical Asp or Glu sidechain in the ligand binds through a carboxyl oxygen to the MIDAS Mg<sup>2+</sup> ion (<xref ref-type="bibr" rid="bib26">Liddington, 2014</xref>). Mutation of single MIDAS residues or removal of the Mg<sup>2+</sup> ion by chelation abolishes ligand binding by integrins (<xref ref-type="bibr" rid="bib28">Michishita et al., 1993</xref>; <xref ref-type="bibr" rid="bib23">Kern et al., 1994</xref>; <xref ref-type="bibr" rid="bib22">Kamata et al., 1995</xref>). Similarly, mutation of the MIDAS motif of TRAP severely impairs salivary gland invasion and infectivity of the vertebrate host while gliding motility is decreased in salivary gland but not in hemolymph sporozoites (<xref ref-type="bibr" rid="bib27">Matuschewski et al., 2002</xref>). In contrast, deletion of TRAP completely abrogates salivary gland invasion, infectivity and productive motility (<xref ref-type="bibr" rid="bib46">Sultan et al., 1997</xref>; <xref ref-type="bibr" rid="bib31">Münter et al., 2009</xref>) and severely affects substrate adhesion (<xref ref-type="bibr" rid="bib31">Münter et al., 2009</xref>; <xref ref-type="bibr" rid="bib17">Hegge et al., 2010</xref>).</p><p>To elucidate the role of the I domain in TRAP function, we generated the parasite line <italic>trapΔI</italic> expressing TRAP without its I domain. TRAPΔI was expressed and correctly localized in sporozoites as shown by western blotting and immunofluorescence. Interestingly, this line was severely deficient in salivary gland invasion and could not infect mice. Furthermore, we observed no productive movement and only some back-and-forth motility in <italic>trapΔI</italic> hemolymph sporozoites, similar to <italic>trap(-)</italic> hemolymph sporozoites. These results suggest that the biological functions of TRAP are dependent on its I domain. It was therefore remarkable that TRAP function was largely restored by replacement of its I domain by its homologue from <italic>Toxoplasma gondi</italic> with only 28% amino acid sequence identity. Compared to cell surface receptors that engage in typical protein-protein interactions, that is those that are not dependent on Mg<sup>2+</sup> ions, these sequence identities are substantially below the level of 40% to 50% identity generally required for members of the same receptor family to recognize the same ligand. The strength of the Mg<sup>2+</sup> ion bond to the oxygen in the ligand, which has a bond distance of only 2 Å and is partially covalent, may overcome the lack of complementarity in other regions of the ligand binding site, and explain the ability of I domains of such remarkably low sequence identity to function in TRAP. In addition to the low sequence identity, there are six to seven sequence positions where residues are inserted or deleted in Toxoplasma MIC2 or human integrin αI domains compared to TRAP (<xref ref-type="fig" rid="fig1">Figure 1F</xref>). Nonetheless, all regions involved in conformational change around the MIDAS and in the β6-α7 loop are highly conserved in conformation in both the open and closed conformations of the apicomplexan and human I domains (<xref ref-type="bibr" rid="bib43">Song et al., 2012</xref>; <xref ref-type="bibr" rid="bib44">Song and Springer, 2014</xref>). Western blotting showed that the αL-I, αX-I, and MIC2-I TRAP fusions were as well expressed as TRAP-I; furthermore, immunofluorescence showed normal localization in sporozoites, suggesting that trafficking was not impaired.</p><p>Although deletion of the TRAP I domain completely abolished mosquito salivary gland invasion and mouse infection by midgut and hemolymph sporozoites, the MIC2 I domain completely restored these functions. Moreover, no differences in mouse infection were observed between TRAP and MIC2 I domain replacements in infection by mosquito bite or intravenous injection with salivary gland sporozoites, including the length of the prepatent period. Fewer <italic>MIC2-I</italic> than <italic>TRAP-I</italic> sporozoites were able to glide productively in vitro; however, the gliding speed of motile sporozoites and persistence of gliding was similar. Infectivity of HepG2 liver cells was significantly decreased for <italic>MIC2-I</italic> compared to <italic>TRAP-I</italic> sporozoites; yet, quantitative RT-PCR showed that there was little difference in ability to infect liver cells in vivo between intravenously injected MIC2-I and TRAP-I sporozoites. Moreover, there was no change in in vivo tropism.</p><p>We also examined replacement with two mammalian integrin I domains, from the promiscuous αXβ2 integrin and the much more selective αLβ2 integrin. Salivary gland invasion was decreased 100 to 400 and 500 to 1,000-fold in <italic>αX-I</italic> and <italic>αL-I</italic> compared to <italic>TRAP-I</italic> sporozoites, respectively. Infectivity of hemolymph <italic>αX-I</italic> sporozoites in mice was 100-fold deacreased compared to controls while <italic>αL-I</italic> hemolymph sporozoites showed nearly no infectivity as <italic>trap(-)</italic> sporozoites. The greater efficacy of <italic>αX-I</italic> than <italic>αL-I</italic> sporozoites in invasion of mosquito salivary glands, infection of mice, and productive motility in vivo confirmed our hypothesis that the polyreactive αX I domain would better support TRAP function than the highly specific αL I domain, albeit at low levels.</p><p>Multiple factors may account for the substantially lesser efficacy of mammalian integrin I domains than the MIC2 I domain. MIC2 has a similar function to TRAP in <italic>Toxoplasma</italic> and may be its orthologue. Each has an I domain that is inserted in an extensible β-ribbon in tandem with a TSR domain and a long-range disulfide bond that moves in allostery (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Integrins, TRAP, and MIC2 connect to the actin cytoskeleton, which applies force to their cytoplasmic domains that is resisted by ligands and provides traction for motility and cell invasion. The force (F) transmitted through the I domain, times the difference in extension of the I domain in the closed and open states (Δx), gives an energy (F•Δx = E) that tilts the energy landscape toward the open, high affinity state (<xref ref-type="bibr" rid="bib25">Li and Springer, 2017</xref>). Because of their extensible β-ribbons, Δx is substantially greater for TRAP and MIC2 than for integrin I domains, and cytoskeletal forces may also differ considerably. To compensate for these differences, the energy differences between the closed and open states, as well as the kinetics for crossing between them, may be tuned differently for TRAP and MIC2 than for integrin I domains. Their degree of polyspecificity is also likely to vary. Integrins αXβ2 and αMβ2 have each been reported to bind &gt;30 ligands, including glycoproteins and heparan (<xref ref-type="bibr" rid="bib55">Yakubenko et al., 2002</xref>). However, these integrin I domains can also bind specifically, as shown by binding to distinct high-affinity sites within their common ligand, iC3b (<xref ref-type="bibr" rid="bib54">Xu et al., 2017</xref>).</p><p>The most polyreactive integrin I domains, αX and αM are basic with higher pI (8.9 and 9.5, respectively) than the highly specific αL (pI 5.6), αE (pI 4.6), and collagen-binding α1, α2, α10, and α11 I domains (pI 5.1–5.6). As the surfaces of all cells are negatively charged and almost all proteins are acidic, we tested whether the functions of the basic TRAP I domain (pI = 9.7) would be altered with seven substitutions that made it neutral (pI 6.8). This <italic>RevCharge</italic> mutant was well expressed and localized. <italic>RevCharge</italic> sporozoites accumulated well in mosquito salivary glands and were infectious when injected intravenously. However, gliding in vitro and infectivity by mosquito bite were greatly decreased. Although the pI of RevCharge of 6.8 was close to that of MIC2, its mutations were clustered around the periphery of the MIDAS site and the electrostatic surface of its ligand-binding face more closely resembled that of αL than MIC2, TRAP, or αX (<xref ref-type="fig" rid="fig6">Figure 6</xref>). These results suggest that the distribution of electrostatic charge on the TRAP I domain is an important variable. The difference between infection by mosquito bite and intravenous injection further suggests that electrostatics may have an important role in successful sporozoite exit from the dermis into the circulation.</p><p>The findings that the I domain from <italic>Toxoplasma</italic> MIC2 that encounters different ligands as TRAP can replace its function in mediating salivary gland invasion and infection of mice strongly suggest that the I domain functions to provide traction for motility and cell invasion rather than tissue tropism. Binding of the TRAP I domain to multiple distinctive ligands is required by its function in mosquitos in migration into salivary glands and in vertebrate hosts in emigration from the dermis into the circulation and from the circulation into the liver, followed by productive invasion of liver parenchymal cells. The ligands in the mosquito must differ from those in the vertebrate; those encountered in the vertebrate in the dermis, endothelium and liver may also differ. Furthermore, <italic>Toxoplasma</italic> lives in epithelia in the gastrointestinal system of cats and other mammals, and lacks an arthropod host, yet its MIC2 I domain functions robustly in mosquito salivary gland invasion. Our results are consistent with TRAP binding to the many ligands that have been identified for it, including liver-specific fetuin-A (<xref ref-type="bibr" rid="bib21">Jethwaney et al., 2005</xref>), proteoglycans (<xref ref-type="bibr" rid="bib36">Robson et al., 1995</xref>; <xref ref-type="bibr" rid="bib32">Pradel et al., 2002</xref>), glycosaminoglycans (<xref ref-type="bibr" rid="bib27">Matuschewski et al., 2002</xref>), and the integrin αV subunit (<xref ref-type="bibr" rid="bib12">Dundas et al., 2018</xref>) in vertebrates and saglin in mosquitos (<xref ref-type="bibr" rid="bib15">Ghosh et al., 2009</xref>).</p><p>Abolition of TRAP function by deletion of its I domain as shown here, together with the negligible effects of mutation or exchange of other domains (<xref ref-type="bibr" rid="bib27">Matuschewski et al., 2002</xref>; <xref ref-type="bibr" rid="bib13">Ejigiri et al., 2012</xref>) strongly suggests that the I domain is the sole ligand binding domain. A model in which TRAP does not provide liver tropism is also consistent with the expression of TRAP in sporozoites of <italic>Plasmodium</italic> species that infect birds and initially infect skin rather than liver cells (<xref ref-type="bibr" rid="bib5">Böhme et al., 2018</xref>).</p><p>Our results support a model in which TRAP does not determine tropism for salivary glands in mosquitos or liver in mammals and instead acts as a poly-specific receptor that provides traction for sporozoite emigration into these tissues and infection of cells that is triggered by other receptors. Similarly, integrins, from which the TRAP I domain may have been borrowed, are activated by cytoskeletal activity, which is generally signaled by G protein-coupled receptors or receptors that couple to tyrosine kinases. This model has the advantage that the signaling receptors can be extremely sensitive and ATP-dependent cytoskeleton polymerization or actomyosin contraction through activation of adhesins can greatly amplify those signals and provide ultrasensitive regulation of adhesiveness (<xref ref-type="bibr" rid="bib25">Li and Springer, 2017</xref>). This might be essential during the stick-and-slip gliding of sporozoites (<xref ref-type="bibr" rid="bib31">Münter et al., 2009</xref>).</p><p>Chemoattractants have the advantage that they can drive directional migration through multiple layers of distinctive cell types as in the liver. In vertebrates, chemoattractants and their receptors cooperate with integrins and their ligands to enable highly specific leukocyte emigration from the vasculature into organs or sites of inflammation (<xref ref-type="bibr" rid="bib45">Springer, 1994</xref>). Chemoattractant receptors evolved distinctly in prokaryotes and eukaryotes and perhaps take yet a different form in apicomplexans. The ability of chemoattractants to activate motility, termed chemokinesis, may be related to the use here of BSA, a known carrier of fatty acids and other hydrophobes, to activate sporozoite gliding. Our finding that the I domain of TRAP is required for gliding motility and invasion by sporozoites of mosquito salivary glands and mammalian liver, without a strong requirement for evolved specificity, suggests that new paradigms may be needed to understand sporozoite activation and homing of sporozoites to specific organs in their hosts.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type <break/>(species) or resource</th><th valign="top">Designation</th><th valign="top">Source or reference</th><th valign="top">Identifiers</th><th valign="top">Additional <break/>information</th></tr></thead><tbody><tr><td valign="top">Antibody</td><td valign="top">anti-CSP (mouse monoclonal)</td><td valign="top"><xref ref-type="bibr" rid="bib56">Yoshida et al., 1980</xref></td><td valign="top">MR4: MRA-100</td><td valign="top">mAb 3D11</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-TRAP (rabbit ployclonal)</td><td valign="top">This paper</td><td valign="top">/</td><td valign="top">/</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-rabbit (Goat)</td><td valign="top">ThermoFisher Scientific</td><td valign="top">Cat#A-11034</td><td valign="top">coupled to AlexaFluor 488</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-rabbit (Goat)</td><td valign="top">ThermoFisher Scientific</td><td valign="top">Cat#A10523</td><td valign="top">coupled to Cy5</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-mouse (Goat)</td><td valign="top">ThermoFisher Scientific</td><td valign="top">Cat#A-11001</td><td valign="top">coupled to AlexaFluor 488</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-mouse (Goat)</td><td valign="top">ThermoFisher <break/>Scientific</td><td valign="top">Cat#A10524</td><td valign="top">coupled to Cy5</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-rabbit (Goat)</td><td valign="top">Bio-Rad</td><td valign="top">Cat#1705046</td><td valign="top">Immun Star (GAR)-HRP</td></tr><tr><td valign="top">Antibody</td><td valign="top">anti-mouse (sheep)</td><td valign="top">GE-Healthcare</td><td valign="top">NXA931-1ML</td><td valign="top">IgG, HRP linked whole Ab</td></tr><tr><td valign="top">Bacteria (<italic>Escherichia coli</italic>)</td><td valign="top">XL1-blue cells</td><td valign="top">Agilent technologies</td><td valign="top">Cat#200236</td><td valign="top">Chemically competent cells</td></tr><tr><td valign="top">Other</td><td valign="top">Hoechst 33342</td><td valign="top">ThermoFisher Scientific</td><td valign="top">Cat#H3570</td><td valign="top">/</td></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">SYBR Green PCR Master Mix</td><td valign="top">ThermoFisher Scientific</td><td valign="top">Cat#4309155</td><td valign="top">/</td></tr><tr><td valign="top">Cell line (<italic>Homo sapiens</italic>)</td><td valign="top">HepG2</td><td valign="top">ATCC</td><td valign="top">HB-8065</td><td valign="top">/</td></tr><tr><td valign="top">Strain (<italic>Mus musculus)</italic></td><td valign="top">NMRI</td><td valign="top">Janvier Labs/Charles River Laboratories</td><td valign="top">/</td><td valign="top">/</td></tr><tr><td valign="top">Strain (<italic>Mus musculus)</italic></td><td valign="top">C57BL/6JRj</td><td valign="top">Janvier Labs/Charles River Laboratories</td><td valign="top">/</td><td valign="top">/</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top">ANKA</td><td valign="top"><xref ref-type="bibr" rid="bib49">Vincke and Bafort, 1968</xref></td><td valign="top">MR4: MRA-671</td><td valign="top">/</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>trap(-)rec</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>trapΔI</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain <break/>(<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>TRAP-I fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>MIC2-I fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>αX-I fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>αL-I fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>TRAP-I non-fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>MIC2-I non-fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>αX-I non-fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>αL-I non-fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Strain (<italic>Plasmodium berghei</italic>)</td><td valign="top"><italic>RevCharge non-fluo</italic></td><td valign="top">this paper</td><td valign="top">/</td><td valign="top">ANKA background</td></tr><tr><td valign="top">Sequenced-based reagent</td><td valign="top"><italic>gapdh</italic> forward</td><td valign="top">this paper</td><td valign="top">PCR primers</td><td valign="top"><named-content content-type="sequence">TGAGGCCGGTGCTGAGTATGTCG</named-content></td></tr><tr><td valign="top">Sequenced-based reagent</td><td valign="top"><italic>gapdh</italic> reverse</td><td valign="top">this paper</td><td valign="top">PCR primers</td><td valign="top"><named-content content-type="sequence">CCACAGTCTTCTGGGTGGCAGTG</named-content></td></tr><tr><td valign="top">Sequenced-based reagent</td><td valign="top">18 s RNA forward</td><td valign="top">this paper</td><td valign="top">PCR primers</td><td valign="top"><named-content content-type="sequence">AAGCATTAAATAAAGCGAATACATCCTTAC</named-content></td></tr><tr><td valign="top">Sequenced-based reagent</td><td valign="top">18 s RNA reverse</td><td valign="top">this paper</td><td valign="top">PCR primers</td><td valign="top"><named-content content-type="sequence">GGAGATTGGTTTTGACGTTTATGTG</named-content></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">TRAP gene sequence: <italic>TRAP-I</italic></td><td valign="top">ThermoFisher Scientific</td><td valign="top">/</td><td valign="top">codon modified (<italic>E. coli</italic> K12)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">TRAP gene sequence: <italic>MIC2-I</italic></td><td valign="top">ThermoFisher Scientific</td><td valign="top">/</td><td valign="top">codon modified (<italic>E. coli</italic> K12)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">TRAP gene <break/>sequence: <italic>αX-I</italic></td><td valign="top">ThermoFisher Scientific</td><td valign="top">/</td><td valign="top">codon modified (<italic>E. coli</italic> K12)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">TRAP gene sequence: <italic>αL-I</italic></td><td valign="top">ThermoFisher Scientific</td><td valign="top">/</td><td valign="top">codon modified (<italic>E. coli</italic> K12)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">TRAP gene sequence: <italic>RevCharge</italic></td><td valign="top">ThermoFisher Scientific</td><td valign="top">/</td><td valign="top">codon modified (<italic>E. coli</italic> K12)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pMK-RV</td><td valign="top">ThermoFisher Scientific</td><td valign="top">/</td><td valign="top">Kan<sup>R</sup></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">Pb238</td><td valign="top"><xref ref-type="bibr" rid="bib9">Deligianni et al., 2011</xref> <break/><xref ref-type="bibr" rid="bib42">Singer et al., 2015</xref></td><td valign="top">/</td><td valign="top">Amp<sup>R</sup></td></tr><tr><td valign="top">Recombinant <break/>DNA reagent</td><td valign="top">PbGEM-107890</td><td valign="top"><xref ref-type="bibr" rid="bib40">Schwach et al., 2015</xref> <break/>PlasmoGEM</td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://plasmogem.sanger.ac.uk/designs/search_result?id=PbGEM-107890">https://plasmogem.sanger.ac.uk/designs/search_result?id=PbGEM-107890</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Prism 5.0</td><td valign="top">GraphPad, San Diego</td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://www.graphpad.com/scientific-software/prism/">https://www.graphpad.com/scientific-software/prism/</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">PyMOL</td><td valign="top">The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC</td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://pymol.org/2/">https://pymol.org/2/</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">AxioVision</td><td valign="top">Carl Zeiss Microscopy</td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://www.zeiss.com/microscopy/int/home.html">https://www.zeiss.com/microscopy/int/home.html</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Volocity</td><td valign="top">PerkinElmer</td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://www.perkinelmer.de/corporate">http://www.perkinelmer.de/corporate</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">ApE</td><td valign="top">ApE – A plasmid Editor by M. Wayne Davis</td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://jorgensen.biology.utah.edu/wayned/ape/">http://jorgensen.biology.utah.edu/wayned/ape/</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">ImageJ</td><td valign="top"><xref ref-type="bibr" rid="bib37">Schindelin et al., 2012</xref></td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://imagej.nih.gov/ij/">https://imagej.nih.gov/ij/</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Clustal Omega</td><td valign="top"><xref ref-type="bibr" rid="bib41">Sievers et al., 2011</xref></td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="https://www.ebi.ac.uk/Tools/msa/clustalo/">https://www.ebi.ac.uk/Tools/msa/clustalo/</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Optimizer</td><td valign="top"><xref ref-type="bibr" rid="bib33">Puigbò et al., 2007</xref></td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://genomes.urv.es/OPTIMIZER/">http://genomes.urv.es/OPTIMIZER/</ext-link></td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">PlasmoDB (version 26–34)</td><td valign="top"><xref ref-type="bibr" rid="bib3">Aurrecoechea et al., 2009</xref></td><td valign="top">/</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://plasmodb.org/plasmo/">http://plasmodb.org/plasmo/</ext-link></td></tr></tbody></table></table-wrap><sec id="s4-1"><title>Bioinformatic analysis</title><p><italic>Plasmodium</italic> sequences were retrieved from PlasmoDB (<ext-link ext-link-type="uri" xlink:href="http://plasmodb.org/plasmo/">http://plasmodb.org/plasmo/</ext-link>, version 26–34) (<xref ref-type="bibr" rid="bib3">Aurrecoechea et al., 2009</xref>) and multiple sequence alignments were performed with Clustal Omega (<ext-link ext-link-type="uri" xlink:href="http://www.ebi.ac.uk/Tools/msa/clustalo/">http://www.ebi.ac.uk/Tools/msa/clustalo/</ext-link>) (<xref ref-type="bibr" rid="bib41">Sievers et al., 2011</xref>). To change the codon usage of open reading frames (ORFs) we applied the tool OPTIMIZER (<ext-link ext-link-type="uri" xlink:href="http://genomes.urv.es/OPTIMIZER/">http://genomes.urv.es/OPTIMIZER/</ext-link>) (<xref ref-type="bibr" rid="bib33">Puigbò et al., 2007</xref>).