<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">57921</article-id><article-id pub-id-type="doi">10.7554/eLife.57921</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Short Report</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Robo functions as an attractive cue for glial migration through SYG-1/Neph</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-184169"><name><surname>Qu</surname><given-names>Zhongwei</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-6994-0530</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-184170"><name><surname>Zhang</surname><given-names>Albert</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-1310-5680</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-32958"><name><surname>Yan</surname><given-names>Dong</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-7542-1251</contrib-id><email>dong.yan@duke.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund3"/><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Molecular Genetics and Microbiology, Duke University Medical Center</institution><addr-line><named-content content-type="city">Durham</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution>Department of Neurobiology, Regeneration Next Initiative, Duke Center for Neurodegeneration and Neurotherapeutics, and Duke Institute for Brain Sciences, Duke University Medical Center</institution><addr-line><named-content content-type="city">Durham</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Shen</surname><given-names>Kang</given-names></name><role>Reviewing Editor</role><aff><institution>Howard Hughes Medical Institute, Stanford University</institution><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Cooper</surname><given-names>Jonathan A</given-names></name><role>Senior Editor</role><aff><institution>Fred Hutchinson Cancer Research Center</institution><country>United States</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>19</day><month>11</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e57921</elocation-id><history><date date-type="received" iso-8601-date="2020-04-15"><day>15</day><month>04</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2020-11-02"><day>02</day><month>11</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Qu et al</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Qu et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-57921-v1.pdf"/><abstract><p>As one of the most-studied receptors, Robo plays functions in many biological processes, and its functions highly depend on Slit, the ligand of Robo. Here we uncover a Slit-independent role of Robo in glial migration and show that neurons can release an extracellular fragment of Robo upon cleavage to attract glia during migration in <italic>Caenorhabditis elegans</italic>. Furthermore, we identified the conserved cell adhesion molecule SYG-1/Neph as a receptor for the cleaved extracellular Robo fragment to mediate glial migration and SYG-1/Neph functions through regulation of the WAVE complex. Our studies reveal a previously unknown Slit-independent function and regulatory mechanism of Robo and show that the cleaved extracellular fragment of Robo can function as a ligand for SYG-1/Neph to guide glial migration. As Robo, the cleaved region of Robo, and SYG-1/Neph are all highly conserved across the animal kingdom, our findings may present a conserved Slit-independent Robo mechanism during brain development.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>Robo</kwd><kwd>glial migration</kwd><kwd>SYG-1</kwd><kwd>cleavage</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>C. elegans</italic></kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000065</institution-id><institution>National Institute of Neurological Disorders and Stroke</institution></institution-wrap></funding-source><award-id>NS094171</award-id><principal-award-recipient><name><surname>Yan</surname><given-names>Dong</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000065</institution-id><institution>National Institute of Neurological Disorders and Stroke</institution></institution-wrap></funding-source><award-id>NS105638</award-id><principal-award-recipient><name><surname>Yan</surname><given-names>Dong</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100006512</institution-id><institution>School of Medicine, Duke University</institution></institution-wrap></funding-source><award-id>The Holland Trice Awards</award-id><principal-award-recipient><name><surname>Yan</surname><given-names>Dong</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>An extracellular cleavage fragment of Robo released from neurons can bind to glia-expressed SYG-1 to guide glia migration.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>The evolutionarily conserved Robo family was first identified in the classic genetic studies of <italic>Drosophila</italic> CNS axonal midline crossing (<xref ref-type="bibr" rid="bib38">Seeger et al., 1993</xref>) and belongs to the immunoglobulin (Ig) superfamily. Besides their functions in axon guidance (<xref ref-type="bibr" rid="bib11">Dickson and Gilestro, 2006</xref>), Robo is also involved in cell migration (<xref ref-type="bibr" rid="bib24">Killeen and Sybingco, 2008</xref>; <xref ref-type="bibr" rid="bib47">Viveiros et al., 2011</xref>; <xref ref-type="bibr" rid="bib20">Hinck, 2004</xref>; <xref ref-type="bibr" rid="bib16">Grieshammer et al., 2004</xref>), organogenesis (<xref ref-type="bibr" rid="bib16">Grieshammer et al., 2004</xref>; <xref ref-type="bibr" rid="bib28">Mommersteeg et al., 2013</xref>), cancer development (<xref ref-type="bibr" rid="bib49">Wang et al., 2008</xref>), and immune cell regulation (<xref ref-type="bibr" rid="bib51">Wu et al., 2001</xref>; <xref ref-type="bibr" rid="bib5">Branchfield et al., 2016</xref>). In these processes Robo functions as the receptor for the guidance cue molecule – Slit. However, mutations of Robo cause abnormalities in <italic>Caenorhabditis elegans</italic> (<xref ref-type="bibr" rid="bib54">Zallen et al., 1998</xref>; <xref ref-type="bibr" rid="bib18">Hao et al., 2001</xref>), zebrafish (<xref ref-type="bibr" rid="bib13">Fricke et al., 2001</xref>), and cultured mammalian neurons (<xref ref-type="bibr" rid="bib21">Hivert et al., 2002</xref>; <xref ref-type="bibr" rid="bib27">Liu et al., 2004</xref>) that have not been observed in Slit mutants, suggesting that there may be evolutionarily conserved Slit-independent aspects of Robo function and regulation.</p><p>Glial cells often need to migrate over long distances from their birthplace to appropriate regions where they form functional units with neurons or perform other roles (<xref ref-type="bibr" rid="bib15">Gilmour et al., 2002</xref>; <xref ref-type="bibr" rid="bib23">Jarjour and Kennedy, 2004</xref>; <xref ref-type="bibr" rid="bib25">Kinrade et al., 2001</xref>; <xref ref-type="bibr" rid="bib26">Klämbt, 2009</xref>). Some guidance molecules including those in the Netrin and Semaphorin families were shown to be involved in glial migration (<xref ref-type="bibr" rid="bib25">Kinrade et al., 2001</xref>; <xref ref-type="bibr" rid="bib22">Jarjour et al., 2003</xref>; <xref ref-type="bibr" rid="bib37">Sasse and Klämbt, 2016</xref>; <xref ref-type="bibr" rid="bib45">Spassky et al., 2002</xref>; <xref ref-type="bibr" rid="bib46">Unni et al., 2012</xref>). In <italic>Drosophila</italic>, CNS-derived glial cells can move along nerves to reach their final position, and during migration the glial expression of ROBO2 receptor is required for preventing glial breakaway from the nerve in a Slit-dependent manner (<xref ref-type="bibr" rid="bib37">Sasse and Klämbt, 2016</xref>).