</p></sec><sec id="s4-2"><title>Generation of <italic>trap(-)</italic> and <italic>trapΔI</italic> parasites</title><p>TRAP knockout (<italic>trap(-)</italic>) parasites were generated with the PlasmoGem (<xref ref-type="bibr" rid="bib40">Schwach et al., 2015</xref>) vector (PbGEM-107890) using standard protocols (<xref ref-type="bibr" rid="bib20">Janse et al., 2006</xref>). Isogenic <italic>trap(-)</italic> parasites were subsequently negatively selected with 5-fluorocytosine (1.0 mg/mL in the drinking water) to give rise to selection marker free <italic>trap(-)</italic> parasites (<xref ref-type="bibr" rid="bib7">Braks et al., 2006</xref>). For the generation of <italic>trapΔI</italic> parasites we made use of the Pb238 vector (<xref ref-type="bibr" rid="bib9">Deligianni et al., 2011</xref>; <xref ref-type="bibr" rid="bib24">Klug and Frischknecht, 2017</xref>). In a first step the <italic>trap</italic> 3’UTR (970 bp) was amplified with the primers P165/P166 and cloned (<italic>BamHI</italic> and <italic>EcoRV</italic>) downstream of the resistance cassette in the Pb238 vector. In a next step the coding sequence of the <italic>trap</italic> gene including the 5’ and 3’ UTR was amplified with the primers P508/P509 and cloned in the pGEM-T-Easy vector giving rise to the plasmid pGEM-TRAPfull. Subsequently the pGEM-TRAPfull plasmid was mutated with the primers P535/P536 and P537/P538 to introduce a restriction site for <italic>NdeI</italic> directly in front of the start codon ATG and a restriction site for <italic>PacI</italic> directly after the stop codon TAA. The mutated sequence was cloned (<italic>SacII</italic> and <italic>EcoRV</italic>) in the Pb238 intermediate vector that contained already the <italic>trap</italic> 3’UTR downstream of the selection marker and the resulting plasmid was named Pb238-TRAP-NdeI/PacI. The designed DNA sequence lacking the coding region of the I domain was codon modified for <italic>E. coli</italic> K12 and synthesized at GeneArt (Invitrogen). Subsequently the designed sequence was cloned (<italic>NdeI</italic> and <italic>PacI</italic>) in the Pb238-TRAP-NdeI/PacI by replacing the endogenous <italic>trap</italic> gene. Final DNA sequences were digested for linearization (<italic>NotI</italic>, PbGEM-107890; <italic>SacII</italic> and <italic>KpnI,</italic> Pb238-TRAP∆I), purified and transfected into wild type parasites (<italic>wt</italic>) using standard protocols (<xref ref-type="bibr" rid="bib20">Janse et al., 2006</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>).</p></sec><sec id="s4-3"><title>Generation of <italic>TRAP-I</italic>, <italic>MIC2-I</italic>, <italic>αL-I</italic>, <italic>αX-I</italic> and <italic>RevCharge</italic> parasites</title><p>To generate parasite lines expressing TRAP with different I domains, bp 115 to bp 696 (581 bp; I42 to V228; 194 aa in total) of the wild type <italic>trap</italic> gene (<italic>Plasmodium berghei</italic> ANKA strain) were exchanged with sequences from the micronemal protein 2 (MIC2) of <italic>Toxoplasma gondii</italic> (567 bp, L75 to V263, 189 aa), the integrin CD11c/αX (552 bp, Q150 to I333, 184 aa) and the integrin CD11a/αL (531 bp, V155 to I331, 177 aa) of <italic>Homo sapiens</italic>. Chimeric sequences as well as the coding sequence of the wild type <italic>trap</italic> gene that served as a control, were codon modified for <italic>E. coli</italic> K12 to prevent incorrect homologous recombination with the <italic>trap</italic> coding sequence downstream of the I domain coding region and to avoid changes of the codon usage within the open reading frame caused by the exchanged I domain coding sequence. This enabled also simple differentiation between wild type and transgenic parasites by PCR. For the generation of <italic>RevCharge</italic> parasites seven mutations of non-conserved amino acids (H56E, H62E, H123E, K164Q, K165D, R195E and K202E; <italic>P. berghei</italic> ANKA strain) were introduced into the codon modified wild type <italic>trap</italic> gene. These mutations were expected to shift the surface charge at the apical side of the I domain from a pI of 9.7 to 6.8 while leaving the MIDAS intact and the structural integrity of the domain unaffected. All designed sequences were synthesized at GeneArt (Invitrogen) and cloned in the Pb238-TRAP-NdeI/PacI vector (<italic>NdeI/PacI</italic>) that was already used to generate the <italic>trapΔI</italic> line. Constructs were digested for linearization (<italic>ScaI-HF</italic>) and transfected using standard protocols (<xref ref-type="bibr" rid="bib20">Janse et al., 2006</xref>). Transfections were performed in the negatively selected TRAP knockout line <italic>trap(-)</italic> as well as in the fluorescent background line <italic>fluo</italic> to independently generate fluorescent (<italic>fluo</italic>) and non-fluorescent (<italic>non-fluo</italic>) sets of mutants (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>).</p></sec><sec id="s4-4"><title>Generation of isogenic parasite populations</title><p>Isogenic parasite lines were generated by serial dilution of parental populations obtained from transfections. Per transfection one mouse was infected by intraperitoneal injection of ~200 µL frozen parasites of the parental population. To increase the number of transfected parasites within infected mice pyrimethamine (0.07 mg/mL) was given within the drinking water 24 hr post injection (hpi). Donor mice were bled two to three days post injection once parasitemia reached 0.5–1%. Parasites were diluted in phosphate buffered saline (PBS) to 0.7–0.8 parasites per 100 µL and the same volume was subsequently injected into 6–10 naive mice. Parasites were allowed to grow for 8–10 days until parasitemia reached 1.5–2%. Blood of infected mice was taken by cardiac puncture (usually 600–800 µL) and used to make parasite stocks (~200 µL infected blood) and to isolate genomic DNA with the Blood and Tissue Kit (Qiagen).</p></sec><sec id="s4-5"><title>Mosquito infection</title><p>Naive mice were infected with 100–200 µL frozen parasite stocks and parasites allowed to grow for four to five days. Infected mice were either directly fed to mosquitoes or used for a fresh blood transfer of 2 × 10<sup>7</sup> parasites by intraperitoneal injection into two to three naive mice. Parasites within recipient mice were allowed to grow for further three to four days, depending on the number of exflagellation events observed. To determine the number of exflagellation events, and subsequently the number of male gametocytes, a drop of tail blood was placed on a microscope slide, covered with a coverslip and incubated for 10–12 min at room temperature (20–22°C). The number of exflagellation events was counted with a light microscope (Zeiss) and a counting grid by using 40-fold magnification with phase contrast. If at least one exflagellation event per field could be observed mice were fed to mosquitoes. Mosquitoes were starved overnight prior to the feeding to increase the number of biting mosquitoes. Per mosquito cage (approximately 200–300 female mosquitoes) two to three mice were used for feeding.</p></sec><sec id="s4-6"><title>Isolation of midgut, hemolymph and salivary gland sporozoites</title><p>To estimate the number of sporozoites, infected <italic>Anopheles stephensi</italic> mosquitoes were dissected on day 13, 14, 18, and 22 post infection. For the collection of hemolymph sporozoites, infected <italic>A. stephensi</italic> mosquitoes were cut with a needle to remove the last segment of the abdomen. Subsequently the thorax was pierced with a finely drawn Pasteur pipette filled with RPMI/PS solution. While gently pressing the pipette the haemocoel cavity was flushed with solution which dripped off the abdomen. The sporozoite solution was collected on a piece of foil and transferred into a plastic reaction tube. To determine the number of midgut sporozoites, the abdomen of infected mosquitoes was dissected with two needles and the midgut was extracted. Isolated midguts were transferred into a plastic reaction tube containing 50 µL RPMI/PS solution. For the isolation of salivary gland sporozoites, the head of infected mosquitoes was gently pulled away with a needle while fixing the mosquito in place with a second needle. Ideally the salivary glands stayed attached to the head and could be easily isolated. Salivary glands were transferred into a plastic reaction tube with 50 µL RPMI/PS. To release sporozoites, pooled midguts and salivary glands were homogenized using a plastic pestle for 2 min. To count the parasites in each sample, 5–10 µL of the sporozoite solution (1:10 dilution) was applied on a hemocytometer. Sporozoites were counted using a light microscope (Zeiss) with 40-fold magnification and phase contrast. For each counting experiment at least 10 mosquitoes were dissected. However, the number was adapted depending on the infection rate of the mosquitoes and the experiment that was performed.</p></sec><sec id="s4-7"><title>Animal experiments</title><p>To determine the prepatency of parasite lines during sporozoite transmission two different routes of infection were tested. Female C57BL/6 mice were either exposed to infected mosquitoes or infected by intravenous injection of midgut, hemolymph or salivary gland sporozoites. To infect mice by mosquito bites, mosquitoes infected with fluorescent parasite lines were pre-selected for fluorescence of the abdomen by using a stereomicroscope (SMZ1000, Nikon) with an attached fluorescence unit. Subsequently parasite positive mosquitoes were separated in cups to 10 each and allowed to recover overnight. Approximately six hours prior to the experiment mosquitoes were starved by removing salt and sugar pads. Mice were anesthetized by intraperitoneal injection of a mixture of ketamine and xylazine (87.5 mg/kg ketamine and 12.5 mg/kg xylazine) and placed with the ventral side on the mosquito cups. Mosquitoes infected 17–24 days prior to the experiment were allowed to feed for approximately 15 min before mice were removed. During this time eyes of mice were treated with Bepanthen cream (Bayer) to prevent dehydration of the cornea. After the experiment mice were allowed to recover and tested for blood stage parasites on a daily basis by evaluation of Giemsa stained blood smears. If non-fluorescent parasite lines were tested infected mosquitoes were not pre-sorted. In these experiments midguts of mosquitoes that had taken a blood meal were dissected after the experiment and the number of midgut sporozoites was counted as described previously. Mice that were bitten by mosquitoes that contained no midgut sporozoites were excluded from the analysis.</p><p>For injections hemolymph or salivary gland sporozoites were isolated either 13–16 days (hemolymph) or 17–24 days (salivary gland) post infection. Sporozoite solutions were diluted to the desired concentration with RPMI/PS (either 10,000 or 25,000 sporozoites) and injected intravenously into the tail vein of naive mice. The presence of blood stage parasites was evaluated on a daily basis.</p></sec><sec id="s4-8"><title>In vitro gliding assay</title><p>To analyze speed and movement pattern of sporozoites, in vitro gliding assays were performed in glass-bottom 96-well plates (Nunc). Hemolymph and salivary gland sporozoites were obtained by dissecting infected <italic>A. stephensi</italic> mosquitoes. To free the sporozoites from salivary glands, samples were grounded with a pestle. Subsequently salivary gland samples were centrifuged for 3 min at 1,000 rpm (Thermo Fisher Scientific, Biofuge primo) to separate sporozoites from tissue. Afterwards ~40 µL of the supernatant was transferred into a new 1.5 mL plastic reaction tube and diluted with a variable volume of RPMI/PS depending on the planned number of assays and the sporozoite concentration resulting in a minimum of 50,000 sporozoites per well. For each assay about 50 µL of the sporozoite suspension was mixed with 50 µL RPMI medium containing 6% bovine serum albumin (BSA) to initiate activation. Subsequently sporozoites were allowed to attach to the bottom by centrifugation at 800 rpm for 3 min (Heraeus Multifuge S1). Using fluorescence microscopy (Axiovert 200M) with a 10x objective movies were recorded with one image every three seconds for 3 to 5 min depending on the experiment. Movies were analyzed manually using the Manual Tracking Plugin from ImageJ (<xref ref-type="bibr" rid="bib37">Schindelin et al., 2012</xref>) to determine speed and trajectories of moving sporozoites. Sporozoites that were able to glide at least one full circle during a 3 min movie were considered to be productively moving while all other sporozoites were classified as non-productively moving (moving less than one circle) or non-motile.</p></sec><sec id="s4-9"><title>Live imaging</title><p>For the imaging of sporozoites within salivary glands infected mosquitoes were dissected 17–24 days post infection as described previously. Isolated salivary glands were transferred with a needle to a microscope slide containing a drop of Grace’s medium (Gibco) and carefully sealed with a cover slip. Samples were imaged with an Axiovert 200M (Zeiss) using 63x (N.A. 1.3) and 10x (N.A. 0.25) objectives.</p></sec><sec id="s4-10"><title>Antibodies</title><p>For immunofluorescence assays we made use of antibodies directed against the circumsporozoite protein (CSP) and the thrombospondin related anonymous protein (TRAP). In all assays the anti-CSP antibody mAb 3D11 (<xref ref-type="bibr" rid="bib56">Yoshida et al., 1980</xref>) was applied as unpurified culture supernatant of the corresponding hybridoma cell line (1:5 diluted for immunofluorescence assays). TRAP antibodies were generated against the peptide AEPAEPAEPAEPAEPAEP by Eurogenetec and the purified antibody was applied as 1:100 dilution in immunofluorescence assays. Antibodies against the same peptide have been shown previously to specifically detect TRAP by immunofluorescence and western blotting (<xref ref-type="bibr" rid="bib13">Ejigiri et al., 2012</xref>). Secondary antibodies coupled to AlexaFluor 488 or Cy5 (goat anti-mouse or goat anti-rabbit) directed against primary antibodies were obtained from Invitrogen and always used as 1:500 dilution.</p></sec><sec id="s4-11"><title>Immunofluorescence assays with sporozoites</title><p>To visualize the expression and localization of TRAP in sporozoites, infected salivary glands were dissected as described previously and pooled in plastic reaction tubes containing 50 µL PBS or RPMI/PS. Afterwards salivary glands were mechanically grounded with a plastic pestle to release sporozoites from tissue. Immunofluorescence assays were performed by two different methods either fixing sporozoites in solution or on glass cover slips. To fix the parasites on glass, salivary glands were dissected in RPMI/PS and treated as described. Sporozoite solutions were transferred into 24-well plates containing round cover slips, activated with an equal volume RPMI/PS containing 6% BSA and allowed to glide for approximately 30 min at RT. Subsequently the supernatant was discarded and sporozoites were fixed with 4% PFA (in PBS) for 1 hr at RT. Fixed samples were washed three times with PBS for 5 min each. If immunofluorescence was performed on sporozoites in solution, salivary glands were dissected in PBS and treated as described previously. Sporozoite solutions were directly fixed by adding 1 mL of 4% PFA (in PBS) for 1 hr at RT. After fixation samples were washed as described for samples fixed on glass while samples in solution had to be additionally pelleted after each step by centrifugation for 3 min at 10,000 rpm (Thermo Fisher Scientific, Biofuge primo). Subsequently sporozoites were blocked (PBS containing 2% BSA) or blocked and permeabilized (PBS containing 2% BSA and 0.5% Triton X-100) over night at 4°C or for 1 hr at RT, respectively. Samples were incubated with primary antibody solutions for 1 hr at RT in the dark and subsequently washed three times with PBS. After the last washing step, samples were treated with secondary antibody solutions and incubated for 1 hr at RT in the dark. Stained samples were washed three times in PBS and the supernatant was discarded. If the immunofluorescence assay was performed in solution, sporozoite pellets were resuspended in 50 μL of remaining PBS, carefully pipetted on microscopy slides and allowed to settle for 10–15 min at RT. Remaining liquid was removed with a soft tissue and samples were covered with cover slips which had been prepared with 7 μL of mounting medium (ThermoFisher Scientific, ProLong Gold Antifade Reagent). If the immunofluorescence assay was performed on sporozoites that were fixed on glass, cover slips were removed with forceps, carefully dabbed on a soft tissue and placed on microscopy slides that had been prepared with 7 μL of mounting medium. Samples were allowed to set overnight at RT and kept at 4°C or directly examined. Images were acquired with a spinning disc confocal microscope (Nikon Ti series) with 60-fold magnification (CFI Apo TIRF 60x H; NA 1.49).