</p><p>Proteolytic modifications play important roles in regulating Ig superfamily proteins. One good example is the Netrin receptor DCC. DCC can be cleaved first at the extracellular region and subsequently at the intracellular domains (<xref ref-type="bibr" rid="bib30">Neuhaus-Follini and Bashaw, 2015</xref>). The DCC intracellular cleavage fragment can then translocate into the nucleus and equip DCC with transcriptional regulatory function (<xref ref-type="bibr" rid="bib30">Neuhaus-Follini and Bashaw, 2015</xref>). Similarly, NCAM and EphrinA5 can go through extracellular cleavage to release adhesive interactions and cause cell detachment (<xref ref-type="bibr" rid="bib6">Brennaman et al., 2014</xref>). <italic>Drosophila</italic> Robo can be cleaved at the FN3 (Fibronectin type-III) repeats of the extracellular region, and the extracellular cleavage fragment can recruit Son of sevenless (Sos) to mediate Slit-dependent midline repulsion (<xref ref-type="bibr" rid="bib10">Coleman et al., 2010</xref>). However, in all these cases the cleaved fragments and the function of the receptors highly rely on their canonical ligands. It is still unknown whether the cleavage of Ig superfamily receptors can function in a fashion that is independent of their canonical ligands.</p><p>There are in total 56 glia in <italic>C. elegans</italic>, which include 50 neuroepithelial glia that ensheath sensory neuron receptive endings (<xref ref-type="bibr" rid="bib31">Oikonomou and Shaham, 2011</xref>; <xref ref-type="bibr" rid="bib41">Shaham, 2015</xref>). The largest sensory organ of the worm, called the amphid sensilla, is a pair of sensilla composed of 12 neurons and two glial cells each (<xref ref-type="bibr" rid="bib50">Ward et al., 1975</xref>). These glia, called the amphid sheath (AMsh) and amphid socket (AMso) cells, form channels that ensheath the dendrites of sensory neurons in the amphid sensilla (<xref ref-type="bibr" rid="bib31">Oikonomou and Shaham, 2011</xref>; <xref ref-type="bibr" rid="bib50">Ward et al., 1975</xref>; <xref ref-type="bibr" rid="bib35">Perkins et al., 1986</xref>). Furthermore, these glial cells are vital for the proper functioning of the neurons that they ensheath, where they can modulate neural activity through secreted molecules at the receptive endings and control neuron receptive ending shape (<xref ref-type="bibr" rid="bib2">Bacaj et al., 2008</xref>; <xref ref-type="bibr" rid="bib40">Shaham, 2010</xref>; <xref ref-type="bibr" rid="bib44">Singhvi et al., 2016</xref>). In previous studies we show that the fate determination of <italic>C. elegans</italic> AMsh glial cells utilizes similar mechanisms as those in mammals (<xref ref-type="bibr" rid="bib56">Zhang et al., 2020a</xref>). AMsh glia are born close to the nose of <italic>C. elegans</italic>, where their processes anchor to the nose region while the cell bodies migrate toward the nerve ring (<xref ref-type="bibr" rid="bib41">Shaham, 2015</xref>; <xref ref-type="bibr" rid="bib19">Heiman and Shaham, 2009</xref>), and the position of AMsh glia is important for their function (<xref ref-type="bibr" rid="bib57">Zhang et al., 2020b</xref>). With all these advantages, AMsh glia have emerged as a powerful model to study the potential conserved mechanisms underlying glial development and function.</p><sec id="s1-1"><title>SAX-3/Robo regulates glial migration in a Slit-independent manner</title><p>In an unbiased genetic screen for glial migration, we isolated two loss-of-function alleles of <italic>sax-3</italic>, the only Robo receptor in <italic>C. elegans</italic> (<xref ref-type="bibr" rid="bib54">Zallen et al., 1998</xref>), with defects in AMsh glial migration. To quantify the migration of AMsh, we used the pharyngeal terminal bulb as a reference point and found that AMsh cell bodies reside at the side of and align with the center of pharyngeal terminal bulbs in day 1 (D1) young adults (<xref ref-type="fig" rid="fig1">Figure 1a and b</xref>). AMsh glia fail to migrate to their final positions in both <italic>sax-3(lf)</italic> alleles, and <italic>yad10</italic> animals display stronger phenotypes than <italic>yad147</italic> animals and show a similar extent of defects as those in the null allele of <italic>sax-3 (ky123)</italic> (<xref ref-type="bibr" rid="bib54">Zallen et al., 1998</xref>), suggesting that <italic>yad10</italic> is likely a null allele of <italic>sax-3</italic> (<xref ref-type="fig" rid="fig1">Figure 1a and b</xref> and <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1a and c</xref>). To further characterize the <italic>sax-3(lf)</italic> phenotype we examined AMsh migration at different developmental stages in a single animal and found that <italic>sax-3(lf</italic>) animals exhibited migration defects in all post-embryonic stages, suggesting that <italic>sax-3</italic> is required for AMsh migration during development (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1b</xref>).</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title><italic>sax-3/</italic>Robo regulates AMsh glial migration in a Slit-independent fashion.</title><p>(<bold>a</bold>) Loss-of-function in <italic>sax-3</italic> causes defects in AMsh glial migration. Confocal images and schematic representation of AMsh glia in control and <italic>sax-3(yad10)</italic> animals expressing <italic>Pf53f4.13::GFP</italic> (<italic>yadIs48</italic>). TB: pharyngeal terminal bulb. Scale bar, 10 µm. (<bold>b</bold>) Quantification of <underline>M</underline>igration <underline>I</underline>ndex (MI) in control and three alleles of <italic>sax-3(lf)</italic> animals. MI is calculated as (b–a)/a × 100%. As illustrated in the (<bold>a</bold>), ‘a’ represents the distance between the tip of nose and the center of the pharyngeal terminal bulb. ‘b’ shows the distance between the tip of nose and the center of the AMsh cell bodies. (<bold>c</bold>) The function of <italic>sax-3</italic> does not rely on <italic>slt-1</italic>. White and gray bars show the percentage of animals with defects in one AMsh or both AMsh glia respectively. ‘<italic>no vab</italic>’: animals with normal head morphology. (<bold>d</bold>) Expression of a secreted SAX-3 extracellular fragment in neurons rescue AMsh defects in <italic>sax-3(lf)</italic> animals. Data shows the percentage of animals with AMsh migration defects. <italic>Punc-33(Pneuron)</italic>, <italic>Pf53f4.13</italic>(PAMsh), and <italic>Pf16f9.3</italic>(PAMsh(2)) are used as pan-neuronal and AMsh-specific promoters to express genes in neurons or AMsh glia. In (<bold>b</bold>), data are represented as mean ± SEM. One-way ANOVA test. **, p&lt;0.01; Each point represents at least 30 worms. In (<bold>c) and (d</bold>), data are represented as mean ± SEM. Two-way ANOVA test. **, p&lt;0.01; ns, no significant difference. Each point represents three experiments of at least 50 worms each.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57921-fig1-v1.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Loss-of-function of <italic>sax-3/</italic>Robo causes AMsh migration defects.</title><p>(<bold>a</bold>) Diagram shows the mutations in four different <italic>sax-3</italic> alleles examined in this study. (<bold>b</bold>) Data showing the distance between the nose tip and the center of AMsh cell bodies at different developmental stages of individual animals. Five animals were quantified for each genotype, and each animal is represented by a single line. (<bold>c</bold>) Gel pictures (top) and quantification of RT-PCR results show that both <italic>yad10</italic> and <italic>yad147</italic> mutations decrease the expression of <italic>sax-3</italic> mRNA. <italic>act-1</italic>/actin was used as a control. Student’s t-test, *p&lt;0.05. (<bold>d–e</bold>) AMsh migration defects in <italic>sax-3</italic> mutants did not originate from a displaced nerve ring. Confocal images (<bold>d</bold>) and quantification data (<bold>e</bold>), % of animals with AMsh glia locating at the anterior of the nerve ring, show that AMsh glia are at the anterior of the displaced nerve ring. (<bold>g</bold>) Confocal images show that both PAMsh (<italic>Pf53f4.13</italic>) and PAMsh(2) (<italic>Pf16f9.3</italic>) are expressed in the AMsh glia at the 1.5-fold stage. H2B::GFP was expressed under these promoters. (<bold>f</bold>) Quantification shows the percentage of animals with ‘vab head’ defects. <italic>Punc-33</italic> promoter is used as the pan-neuronal promoter. (<bold>h</bold>) Diagrams show all constructs used in this study. In (<bold>e</bold>) and (<bold>f</bold>), data are represented as mean ± SEM. Two-way ANOVA test. **, p&lt;0.01; ns, no significant difference. Each point represents three experiments of at least 50 worms. Scale bar, 10 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57921-fig1-figsupp1-v1.tif"/></fig></fig-group><p>Next, we examined the function of the canonical Robo ligand, Slit, in AMsh migration and found that loss-of-function of <italic>slt-1(ok255,</italic> null allele), the only Slit in <italic>C. elegans</italic>, did not cause any defects, suggesting that Robo functions in a Slit-independent manner to regulate AMsh migration (<xref ref-type="fig" rid="fig1">Figure 1c</xref>). As <italic>sax-3</italic> is involved in the regulation of nerve ring position (<xref ref-type="bibr" rid="bib54">Zallen et al., 1998</xref>; <xref ref-type="bibr" rid="bib36">Sasakura et al., 2005</xref>), it could be argued that the AMsh migration defect could originate from the anteriorly positioned nerve ring in <italic>sax-3(lf)</italic> mutants. To exclude this possibility, we examined the relative position of AMsh glial cells and the nerve ring. Results show that AMsh cell bodies reside posterior to the nerve ring in control animals but are misplaced anterior to the nerve ring in <italic>sax-3(lf)</italic> animals (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1d and e</xref>), suggesting that the AMsh migration defect is not a side phenotype coming from a displaced nerve ring. As about 40% of <italic>sax-3(lf)</italic> animals display defects in head morphogenesis, called ‘<italic>vab head’</italic> (<xref ref-type="bibr" rid="bib14">Ghenea et al., 2005</xref>), it is also possible that AMsh defects could be a result of abnormal head morphology. To rule out this possibility, we examined <italic>sax-3(lf)</italic> animals without ‘<italic>vab head’</italic> phenotypes and found that they displayed the same degree of AMsh defects as in all <italic>sax-3(lf)</italic> animals, supporting the conclusion that the AMsh migration defects in <italic>sax-3(lf)</italic> animals are independent of the ‘<italic>vab head’</italic> phenotypes (<xref ref-type="fig" rid="fig1">Figure 1c</xref>).</p></sec><sec id="s1-2"><title>The extracellular cleavage fragment of SAX-3/Robo functions as an attractive cue for glial migration</title><p>To understand how <italic>sax-3</italic> regulates AMsh migration, we carried out tissue-specific rescue experiments. Unexpectedly, as a well-studied receptor, <italic>sax-3</italic> does not function cell-autonomously in AMsh migration, and instead expression of <italic>sax-3</italic> cDNA in neurons fully rescues <italic>sax-3(lf)</italic> AMsh phenotypes (<xref ref-type="fig" rid="fig1">Figure 1d</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1g</xref>). It is even more striking that expression of truncated forms of SAX-3 lacking the intracellular domains (ΔC) or both intracellular and transmembrane domains (Δ[C+TM]) fully rescues <italic>sax-3</italic> AMsh defects (<xref ref-type="fig" rid="fig1">Figure 1d</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1h</xref>), while these transgenes did not affect the <italic>sax-3(lf)</italic> ‘<italic>vab head’</italic> phenotypes (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1f and h</xref>). A possible explanation for these observations is that a secreted extracellular fragment of SAX-3 may function as an attractive cue released by neurons to guide AMsh migration. To reach this possibility, either <italic>sax-3</italic> should have an alternative splicing form that only contains its extracellular region or SAX-3 protein should be cleaved in the extracellular region. The <italic>C. elegans</italic> genome has been well annotated and studied (<xref ref-type="bibr" rid="bib17">Gupta and Sternberg, 2003</xref>), and <italic>sax-3</italic> does not have any known splicing forms containing only the extracellular region. Interestingly, <italic>Drosophila</italic> and human Robo have been shown to be cleaved at the FN3 repeats of the extracellular region (<xref ref-type="bibr" rid="bib10">Coleman et al., 2010</xref>; <xref ref-type="bibr" rid="bib39">Seki et al., 2010</xref>). As FN3 repeats are highly conserved between <italic>C. elegans</italic> SAX-3 and <italic>Drosophila</italic> Robo, we decided to test whether SAX-3 could also be cleaved in the extracellular region. We first generated transgenes expressing SAX-3::HA in the nervous system and collected animals at different developmental stages. As shown in <xref ref-type="fig" rid="fig2">Figure 2a</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1a</xref>, we were able to detect a cleavage fragment around 70 kDa in different transgene lines and using different anti-HA antibodies. As the HA tag is fused to the C-terminus of SAX-3, based on the molecular weight (about 70 kDa) the cleavage site is likely to be in the FN3 repeats, which is consistent with what was found in <italic>Drosophila</italic> Robo (<xref ref-type="bibr" rid="bib10">Coleman et al., 2010</xref>). More importantly, the extracellular cleavage happens from the embryonic 1.5-fold stage to early larval stages, when AMsh glia migrate from their birthplace to the nerve ring region (<xref ref-type="fig" rid="fig2">Figure 2a</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1a</xref>). As the function of <italic>sax-3</italic> in AMsh migration is independent of Slit, we asked whether the cleavage of SAX-3 relied on Slit and found that the cleavage of SAX-3 was not regulated by Slit (<xref ref-type="fig" rid="fig2">Figure 2b</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1b</xref>). To further confirm that the cleavage site is in the FN3 repeats, we generated transgenes expressing a mini SAX-3 extracellular region that only contains the FN3 repeats, transmembrane domain, and a GFP inserted between the signal peptide and the first FN3 repeat (GFP-FN3-TM) and examined the cleavage products of this fragment. We found that FN3 repeats were sufficient for the cleavage (<xref ref-type="fig" rid="fig2">Figure 2c</xref>), and based on the molecular weights of free GFP (27 kDa), GFP-FN3-TM (~80 kDa), and the cleavage product (~45 kDa) we concluded that the cleavage site was in the second repeat of FN3. We then generated transgenes expressing the GFP-FN3-TM fragment lacking one of the three FN3 repeats. As deletion of the first FN3 repeat (FN3-a) caused failure of expression, we were only able to examine the effect of removing the second (FN3-b) or the third FN3 (FN3-c) repeat. We found that the cleavage was abolished if the second FN3 repeat was absent, while deletion of the third FN3 repeat did not affect the cleavage (<xref ref-type="fig" rid="fig2">Figure 2d</xref>). Consistent with its important role in SAX-3 cleavage, extracellular cleavage was undetectable in transgenes expressing a truncated form of SAX-3 without the second FN3 repeat (<xref ref-type="fig" rid="fig2">Figure 2e</xref>). These data support the conclusion that the cleavage site of SAX-3 is in the second repeat of FN3. To test whether the extracellular cleavage of SAX-3 is essential for its function in AMsh migration, we examined the rescue ability of the