</p></sec><sec id="s4-12"><title>Western blot analysis of TRAP expression</title><p>Salivary glands of infected mosquitoes were dissected in 100 µL PBS on ice and subsequently smashed with a pestle to release sporozoites. For the isolation of hemolymph sporozoites infected mosquitoes were flushed with PBS as previously described. Sporozoite solutions were kept on ice, counted using a haemocytometer and distributed to 30,000 sporozoites per reaction tube. Samples were centrifuged for 1 min with 13,000 rpm (Thermo Fisher Scientific, Biofuge primo) at 4°C to pellet sporozoites. Subsequently the supernatant was discarded, and pellets were lysed in 20 µL RIPA buffer (50 mM Tris pH 8, 1% NP40, 0.5% sodium dexoycholate, 0.1% SDS, 150 mM NaCl, 2 mM EDTA) supplemented with protease inhibitors (Sigma-Aldrich, P8340) for ≥1 hr on ice. Lysates were mixed with Laemmli buffer, heated for 10 min at 95°C and centrifuged for 1 min at 13,000 rpm (Thermo Fisher Scientific, Biofuge primo). Samples were separated on precast 4–15% SDS-PAGE gels (Mini Protein TGX Gels, Bio-Rad) and blotted on nitrocellulose membranes with the Trans-Blot Turbo Transfer System (Bio-Rad). Blocking was performed by incubation in PBS containing 0.05% Tween20% and 5% milk powder for 1 hr at RT. Afterwards, the solution was refreshed and antibodies directed against TRAP (rabbit polyclonal antibody, 1:1000 diluted) or the loading control CSP (mAb 3D11, cell culture supernatant 1:1000 diluted) were added. Membranes were washed three times (PBS with 0.05% Tween20) and secondary anti-rabbit antibodies (Immun-Star (GAR)-HRP, Bio-Rad) or anti-mouse antibodies (NXA931, GE Healthcare) conjugated to horse radish peroxidase were applied for 1 hr (1:10,000 dilution) at room temperature. Signals were detected using SuperSignal West Pico Chemiluminescent Substrate or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). After the detection of TRAP, blots were treated with stripping buffer (Glycine 15 g/L, SDS 1 g/L, Tween20 10 ml/L, pH 2,2) for 15 min prior to incubation with anti-CSP antibodies used as loading control.</p></sec><sec id="s4-13"><title>Cell lines</title><p>HepG2 cells were a gift from our virology department who had obtained the cells from ATCC. Cell line identity was regularly confirmed by SNP sequencing and visual observations of cell morphology. Cells were routinely tested for mycoplasma contamination using the MycoAlert mycoplasma detection kit (Lonza, Basel, Switzerland). We culture cells for a maximum of 10 passages.</p></sec><sec id="s4-14"><title>Liver stage development assay</title><p>Two days prior to the experiment 50,000 HepG2 cells/well were seeded in an 8-well Permanox Lab-Tek chamber slide (Nunc). On day zero salivary glands were isolated from infected female mosquitoes and collected in RPMI medium within a 1.5 mL reaction tube. Sporozoites were released by mechanically disrupting the salivary glands with a polypropylene pestle. The solution was centrifuged in a tabletop centrifuge at 1,000 rpm for 3 min at RT and the supernatant was transferred to a new 1.5 mL reaction tube. The salivary gland pellet was resuspended in 100 µL RPMI medium, smashed again using a pestle, centrifuged (1,000 rpm, 3 min, RT) and the supernatant was pooled with the first one. A 1:10 dilution of the sporozoite solution was counted in a Neubauer counting chamber and 10,000 salivary gland sporozoites were used to infect HepG2 cells per well. After 1.5 hr wells were washed twice with complete DMEM medium and HepG2 cells were allowed to grow in complete DMEM medium supplemented with 1x Antibiotic-Antimycotic (Thermo Fisher Scientific). At 24 hr and 48 hr post infection cells were fixed using ice cold methanol for 10 min at RT, followed by blocking with 10% FBS/PBS overnight at 4°C. Staining with primary antibody α-<italic>Pb</italic>HSP70 1:300 in 10% FBS/PBS for 2 hr at 37°C was succeeded by two washing steps with 1% FBS/PBS. Incubation with secondary antibody α-mouse Alexa Fluor 488 1:300 in 10% FBS/PBS was performed for 1 hr at 37°C. Hoechst 33342 was added and incubated for 5 min at RT followed by two washing steps with 1% FBS/PBS. The assay was mounted in 50% glycerol and sealed using a glass cover slip. Samples were imaged with an Axiovert 200M (Zeiss) microscope and subsequently analyzed using ImageJ (<xref ref-type="bibr" rid="bib37">Schindelin et al., 2012</xref>). In brief, the perimeter of single liver stages was encircled, and the area measured using the internal measurement tool.</p></sec><sec id="s4-15"><title>Sporozoite invasion assay</title><p>Two days prior to the experiment 180,000 HepG2 cells/well were seeded in an 8-well Permanox Lab-Tek chamber slide (Nunc). Sporozoites were isolated as described above and 10,000 sporozoites/well were used to infect HepG2. At 1.5 hr post infection cells were washed twice with complete DMEM medium and fixed using 4% PFA/PBS 20 min at RT. Blocking was performed with 10% FBS/PBS o/n at 4°C followed by incubation with primary antibodies α-<italic>Pb</italic>CSP 1:100 in 10% FBS/PBS (2 hr 37°C), two washing steps with 1% FBS/PBS and incubation with secondary antibodies α-mouse Alexa Fluor 488 1:300 in 10% FBS/PBS (1 hr 37°C). After two washing steps with 1% FBS/PBS, cells were permeabilized by addition of ice cold methanol and incubation at RT for 10 min. Blocking with 10% FBS/PBS (4°C and overnight) was followed by an incubation with primary antibodies α-<italic>Pb</italic>CSP 1:100 in 10% FBS/PBS (2 hr at 37°C), two washing steps with 1% FBS/PBS and incubation with primary antibodies α-mouse Alexa Fluor 546 1:300 in 10% FBS/PBS (1 hr at 37°C). The assay was mounted in 50% glycerol after two washing steps with 1% FBS/PBS.</p></sec><sec id="s4-16"><title>Measuring organ-specific parasite load</title><p>To measure the parasite load of different organs C57BL/6 mice were infected by intravenous injection of 20,000 salivary gland sporozoites. At 42 hr after infection organs were harvested, homogenized and the RNA was isolated using Trizol according to the manufacturer's protocol. Isolated RNA was treated with DNase using the Turbo DNA-free Kit (Invitrogen). Subsequently RNA content of generated samples was measured using a NanoDrop and liver, intestine, spleen and lung samples were pooled in equal amounts of RNA to generate single samples for each parasite line and harvested organ. RNA pools were used to synthetize cDNA using the First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). Quantitative RT-PCR was performed in triplicates on an ABI7500 (Applied Biosystems) using a 2x SYBR green Mastermix (Applied Biosystems). <italic>Plasmodium berghei</italic> 18S rRNA was used to quantify parasites and mouse specific GAPDH was utilized as housekeeping gene for normalization. Subsequently the ∆cT was plotted as mean of all replicates per parasite strain and harvested organ (<xref ref-type="bibr" rid="bib38">Schmittgen and Livak, 2008</xref>).</p></sec><sec id="s4-17"><title>Animal work</title><p>For all experiments female 4–6 week-old Naval Medical Research Institute (NMRI) mice or C57BL/6 mice obtained from Janvier laboratories were used. Transgenic parasites were generated in the <italic>Plasmodium berghei</italic> ANKA background (<xref ref-type="bibr" rid="bib49">Vincke and Bafort, 1968</xref>) either directly in wild type or from wild type derived strains (e.g. <italic>trap(-)</italic> and <italic>fluo</italic>). Parasites were cultivated in NMRI mice while transmission experiments with sporozoites were performed in C57Bl/6 mice only.</p></sec><sec id="s4-18"><title>Statistical analysis</title><p>Statistical analysis was performed using GraphPad Prism 5.0 (GraphPad, San Diego, CA, USA). Data sets were either tested with a one-way ANOVA or a Student’s t test. A value of p&lt;0.05 was considered significant.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Christian Sommerauer and Miriam Reinig for rearing <italic>Anopheles stephensi</italic> mosquitoes as well as Christine Hopp for helpful discussions at the BioMalPar conference. This work was funded by the Human Frontier Science Program (RGY0071/2011), the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) – project number 240245660 – SFB 1129, NIH Grant CA 31798, and the European Research Council (ERC StG 281719). DK is currently funded by a DFG postdoctoral fellow ship (KL 3251/1–1) and is an alumnus of the Heidelberg Biosciences International Graduate School (HBIGS). FF is member of CellNetworks Cluster of excellence at Heidelberg University. We acknowledge the microscopy support from the Infectious Diseases Imaging Platform (IDIP) at the Center for Integrative Infectious Disease Research.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Data curation, Formal analysis, Investigation, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Data curation, Formal analysis, Investigation, Writing - review and editing</p></fn><fn fn-type="con" id="con4"><p>Data curation, Formal analysis, Investigation, Writing - review and editing</p></fn><fn fn-type="con" id="con5"><p>Data curation, Formal analysis, Investigation, Writing - review and editing</p></fn><fn fn-type="con" id="con6"><p>Resources, Investigation, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con7"><p>Conceptualization, Resources, Writing - review and editing</p></fn><fn fn-type="con" id="con8"><p>Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing</p></fn><fn fn-type="con" id="con9"><p>Conceptualization, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other" id="fn1"><p>Animal experimentation: All animal experiments were performed according to the German Animal Welfare Act (Tierschutzgesetz) and executed following the guidelines of the Society of Laboratory Animal Science (GV-SOLAS) and of the Federation of European Laboratory Animal Science Associations (FELASA). All experiments were approved by the responsible German authorities (Regierungspräsidium Karlsruhe, G-134/14 and G266/16). All interventions were performed under ketamine/xylazine anesthesia, and every effort was made to minimize suffering.</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>Primer sequences.</title><p>Primers used for the generation and genotyping of the parasite lines presented in this study.</p></caption><media mime-subtype="docx" mimetype="application" xlink:href="elife-57572-supp1-v1.docx"/></supplementary-material><supplementary-material id="supp2"><label>Supplementary file 2.</label><caption><title>Amino acid sequences of the TRAP variants expressed by the parasite lines <italic>TRAP-I</italic>, <italic>MIC2-I</italic>, <italic>αX-I, αL-I, and RevCharge</italic>.</title><p>Shown are the sequences of each TRAP replacement. Residues that are part of the extendable ß-ribbon are written in green, residues that form the remainder of the I domain are written in red, residues of the thrombospondin domain are written in orange, and the remaining native residues of <italic>Pb</italic>TRAP are written in black. Residues written in blue were introduced into wild type <italic>Pb</italic>TRAP to generate a more negative charge on the portion of the I domain surface surrounding the MIDAS in the <italic>RevCharge</italic> mutant. Residues written in white on a black background were mutated to create a better fitting of the exchanged portion of the I domain with the N- and C-terminal segments of the <italic>Pb</italic>TRAP I domain/extendable ß-ribbon. The calculated pI of the I domain region is shown in parentheses.</p></caption><media mime-subtype="docx" mimetype="application" xlink:href="elife-57572-supp2-v1.docx"/></supplementary-material><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="pdf" mimetype="application" xlink:href="elife-57572-transrepform-v1.pdf"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>All data generated or analysed during this study are included in the manuscript and supporting files.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aly</surname> <given-names>AS</given-names></name><name><surname>Matuschewski</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>A malarial cysteine protease is necessary for <italic>Plasmodium sporozoite egress</italic> from oocysts</article-title><source>Journal of Experimental Medicine</source><volume>202</volume><fpage>225</fpage><lpage>230</lpage><pub-id pub-id-type="doi">10.1084/jem.20050545</pub-id><pub-id pub-id-type="pmid">16027235</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Amino</surname> <given-names>R</given-names></name><name><surname>Thiberge</surname> <given-names>S</given-names></name><name><surname>Martin</surname> <given-names>B</given-names></name><name><surname>Celli</surname> <given-names>S</given-names></name><name><surname>Shorte</surname> <given-names>S</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name><name><surname>Ménard</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Quantitative imaging of Plasmodium transmission from mosquito to mammal</article-title><source>Nature Medicine</source><volume>12</volume><fpage>220</fpage><lpage>224</lpage><pub-id pub-id-type="doi">10.1038/nm1350</pub-id><pub-id pub-id-type="pmid">16429144</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aurrecoechea</surname> <given-names>C</given-names></name><name><surname>Brestelli</surname> <given-names>J</given-names></name><name><surname>Brunk</surname> <given-names>BP</given-names></name><name><surname>Dommer</surname> <given-names>J</given-names></name><name><surname>Fischer</surname> <given-names>S</given-names></name><name><surname>Gajria</surname> <given-names>B</given-names></name><name><surname>Gao</surname> <given-names>X</given-names></name><name><surname>Gingle</surname> <given-names>A</given-names></name><name><surname>Grant</surname> <given-names>G</given-names></name><name><surname>Harb</surname> <given-names>OS</given-names></name><name><surname>Heiges</surname> <given-names>M</given-names></name><name><surname>Innamorato</surname> <given-names>F</given-names></name><name><surname>Iodice</surname> <given-names>J</given-names></name><name><surname>Kissinger</surname> <given-names>JC</given-names></name><name><surname>Kraemer</surname> <given-names>E</given-names></name><name><surname>Li</surname> <given-names>W</given-names></name><name><surname>Miller</surname> <given-names>JA</given-names></name><name><surname>Nayak</surname> <given-names>V</given-names></name><name><surname>Pennington</surname> <given-names>C</given-names></name><name><surname>Pinney</surname> <given-names>DF</given-names></name><name><surname>Roos</surname> <given-names>DS</given-names></name><name><surname>Ross</surname> <given-names>C</given-names></name><name><surname>Stoeckert</surname> <given-names>CJ</given-names></name><name><surname>Treatman</surname> <given-names>C</given-names></name><name><surname>Wang</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>PlasmoDB: a functional genomic database for malaria parasites</article-title><source>Nucleic Acids Research</source><volume>37</volume><fpage>D539</fpage><lpage>D543</lpage><pub-id pub-id-type="doi">10.1093/nar/gkn814</pub-id><pub-id pub-id-type="pmid">18957442</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bane</surname> <given-names>KS</given-names></name><name><surname>Lepper</surname> <given-names>S</given-names></name><name><surname>Kehrer</surname> <given-names>J</given-names></name><name><surname>Sattler</surname> <given-names>JM</given-names></name><name><surname>Singer</surname> <given-names>M</given-names></name><name><surname>Reinig</surname> <given-names>M</given-names></name><name><surname>Klug</surname> <given-names>D</given-names></name><name><surname>Heiss</surname> <given-names>K</given-names></name><name><surname>Baum</surname> <given-names>J</given-names></name><name><surname>Mueller</surname> <given-names>AK</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>The actin Filament-Binding protein coronin regulates motility in plasmodium sporozoites</article-title><source>PLOS Pathogens</source><volume>12</volume><elocation-id>e1005710</elocation-id><pub-id pub-id-type="doi">10.1371/journal.ppat.1005710</pub-id><pub-id pub-id-type="pmid">27409081</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Böhme</surname> <given-names>U</given-names></name><name><surname>Otto</surname> <given-names>TD</given-names></name><name><surname>Cotton</surname> <given-names>JA</given-names></name><name><surname>Steinbiss</surname> <given-names>S</given-names></name><name><surname>Sanders</surname> <given-names>M</given-names></name><name><surname>Oyola</surname> <given-names>SO</given-names></name><name><surname>Nicot</surname> <given-names>A</given-names></name><name><surname>Gandon</surname> <given-names>S</given-names></name><name><surname>Patra</surname> <given-names>KP</given-names></name><name><surname>Herd</surname> <given-names>C</given-names></name><name><surname>Bushell</surname> <given-names>E</given-names></name><name><surname>Modrzynska</surname> <given-names>KK</given-names></name><name><surname>Billker</surname> <given-names>O</given-names></name><name><surname>Vinetz</surname> <given-names>JM</given-names></name><name><surname>Rivero</surname> <given-names>A</given-names></name><name><surname>Newbold</surname> <given-names>CI</given-names></name><name><surname>Berriman</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Complete avian malaria parasite genomes reveal features associated with lineage-specific evolution in birds and mammals</article-title><source>Genome Research</source><volume>28</volume><fpage>547</fpage><lpage>560</lpage><pub-id pub-id-type="doi">10.1101/gr.218123.116</pub-id><pub-id pub-id-type="pmid">29500236</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Boothroyd</surname> <given-names>JC</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Expansion of host range as a driving force in the evolution of Toxoplasma</article-title><source>Memórias Do Instituto Oswaldo Cruz</source><volume>104</volume><fpage>179</fpage><lpage>184</lpage><pub-id pub-id-type="doi">10.1590/S0074-02762009000200009</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Braks</surname> <given-names>JA</given-names></name><name><surname>Franke-Fayard</surname> <given-names>B</given-names></name><name><surname>Kroeze</surname> <given-names>H</given-names></name><name><surname>Janse</surname> <given-names>CJ</given-names></name><name><surname>Waters</surname> <given-names>AP</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Development and application of a positive-negative selectable marker system for use in reverse genetics in plasmodium</article-title><source>Nucleic Acids Research</source><volume>34</volume><elocation-id>e39</elocation-id><pub-id pub-id-type="doi">10.1093/nar/gnj033</pub-id><pub-id pub-id-type="pmid">16537837</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cowman</surname> <given-names>AF</given-names></name><name><surname>Healer</surname> <given-names>J</given-names></name><name><surname>Marapana</surname> <given-names>D</given-names></name><name><surname>Marsh</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Malaria: biology and disease</article-title><source>Cell</source><volume>167</volume><fpage>610</fpage><lpage>624</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2016.07.055</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Deligianni</surname> <given-names>E</given-names></name><name><surname>Morgan</surname> <given-names>RN</given-names></name><name><surname>Bertuccini</surname> <given-names>L</given-names></name><name><surname>Kooij</surname> <given-names>TW</given-names></name><name><surname>Laforge</surname> <given-names>A</given-names></name><name><surname>Nahar</surname> <given-names>C</given-names></name><name><surname>Poulakakis</surname> <given-names>N</given-names></name><name><surname>Schüler</surname> <given-names>H</given-names></name><name><surname>Louis</surname> <given-names>C</given-names></name><name><surname>Matuschewski</surname> <given-names>K</given-names></name><name><surname>Siden-Kiamos</surname> <given-names>I</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Critical role for a stage-specific actin in male exflagellation of the malaria parasite</article-title><source>Cellular Microbiology</source><volume>13</volume><fpage>1714</fpage><lpage>1730</lpage><pub-id pub-id-type="doi">10.1111/j.1462-5822.2011.01652.x</pub-id><pub-id pub-id-type="pmid">21790945</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dessens</surname> <given-names>JT</given-names></name><name><surname>Beetsma</surname> <given-names>AL</given-names></name><name><surname>Dimopoulos</surname> <given-names>G</given-names></name><name><surname>Wengelnik</surname> <given-names>K</given-names></name><name><surname>Crisanti</surname> <given-names>A</given-names></name><name><surname>Kafatos</surname> <given-names>FC</given-names></name><name><surname>Sinden</surname> <given-names>RE</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>CTRP is essential for mosquito infection by malaria ookinetes</article-title><source>The EMBO Journal</source><volume>18</volume><fpage>6221</fpage><lpage>6227</lpage><pub-id pub-id-type="doi">10.1093/emboj/18.22.6221</pub-id><pub-id pub-id-type="pmid">10562534</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Douglas</surname> <given-names>RG</given-names></name><name><surname>Amino</surname> <given-names>R</given-names></name><name><surname>Sinnis</surname> <given-names>P</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Active migration and passive transport of malaria parasites</article-title><source>Trends in Parasitology</source><volume>31</volume><fpage>357</fpage><lpage>362</lpage><pub-id pub-id-type="doi">10.1016/j.pt.2015.04.010</pub-id><pub-id pub-id-type="pmid">26001482</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dundas</surname> <given-names>K</given-names></name><name><surname>Shears</surname> <given-names>MJ</given-names></name><name><surname>Sun</surname> <given-names>Y</given-names></name><name><surname>Hopp</surname> <given-names>CS</given-names></name><name><surname>Crosnier</surname> <given-names>C</given-names></name><name><surname>Metcalf</surname> <given-names>T</given-names></name><name><surname>Girling</surname> <given-names>G</given-names></name><name><surname>Sinnis</surname> <given-names>P</given-names></name><name><surname>Billker</surname> <given-names>O</given-names></name><name><surname>Wright</surname> <given-names>GJ</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Alpha-v-containing integrins are host receptors for the <italic>Plasmodium falciparum</italic> sporozoite surface protein, TRAP</article-title><source>PNAS</source><volume>115</volume><fpage>4477</fpage><lpage>4482</lpage><pub-id pub-id-type="doi">10.1073/pnas.1719660115</pub-id><pub-id pub-id-type="pmid">29632205</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ejigiri</surname> <given-names>I</given-names></name><name><surname>Ragheb</surname> <given-names>DR</given-names></name><name><surname>Pino</surname> <given-names>P</given-names></name><name><surname>Coppi</surname> <given-names>A</given-names></name><name><surname>Bennett</surname> <given-names>BL</given-names></name><name><surname>Soldati-Favre</surname> <given-names>D</given-names></name><name><surname>Sinnis</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Shedding of TRAP by a rhomboid protease from the malaria sporozoite surface is essential for gliding motility and sporozoite infectivity</article-title><source>PLOS Pathogens</source><volume>8</volume><elocation-id>e1002725</elocation-id><pub-id pub-id-type="doi">10.1371/journal.ppat.1002725</pub-id><pub-id pub-id-type="pmid">22911675</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Frischknecht</surname> <given-names>F</given-names></name><name><surname>Matuschewski</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title><italic>Plasmodium</italic> sporozoite biology</article-title><source>Cold Spring Harbor Perspectives in Medicine</source><volume>7</volume><elocation-id>a025478</elocation-id><pub-id pub-id-type="doi">10.1101/cshperspect.a025478</pub-id><pub-id pub-id-type="pmid">28108531</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ghosh</surname> <given-names>AK</given-names></name><name><surname>Devenport</surname> <given-names>M</given-names></name><name><surname>Jethwaney</surname> <given-names>D</given-names></name><name><surname>Kalume</surname> <given-names>DE</given-names></name><name><surname>Pandey</surname> <given-names>A</given-names></name><name><surname>Anderson</surname> <given-names>VE</given-names></name><name><surname>Sultan</surname> <given-names>AA</given-names></name><name><surname>Kumar</surname> <given-names>N</given-names></name><name><surname>Jacobs-Lorena</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Malaria parasite invasion of the mosquito salivary gland requires interaction between the plasmodium TRAP and the anopheles saglin proteins</article-title><source>PLOS Pathogens</source><volume>5</volume><elocation-id>e1000265</elocation-id><pub-id pub-id-type="doi">10.1371/journal.ppat.1000265</pub-id><pub-id pub-id-type="pmid">19148273</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Grakoui</surname> <given-names>A</given-names></name><name><surname>Bromley</surname> <given-names>SK</given-names></name><name><surname>Sumen</surname> <given-names>C</given-names></name><name><surname>Davis</surname> <given-names>MM</given-names></name><name><surname>Shaw</surname> <given-names>AS</given-names></name><name><surname>Allen</surname> <given-names>PM</given-names></name><name><surname>Dustin</surname> <given-names>ML</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>The immunological synapse: a molecular machine controlling T cell activation</article-title><source>Science</source><volume>285</volume><fpage>221</fpage><lpage>227</lpage><pub-id pub-id-type="doi">10.1126/science.285.5425.221</pub-id><pub-id pub-id-type="pmid">10398592</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hegge</surname> <given-names>S</given-names></name><name><surname>Münter</surname> <given-names>S</given-names></name><name><surname>Steinbüchel</surname> <given-names>M</given-names></name><name><surname>Heiss</surname> <given-names>K</given-names></name><name><surname>Engel</surname> <given-names>U</given-names></name><name><surname>Matuschewski</surname> <given-names>K</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Multistep adhesion of <italic>Plasmodium sporozoites</italic></article-title><source>The FASEB Journal</source><volume>24</volume><fpage>2222</fpage><lpage>2234</lpage><pub-id pub-id-type="doi">10.1096/fj.09-148700</pub-id><pub-id pub-id-type="pmid">20159960</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heintzelman</surname> <given-names>MB</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Gliding motility in apicomplexan parasites</article-title><source>Seminars in Cell &amp; Developmental Biology</source><volume>46</volume><fpage>135</fpage><lpage>142</lpage><pub-id pub-id-type="doi">10.1016/j.semcdb.2015.09.020</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hellmann</surname> <given-names>JK</given-names></name><name><surname>Perschmann</surname> <given-names>N</given-names></name><name><surname>Spatz</surname> <given-names>JP</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Tunable substrates unveil chemical complementation of a genetic cell migration defect</article-title><source>Advanced Healthcare Materials</source><volume>2</volume><fpage>1162</fpage><lpage>1169</lpage><pub-id pub-id-type="doi">10.1002/adhm.201200426</pub-id><pub-id pub-id-type="pmid">23355513</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Janse</surname> <given-names>CJ</given-names></name><name><surname>Ramesar</surname> <given-names>J</given-names></name><name><surname>Waters</surname> <given-names>AP</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>High-efficiency transfection and drug selection of genetically transformed blood stages of the rodent malaria parasite <italic>Plasmodium berghei</italic></article-title><source>Nature Protocols</source><volume>1</volume><fpage>346</fpage><lpage>356</lpage><pub-id pub-id-type="doi">10.1038/nprot.2006.53</pub-id><pub-id pub-id-type="pmid">17406255</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jethwaney</surname> <given-names>D</given-names></name><name><surname>Lepore</surname> <given-names>T</given-names></name><name><surname>Hassan</surname> <given-names>S</given-names></name><name><surname>Mello</surname> <given-names>K</given-names></name><name><surname>Rangarajan</surname> <given-names>R</given-names></name><name><surname>Jahnen-Dechent</surname> <given-names>W</given-names></name><name><surname>Wirth</surname> <given-names>D</given-names></name><name><surname>Sultan</surname> <given-names>AA</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Fetuin-A, a hepatocyte-specific protein that binds plasmodium berghei thrombospondin-related adhesive protein: a potential role in infectivity</article-title><source>Infection and Immunity</source><volume>73</volume><fpage>5883</fpage><lpage>5891</lpage><pub-id pub-id-type="doi">10.1128/IAI.73.9.5883-5891.2005</pub-id><pub-id pub-id-type="pmid">16113307</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kamata</surname> <given-names>T</given-names></name><name><surname>Wright</surname> <given-names>R</given-names></name><name><surname>Takada</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Critical threonine and aspartic acid residues within the I domains of beta 2 integrins for interactions with intercellular adhesion molecule 1 (ICAM-1) and C3bi</article-title><source>Journal of Biological Chemistry</source><volume>270</volume><fpage>12531</fpage><lpage>12535</lpage><pub-id pub-id-type="doi">10.1074/jbc.270.21.12531</pub-id><pub-id pub-id-type="pmid">7539004</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kern</surname> <given-names>A</given-names></name><name><surname>Briesewitz</surname> <given-names>R</given-names></name><name><surname>Bank</surname> <given-names>I</given-names></name><name><surname>Marcantonio</surname> <given-names>EE</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>The role of the I domain in ligand binding of the human integrin alpha 1 beta 1</article-title><source>The Journal of Biological Chemistry</source><volume>269</volume><fpage>22811</fpage><lpage>22816</lpage><pub-id pub-id-type="pmid">7521332</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Klug</surname> <given-names>D</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Motility precedes egress of malaria parasites from oocysts</article-title><source>eLife</source><volume>6</volume><elocation-id>e19157</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.19157</pub-id><pub-id pub-id-type="pmid">28115054</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>J</given-names></name><name><surname>Springer</surname> <given-names>TA</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Integrin extension enables ultrasensitive regulation by cytoskeletal force</article-title><source>PNAS</source><volume>114</volume><fpage>4685</fpage><lpage>4690</lpage><pub-id pub-id-type="doi">10.1073/pnas.1704171114</pub-id><pub-id pub-id-type="pmid">28416675</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liddington</surname> <given-names>RC</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Structural aspects of integrins</article-title><source>Advances in Experimental Medicine and Biology</source><volume>819</volume><fpage>111</fpage><lpage>126</lpage><pub-id pub-id-type="doi">10.1007/978-94-017-9153-3_8</pub-id><pub-id pub-id-type="pmid">25023171</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Matuschewski</surname> <given-names>K</given-names></name><name><surname>Nunes</surname> <given-names>AC</given-names></name><name><surname>Nussenzweig</surname> <given-names>V</given-names></name><name><surname>Ménard</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Plasmodium sporozoite invasion into insect and mammalian cells is directed by the same dual binding system</article-title><source>The EMBO Journal</source><volume>21</volume><fpage>1597</fpage><lpage>1606</lpage><pub-id pub-id-type="doi">10.1093/emboj/21.7.1597</pub-id><pub-id pub-id-type="pmid">11927544</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Michishita</surname> <given-names>M</given-names></name><name><surname>Videm</surname> <given-names>V</given-names></name><name><surname>Arnaout</surname> <given-names>MA</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>A novel divalent cation-binding site in the A domain of the beta 2 integrin CR3 (CD11b/CD18) is essential for ligand binding</article-title><source>Cell</source><volume>72</volume><fpage>857</fpage><lpage>867</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(93)90575-B</pub-id><pub-id pub-id-type="pmid">8458080</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Morahan</surname> <given-names>BJ</given-names></name><name><surname>Wang</surname> <given-names>L</given-names></name><name><surname>Coppel</surname> <given-names>RL</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>No TRAP, no invasion</article-title><source>Trends in Parasitology</source><volume>25</volume><fpage>77</fpage><lpage>84</lpage><pub-id pub-id-type="doi">10.1016/j.pt.2008.11.004</pub-id><pub-id pub-id-type="pmid">19101208</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moreira</surname> <given-names>CK</given-names></name><name><surname>Templeton</surname> <given-names>TJ</given-names></name><name><surname>Lavazec</surname> <given-names>C</given-names></name><name><surname>Hayward</surname> <given-names>RE</given-names></name><name><surname>Hobbs</surname> <given-names>CV</given-names></name><name><surname>Kroeze</surname> <given-names>H</given-names></name><name><surname>Janse</surname> <given-names>CJ</given-names></name><name><surname>Waters</surname> <given-names>AP</given-names></name><name><surname>Sinnis</surname> <given-names>P</given-names></name><name><surname>Coppi</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>The plasmodium TRAP/MIC2 family member, TRAP-Like protein (TLP), is involved in tissue traversal by sporozoites</article-title><source>Cellular Microbiology</source><volume>10</volume><fpage>1505</fpage><lpage>1516</lpage><pub-id pub-id-type="doi">10.1111/j.1462-5822.2008.01143.x</pub-id><pub-id pub-id-type="pmid">18346224</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Münter</surname> <given-names>S</given-names></name><name><surname>Sabass</surname> <given-names>B</given-names></name><name><surname>Selhuber-Unkel</surname> <given-names>C</given-names></name><name><surname>Kudryashev</surname> <given-names>M</given-names></name><name><surname>Hegge</surname> <given-names>S</given-names></name><name><surname>Engel</surname> <given-names>U</given-names></name><name><surname>Spatz</surname> <given-names>JP</given-names></name><name><surname>Matuschewski</surname> <given-names>K</given-names></name><name><surname>Schwarz</surname> <given-names>US</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Plasmodium sporozoite motility is modulated by the turnover of discrete adhesion sites</article-title><source>Cell Host &amp; Microbe</source><volume>6</volume><fpage>551</fpage><lpage>562</lpage><pub-id pub-id-type="doi">10.1016/j.chom.2009.11.007</pub-id><pub-id pub-id-type="pmid">20006843</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pradel</surname> <given-names>G</given-names></name><name><surname>Garapaty</surname> <given-names>S</given-names></name><name><surname>Frevert</surname> <given-names>U</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Proteoglycans mediate malaria sporozoite targeting to the liver</article-title><source>Molecular Microbiology</source><volume>45</volume><fpage>637</fpage><lpage>651</lpage><pub-id pub-id-type="doi">10.1046/j.1365-2958.2002.03057.x</pub-id><pub-id pub-id-type="pmid">12139612</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Puigbò</surname> <given-names>P</given-names></name><name><surname>Guzmán</surname> <given-names>E</given-names></name><name><surname>Romeu</surname> <given-names>A</given-names></name><name><surname>Garcia-Vallvé</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>OPTIMIZER: a web server for optimizing the Codon usage of DNA sequences</article-title><source>Nucleic Acids Research</source><volume>35</volume><fpage>W126</fpage><lpage>W131</lpage><pub-id pub-id-type="doi">10.1093/nar/gkm219</pub-id><pub-id pub-id-type="pmid">17439967</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Quadt</surname> <given-names>KA</given-names></name><name><surname>Streichfuss</surname> <given-names>M</given-names></name><name><surname>Moreau</surname> <given-names>CA</given-names></name><name><surname>Spatz</surname> <given-names>JP</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Coupling of retrograde flow to force production during malaria parasite migration</article-title><source>ACS Nano</source><volume>10</volume><fpage>2091</fpage><lpage>2102</lpage><pub-id pub-id-type="doi">10.1021/acsnano.5b06417</pub-id><pub-id pub-id-type="pmid">26792112</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ramakrishnan</surname> <given-names>C</given-names></name><name><surname>Dessens</surname> <given-names>JT</given-names></name><name><surname>Armson</surname> <given-names>R</given-names></name><name><surname>Pinto</surname> <given-names>SB</given-names></name><name><surname>Talman</surname> <given-names>AM</given-names></name><name><surname>Blagborough</surname> <given-names>AM</given-names></name><name><surname>Sinden</surname> <given-names>RE</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Vital functions of the malarial ookinete protein, CTRP, reside in the A domains</article-title><source>International Journal for Parasitology</source><volume>41</volume><fpage>1029</fpage><lpage>1039</lpage><pub-id pub-id-type="doi">10.1016/j.ijpara.2011.05.007</pub-id><pub-id pub-id-type="pmid">21729699</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Robson</surname> <given-names>KJ</given-names></name><name><surname>Frevert</surname> <given-names>U</given-names></name><name><surname>Reckmann</surname> <given-names>I</given-names></name><name><surname>Cowan</surname> <given-names>G</given-names></name><name><surname>Beier</surname> <given-names>J</given-names></name><name><surname>Scragg</surname> <given-names>IG</given-names></name><name><surname>Takehara</surname> <given-names>K</given-names></name><name><surname>Bishop</surname> <given-names>DH</given-names></name><name><surname>Pradel</surname> <given-names>G</given-names></name><name><surname>Sinden</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Thrombospondin-related adhesive protein (TRAP) of <italic>Plasmodium falciparum</italic>: expression during sporozoite ontogeny and binding to human hepatocytes</article-title><source>The EMBO Journal</source><volume>14</volume><fpage>3883</fpage><lpage>3894</lpage><pub-id pub-id-type="doi">10.1002/j.1460-2075.1995.tb00060.x</pub-id><pub-id pub-id-type="pmid">7664729</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schindelin</surname> <given-names>J</given-names></name><name><surname>Arganda-Carreras</surname> <given-names>I</given-names></name><name><surname>Frise</surname> <given-names>E</given-names></name><name><surname>Kaynig</surname> <given-names>V</given-names></name><name><surname>Longair</surname> <given-names>M</given-names></name><name><surname>Pietzsch</surname> <given-names>T</given-names></name><name><surname>Preibisch</surname> <given-names>S</given-names></name><name><surname>Rueden</surname> <given-names>C</given-names></name><name><surname>Saalfeld</surname> <given-names>S</given-names></name><name><surname>Schmid</surname> <given-names>B</given-names></name><name><surname>Tinevez</surname> <given-names>JY</given-names></name><name><surname>White</surname> <given-names>DJ</given-names></name><name><surname>Hartenstein</surname> <given-names>V</given-names></name><name><surname>Eliceiri</surname> <given-names>K</given-names></name><name><surname>Tomancak</surname> <given-names>P</given-names></name><name><surname>Cardona</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Fiji: an open-source platform for biological-image analysis</article-title><source>Nature Methods</source><volume>9</volume><fpage>676</fpage><lpage>682</lpage><pub-id pub-id-type="doi">10.1038/nmeth.2019</pub-id><pub-id pub-id-type="pmid">22743772</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schmittgen</surname> <given-names>TD</given-names></name><name><surname>Livak</surname> <given-names>KJ</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Analyzing real-time PCR data by the comparative C(T) method</article-title><source>Nature</source><volume>3</volume><fpage>1101</fpage><lpage>1108</lpage><pub-id pub-id-type="doi">10.1038/nprot.2008.73</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schürpf</surname> <given-names>T</given-names></name><name><surname>Springer</surname> <given-names>TA</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Regulation of integrin affinity on cell surfaces</article-title><source>The EMBO Journal</source><volume>30</volume><fpage>4712</fpage><lpage>4727</lpage><pub-id pub-id-type="doi">10.1038/emboj.2011.333</pub-id><pub-id pub-id-type="pmid">21946563</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schwach</surname> <given-names>F</given-names></name><name><surname>Bushell</surname> <given-names>E</given-names></name><name><surname>Gomes</surname> <given-names>AR</given-names></name><name><surname>Anar</surname> <given-names>B</given-names></name><name><surname>Girling</surname> <given-names>G</given-names></name><name><surname>Herd</surname> <given-names>C</given-names></name><name><surname>Rayner</surname> <given-names>JC</given-names></name><name><surname>Billker</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>PlasmoGEM, a