truncated form of SAX-3 that lacks the second FN3 repeat and found that this mutant form of SAX-3 completely lost rescue ability (<xref ref-type="fig" rid="fig2">Figure 2f</xref>, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1c</xref>). The extracellular cleavage of SAX-3 appears to show certain specificity for AMsh migration, as the same transgene (SAX-3 ΔFN3-b) fully rescued <italic>sax-3(lf) ‘vab head’</italic> phenotypes (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1f</xref>, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1c</xref>). To further confirm the role of extracellular SAX-3 cleavage in AMsh migration, we generated a <italic>sax-3(yad175)</italic> deletion allele that lacks the second repeat of FN3 (FN3-b). <italic>sax-3(yad175)</italic> decreases <italic>sax-3</italic> mRNA to about 50% of that in control animals (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1d</xref>) and appears to be a weak loss-of-function allele of <italic>sax-3,</italic> as both <italic>sax-3(ky123,</italic> presumptive null allele) and <italic>sax-3(yad10)</italic> show higher penetrance of <italic>vab</italic> head and AVM guidance defects (<xref ref-type="bibr" rid="bib55">Zallen et al., 1999</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1f</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1e</xref>). Despite being a weak allele, <italic>sax-3(yad175)</italic> exhibits stronger AMsh migration defects when compared with any other <italic>sax-3</italic> alleles examined, supporting the critical role of SAX-3 extracellular cleavage in AMsh migration (<xref ref-type="fig" rid="fig2">Figure 2f</xref>). To illustrate the function of the extracellular cleavage fragment, we expressed a secreted SAX-3 extracellular fragment containing Ig 1–5 domains and the first FN3 repeat (FN3-a) under pan-neuronal (<italic>Punc-33</italic> and <italic>Prgef-1</italic>) or amphid neuron-specific (<italic>Parl-13</italic>) promoters, which mimics the cleavage product, and found that this fragment was able to fully rescue <italic>sax-3(lf)</italic> AMsh defects (<xref ref-type="fig" rid="fig2">Figure 2f</xref>, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1f</xref>). Further experiments show that both Ig domains and the first FN3 repeat (FN3-a) may be important for the function of the SAX-3 extracellular cleavage fragment in AMsh migration (<xref ref-type="fig" rid="fig2">Figure 2f</xref>).</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>The extracellular cleavage of SAX-3 is required for AMsh glial migration.</title><p>(<bold>a</bold>) SAX-3 is cleaved in the extracellular region during development. A schematic diagram at the top panel shows that the HA tag was fused at the C-terminal of SAX-3, and the leftover of the extracellular cleavage detected by the HA antibody is about 70 kDa. Results from western blot show a cleavage fragment of SAX-3 in later embryonic and early larval stages. F: full length SAX-3::HA; C: the C-terminal fragment generated by SAX-3 extracellular cleavage. (<bold>b</bold>) Loss-of-function of <italic>slt-1</italic>/Slit does not affect the cleavage of SAX-3. F: full length SAX-3::HA; C: SAX-3 cleavage fragment. (<bold>c</bold>) The FN3 repeats mediate SAX-3 cleavage. FN3: FN3 repeats; TM: transmembrane domain; F: full length; C: cleavage fragment; G: free GFP. (<bold>d</bold>) FN3-b (the second repeat of FN3 repeats) is required for the cleavage. F: full length; C: cleavage fragment. (<bold>e</bold>) Deletion of FN3-b prevents SAX-3 cleavage. Images show results from two independent transgenic lines with FN3-b deletion (ΔFN3-b). Although having slightly different expression patterns, they both lose the extracellular cleavage fragment of SAX-3. (<bold>f</bold>) Expression of a fragment mimicking the SAX-3 extracellular fragment fully rescues AMsh defects in <italic>sax-3(lf)</italic> animals. Data are represented as mean ± SEM. Two-way ANOVA test. **, p&lt;0.01; ns, no significant difference. Each point represents three experiments of at least 50 worms each.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57921-fig2-v1.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>The Slit-independent SAX-3 cleavage.</title><p>Images show the results from a second anti-HA antibody to confirm that SAX-3 has a developmental-stage-dependent cleavage (<bold>a</bold>), and this cleavage does not depend on <italic>slt-1</italic> (<bold>b</bold>). (<bold>c</bold>) Deletion of the second FN3 repeats (FN3-b) did not decrease the expression or change the expression pattern of SAX-3 in transgenes. (<bold>d</bold>) Gel pictures (top) and quantification of RT-PCR results show that <italic>yad175</italic> mutation decreases the expression of <italic>sax-3</italic> mRNA. <italic>act-1</italic>/actin was used as a control. Student’s t-test, *p&lt;0.05. (<bold>e</bold>) Quantification shows percentage of animals with AVM guidance defects. AVM was visualized using <italic>zdIs5</italic> (<italic>Pmec-4::GFP</italic>) marker, and AVM guidance defects were defined as any abnormality in AVM axon growth direction. (<bold>f</bold>) Quantification data show that expression of a fragment (Ig(1-5)-FN3-a) mimicking the SAX-3 extracellular cleavage product by pan-neuronal (<italic>Punc-33</italic>, <italic>Prgef-1</italic>) or amphid neuron-specific (<italic>Parl-13</italic>) promoters can fully rescue AMsh migration defects in <italic>sax-3(lf)</italic> animals. Data are represented as mean ± SEM. Two-way ANOVA test. **, p&lt;0.01; ns, no significant difference. Each point represents three experiments of at least 50 worms. Scale bar, 10 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57921-fig2-figsupp1-v1.tif"/></fig></fig-group></sec><sec id="s1-3"><title>SYG-1/Neph is the receptor for the SAX-3/Robo extracellular cleavage fragment during glial migration</title><p>With the discovery of the function of the SAX-3 extracellular cleavage fragment in AMsh glial migration, we hypothesized that the cleavage fragment is released from neurons, where <italic>sax-3</italic> is expressed (<xref ref-type="bibr" rid="bib54">Zallen et al., 1998</xref>), and functions as an attractive cue for glial migration. If that is the case, there should be a receptor in AMsh glia to interact with the SAX-3 cleavage fragment and mediate AMsh migration. To identify the potential receptor for the SAX-3 cleavage fragment, we generated a transgene expressing a functional FLAG::SAX-3 fusion protein, in which a FLAG tag was inserted between the signal peptide and the first Ig domain. We first confirmed that we could detect the developmental-stage-dependent SAX-3 cleavage in this transgene (<xref ref-type="fig" rid="fig3">Figure 3a</xref>). Then we carried out immunoprecipitation (IP) using anti-FLAG-coated beads on protein lysate collected from 44 cell and threefold stage embryos and submitted them for proteomics (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1a</xref>). As the SAX-3 cleavage happens only in threefold but not in 44-cell stage embryos, we focused on membrane proteins that specifically interacted with SAX-3 in threefold stage embryos. Furthermore, Ig superfamily proteins have been shown to be able to interact with each other in many biological processes (<xref ref-type="bibr" rid="bib8">Cameron and McAllister, 2018</xref>; <xref ref-type="bibr" rid="bib48">Wai Wong et al., 2012</xref>), so we also focused our analysis on Ig superfamily proteins. <italic>syg-1</italic>, a nephrin family adhesion molecule (<xref ref-type="bibr" rid="bib43">Shen and Bargmann, 2003</xref>), caught our attention (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1b</xref>, <xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>) because it contains multiple Ig domains in its extracellular regions (<xref