database supporting a community resource for large-scale experimental genetics in malaria parasites</article-title><source>Nucleic Acids Research</source><volume>43</volume><fpage>D1176</fpage><lpage>D1182</lpage><pub-id pub-id-type="doi">10.1093/nar/gku1143</pub-id><pub-id pub-id-type="pmid">25593348</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sievers</surname> <given-names>F</given-names></name><name><surname>Wilm</surname> <given-names>A</given-names></name><name><surname>Dineen</surname> <given-names>D</given-names></name><name><surname>Gibson</surname> <given-names>TJ</given-names></name><name><surname>Karplus</surname> <given-names>K</given-names></name><name><surname>Li</surname> <given-names>W</given-names></name><name><surname>Lopez</surname> <given-names>R</given-names></name><name><surname>McWilliam</surname> <given-names>H</given-names></name><name><surname>Remmert</surname> <given-names>M</given-names></name><name><surname>Söding</surname> <given-names>J</given-names></name><name><surname>Thompson</surname> <given-names>JD</given-names></name><name><surname>Higgins</surname> <given-names>DG</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Fast, scalable generation of high-quality protein multiple sequence alignments using clustal omega</article-title><source>Molecular Systems Biology</source><volume>7</volume><elocation-id>539</elocation-id><pub-id pub-id-type="doi">10.1038/msb.2011.75</pub-id><pub-id pub-id-type="pmid">21988835</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Singer</surname> <given-names>M</given-names></name><name><surname>Marshall</surname> <given-names>J</given-names></name><name><surname>Heiss</surname> <given-names>K</given-names></name><name><surname>Mair</surname> <given-names>GR</given-names></name><name><surname>Grimm</surname> <given-names>D</given-names></name><name><surname>Mueller</surname> <given-names>AK</given-names></name><name><surname>Frischknecht</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Zinc finger nuclease-based double-strand breaks attenuate malaria parasites and reveal rare microhomology-mediated end joining</article-title><source>Genome Biology</source><volume>16</volume><fpage>249</fpage><lpage>267</lpage><pub-id pub-id-type="doi">10.1186/s13059-015-0811-1</pub-id><pub-id pub-id-type="pmid">26573820</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Song</surname> <given-names>G</given-names></name><name><surname>Koksal</surname> <given-names>AC</given-names></name><name><surname>Lu</surname> <given-names>C</given-names></name><name><surname>Springer</surname> <given-names>TA</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Shape change in the receptor for gliding motility in plasmodium sporozoites</article-title><source>PNAS</source><volume>109</volume><fpage>21420</fpage><lpage>21425</lpage><pub-id pub-id-type="doi">10.1073/pnas.1218581109</pub-id><pub-id pub-id-type="pmid">23236185</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Song</surname> <given-names>G</given-names></name><name><surname>Springer</surname> <given-names>TA</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Structures of the <italic>Toxoplasma</italic> gliding motility adhesin</article-title><source>PNAS</source><volume>111</volume><fpage>4862</fpage><lpage>4867</lpage><pub-id pub-id-type="doi">10.1073/pnas.1403059111</pub-id><pub-id pub-id-type="pmid">24639528</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Springer</surname> <given-names>TA</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm</article-title><source>Cell</source><volume>76</volume><fpage>301</fpage><lpage>314</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(94)90337-9</pub-id><pub-id pub-id-type="pmid">7507411</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sultan</surname> <given-names>AA</given-names></name><name><surname>Thathy</surname> <given-names>V</given-names></name><name><surname>Frevert</surname> <given-names>U</given-names></name><name><surname>Robson</surname> <given-names>KJ</given-names></name><name><surname>Crisanti</surname> <given-names>A</given-names></name><name><surname>Nussenzweig</surname> <given-names>V</given-names></name><name><surname>Nussenzweig</surname> <given-names>RS</given-names></name><name><surname>Ménard</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>TRAP is necessary for gliding motility and infectivity of plasmodium sporozoites</article-title><source>Cell</source><volume>90</volume><fpage>511</fpage><lpage>522</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)80511-5</pub-id><pub-id pub-id-type="pmid">9267031</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tomley</surname> <given-names>FM</given-names></name><name><surname>Soldati</surname> <given-names>DS</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Mix and match modules: structure and function of microneme proteins in apicomplexan parasites</article-title><source>Trends in Parasitology</source><volume>17</volume><fpage>81</fpage><lpage>88</lpage><pub-id pub-id-type="doi">10.1016/S1471-4922(00)01761-X</pub-id><pub-id pub-id-type="pmid">11228014</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vanderberg</surname> <given-names>JP</given-names></name></person-group><year iso-8601-date="1974">1974</year><article-title>Studies on the motility of plasmodium sporozoites</article-title><source>The Journal of Protozoology</source><volume>21</volume><fpage>527</fpage><lpage>537</lpage><pub-id pub-id-type="doi">10.1111/j.1550-7408.1974.tb03693.x</pub-id><pub-id pub-id-type="pmid">4138523</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vincke</surname> <given-names>LH</given-names></name><name><surname>Bafort</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="1968">1968</year><article-title>Results of 2 years of observation of the cyclical transmission of plasmodium berghei</article-title><source>Annales Des Societes Belges De Medecine Tropicale, De Parasitologie, Et De Mycologie</source><volume>48</volume><fpage>439</fpage><lpage>454</lpage><pub-id pub-id-type="pmid">4397432</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vorup-Jensen</surname> <given-names>T</given-names></name><name><surname>Carman</surname> <given-names>CV</given-names></name><name><surname>Shimaoka</surname> <given-names>M</given-names></name><name><surname>Schuck</surname> <given-names>P</given-names></name><name><surname>Svitel</surname> <given-names>J</given-names></name><name><surname>Springer</surname> <given-names>TA</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Exposure of acidic residues as a danger signal for recognition of fibrinogen and other macromolecules by integrin alphaXbeta2</article-title><source>PNAS</source><volume>102</volume><fpage>1614</fpage><lpage>1619</lpage><pub-id pub-id-type="doi">10.1073/pnas.0409057102</pub-id><pub-id pub-id-type="pmid">15665082</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vorup-Jensen</surname> <given-names>T</given-names></name><name><surname>Chi</surname> <given-names>L</given-names></name><name><surname>Gjelstrup</surname> <given-names>LC</given-names></name><name><surname>Jensen</surname> <given-names>UB</given-names></name><name><surname>Jewett</surname> <given-names>CA</given-names></name><name><surname>Xie</surname> <given-names>C</given-names></name><name><surname>Shimaoka</surname> <given-names>M</given-names></name><name><surname>Linhardt</surname> <given-names>RJ</given-names></name><name><surname>Springer</surname> <given-names>TA</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Binding between the integrin alphaXbeta2 (CD11c/CD18) and heparin</article-title><source>Journal of Biological Chemistry</source><volume>282</volume><fpage>30869</fpage><lpage>30877</lpage><pub-id pub-id-type="doi">10.1074/jbc.M706114200</pub-id><pub-id pub-id-type="pmid">17699512</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wengelnik</surname> <given-names>K</given-names></name><name><surname>Spaccapelo</surname> <given-names>R</given-names></name><name><surname>Naitza</surname> <given-names>S</given-names></name><name><surname>Robson</surname> <given-names>KJ</given-names></name><name><surname>Janse</surname> <given-names>CJ</given-names></name><name><surname>Bistoni</surname> <given-names>F</given-names></name><name><surname>Waters</surname> <given-names>AP</given-names></name><name><surname>Crisanti</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>The A-domain and the thrombospondin-related motif of <italic>Plasmodium falciparum</italic> TRAP are implicated in the invasion process of mosquito salivary glands</article-title><source>The EMBO Journal</source><volume>18</volume><fpage>5195</fpage><lpage>5204</lpage><pub-id pub-id-type="doi">10.1093/emboj/18.19.5195</pub-id><pub-id pub-id-type="pmid">10508153</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Whittaker</surname> <given-names>CA</given-names></name><name><surname>Hynes</surname> <given-names>RO</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Distribution and evolution of von willebrand/integrin A domains: widely dispersed domains with roles in cell adhesion and elsewhere</article-title><source>Molecular Biology of the Cell</source><volume>13</volume><fpage>3369</fpage><lpage>3387</lpage><pub-id pub-id-type="doi">10.1091/mbc.e02-05-0259</pub-id><pub-id pub-id-type="pmid">12388743</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname> <given-names>S</given-names></name><name><surname>Wang</surname> <given-names>J</given-names></name><name><surname>Wang</surname> <given-names>JH</given-names></name><name><surname>Springer</surname> <given-names>TA</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Distinct recognition of complement iC3b by integrins α X β 2 and α M β 2</article-title><source>PNAS</source><volume>114</volume><fpage>3403</fpage><lpage>3408</lpage><pub-id pub-id-type="doi">10.1073/pnas.1620881114</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yakubenko</surname> <given-names>VP</given-names></name><name><surname>Lishko</surname> <given-names>VK</given-names></name><name><surname>Lam</surname> <given-names>SC</given-names></name><name><surname>Ugarova</surname> <given-names>TP</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>A molecular basis for integrin alphaMbeta 2 ligand binding promiscuity</article-title><source>The Journal of Biological Chemistry</source><volume>277</volume><fpage>48635</fpage><lpage>48642</lpage><pub-id pub-id-type="doi">10.1074/jbc.M208877200</pub-id><pub-id pub-id-type="pmid">12377763</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yoshida</surname> <given-names>N</given-names></name><name><surname>Nussenzweig</surname> <given-names>RS</given-names></name><name><surname>Potocnjak</surname> <given-names>P</given-names></name><name><surname>Nussenzweig</surname> <given-names>V</given-names></name><name><surname>Aikawa</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="1980">1980</year><article-title>Hybridoma produces protective antibodies directed against the sporozoite stage of malaria parasite</article-title><source>Science</source><volume>207</volume><fpage>71</fpage><lpage>73</lpage><pub-id pub-id-type="doi">10.1126/science.6985745</pub-id><pub-id pub-id-type="pmid">6985745</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.57572.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Soldati-Favre</surname><given-names>Dominique</given-names></name><role>Reviewing Editor</role><aff><institution>University of Geneva</institution><country>Switzerland</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>The thrombospondin related anonymous protein (TRAP) is an important adhesin expressed by the sporozoite stage of the malaria parasite, required for sporozoite motility and invasion of the salivary gland in the mosquito and of the liver in the mammalian host. To gain insight into the contribution of integrin I-domain of TRAP, the authors performed deletion as well as creative swap between Plasmodium, Toxoplasma and mammalian integrin I-domains. These technically challenging experiments established that the I domains have the versatile capacity to confer adhesive properties to TRAP both in vertebrate and arthropod hosts.</p><p><bold>Decision letter after peer review:</bold></p><p>[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]</p><p>Thank you for submitting your work entitled &quot;Cationic charge and polyspecificity of an integrin domain regulates infectivity of malaria parasites&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.</p><p>Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered for publication in <italic>eLife</italic> at this stage.</p><p>As you will see, the three reviewers are broadly supportive of this work, which addresses an important topic. However, they were especially concerned that the conclusions drawn from the a-L and a-X swapped mutants are not sufficiently supported by the data. Importantly they raised three main issues that will take some time to address (more than two months) and in consequence, we have together opted for a rejection with a strong encouragement for re-submission. If you are able to address these issues we will consider a newly submitted form of this paper that we will treat as a revised manuscript. If you choose this course of action please submit a separate cover letter detailing the changes you have made.</p><p>Main points to be addressed:</p><p>1) Establish if the two human integrin I-domain swaps have the same phenotype as the trap null allele. At the moment the authors imply that they are strong hypomorphs but two reviewers point out there is no side-by-side quantitative comparison with the null. If the human integrin I-domain swaps do phenocopy the null then the wording in the manuscript must be changed significantly.</p><p>2) Make a direct link between I-domain ligand binding and phenotype rather than implying this is the reason for the observed effects. The suggestion of performing the gliding assays on different substrates, and especially on known ligands of the swapped I-domains, is a good one and would be informative.</p><p>3) Establish that the I-domains retain their folding and binding functions in the context of the chimeric trap.</p><p><italic>Reviewer #1:</italic></p><p>In this study, Klug and colleagues report on the role of the integrin I-domain of TRAP, an important adhesin expressed by the sporozoite stage of the malaria parasite. Previous studies have shown that TRAP is required for sporozoite motility and invasion of the salivary gland in the mosquito and of the liver in the mammalian host. A metal ion-dependent adhesion site (MIDAS) within the I-domain of TRAP is known to play a role in sporozoite infectivity, however the functional and adhesive properties of the I-domain remain undefined. More generally, the mechanisms of sporozoite infection are poorly understood at the molecular level, so this study addresses an important topic.</p><p>To investigate the function of TRAP I-domain, the authors generated a number of mutants in <italic>P. berghei</italic> and performed robust phenotype analysis including gliding motility assays and analysis of sporozoite infectivity in the mosquito (invasion of salivary gland) and in the mouse (invasion of the liver). The work is very well performed and includes a large body of data, combining genetic approaches, in vitro and in vivo experiments. The paper is clearly written and the conclusions drawn from the results generally justified.</p><p>The data convincingly show that:</p><p>a) Sporozoites expressing a truncated TRAP lacking the I-domain are non-motile and do not invade the mosquito salivary glands and the mouse liver.</p><p>b) Replacement of TRAP I-domain with the I-domain from Toxoplasma MIC2 results in normal invasion of salivary glands and normal sporozoite infectivity in mice, although gliding motility is reduced.</p><p>c) Replacement of TRAP I-domain with the I-domain from human aX or aL integrin results in a severe reduction of sporozoite infectivity and gliding motility, although residual infectivity was observed in both mosquito and mouse.</p><p>d) Introduction of 7 point mutations in the I-domain of TRAP, to replace positively charged residues (H/K/R) by negatively charged residues (E/D), results in normal invasion of mosquito salivary glands yet reduced motility and slightly reduced infectivity in the mouse.</p><p>Based on the presented data, the authors conclude that the adhesive properties of the I-domain of TRAP can be partially fulfilled by the I-domain from other organisms, and that the cationic charge and the polyspecificity of the I-domain regulates sporozoite infectivity. However, the main limitation of the study is that adhesion and ligand binding were not directly assessed, so the aforementioned conclusions are based on indirect evidence or speculation. It is important to experimentally address the adhesive properties of the chimeric TRAP proteins expressed in the mutant parasites.</p><p>Major points</p><p>1) The authors conclude that the observed phenotypic defects are due to altered ligand binding properties of mutated TRAP proteins. However this was not addressed experimentally. Other modifications in the mutants, such as an alteration of the conformation of TRAP, could also contribute to the observed phenotype, unrelated with TRAP-I adhesive properties. In the absence of direct experimental evidence, it seems too speculative to conclude that the polyspecificity of the I-domain regulates sporozoite infectivity. The data clearly shows that MIC2-I almost completely complement TRAP-I functions, whilst aX-I and aL-I are poorly functional in this context. TRAP-I is basic (like aX-I), but MIC2-I is acidic (like aL-I). The data therefore show no correlation between infectivity and charges, and thus do not support an important role of the I-domain charges. Other factors may explain why MIC2-I is functionally superior to the I-domain from humain integrins, including the size of the domain size (MIC2 is closest to TRAP: 194 aa for PbTRAP-I; 189 aa for MIC2-I; 184 aa for aX-I; 177 aa for aL-I). The authors cannot exclude that a smaller I-domain may affect the conformation of TRAP protein, including other parts of the proteins such as the β ribbon. Surprisingly, the data also show no direct correlation between gliding motility and infectivity, since MIC2 and RevCharge mutants show severely reduced motility yet invade almost normally the mosquito and the mouse. This questions the relevance of the gliding assay. How do sporozoites with reduced gliding motility invade mosquito salivary glands and mouse cells?</p><p>Maybe a simple way to address these issues would be to perform gliding assays not merely on glass slides, as performed here, but on specific substrates, including known ligands of MIC2, aX or aL integrins. This would strengthen the conclusion that the effects of the I-domain modifications are really due to changes in the adhesional properties of the chimeric proteins. For example, do sporozoites expressing the aL-I domain recover gliding motility on ICAM1?</p><p>2) The phenotype of the RevCharge mutant should be more thoroughly investigated to better document a defect in sporozoite infectivity for the liver. Figure 6F shows a partial reduction of parasite fitness in the mouse, which could be quantified more precisely. In vitro assays in HepG2 cultures, as performed with the MIC2 mutant, should be included. This is important to strengthen or invalidate the hypothesis that charges in the I-domain play an important role in sporozoite infectivity.</p><p>3) The authors checked by immunofluorescence that TRAP is expressed in the mutant sporozoites. However, they should also provide evidence that the level of expression of TRAP is unaffected in the mutants, ideally using Western Blot as shown for the RevCharge mutant. This is particularly important as sequences codon-optimized for <italic>E. coli</italic> were used, which may differentially affect the level of expression of the proteins. Why using <italic>E. coli</italic> optimized sequences?</p><p><italic>Reviewer #2:</italic></p><p>The manuscript by Klug et al. investigates the biochemical and functional properties of I-domains by genetically replacing the I-domain within an important malaria parasite ligand called TRAP with I domains taken from another parasite (<italic>T. gondii</italic>) ligand, and two from human integrins. Plasmodium parasites lacking either the entire TRAP locus or just the I-domain of TRAP do not move, or invade the vector salivary glands. The authors find that the exogenous I domains from different sources can, to varying degrees, complement TRAP function resulting in the partial rescue of some motility, and ability to invade. The authors notice that the surface charges of TRAP in the rodent parasite <italic>P. berghei</italic> are cationic and to determine if this is important for function, mutate these residues to acidic amino acids and show again that the functions of TRAP are impaired.</p><p>The manuscript is very nicely put together with high quality data, well-prepared figures, and the writing is clear. Overall, I found this a rather strange study where the authors have used the phenotyping available in the <italic>Plasmodium berghei</italic> rodent infection model to investigate general properties of I domains from different proteins and organisms.</p><p>Major points</p><p>The authors take several precautions to try to ensure the I-domains retain their function when transplanted in the Plasmodium TRAP sequence by taking structural considerations into account and showing that the proteins are detectable using anti-TRAP antibodies in the transgenic parasites. A key point in my mind is whether the human integrin I-domains really do complement the function of the I-domain in TRAP. In the manuscript, the authors show that the I-domain mutant is a null (Figure 2B) and that the human integrin I -domain replacement parasites are very strong hypomorphs (Figures 3F, 4A); however, there does not appear to be a direct side-by-side comparison – e.g. injecting 25,000 HL sporozoites of the TRAP I-domain deletion alongside the integrin replacements in Figure 3—figure supplement 3B, for example. Also, are the authors able to demonstrate that the inserted I-domains retain their functions from their original proteins – is there a known ligand for the inserted integrin I-domains?</p><p>For the revCharge mutant, the authors imply that the loss of motility and ability to infect mice is due to the alteration in I-domain ligand binding, but could not an alternative explanation be that a proportion of the protein no longer folds correctly or that interactions with other parasite proteins necessary for full function are altered? The authors suggest the role of the I-domain is to interact with the host substrate, but these are not defined in the manuscript making it conceptually a rather large leap to link the mutations made in the protein to the phenotypes seen in the parasite.</p><p><italic>Reviewer #3:</italic></p><p>In this study the authors swap integrin &quot;I&quot; domains from MIC2 and mammalian integrins with the I-domain of TRAP, the key motility adhesin of malaria sporozoites. Though the domain structure of the extracellular portion of TRAP has long been known to include an integrin-like I-domain, previous mutational studies of this domain were not that informative and the idea to perform domain-swapping experiments between Plasmodium, Toxoplasma and mammalian integrin I-domains is creative and potentially informative. Overall, the MIC2 swapped TRAP and the charge-altered TRAP are the most informative data while the conclusions drawn from the a-L and a-X swapped mutants are not justified by the data shown.</p><p>1) The human integrin I-domain swapped mutants essentially behave like the TRAP KO. There is an elegant explanation in the Discussion as to why the a-L and a-X domains may not open and close in the same way as the I-domains of TRAP and MIC2. However, in the face of no data to support this or another hypothesis, it is equally plausible that there is some significant misfolding on the TRAP with a mammalian I domain. It would be important to show that this is not the case. Since there are commercially available antibodies to human integrins, can they be used, especially ones specific for conformational epitopes, to confirm the overall folding of the a-L and a-X domains.</p><p>2) The data shown for the a-L and a-X mutants do not support the conclusions. These mutants have less than 200 sporozoites in their salivary glands, the a-L mutant is not motile and not infectious while the a-X mutant is minimally motile and very poorly infectious after IV inoculation. These data look like the TRAP KO (Sultan et al., 1997), where they observed 100 to 200 sporozoites in the salivary glands and had a few infected mice when sporozoites were inoculated IV. Given this, how can they state: &quot;Parasites expressing TRAP with I-domains from other organisms including humans can have nearly intact motility and invasion”. Or &quot;…I-domain of TRAP is required to mediate adhesional properties which can be partially preserved when the native I-domain is replaced by I-domains from human integrins…&quot;. These statements are in the Introduction and Abstract but additionally, a central theme of the Discussion is that the a-L and a-X mutants are sufficiently intact to draw meaningful conclusions.</p><p>3) TRAP expression in mutant lines is verified by immunofluorescence that is not quantified. Since decreased levels of mutant TRAP could have phenotypes due to the mutation or to expression level, its critical to have western blot verification of mutant TRAP expression compared to WT TRAP expression, in all lines analyzed.</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for submitting your article &quot;Plasmodium adhesin TRAP retains function when its ligand-binding domain replaced by evolutionarily distant I domains&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Dominique Soldati-Favre as the Senior Editor. The reviewers have opted to remain anonymous.</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in <italic>eLife</italic> but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data.</p><p>Specifically, the interpretation of the human I domain swaps needs to be carefully worded to avoid over-interpreting the data, which seems to be the case here.</p><p>Summary:</p><p>In this study, Klug and colleagues report on the role of the integrin I-domain of TRAP, an important adhesin expressed by the sporozoite stage of the malaria parasite. Previous studies have shown that TRAP is required for sporozoite motility and invasion of the salivary gland in the mosquito and of the liver in the mammalian host. The authors swap integrin &quot;I&quot; domains from the <italic>Toxoplasma gondii</italic> ligand MIC2 and mammalian integrins with the I-domain of TRAP, the key motility adhesin of malaria sporozoites. Though the domain structure of the extracellular portion of TRAP has long been known to include an integrin-like I-domain, previous mutational studies of this domain were not that informative and the idea to perform domain-swapping experiments between Plasmodium, Toxoplasma and mammalian integrin I-domains is creative and potentially informative. Overall, the MIC2 swapped TRAP and the charge-altered TRAP are the most informative data while the conclusions drawn from the a-L and a-X swapped mutants are not justified by the data shown.</p><p>Revisions for this paper:</p><p>One major reservations of the previous iteration of this study was that the conclusions drawn from the parasites in which the TRAP I-domain was replaced by the human a-L and a-X integrin domains were not justified by the data shown and this has not been corrected in the revised manuscript. Indeed, salivary gland sporozoite numbers of the a-L and a-X mutants are in the same range as the TRAPΔI and TRAP KO parasites, with only the prevalence of infection somewhat increased in the a-X parasites. Infectivity studies demonstrate that the a-L parasites are similar to the TRAPΔI and TRAP KO parasites. With numerous careful experiments they that show the a-X parasites are more infectious than the a-L, TRAPΔI and TRAP KO parasites, and this interesting finding suggests that the charge on a-X may enable the mutant TRAP to have some minimal activity. However, their data show that the a-X sporozoites are about 100-fold decreased in their infectivity compared to controls. It has been previously demonstrated that a one day delay in patency is equivalent to a 10-fold decrease in infection. When 10,000 hemolymph sporozoites are inoculated IV, 100% of control mice are infected with a prepatent period of 4 days. With the a-X parasites only 50% of mice are infected and the prepatent period is 6 days. Thus, even if one ignores the fact that half the mice were not infected, the ones that did get infected had a 100-fold lower functional inoculum.</p><p>Characterization of this significant attenuation of infectivity of the a-X parasites in mosquito and mammalian hosts as &quot;partial restoration&quot; of TRAP function is misleading. Indeed given the phenotype they describe, it is clear that the a-X parasites cannot be naturally transmitted for a single life cycle. Thus, the paper should focus on the interesting phenotypes of the MIC2 and reverse charge sporozoites, and only compare the a-X parasites to the a-L and TRAP KO parasites where there is a small marginal increase in infectivity supporting the importance of charge in the TRAP I-domain.</p><p>The following statements in the paper should be deleted, or changed to only include the MIC-2 mutant.</p><p>Title:</p><p>The current title implies that human I domains confer some functionality to TRAP which, given that these mutants have salivary gland sporozoite counts in the range of the TRAP KO, and infectivity levels that are 100-fold decreased, is misleading.</p><p>Abstract:</p><p>&quot;…its replacement with I domains from Toxoplasma MIC2 or the human integrin αX-subunit substantially or partially restores these functions&quot;.</p><p>&quot;Results with TRAP, MIC2 and aX-I domains show remarkable interchangeability in their ability to engage with ligands in divergent tissues in arthropoa and chordata&quot;.</p><p>&quot;…results suggest that apicomplexan parasites appropriated I domains in part for their ability to recognize structurally diverse ligands&quot;</p><p>&quot;…permit TRAP to function as an adhesin with diverse ligands in both vertebrate and arthropod hosts&quot;</p><p>The ability to engage with ligands is not addressed here, so wording should be revised. Also, the aX-I domain is poorly functional in TRAP, so &quot;remarkable interchangeability&quot; is not correct in this case.</p><p>Introduction:</p><p>&quot;Parasites expressing TRAP with I domains from other organisms, including humans show partially rescued motility and invasion.&quot;</p><p>Results:</p><p>&quot;This could hint that the charge of αX could compensate for the long evolutionary distance between apicomplexa and mammals.&quot;</p><p>Discussion:</p><p>&quot;It was therefore remarkable that TRAP function was largely or partially restored by replacement of its I domain by homologues from Toxoplasma gondi and <italic>Homo sapiens</italic> with only 28% and 18% amino acid sequence identity, respectively.&quot;</p><p>&quot;TRAP function was largely or partially restored by replacement of its I domain&quot;. This is true for Toxoplasma MIC2 domain but not human integrin I domains.</p><p>&quot;…immunofluorescence showed normal localization in sporozoites, suggesting that they were properly folded&quot;.</p><p>The immunofluorescence data provide no information on the folding of TRAP.</p><p>&quot;Infectivity of hemolymph αX-I and αL-I sporozoites in mice was decreased at least 4-fold and 15-fold, respectively.&quot; Infectivity in the a-L sporozoites was similar to the TRAP KO, and in the a-X sporozoites was 100-fold decreased compared to controls.</p><p>&quot;The findings that I domains from organisms that encounter none of the same ligands as TRAP can replace its function in mediating salivary gland invasion and infection of mice strongly suggest that the I domain functions to provide traction for motility and cell invasion rather than tissue tropism.&quot; This should specify that they are referring to replacement with MIC2.</p><p>&quot;…the I domain of TRAP is required for gliding motility and invasion by sporozoites of mosquito salivary glands and mammalian liver, without a requirement for evolved specificity&quot;.</p><p>The data with the human I domains show that any I domain cannot confer function in TRAP, so this statement is not correct.</p><p>The authors attempted to analyze the motility of mutant sporozoites on various substrates. They indicate that they &quot;were not able to measure a significant effect of a specific ligand&quot;.</p><p>However, Figure 1 shows that aX-I and aL-I activated on BSA are mostly floating, while on the other substrates sporozoites are mostly attached or display unproductive motility. This could be an indication that the human I-domains retained some adhesive properties. However, it would be useful to have the same type of data with the I domain-deleted mutant, and the threshold, as indicated in A, should also be shown on the other panels.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.57572.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]</p><disp-quote content-type="editor-comment"><p>As you will see, the three reviewers are broadly supportive of this work, which addresses an important topic. However, they were especially concerned that the conclusions drawn from the a-L and a-X swapped mutants are not sufficiently supported by the data. Importantly they raised three main issues that will take some time to address (more than two months) and in consequence, we have together opted for a rejection with a strong encouragement for re-submission. If you are able to address these issues we will consider a newly submitted form of this paper that we will treat as a revised manuscript. If you choose this course of action please submit a separate cover letter detailing the changes you have made.</p></disp-quote><p>Thank you for the constructive and encouraging evaluation of our manuscript. Please find in the following our comments describing the changes in the manuscript we introduced and the additional experiments we performed to address the comments from the reviewers. Please note that due to the extensive changes and the suggestion by reviewer 3 to remove part of the supplement two authors who participated in the deleted work were removed from the author list and two authors changed position reflecting their respective contributions since the last submission. In total we added data from over 30 mosquito cage infections to improve the infection data of some of the mutants and to provide adequate Western blots for all mutants, who did not enter the salivary glands from hemolymph sporozoites.</p><disp-quote content-type="editor-comment"><p>Main points to be addressed:</p><p>1) Establish if the two human integrin I-domain swaps have the same phenotype as the trap null allele. At the moment the authors imply that they are strong hypomorphs but two reviewers point out there is no side-by-side quantitative comparison with the null. If the human integrin I-domain swaps do phenocopy the null then the wording in the manuscript must be changed significantly.</p></disp-quote><p>Thank you for this suggestion, which helped us clarifying a discussion amongst the authors when writing the manuscript. We now performed a side by side comparison with the null mutant and the I-domain deletion as recommended (Table 2 of the manuscript). The new results show that the aX line partially rescues TRAP function, as sporozoite injection led to the infection of around 50% of all mice (11/20) that received a sporozoite injection while no mice became blood stage patent if infected with the I-domain deletion (0/14) or the TRAP knockout (0/10); note that Table 3 summarizes these data for injections with hemolymph sporozoites. Only one mouse (from 20) could be infected with the aL line. Therefore we agree with the reviewers that the aL mutant is essentially not rescuing TRAP functions and changed the wording across the manuscript accordingly. The new data were incorporated into Table 2 and a Table 3 was added that sums up the key data from Table 2 for faster direct comparison between the mutant lines.</p><disp-quote content-type="editor-comment"><p>2) Make a direct link between I-domain ligand binding and phenotype rather than implying this is the reason for the observed effects. The suggestion of performing the gliding assays on different substrates, and especially on known ligands of the swapped I-domains, is a good one and would be informative.</p></disp-quote><p>Ligand binding by TRAP is indeed a key question for sporozoite biology. In the literature several potential ligands of TRAP are described such as proteoglycans and Fetuin-A on hepatocytes, saglin on salivary glands and an integrin in the skin. This broad range of potential ligands indicates already that TRAP interacts promiscuously with different proteins on different tissues even if the interaction might be specific in each case. It is also important to point out that these putative ligands are only important for TRAP mediated invasion but not needed for TRAP mediated motility although the data for the integrin in the skin suggest a minor effect on in vivo motility (Dundas et al., 2018).</p><p>While productive movement is dependent on TRAP and, as we show in this manuscript, also requires the presence of the I-domain within TRAP no specific TRAP-ligand is needed to activate sporozoites. In fact sporozoites do glide even in RPMI medium that contains only amino acids without protein additives or even in PBS with just added glucose. Hence, addition of a protein like bovine serum albumin (BSA) boosts activation and/or adhesion of sporozoites and increases the percentage of gliding parasites. However, other added proteins show similar effects. Therefore testing ligand specificity of TRAP in a motility assay is unfortunately not trivial; a rather disappointing observation that cost us many hairs over the years.</p><p>To illustrate this, we include <xref ref-type="fig" rid="sa2fig1">Author response image 1</xref>. This shows results from gliding assays within 96-well plates coated with different proteins of the extracellular matrix (laminin, fibronectin and collagen), ICAM-I, a known ligand of the aL-I domain and heparin, a ligand of the aX-I domain. We tested also the gliding behaviour of sporozoites of all four lines in the presence of seven differently charged heptapeptides as well as in the presence of BSA (positive control) and pure RPMI medium (negative control). The results of these experiments are compiled below.</p><fig id="sa2fig1"><label>Author response image 1.</label><caption><title>In vitro gliding motility of TRAP-I, MIC2-I, αX-I and αL-I sporozoites on different substrates.</title><p>Sporozoites were allowed to glide in wells coated with heparin, laminin, fibronection, collagen and two different concentrations of ICAM-I (10 µg/mL and 20 µg/mL); see Author response table 1. In addition gliding motility was tested in the presence of seven differently charged heptapeptides as well as in 3% BSA and in RPMI(P/S) without additives. (<bold>A</bold>) Gliding motility of TRAP-I salivary gland sporozoites. The red line indicates the baseline of productive motility observed in the negative control RPMI(P/S). Per condition 184 to 415 sporozoites were analyzed. (<bold>B</bold>) Gliding motility of MIC2-I salivary gland sporozoites. Per condition 111 to 174 sporozoites were analyzed. (<bold>C</bold>) Gliding motility of MIC2-I hemolymph sporozoites. Per condition 59 to 200 sporozoites were analyzed. (<bold>D</bold>) Gliding motility of αX-I hemolymph sporozoites. Per condition 97 to 366 sporozoites were analyzed. (<bold>E</bold>) Gliding motility of αL-I hemolymph sporozoites. Per condition 167 to 240 sporozoites were analyzed. (<bold>F</bold>) Classification of movement pattern according to Figure 2—figure supplement 2 of the manuscript. (<bold>G</bold>) Sequence and charge of tested heptapeptides. The CPPpred Score (https://omictools.com/cpppred-tool) gives the probability of the peptide to be membrane permeable (&lt;0.5; unlikely to cross membranes, &gt;0.5; likely to cross membranes). Note that the assay was not performed with TRAP-I hemolymph sporozoites because we did not observe any specific activation of gliding motility for αX-I and αL-I hemolymph sporozoites in any condition. All assays were performed in duplicates with sporozoites obtained from two mosquito feeding experiments. nd: not determined.