ref-type="bibr" rid="bib54">Zallen et al., 1998</xref>; <xref ref-type="bibr" rid="bib43">Shen and Bargmann, 2003</xref>). To confirm the interaction between SYG-1 and SAX-3, we first generated a transgene expressing SYG-1::HA in glia and FLAG::SAX-3 in neurons and then examined the interaction between SYG-1::HA and FLAG::SAX-3 by IP using anti-HA-coated beads. As shown in <xref ref-type="fig" rid="fig3">Figure 3b</xref>, the extracellular cleavage fragment but not the full-length SAX-3 can bind with SYG-1::HA, suggesting that SYG-1 can directly or indirectly bind with the SAX-3 extracellular cleavage fragment. With these findings, we further examined the function of <italic>syg-1</italic> in AMsh migration and found that <italic>syg-1</italic> was expressed in AMsh glia during migration and loss-of-function of <italic>syg-1(ok3640, null allele)</italic> caused similar AMsh migration defects as those in <italic>sax-3(lf)</italic> mutants (<xref ref-type="fig" rid="fig3">Figure 3c–e</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2a</xref>). Furthermore, double mutants of <italic>syg-1;sax-3</italic> displayed the same extent of defects as in <italic>sax-3</italic> single mutants (<xref ref-type="fig" rid="fig3">Figure 3d and e</xref>), supporting the conclusion that <italic>syg-1</italic> and <italic>sax-3</italic> function in the same genetic pathway to regulate AMsh migration. As <italic>syg-1</italic> has been shown to function together with <italic>syg-2</italic>, another Ig super family protein, in synapse formation and axon branching (<xref ref-type="bibr" rid="bib42">Shen et al., 2004</xref>; <xref ref-type="bibr" rid="bib9">Chia et al., 2014</xref>), we examined the function of <italic>syg-2</italic> in AMsh migration and did not observe any abnormalities in <italic>syg-2(lf)</italic> mutants (<xref ref-type="fig" rid="fig3">Figure 3e</xref>). Consistent with its potential role as a receptor for the SAX-3 cleavage fragment, <italic>syg-1</italic> cell autonomously regulates AMsh migration (<xref ref-type="fig" rid="fig3">Figure 3e</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2b</xref>). Further genetic analysis also showed that the conserved WIRS (WAVE Regulatory receptor sequence) in the SYG-1 C-terminal (<xref ref-type="bibr" rid="bib9">Chia et al., 2014</xref>) is essential for its function in AMsh migration (<xref ref-type="fig" rid="fig3">Figure 3e</xref>), and interruption of WAVE complex function by mutating <italic>gex-3</italic>, one of the key components of the WAVE complex (<xref ref-type="bibr" rid="bib9">Chia et al., 2014</xref>), cell autonomously caused similar AMsh migration defects as observed in <italic>sax-3(lf)</italic> and <italic>syg-1(lf)</italic> mutants (<xref ref-type="fig" rid="fig3">Figure 3f,g</xref>). Finally, to further test the ligand/receptor function of the SAX-3 cleavage fragment and SYG-1, we tested whether AMsh glia can further migrate along the body in transgenic animals that express the cleavage product of SAX-3 in the tail neurons (<italic>Pitr-1b</italic>) or tail hypodermis (<italic>Plin-44</italic>) of <italic>sax-3(lf)</italic> animals (<xref ref-type="bibr" rid="bib32">Ou et al., 2010</xref>). We found that in these transgenes the migration distance of AMsh was almost three times that of control animals, and loss-of-function in <italic>syg-1</italic> completely blocked the over-migration phenotypes in these transgenes (<xref ref-type="fig" rid="fig3">Figure 3h and i</xref>). With this evidence we believe that the neuron-released SAX-3 extracellular cleavage fragment functions as an attractive cue, and SYG-1 functions as its receptor to mediate AMsh migration (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>SYG-1 functions as a receptor for the SAX-3 extracellular cleavage fragment during AMsh glial migration.</title><p>(<bold>a</bold>) Image from western blot show the SAX-3 extracellular fragment by N-terminal tagging FLAG transgenes. Stars (*) label bands that are nonspecifically recognized by the anti-FLAG antibody. A schematic diagram at the top panel shows that the FLAG tag was fused at the N-terminal of SAX-3, and the extracellular cleavage fragment detected by the FLAG antibody is about 55 kDa. (<bold>b</bold>) SYG-1 specifically binds with the SAX-3 extracellular cleavage fragment. SYG-1::HA expression is driven by the pan-glial promoter <italic>Pmir-228</italic>, and FLAG::SAX-3 is expressed under the pan-neuronal promoter <italic>Punc-33</italic>. Stars (*) label bands that are nonspecifically recognized by the anti-FLAG antibody. (<bold>c</bold>) Confocal images of AMsh glia in control and <italic>syg-1(ok3640)</italic> animals. TB: pharyngeal terminal bulb. Stars (*) label AMsh cell bodies. Scale bar, 10 µm. (<bold>d</bold>) Quantification of <underline>M</underline>igration <underline>I</underline>ndex (MI) in control, <italic>syg-1</italic>, <italic>sax-3</italic>, and <italic>syg-1;sax-3</italic> double mutants show that double mutants of <italic>syg-1;sax-3</italic> display similar defects as in <italic>sax-3</italic> single mutants. (<bold>e</bold>) <italic>syg-1</italic> cell autonomously regulates AMsh glial migration, and the WAVE regulatory receptor sequence is required for <italic>syg-1</italic> function. (<bold>f and g</bold>) <italic>gex-3</italic> cell autonomously regulates AMsh glial migration. Quantification of <underline>M</underline>igration <underline>I</underline>ndex (<bold>f</bold>) and the percentage of animals with AMsh defects (<bold>g</bold>) show that <italic>gex-3</italic> is required for AMsh migration. (<bold>h and i</bold>) Confocal images (<bold>h</bold>) and quantification (<bold>i</bold>) show that ectopic expression of a fragment mimicking the SAX-3 cleavage fragment in the tail neurons (<italic>Pitr-1</italic>) or hypodermis (<italic>Plin-44</italic>) causes <italic>syg-1</italic>-dependent over-migration of AMsh glia. Red arrowheads point to the center of the pharyngeal terminal bulb. Green arrowheads indicate AMsh cell body position. Scale bar, 10 µm. In <bold>d</bold>, <bold>f</bold>, and <bold>i</bold>, data are represented as mean ± SEM. One-way ANOVA test. **, p&lt;0.01; Each point represents at least 30 worms. In (<bold>e and g</bold>), data are represented as mean ± SEM. Two-way ANOVA test. **, p&lt;0.01; ns, no significant difference. Each point represents three experiments of at least 50 worms each.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57921-fig3-v1.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Identification of SAX-3 interacting proteins by proteomics.</title><p>(<bold>a</bold>) A image from silver staining shows the full length (black stars) and cleaved fragment (red stars) of SAX-3. These samples were then submitted for proteomics. (<bold>b</bold>) A screenshot of the Scaffold software that shows that SYG-1 was identified with specific interactions with SYG-1 in threefold but not in 44-cell stage embryos. The green color of the asparagine(N) means that this amino acid was deamidated to either aspartic acid or isoaspartic acid.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57921-fig3-figsupp1-v1.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>SYG-1 is expressed in AMsh glia.</title><p>(<bold>a</bold>) Confocal images show that a 2.5 kb <italic>syg-1</italic> promoter can drive GFP expression in AMsh (labeled by <italic>Pf53f4.13::H2B::mCherry</italic>) in embryos (left) and larva (right). Scale bar, 10 µm. (<bold>b</bold>) Expression of <italic>syg-1</italic> in AMsh glia driven by PAMsh(2) (Pf16f9.3) can rescue <italic>syg-1(lf)</italic> phenotypes.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57921-fig3-figsupp2-v1.tif"/></fig></fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>A model for regulation of AMsh glial migration by SAX-3 and SYG-1.