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57572-resp-fig1-v1.tif"/></fig><p>Evaluating substrate specificity of <italic>TRAP-I</italic>, <italic>MIC2-I</italic>, <italic>αX-I</italic> and <italic>αL-I</italic> sporozoites:</p><p>We tested gliding motility in vitro for sporozoites of the four parasite lines TRAP-I, TRAP-MIC2, TRAP-αX and TRAP-αL in 96-well plates coated with heparin, ICAM-I, laminin, fibronectin and collagen. We included also a library of seven differently charged heptapeptides that we had available in our laboratory. As positive control we made use of 3% bovine serum albumin (BSA) and as negative control we tested RPMI medium mixed with penicillin and streptomycin that was used as base in all conditions. Hemolymph and salivary gland sporozoites were obtained by dissecting infected <italic>A.stephensi</italic> mosquitoes as described in Materials and methods. In brief, salivary glands were dissected and transferred into a plastic reaction tube containing 50 µL RPMI/PS. Salivary glands were ground with a pestle and centrifuged for 3min at 1000rpm at room temperature to separate freed sporozoites from mosquito tissue. Subsequently approximately 40µL of the supernatant was transferred into a new reaction tube. For the collection of hemolymph sporozoites infected <italic>A. stephensi</italic> mosquitoes were cut with a needle to remove the last segment of the abdomen. Subsequently the thorax was pierced with a finely drawn Pasteur pipette filled with RPMI/PS solution. While gently pressing the pipette the haemocoel cavity was flushed with solution which dripped off the abdomen. The sporozoite solution was collected on a piece of foil and transferred into a plastic reaction tube. Sporozoite concentration of salivary gland and hemolymph sporozoites was subsequently calculated using a hemocytometer. Afterwards sporozoites were diluted with RPMI/PS to achieve a volume of 50 µL per tested condition containing not less than 5000 sporozoites. Depending on the condition 50µL of sporozoite suspension was mixed with either 50µL RPMI containing 6% bovine serum albumin (BSA) or with 50µL peptide solution for activation. Peptides were ordered as solid substrates and solubilized in water to generate stocks with a final concentration of 10mg/mL. Using RPMI/PS the stock solution was diluted to an initial concentration of 2mg/mL to achieve a final dilution of 1mg/mL after addition of sporozoites. Alongside to BSA and peptides, six different coatings were tested for sporozoite motility. Coated wells were loaded with 50 µL sporozoite solution that was mixed with an equal volume of RPMI/PS. As a negative control sporozoites were allowed to glide in an uncoated well in RPMI/PS without any addition of peptides or BSA. To ensure the same conditions for each gliding assay, samples were prepared in 3min intervals. To allow sporozoites to attach to the optical bottom, samples were centrifuged at 800rpm for 3min before imaging. Using fluorescent microscopy (Axiovert 200M; 10x objective with NA 0.25) videos were recorded with three seconds per frame for 3min. Subsequently data were analyzed using ImageJ.</p><table-wrap id="resptable1" position="float"><label>Author response table 1.</label><caption><title>Coating protocols used to test gliding motility of sporozoites on different substrates.</title><p>Gliding assays were performed in 96-well plates and wells were coated with heparin, ICAM-I, laminin, fibronectin and collagen according to the following protocols (Bilsland, Diamond and Springer, 1994; Gao et al., 2011).</p></caption><table frame="hsides" rules="groups"><thead><tr><th>Coating agent</th><th>Concentration</th><th>Protocol</th></tr></thead><tbody><tr><td>Heparin</td><td>100 U/µL</td><td>Heparin (stock: 25000 U/µL) was diluted in Laminin buffer (150 mM NaCl, 50 mM TRIS, pH 7.4) to 100 U/µL. <break/>Coating procedure: Per well 150 µL heparin solution was added and incubated overnight at 4°C. Before the gliding assay was started wells were washed once with PBS.</td></tr><tr><td>ICAM-I</td><td>10 µg/mL</td><td rowspan="2">ICAM-I (stock: 2 mg/mL) was diluted in PBS to 10 or 20 µg/mL. <break/>Coating procedure: Per well 150 µL of the final solution was added and incubated at 4°C overnight. Before the gliding assays were started wells were washed once with PBS.</td></tr><tr><td>ICAM-I</td><td>20 µg/mL</td></tr><tr><td>Laminin</td><td>25 µg/mL</td><td>Laminin (stock: 1 mg/mL) was diluted in Laminin buffer to 25 µg/mL. <break/>Coating procedure: Wells were washed with 70 % EtOH to increase hydrophilicity. Subsequently wells were washed three times with H<sub>2</sub>O to remove remnants of EtOH. Per well 200 µL laminin solution was added and incubated at room temperature for one hour. Before the gliding assay was started wells were washed once with PBS.</td></tr><tr><td>Fibronectin</td><td>50 µg/mL</td><td>Fibronectin (stock: 1 mg/mL) was diluted in Laminin buffer to 50 µg/mL. <break/>Coating procedure: As above.</td></tr><tr><td>Collagen</td><td>2.5 µg/mL</td><td>Collagen (stock: 1 mg/mL) was diluted in 0.2 M acetic acid to 2.5 µg/mL. <break/>Coating procedure: As above.</td></tr></tbody></table></table-wrap><p>In contrast to the intuitive hypothesis that known ligands of the human integrin I-domains should activate sporozoite motility we were not able to measure a significant effect of a specific ligand. aL-I sporozoites and aX-I sporozoites isolated from the hemolymph were either not able to glide productively or showed gliding at very low percentages (1/100-200 sporozoites). Control sporozoites from salivary glands showed about 50% of actively gliding sporozoites in BSA while already about 10% of sporozoites were gliding in the negative control (RPMI medium only). In other conditions sporozoite activation was lower than with BSA but mostly above 10%. We couldn’t observe any significant differences in activation between different compounds other than BSA.</p><p>While these results were disappointing at first they agree with published observation of sporozoite activation (e.g. see Perschmann et al., Nano Letters 2011).</p><disp-quote content-type="editor-comment"><p>3) Establish that the I-domains retain their folding and binding functions in the context of the chimeric trap.</p></disp-quote><p>We agree with the reviewers that this is an important question. Naturally, verification of protein folding in vivo is a difficult task. We already considered the suggestion of reviewer 3 to do immunofluorescence with I-domain specific antibodies during our studies. Indeed there are antibodies targeting integrins available that target the I-domain of human integrin aX and aL available. Yet we feel that a proper positive and negative control would necessitate further parasite lines such as a TRAP-aX line with a targeted mutation that disrupts the conformation or epitope.</p><p>As an alternative to generating more lines that could be less infective as the ones at hand, we performed more infection experiments. These showed that aX can rescue sporozoite infectivity to mice at a rather high level, while aL could not (only one infected mouse). In addition, we performed additional experiments with the RevCharge mutant, which revealed an interesting functionality: the RevCharge mutant infects salivary glands normally, yet it shows a severe impairment in gliding motility and infectivity of mice. This suggests that the folding of the protein must be correct yet, it cannot fully function in the mammalian host. In the aX line we observed invasion of salivary glands at very low rates as well as little (but clearly detectable) ability to actively glide in circles (Video 2). However, injected hemolymph sporozoites caused infections in more than 50% of all treated mice (9/16; Tables 2 and 3). This suggests that the I-domain is partly functional in this mutant. Hence, one domain (RevCharge) allows salivary gland invasion, while both allow some degree of mice infection. All these observations document a restored function of TRAP that could not be observed if the I-domain is not at least partially functional. We performed also western blot experiments with hemolymph sporozoites of all lines that could not enter the salivary gland showing that TRAP is expressed at comparable levels – we found similar results in midgut sporozoites but these experiments suffered from degradations and are thus not shown. These data are now added to Figure 3.</p><p>Taken together, the data now suggest that TRAP is functionally folded in the TRAP-I, MIC-I, TRAP-RevCharge and the aX-I line while we cannot be sure if this is true for the aL line. We therefore changed the wording across the manuscript to point out that folding of the I-domain could have affected the phenotype observed in aL parasites.</p><disp-quote content-type="editor-comment"><p>Reviewer #1:</p><p>In this study, Klug and colleagues report on the role of the integrin I-domain of TRAP, an important adhesin expressed by the sporozoite stage of the malaria parasite. Previous studies have shown that TRAP is required for sporozoite motility and invasion of the salivary gland in the mosquito and of the liver in the mammalian host. A metal ion-dependent adhesion site (MIDAS) within the I-domain of TRAP is known to play a role in sporozoite infectivity, however the functional and adhesive properties of the I-domain remain undefined. More generally, the mechanisms of sporozoite infection are poorly understood at the molecular level, so this study addresses an important topic.</p><p>To investigate the function of TRAP I-domain, the authors generated a number of mutants in P. berghei and performed robust phenotype analysis including gliding motility assays and analysis of sporozoite infectivity in the mosquito (invasion of salivary gland) and in the mouse (invasion of the liver). The work is very well performed and includes a large body of data, combining genetic approaches, in vitro and in vivo experiments. The paper is clearly written and the conclusions drawn from the results generally justified.</p><p>The data convincingly show that:</p><p>a) Sporozoites expressing a truncated TRAP lacking the I-domain are non-motile and do not invade the mosquito salivary glands and the mouse liver.</p><p>b) Replacement of TRAP I-domain with the I-domain from Toxoplasma MIC2 results in normal invasion of salivary glands and normal sporozoite infectivity in mice, although gliding motility is reduced.</p><p>c) Replacement of TRAP I-domain with the I-domain from human aX or aL integrin results in a severe reduction of sporozoite infectivity and gliding motility, although residual infectivity was observed in both mosquito and mouse.</p><p>d) Introduction of 7 point mutations in the I-domain of TRAP, to replace positively charged residues (H/K/R) by negatively charged residues (E/D), results in normal invasion of mosquito salivary glands yet reduced motility and slightly reduced infectivity in the mouse.</p><p>Based on the presented data, the authors conclude that the adhesive properties of the I-domain of TRAP can be partially fulfilled by the I-domain from other organisms, and that the cationic charge and the polyspecificity of the I-domain regulates sporozoite infectivity. However, the main limitation of the study is that adhesion and ligand binding were not directly assessed, so the aforementioned conclusions are based on indirect evidence or speculation. It is important to experimentally address the adhesive properties of the chimeric TRAP proteins expressed in the mutant parasites.</p><p>Major points</p><p>1) The authors conclude that the observed phenotypic defects are due to altered ligand binding properties of mutated TRAP proteins. However this was not addressed experimentally. Other modifications in the mutants, such as an alteration of the conformation of TRAP, could also contribute to the observed phenotype, unrelated with TRAP-I adhesive properties. In the absence of direct experimental evidence, it seems too speculative to conclude that the polyspecificity of the I-domain regulates sporozoite infectivity. The data clearly shows that MIC2-I almost completely complement TRAP-I functions, whilst aX-I and aL-I are poorly functional in this context. TRAP-I is basic (like aX-I), but MIC2-I is acidic (like aL-I). The data therefore show no correlation between infectivity and charges, and thus do not support an important role of the I-domain charges. Other factors may explain why MIC2-I is functionally superior to the I-domain from humain integrins, including the size of the domain size (MIC2 is closest to TRAP: 194 aa for PbTRAP-I; 189 aa for MIC2-I; 184 aa for aX-I; 177 aa for aL-I). The authors cannot exclude that a smaller I-domain may affect the conformation of TRAP protein, including other parts of the proteins such as the β ribbon. Surprisingly, the data also show no direct correlation between gliding motility and infectivity, since MIC2 and RevCharge mutants show severely reduced motility yet invade almost normally the mosquito and the mouse. This questions the relevance of the gliding assay. How do sporozoites with reduced gliding motility invade mosquito salivary glands and mouse cells?</p></disp-quote><p>We agree with the reviewer that there is no clear correlation between the overall surface charge of the I-domains in general. However, the correlation between phenotype and charge becomes more significant in the RevCharge mutant where the charges in the perimeter of the MIDAS motif are altered in an otherwise unchanged TRAP. To avoid that the reader is misled we changed the wording along the manuscript to highlight this difference more clearly.</p><p>The RevCharge mutant allowed some striking observations. This mutant shows a strong phenotype in gliding motility in vitro and an uncoupling of salivary gland and mouse infection. The RevCharge sporozoites enter normally into salivary glands but are much less infectious to mice. This highlights that the charge around the MIDAS must be important in the skin and/or liver and less so for salivary gland invasion. However, we refrain from overinterpreting this data towards explaining the results obtained with the other I-domain swaps.</p><p>The value (and problem) of the gliding assay on glass is often misunderstood. The striking phenomenon that sporozoites cannot glide in vitro but invade just fine in vivo has most likely to do with the two-dimensionality of the gliding assay as we also discussed in Bane et al., 2016, where the coronin(-) mutant showed a similar phenotype: highly compromised gliding but no difference in skin migration. Also <italic>P. falciparum</italic> sporozoites do not glide in this standard assay used for rodent-infecting <italic>Plasmodium</italic> sporozoites, while their motility in the skin (ie in 3D) is very similar (see recent BioRxiv paper by Photini Sinnis, doi: https://doi.org/10.1101/716878). This, however doesn’t diminish the use of the gliding assay. On the contrary, this simple and highly quantitative assay allows to detect minor but nevertheless interesting phenotypes that will help us to understand how the proteins of the parasite act together to ensure efficient gliding (see e.g. our discussion in Moreau et al., PLoS Pathogens 2017). Please think of the migration assays used for mammalian cells, most of which are similarly simple. They are used to dissect the molecular mechanisms governing cell migration. Often effects of a single gene deletion/mutation can lead to a better understanding of the mechanics while they have little consequence when observed in vivo.</p><disp-quote content-type="editor-comment"><p>Maybe a simple way to address these issues would be to perform gliding assays not merely on glass slides, as performed here, but on specific substrates, including known ligands of MIC2, aX or aL integrins. This would strengthen the conclusion that the effects of the I-domain modifications are really due to changes in the adhesional properties of the chimeric proteins. For example, do sporozoites expressing the aL-I domain recover gliding motility on ICAM1?</p></disp-quote><p>Completely agreed: Please do see our answer to point 2 above. We are currently working on establishing assays that use substrates of different stiffness in both 2D and 3D.</p><disp-quote content-type="editor-comment"><p>2) The phenotype of the RevCharge mutant should be more thoroughly investigated to better document a defect in sporozoite infectivity for the liver. Figure 6F shows a partial reduction of parasite fitness in the mouse, which could be quantified more precisely. In vitro assays in HepG2 cultures, as performed with the MIC2 mutant, should be included. This is important to strengthen or invalidate the hypothesis that charges in the I-domain play an important role in sporozoite infectivity.</p></disp-quote><p>We performed an invasion assay as well as a liver stage assay of the RevCharge mutant compared to the control line TRAP-I. The invasion capacity of the RevCharge mutant is severely impaired while liver stage development seems to be unaffected similar to the results obtained for the MIC2-I mutant. The new data are presented in Figure 6—figure supplement 1 (associated with Figure 6 of the manuscript). We also added more in vivo infection experiments with the RevCharge mutant, which are reported in Tables 2 and 3.</p><disp-quote content-type="editor-comment"><p>3) The authors checked by immunofluorescence that TRAP is expressed in the mutant sporozoites. However, they should also provide evidence that the level of expression of TRAP is unaffected in the mutants, ideally using Western Blot as shown for the RevCharge mutant. This is particularly important as sequences codon-optimized for <italic>E. coli</italic> were used, which may differentially affect the level of expression of the proteins. Why using <italic>E. coli</italic> optimized sequences?</p></disp-quote><p>We included now a western blot of hemolymph derived sporozoites from all chimeras that do not enter salivary glands in sufficient amounts in Figure 3C. We also include a Western blot comparing WT with MIC2 from salivary gland sporozoites (Figure 3E). This shows that TRAP expression is similar to the control (TRAP-I). Please note that we could not detect any phenotypic difference between parasite lines expressing the codon-optimized TRAP (TRAP-I) and wild type sporozoites (compare Figure 2B with Figure 3F and G as well as Figure 2C with 4A and Tables 1 and 2). We mentioned this now at several occasions in the manuscript.</p><p>At the time the study was designed only the codon usage of <italic>P. falciparum</italic> was published but not yet implemented in common online tools for codon usage modification. Therefore one possibility would have been to modify the introduced sequences from <italic>Homo sapiens</italic> and <italic>Toxoplasma</italic> manually according to the codon usage of <italic>P. falciparum</italic> leaving the remaining part of the open reading frame unchanged. We decided not to do so because we were unsure how similar the codon usage of <italic>P. falciparum</italic> and <italic>P. berghei</italic> really is. To avoid a change in codon usage from one species to another within a single ORF we codon optimized all chimeric sequences for <italic>E. coli</italic> K12 that we used to optimize genes in previous studies (Moreau et al., PLoS Pathogens 2017, Douglas et al., PLoS Biology 2018) observing no effect on protein expression. However, for some other genes, we noted that codon modification can have dramatic effects on expression levels (e.g. Spreng et al., EMBO J 2019). Hence the western blots are indeed essential.</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>The manuscript by Klug et al. investigates the biochemical and functional properties of I-domains by genetically replacing the I-domain within an important malaria parasite ligand called TRAP with I domains taken from another parasite (T. gondii) ligand, and two from human integrins. Plasmodium parasites lacking either the entire TRAP locus or just the I-domain of TRAP do not move, or invade the vector salivary glands. The authors find that the exogenous I domains from different sources can, to varying degrees, complement TRAP function resulting in the partial rescue of some motility, and ability to invade. The authors notice that the surface charges of TRAP in the rodent parasite P. berghei are cationic and to determine if this is important for function, mutate these residues to acidic amino acids and show again that the functions of TRAP are impaired.