</title></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-57921-fig4-v1.tif"/></fig></sec></sec><sec id="s2" sec-type="discussion"><title>Discussion</title><p>Studies in different organisms show that Robo functions as the receptor for the repulsive guidance cue Slit (<xref ref-type="bibr" rid="bib11">Dickson and Gilestro, 2006</xref>), and loss-of-function in Robo causes many phenotypes that are shared by Slit mutants (<xref ref-type="bibr" rid="bib11">Dickson and Gilestro, 2006</xref>). However, genetic studies also showed that some Robo-mutant phenotypes are not related to Slit (<xref ref-type="bibr" rid="bib54">Zallen et al., 1998</xref>; <xref ref-type="bibr" rid="bib18">Hao et al., 2001</xref>; <xref ref-type="bibr" rid="bib13">Fricke et al., 2001</xref>; <xref ref-type="bibr" rid="bib21">Hivert et al., 2002</xref>; <xref ref-type="bibr" rid="bib27">Liu et al., 2004</xref>). In <italic>C. elegans</italic>, there is only one Robo, <italic>sax-3</italic>, and one Slit, <italic>slt-1. sax-3(lf)</italic> animals display many phenotypes that are not observed in <italic>slt-1</italic> mutants, including embryonic lethality, abnormal head morphology (<italic>vab</italic> head), and misplacement of neurons (<xref ref-type="bibr" rid="bib54">Zallen et al., 1998</xref>; <xref ref-type="bibr" rid="bib18">Hao et al., 2001</xref>). Based on these observations, it has been long speculated that there are Slit-independent Robo regulatory mechanisms. Here we present evidence to show that neuron-expressed Robo/SAX-3 can be cleaved in the extracellular FN3 repeats during development, and the cleaved extracellular fragment can interact with glial-expressed SYG-1/Neph to mediate F-actin organization and to facilitate glial migration.</p><p>The extracellular region of Robo is evolutionarily conserved from nematodes to mammals and contains five Ig and three FN3 domains. The extracellular cleavages of Robo appear to be conserved in <italic>C. elegans</italic> (this study), <italic>Drosophila</italic>, and human (<xref ref-type="bibr" rid="bib10">Coleman et al., 2010</xref>; <xref ref-type="bibr" rid="bib39">Seki et al., 2010</xref>), though different metalloproteases were utilized in <italic>Drosophila</italic> and human. Recent biochemical and structural studies show that the extracellular domains of Robo can dimerize through the Ig domains, and the dimerization may be inhibited by the FN3 domain in the absence of Slit (<xref ref-type="bibr" rid="bib21">Hivert et al., 2002</xref>; <xref ref-type="bibr" rid="bib27">Liu et al., 2004</xref>; <xref ref-type="bibr" rid="bib53">Zakrys et al., 2014</xref>; <xref ref-type="bibr" rid="bib1">Aleksandrova et al., 2018</xref>; <xref ref-type="bibr" rid="bib3">Barak et al., 2019</xref>; <xref ref-type="bibr" rid="bib52">Yamamoto et al., 2019</xref>; <xref ref-type="bibr" rid="bib34">Pak et al., 2020</xref>). The cleavages of the extracellular domains provide possibility for additional regulatory mechanisms of Robo. Since the extracellular SAX-3/Robo cleavage fragment lacks the inhibitory second FN3 domain, it will be expected to strongly bind with itself or with the full length SAX-3/Robo, and these interactions may play a regulatory role in the activation of Robo downstream signals. In this study we show that the SAX-3/Robo extracellular cleavage fragment can bind with the Ig domain-containing adhesion molecule SYG-1/Neph to regulate the WAVE complex. Since <italic>sax-3</italic>/Robo and <italic>syg-1/</italic> Neph are both expressed in and functionally important for neurons and other cells, it is possible that interactions between the SAX-3 cleaved extracellular fragment and <italic>syg-1/</italic>Neph also play functions beyond glial migration. The potential dimerization of SAX-3/Robo extracellular cleavage fragments may also mediate crosstalk between <italic>syg-1</italic>/Neph and <italic>sax-3/</italic>Robo signals. The extracellular cleavage of SAX-3/Robo generated two fragments: one has all the Ig and the first FN3 domains while the other contains the rest of the FN3, transmembrane, and the intracellular domains. While the released SAX-3/Robo extracellular cleavage fragment functions as a ligand for SYG-1/Neph and has potential to interact with the full length SAX-3/Robo, the membrane-anchored fragment may also play an active role in neuronal development.</p><p>To achieve their vital roles in the nervous system and to form functional units with neurons, glia need to migrate over what are often long distances from their birthplace to the appropriate regions (<xref ref-type="bibr" rid="bib15">Gilmour et al., 2002</xref>; <xref ref-type="bibr" rid="bib23">Jarjour and Kennedy, 2004</xref>; <xref ref-type="bibr" rid="bib25">Kinrade et al., 2001</xref>; <xref ref-type="bibr" rid="bib26">Klämbt, 2009</xref>; <xref ref-type="bibr" rid="bib4">Barres, 2008</xref>; <xref ref-type="bibr" rid="bib12">Fields et al., 2015</xref>; <xref ref-type="bibr" rid="bib29">Mori et al., 2005</xref>). The migration of glia relies on guidance cues and shares many similar mechanisms with neurons (<xref ref-type="bibr" rid="bib25">Kinrade et al., 2001</xref>; <xref ref-type="bibr" rid="bib22">Jarjour et al., 2003</xref>; <xref ref-type="bibr" rid="bib37">Sasse and Klämbt, 2016</xref>; <xref ref-type="bibr" rid="bib45">Spassky et al., 2002</xref>; <xref ref-type="bibr" rid="bib46">Unni et al., 2012</xref>). Our studies uncover a surprising role of Robo receptors – an attractive cue for glial migration – and identify SYG-1/Neph as the glial receptor for the neuronal-released Robo cleavage fragment, suggesting that the function and regulation of guidance molecules are more complicated than anticipated.</p></sec><sec id="s3" sec-type="materials|methods"><title>Materials and methods</title><p>Further information and requests for resources should be directed to and will be fulfilled by the Lead Contact, Dong Yan (<ext-link ext-link-type="uri" xlink:href="https://mgm.duke.edu/faculty-and-research/primary-faculty/dong-yan-phd/">dong.yan@duke.edu</ext-link>).</p><sec id="s3-1"><title>Experimental model and subject details</title><sec id="s3-1-1"><title><italic>C. elegans</italic> genetics</title><p><italic>C. elegans</italic> strains were maintained on nematode growth media (NGM) plates using <italic>Escherichia coli</italic> OP50 as a food source. Animals were grown according to standard methods (<xref ref-type="bibr" rid="bib7">Brenner, 1974</xref>) at 20°C unless otherwise stated. Wild-type worms were of the Bristol N2 strain. Only hermaphrodite animals were used for experiments. All transgenes and strains are described in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>. <italic>yadIs48</italic> (<italic>Pf53f4.13::GFP</italic>) was used to visualize AMsh cells. The null alleles used in genetic analyses were <italic>sax-3(yad10), slit-1 (ok255)</italic>, <italic>syg-1(ok3640), syg-2(ky671),</italic> and <italic>gex-3(zu196)</italic> unless specific alleles were mentioned. <italic>gex-3(zu196)</italic> homozygous animals are sterile, and we analyzed the AMsh phenotypes in first generation homozygotes of <italic>gex-3(zu196),</italic> which may not represent null allele phenotypes due to maternal effects. All other data were acquired in animals that have been homozygous for genotypes of interest for at least three generations. The recessive <italic>sax-3</italic> alleles <italic>yad10</italic> and y<italic>ad147</italic> were isolated from a visualized EMS mutagenesis screen of over 4000 haploid genomes and were two of five mutants with reduced migration defects. Genetic studies show that those five mutants belong to three complementation groups, and <italic>yad10</italic> and <italic>yad14</italic>7 are in one complementation group. Based on their X-linkage and the <italic>vab</italic> head phenotypes, we tested whether they were alleles of <italic>sax-3</italic> and found that they both failed to complement <italic>sax-3(ky123)</italic> null alleles. <italic>yad10</italic> and <italic>yad147</italic> mutations were finally confirmed through sequencing and rescue experiments. The ‘<italic>vab’</italic> head phenotype in <italic>sax-3</italic> mutants was defined as any abnormality of head morphology.