</p><p>The manuscript is very nicely put together with high quality data, well-prepared figures, and the writing is clear. Overall, I found this a rather strange study where the authors have used the phenotyping available in the Plasmodium berghei rodent infection model to investigate general properties of I domains from different proteins and organisms.</p></disp-quote><p>Thank you for this summary of our manuscript. We are glad that the reviewer recognizes our study as unique. The rationale of the experiments was to study the function of I-domains of <italic>Plasmodium</italic> in order to discover specific functionality during the complex migrations of the sporozoite with the hope that this could help in defining receptor ligand interactions. We hence made use of those domains found in the distantly related apicomplexan parasite <italic>T. gondii</italic> and the very distant human integrins. Of course studying human integrin domains could be done more easily in mammalian cell culture.</p><disp-quote content-type="editor-comment"><p>Major points</p><p>The authors take several precautions to try to ensure the I-domains retain their function when transplanted in the Plasmodium TRAP sequence by taking structural considerations into account and showing that the proteins are detectable using anti-TRAP antibodies in the transgenic parasites. A key point in my mind is whether the human integrin I-domains really do complement the function of the I-domain in TRAP. In the manuscript, the authors show that the I-domain mutant is a null (Figure 2B) and that the human integrin I -domain replacement parasites are very strong hypomorphs (Figures 3F, 4A); however, there does not appear to be a direct side-by-side comparison – e.g. injecting 25,000 HL sporozoites of the TRAP I-domain deletion alongside the integrin replacements in Figure 3—figure supplement 3B, for example. Also, are the authors able to demonstrate that the inserted I-domains retain their functions from their original proteins – is there a known ligand for the inserted integrin I-domains?</p></disp-quote><p>We have now added these experiments as described above in our response to the editor.</p><disp-quote content-type="editor-comment"><p>For the revCharge mutant, the authors imply that the loss of motility and ability to infect mice is due to the alteration in I-domain ligand binding, but could not an alternative explanation be that a proportion of the protein no longer folds correctly or that interactions with other parasite proteins necessary for full function are altered? The authors suggest the role of the I-domain is to interact with the host substrate, but these are not defined in the manuscript making it conceptually a rather large leap to link the mutations made in the protein to the phenotypes seen in the parasite.</p></disp-quote><p>We also addressed this question in the response to the editor.</p><disp-quote content-type="editor-comment"><p>Reviewer #3:</p><p>In this study the authors swap integrin &quot;I&quot; domains from MIC2 and mammalian integrins with the I-domain of TRAP, the key motility adhesin of malaria sporozoites. Though the domain structure of the extracellular portion of TRAP has long been known to include an integrin-like I-domain, previous mutational studies of this domain were not that informative and the idea to perform domain-swapping experiments between Plasmodium, Toxoplasma and mammalian integrin I-domains is creative and potentially informative. Overall, the MIC2 swapped TRAP and the charge-altered TRAP are the most informative data while the conclusions drawn from the a-L and a-X swapped mutants are not justified by the data shown.</p></disp-quote><p>We thank the reviewer for the constructive critique and hope that he/she agrees that the newly added data in Figure 6 and Table 3 improved the conclusions for both RevCharge and human integrin domains.</p><disp-quote content-type="editor-comment"><p>1) The human integrin I-domain swapped mutants essentially behave like the TRAP KO. There is an elegant explanation in the Discussion as to why the a-L and a-X domains may not open and close in the same way as the I-domains of TRAP and MIC2. However, in the face of no data to support this or another hypothesis, it is equally plausible that there is some significant misfolding on the TRAP with a mammalian I domain. It would be important to show that this is not the case. Since there are commercially available antibodies to human integrins, can they be used, especially ones specific for conformational epitopes, to confirm the overall folding of the a-L and a-X domains.</p></disp-quote><p>As described above in our response to reviewer 1, we have added additional infection experiments to Table 2 and the newly added Table 3 that support the folding and functionality of the integrin αX I domain. We did not use the specific antibodies as we feel that for proper controls we would have to generate new parasite lines with mutations in the respective epitopes. We also have preliminary data that conformationally trapped TRAP I-domains influence in vivo and in vitro motility and infectivity to similar degrees as those observed for aX I-domains. However, much more work needs to be done before these experiments will be conclusive and could be published and it would hence go beyond the scope of this manuscript to include those data.</p><disp-quote content-type="editor-comment"><p>2) The data shown for the a-L and a-X mutants do not support the conclusions. These mutants have less than 200 sporozoites in their salivary glands, the a-L mutant is not motile and not infectious while the a-X mutant is minimally motile and very poorly infectious after IV inoculation. These data look like the TRAP KO (Sultan et al., 1997), where they observed 100 to 200 sporozoites in the salivary glands and had a few infected mice when sporozoites were inoculated IV. Given this, how can they state: &quot;Parasites expressing TRAP with I-domains from other organisms including humans can have nearly intact motility and invasion.” Or &quot;…I-domain of TRAP is required to mediate adhesional properties which can be partially preserved when the native I-domain is replaced by I-domains from human integrins…&quot;. These statements are in the Introduction and Abstract but additionally, a central theme of the Discussion is that the a-L and a-X mutants are sufficiently intact to draw meaningful conclusions.</p></disp-quote><p>Thanks for this remark, which partly reflects a long discussion we had while putting together the manuscript. Based on the new in vivo results (Tables 2 and 3) we agree with the reviewer that the aL-I domain is most likely nonfunctional and changed the wording across the manuscript accordingly; please also see our comments above.</p><p>There are some differences between our study and Sultan et al., 1997 that could explain different results obtained for infectivity and numbers of sporozoites observed in the salivary glands. One explanation is the wild type ANKA background used in our study compared to the NK65 strain used by Sultan et al. Strain-specific differences have been often observed in malaria research and might also explain these subtle differences in salivary gland invasion and in vivo infectivity in absence of TRAP between different strains. Another explanation might be the different levels of infection from one insectary to another. Indeed, while we repeated the infections we obtained higher infection levels and in some of these infections some sporozoites could be seen in the salivary glands (still not as high as in Sultan et al. though). The data is included in Table 2 and we modified our text accordingly.</p><p>These lower numbers might also arise from the different design of the TRAP knockout lines. Sultan et al. generated a first knockout by single crossover integration into the coding sequence of TRAP. This design can cause the looping out of the selection marker thus restoring wild type parasites. As a consequence the authors might have observed low levels of salivary gland sporozoites (about 300-400 per infected mosquito). Indeed these sporozoites were able to infect mice and were shown by Southern blotting to be wild type parasites, i.e. they did indeed loop out the integrated sequence. To overcome this problem Sultan et al. created two additional knockout lines by double crossover integration to prevent unwanted recombination events. Unfortunately the homology arms that were chosen to initiate recombination are placed inside the open reading frame leaving the coding sequence for the N- and C-terminus of TRAP intact potentially leading to some activity that could explain why numbers for salivary gland sporozoites increased in both lines about 2-fold (about 700 salivary gland sporozoites per infected mosquito) compared to the single crossover knockout and why sporozoites are still infective if injected in high numbers. Alternatively, this difference is due to the variability of infection as we noticed. The important fact is that the lines show at least 90% reduction in salivary gland infection.</p><p>In contrast to this approach the design for the TRAP knockout in our study excludes most of the coding sequence including the start codon to prevent any residual transcriptional activity. We couldn’t observe any productive motility and any infectivity of this line independent if 500k midgut sporozoites or 25k hemolymph sporozoites were injected.</p><disp-quote content-type="editor-comment"><p>3) TRAP expression in mutant lines is verified by immunofluorescence that is not quantified. Since decreased levels of mutant TRAP could have phenotypes due to the mutation or to expression level, its critical to have western blot verification of mutant TRAP expression compared to WT TRAP expression, in all lines analyzed.</p></disp-quote><p>To exclude that differences in protein expression between the different lines are affecting the phenotype we performed western blotting on hemolymph sporozoites of those lines that did not enter the salivary glands. This showed similar TRAP expression in all mutants. The new western blot results were implemented in Figure 3.</p><p>[Editors’ note: what follows is the authors’ response to the second round of review.]</p><disp-quote content-type="editor-comment"><p>Revisions for this paper:</p><p>One major reservations of the previous iteration of this study was that the conclusions drawn from the parasites in which the TRAP I-domain was replaced by the human a-L and a-X integrin domains were not justified by the data shown and this has not been corrected in the revised manuscript. Indeed, salivary gland sporozoite numbers of the a-L and a-X mutants are in the same range as the TRAPΔI and TRAP KO parasites, with only the prevalence of infection somewhat increased in the a-X parasites. Infectivity studies demonstrate that the a-L parasites are similar to the TRAPΔI and TRAP KO parasites. With numerous careful experiments they that show the a-X parasites are more infectious than the a-L, TRAPΔI and TRAP KO parasites, and this interesting finding suggests that the charge on a-X may enable the mutant TRAP to have some minimal activity. However, their data show that the a-X sporozoites are about 100-fold decreased in their infectivity compared to controls. It has been previously demonstrated that a one day delay in patency is equivalent to a 10-fold decrease in infection. When 10,000 hemolymph sporozoites are inoculated IV, 100% of control mice are infected with a prepatent period of 4 days. With the a-X parasites only 50% of mice are infected and the prepatent period is 6 days. Thus, even if one ignores the fact that half the mice were not infected, the ones that did get infected had a 100-fold lower functional inoculum.</p><p>Characterization of this significant attenuation of infectivity of the a-X parasites in mosquito and mammalian hosts as &quot;partial restoration&quot; of TRAP function is misleading. Indeed given the phenotype they describe, it is clear that the a-X parasites cannot be naturally transmitted for a single life cycle. Thus, the paper should focus on the interesting phenotypes of the MIC2 and reverse charge sporozoites, and only compare the a-X parasites to the a-L and TRAP KO parasites where there is a small marginal increase in infectivity supporting the importance of charge in the TRAP I-domain.</p></disp-quote><p>We now reworded all remaining overstatements accordingly and also corrected one sentence that still overstated the rescue effect of aX.</p><disp-quote content-type="editor-comment"><p>The following statements in the paper should be deleted, or changed to only include the MIC-2 mutant.</p><p>Title:</p><p>The current title implies that human I domains confer some functionality to TRAP which, given that these mutants have salivary gland sporozoite counts in the range of the TRAP KO, and infectivity levels that are 100-fold decreased, is misleading.</p></disp-quote><p>We changed the title omitting the mention of human I domains and introducing the word “can” to show that not all I domains rescue, which now reads: Evolutionarily distant I domains can functionally replace the essential ligand-binding domain of Plasmodium TRAP. We also changed the Abstract to make sure that this is reflected. Please see that manuscript file with tracked changes.</p><disp-quote content-type="editor-comment"><p>Abstract:</p><p>&quot;…its replacement with I domains from Toxoplasma MIC2 or the human integrin αX-subunit substantially or partially restores these functions&quot;.</p></disp-quote><p>We completely rewrote the Abstract to put more emphasis. Doing so we removed “or the human integrin aX-subunit“.</p><disp-quote content-type="editor-comment"><p>&quot;Results with TRAP, MIC2 and aX-I domains show remarkable interchangeability in their ability to engage with ligands in divergent tissues in arthropoa and chordata&quot;.</p></disp-quote><p>This sentence only appeared in the initial submission and has already been corrected in the revised version. Yet, please note the re-written Abstract, where this statement is not included anymore.</p><disp-quote content-type="editor-comment"><p>&quot;…results suggest that apicomplexan parasites appropriated I domains in part for their ability to recognize structurally diverse ligands&quot;</p></disp-quote><p>We removed “structurally diverse ligands” and modified the sentence/absrtract accordingly.</p><disp-quote content-type="editor-comment"><p>&quot;…permit TRAP to function as an adhesin with diverse ligands in both vertebrate and arthropod hosts&quot;</p><p>The ability to engage with ligands is not addressed here, so wording should be revised. Also, the aX-I domain is poorly functional in TRAP, so &quot;remarkable interchangeability&quot; is not correct in this case.</p></disp-quote><p>We removed “with diverse ligands”. The expression “remarkable interchangeability” is no longer part of the manuscript.</p><disp-quote content-type="editor-comment"><p>Introduction:</p><p>&quot;Parasites expressing TRAP with I domains from other organisms, including humans show partially rescued motility and invasion.&quot;</p></disp-quote><p>We removed “including humans” and modified the sentence accordingly.</p><disp-quote content-type="editor-comment"><p>Results:</p><p>&quot;This could hint that the charge of αX could compensate for the long evolutionary distance between apicomplexa and mammals.&quot;</p></disp-quote><p>This sentence was completely deleted.</p><disp-quote content-type="editor-comment"><p>Discussion:</p><p>&quot;It was therefore remarkable that TRAP function was largely or partially restored by replacement of its I domain by homologues from Toxoplasma gondi and <italic>Homo sapiens</italic> with only 28% and 18% amino acid sequence identity, respectively.&quot;</p></disp-quote><p>We removed “<italic>Homo sapiens</italic>” and rephrased the sentence accordingly.</p><disp-quote content-type="editor-comment"><p>&quot;TRAP function was largely or partially restored by replacement of its I domain&quot;. This is true for Toxoplasma MIC2 domain but not human integrin I domains.</p></disp-quote><p>As before, this sentence was changed accordingly.</p><disp-quote content-type="editor-comment"><p>&quot;…immunofluorescence showed normal localization in sporozoites, suggesting that they were properly folded&quot;.</p><p>The immunofluorescence data provide no information on the folding of TRAP.</p></disp-quote><p>We completely agree with the reviewer and changed “they were properly folded” to “trafficking was not impaired”.</p><disp-quote content-type="editor-comment"><p>&quot;Infectivity of hemolymph αX-I and αL-I sporozoites in mice was decreased at least 4-fold and 15-fold, respectively.&quot; Infectivity in the a-L sporozoites was similar to the TRAP KO, and in the a-X sporozoites was 100-fold decreased compared to controls.</p></disp-quote><p>We rephrased the sentence accordingly.</p><disp-quote content-type="editor-comment"><p>“The findings that I domains from organisms that encounter none of the same ligands as TRAP can replace its function in mediating salivary gland invasion and infection of mice strongly suggest that the I domain functions to provide traction for motility and cell invasion rather than tissue tropism.” This should specify that they are referring to replacement with MIC2.</p></disp-quote><p>We specified this sentence.</p><disp-quote content-type="editor-comment"><p>&quot;…the I domain of TRAP is required for gliding motility and invasion by sporozoites of mosquito salivary glands and mammalian liver, without a requirement for evolved specificity&quot;.</p><p>The data with the human I domains show that any I domain cannot confer function in TRAP, so this statement is not correct.</p></disp-quote><p>We do think that this sentence is still correct considering that the common ancestor of Toxoplasma and Plasmodium is about 800 million year old. We did modify by including a “strong” such that it reads “…without a strong requirement…” to modulate our statement.</p><disp-quote content-type="editor-comment"><p>The authors attempted to analyze the motility of mutant sporozoites on various substrates. They indicate that they &quot;were not able to measure a significant effect of a specific ligand&quot;.</p><p>However, Figure 1 shows that aX-I and aL-I activated on BSA are mostly floating, while on the other substrates sporozoites are mostly attached or display unproductive motility. This could be an indication that the human I-domains retained some adhesive properties. However, it would be useful to have the same type of data with the I domain-deleted mutant, and the threshold, as indicated in A, should also be shown on the other panels.</p></disp-quote><p>Thanks for pointing this out. Indeed the differences in the amount of unproductive gliding sporozoites are interesting and could indicate minimal TRAP activity. We are planning to investigate this in more detail making further use of the TRAP mutant library we created. As explained in our last rebuttal, a proper analysis will require a functional linkage of the ligands to a surface. Therefore, we think that now testing of the I domain deletion mutant alone would be not advance our understanding significantly. Also, this would require a repeat of many experiments as the peptides would have to be reordered.</p><p>We now include the threshold also in the panel showing gliding motility on different substrates with MIC2-I salivary gland sporozoites. We didn’t include a negative control (RPMI only) for gliding assays with hemolymph sporozoites because these sporozoites are difficult to activate even in the presence of the strong activating compound BSA (only about 20% of wild type hemolymph sporozoites perform active movement while 50-70% of wild type salivary gland sporozoites do active gliding). As a consequence a threshold is not indicated for these experiments.</p><p><bold>References</bold></p><p>Bilsland, C. A. G., Diamond, M. S. and Springer, T. A. (1994) ‘The leukocyte lntegrin pl50,95 (CD11 c/CD18) as a Receptor for iC3b’, <italic>Journal of Immunology (Baltimore, Md : 1950)</italic>, 152, pp. 4582–4589.Gao, C. et al. (2011) ‘Heparin promotes platelet responsiveness by potentiating αIIbβ3-mediated outside-in signaling’, <italic>Blood</italic>. doi: 10.1182/blood-2010-09-307751.</p></body></sub-article></article>