</p></sec></sec><sec id="s3-2"><title>Method details</title><sec id="s3-2-1"><title>Cloning and constructs</title><p>All DNA expression constructs were generated using Gateway cloning technology (Invitrogen, Carlsbad, CA) and subsequently sequenced. <italic>sax-3, syg-1,</italic> and <italic>gex-3</italic> cDNA were amplified from <italic>C. elegans</italic> yk cDNA clones gifted from Dr. Yuji Kohara’s lab. <italic>Pf53f4.</italic>13 (PAMsh), <italic>Pf16f9.3</italic> (PAMsh 2), <italic>Punc-33</italic> (Pneuron), and <italic>Prgef-1</italic>(Pneuron) promoters were used to express genes of interest in AMsh and all neurons. <italic>Parl-13</italic> was used to drive gene expression in amphid neurons. In embryos and other stages, <italic>f53f4.13</italic> and <italic>f16f9.3</italic> are exclusively expressed in AMsh glia, <italic>arl-13</italic> is exclusively expressed in amphid neurons, and <italic>unc-33</italic> and <italic>rgef-1</italic> are broadly expressed in neurons (<xref ref-type="bibr" rid="bib33">Packer et al., 2019</xref>). A complete list of DNA constructs used is included in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>. In general, plasmids used in this study were injected at a concentration of 1–50 ng/µL with a <italic>Pttx-3::RFP</italic> co-injection marker injected at a concentration of 50 ng/µL.</p></sec><sec id="s3-2-2"><title>Microscopy</title><p>Representative images were acquired with a Zeiss LSM700 confocal microscope using a Plan-Apochromat 40×/1.4 objective. Worms were immobilized using 1.5% 1-phenoxy-2-propanol (TCI America, Portland, OR) in M9 buffer and mounted on 5% agar slides. 3D reconstructions were done using Zeiss Zen software. A Zeiss Axio Imager two microscope equipped with Chroma HQ filters was used to score AMsh migration defects and take images to measure Migration Index. Experiments were conducted in triplicates consisting of at least 50 day one adult animals each.</p></sec><sec id="s3-2-3"><title>Protein analysis</title><p>All protein analyses were carried out using transgenes made in this study (see details in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>). Synchronous animals were grown on NGM plates to reach adult stages, and animals were bleached to collect embryos. The freshly isolated embryos were mostly between the 16-cell and 44-cell stages. Embryos were incubated in M9 buffer and collected at different embryonic stages or at the L1 stage. L1 animals were then cultured in NGM plates with O.P. 50 as a food source until they reached the L4 stage, where they were subsequently collected for protein analysis. For western blotting, protein was directly extracted in SDS sample buffer containing 1 mM DTT by freeze-thawing for 20–50 cycles between dry ice/ethanol and a 37°C water bath, and then denatured by heating to 95°C for 5 min. Blots were probed with anti-HA (Sigma, H9658; abcam, ab9110), anti-GFP (Sigma, G1544), and anti-FLAG (Sigma, F3165) antibodies and visualized with Amersham HRP-conjugated anti-rabbit or anti-mouse secondary antibodies at a 1:5000 dilution (GE Healthcare Life Sciences) using the SuperSignal West Femto kit (Pierce, Rockford, IL). For IP experiments, embryos were collected at the 44-cell and 1.5- to 3-fold stages and subsequently lysed with IP lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol) containing protease inhibitor cocktail (Thermo Fisher, 87785, added before use) and sonicated by an ultrasonic cell crusher. Lysates were centrifuged for 10 min at 12,000 rpm at 4°C and supernatant was used for Co-IP using the anti-Protein A/G magnetic beads (Thermo Fisher, 78608) or anti-HA Magnetic beads (Thermo Fisher, 88836) separately according the manufacturer’s protocol. Briefly, beads were equilibrated before use and added to the supernatant and mixed gently. The mixture was incubated on a rotator at 4°C overnight. Beads were collected with a magnetic stand and washed twice with phosphate buffered saline. Supernatant was discarded and proteins were eluted from the beads using SDS-sample buffer at 95°C for 10 min.</p></sec></sec><sec id="s3-3"><title>Collection of supernatant for western blot</title><sec id="s3-3-1"><title>RT-PCR</title><p>To measure <italic>sax-3</italic> mRNA levels in N2, <italic>yad10</italic>, and <italic>yad147</italic> animals, total RNA were isolated from mixed-stage animals. Briefly, worms were collected in the tube and washed with M9 buffer on an end-over-end rotator three times for 90 min in total. RNA was then isolated by using TRI Reagent (Invitrogen). Total RNA (1 μg) of each genotype was reverse transcribed using an iScript Reverse Transcription Supermix (Bio-Rad Laboratories). Relative <italic>sax-3</italic> mRNA levels were determined by PCR with 1 μL cDNAs as templates, and <italic>act-1/actin</italic> was used as internal control. Primers for <italic>sax-3</italic>, Forward: 5ʹ <named-content content-type="sequence">CTGTTTGATTGTCGTGTGACTGG</named-content>-3ʹ; Reverse: 5ʹ-<named-content content-type="sequence">AAAGCTGCCTTGCTCAACG</named-content>-3ʹ. Primers for <italic>act-1</italic>, Forward: 5ʹ-<named-content content-type="sequence">TTGCCGCTCTTGTTGTAGAC</named-content>-3ʹ; Reverse: 5ʹ-<named-content content-type="sequence">TTCGTAGATTGGGACGGTG</named-content>-3ʹ. The PCR products were run in the agarose gel, and the density was calculated using Image J software.</p></sec><sec id="s3-3-2"><title>CRISPR-Cas9-based homology recombination approach</title><p>The <italic>sax-3</italic> FN3-b deletion allele, <italic>yad175,</italic> was constructed by using CRISPR-Cas9-based homology recombination. Briefly, two arms containing about 1000 bp on both sides of FN3-b of <italic>sax-3</italic> were amplified from genomic DNA of wild-type animals, and the fusion fragment of the two arms was then cloned into the PCR8 vector. Two sgRNAs of <italic>sax-3</italic> FN3-b deletion were cloned into pDD122 plasmid (Addgene, #47550). Finally, the recombination template and the two sgRNAs were injected into young adult of <italic>yadIs48</italic> worms simultaneously. <italic>yad175</italic> were isolated from the F2 generation, and the deletion was confirmed by sequencing. <italic>sax-3</italic> sgRNA1: <named-content content-type="sequence">GGATGGAGAGTCAACATG</named-content>; sequence of <italic>sax-3</italic> sgRNA2: <named-content content-type="sequence">GGATGTGCGAATCCGTAT</named-content>.</p></sec><sec id="s3-3-3"><title>Mass spectrometric analysis</title><p>To identify the potential proteins binding with SAX-3, embryos from FLAG::SAX-3::GFP expressing worms were collected at the 44-cell and 1.5- to 3-fold stages. In the same experiment, 1.5- to 3-fold stage embryos of FLAG::INX-3::GFP transgenes were also collected as a control to further preclude unspecific proteins. Next, embryos were subsequently lysed with IP lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol) containing protease inhibitor cocktail (Thermo Fisher, 87785, added before use) and sonicated by an ultrasonic cell crusher. Lysates were centrifuged for 10 min at 12,000 rpm at 4°C and supernatant was used for Co-IP to pull down all the proteins that bind to SAX-3 by using the anti-FLAG magnetic agarose beads (Thermo Fisher, A36798) according to the manufacturer’s protocol.</p><p>IP products were sent to the Duke Center for Genomic and Computational Biology for mass spectrum analysis. Briefly, these in-solution samples were brought to 4% SDS and then subjected to S-trap (Protifi) trypsin digestion and sample cleanup using manufacturer recommended protocols. Digested peptides were lyophilized to dryness and resuspended in 15 µL of 0.2% formic acid/2% acetonitrile. Each sample was subjected to chromatographic separation on a Waters NanoAquity UPLC equipped with a 1.7 µm HSS T3 C18 75 µm I.D. × 250 mm reversed-phase column (NanoFlow data). The mobile phase consisted of (A) 0.1% formic acid in water and (B) 0.1% formic acid in acetonitrile. Of this, 3 µL was injected and peptides were trapped for 3 min on a 5 µm Symmetry C18 180 µm I.D. × 20 mm column at 5 µL/min in 99.9% A. The analytical column was then switched in-line and a linear elution gradient of 5% B to 40% B was performed over 30 min at 400 nL/min for in-gel band analysis and over 90 min at 400 nL/min for Co-IP studies. The analytical column was connected to a Fusion Lumos mass spectrometer (Thermo) through an electrospray interface operating in a data-dependent mode of acquisition. The instrument was set to acquire a precursor MS scan from m/z 375–1500 at R = 120,000 (target AGC 2e5, max IT 50 ms) with MS/MS spectra acquired in the ion trap (target AGC 5e3, max IT 100 ms). For all experiments, HCD energy settings were 30 v and a 20 s dynamic exclusion was employed for previously fragmented precursor ions.</p><p>Raw LC-MS/MS data files were processed in Proteome Discoverer (Thermo Scientific) and then submitted to independent Mascot searches (Matrix Science) against a <italic>C. elegans</italic> protein database containing both forward (4043 entries) and reverse entries of each protein. Search tolerances were five ppm for precursor ions and 0.8 Da for product ions using trypsin specificity with up to two missed cleavages. Carbamidomethylation (+57.0214 Da on C) was set as a fixed modification, whereas oxidation (+15.9949 Da on M) and deamidation (+0.98 Da on QN) were considered dynamic mass modifications. All searched spectra were imported into Scaffold (v4.4, Proteome Software) and scoring thresholds were set to achieve a peptide false discovery rate of 1% using the PeptideProphet algorithm.</p></sec></sec><sec id="s3-4"><title>Quantification and statistical analyses</title><sec id="s3-4-1"><title>Statistical analysis</title><p>Data were analyzed using Student’s t-test and one-way or two-way ANOVA followed by Tukey’s post-hoc test in Graphpad Prism (Graphpad Software, La Jolla, CA). Statistical details are included in the figure legends. In general, a p-value cutoff of 0.05 was considered statistically significant. The data are represented by mean ± SEM. For phenotype penetrance experiments, three biological replicates of at least 50 animals each were used unless otherwise stated.</p></sec></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Dr. Erik Soderblom, Tricia C Ho and Dr. Greg Waitt at Duke Proteomics and Metabolomics Core Facility for helping on sample preparation, mass spectrum analyses, and data interpretation, and Dr. Yuji Kohara for <italic>syg-1, sax-3,</italic> and <italic>gex-3</italic> cDNAs. Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). Ms. Chia-hui Chen characterized some preliminary observations of this study. This project was supported by the Holland Trice Awards. QZ, AZ, and DY were supported by the NIH R01 (NS094171 and NS105638 to DY).</p></ack><sec id="s4" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Data curation, Formal analysis, Validation, Investigation, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Conceptualization, Supervision, Funding acquisition, Validation, Writing - original draft, Writing - review and editing</p></fn></fn-group></sec><sec id="s5" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>Strains and plasmids used in this study.</title></caption><media mime-subtype="docx" mimetype="application" xlink:href="elife-57921-supp1-v1.docx"/></supplementary-material><supplementary-material id="supp2"><label>Supplementary file 2.</label><caption><title>A list of protein identified by proteomics show specific interactions with SAX-3 in 1.5- to 3-fold stage embryos.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-57921-supp2-v1.xlsx"/></supplementary-material><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="docx" mimetype="application" xlink:href="elife-57921-transrepform-v1.docx"/></supplementary-material></sec><sec id="s6" sec-type="data-availability"><title>Data availability</title><p>All data generated or analysed during this study are included in the manuscript and supporting files.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aleksandrova</surname> <given-names>N</given-names></name><name><surname>Gutsche</surname> <given-names>I</given-names></name><name><surname>Kandiah</surname> <given-names>E</given-names></name><name><surname>Avilov</surname> <given-names>SV</given-names></name><name><surname>Petoukhov</surname> <given-names>MV</given-names></name><name><surname>Seiradake</surname> <given-names>E</given-names></name><name><surname>McCarthy</surname> <given-names>AA</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Robo1 forms a compact Dimer-of-Dimers assembly</article-title><source>Structure</source><volume>26</volume><fpage>320</fpage><lpage>328</lpage><pub-id pub-id-type="doi">10.1016/j.str.2017.12.003</pub-id><pub-id pub-id-type="pmid">29307485</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bacaj</surname> <given-names>T</given-names></name><name><surname>Tevlin</surname> <given-names>M</given-names></name><name><surname>Lu</surname> <given-names>Y</given-names></name><name><surname>Shaham</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Glia are essential for sensory organ function in <italic>C. elegans</italic></article-title><source>Science</source><volume>322</volume><fpage>744</fpage><lpage>747</lpage><pub-id pub-id-type="doi">10.1126/science.1163074</pub-id><pub-id pub-id-type="pmid">18974354</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barak</surname> <given-names>R</given-names></name><name><surname>Yom-Tov</surname> <given-names>G</given-names></name><name><surname>Guez-Haddad</surname> <given-names>J</given-names></name><name><surname>Gasri-Plotnitsky</surname> <given-names>L</given-names></name><name><surname>Maimon</surname> <given-names>R</given-names></name><name><surname>Cohen-Berkman</surname> <given-names>M</given-names></name><name><surname>McCarthy</surname> <given-names>AA</given-names></name><name><surname>Perlson</surname> <given-names>E</given-names></name><name><surname>Henis-Korenblit</surname> <given-names>S</given-names></name><name><surname>Isupov</surname> <given-names>MN</given-names></name><name><surname>Opatowsky</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Structural principles in robo activation and Auto-inhibition</article-title><source>Cell</source><volume>177</volume><fpage>272</fpage><lpage>285</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2019.02.004</pub-id><pub-id pub-id-type="pmid">30853216</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barres</surname> <given-names>BA</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>The mystery and magic of Glia: a perspective on their roles in health and disease</article-title><source>Neuron</source><volume>60</volume><fpage>430</fpage><lpage>440</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2008.10.013</pub-id><pub-id pub-id-type="pmid">18995817</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Branchfield</surname> <given-names>K</given-names></name><name><surname>Nantie</surname> <given-names>L</given-names></name><name><surname>Verheyden</surname> <given-names>JM</given-names></name><name><surname>Sui</surname> <given-names>P</given-names></name><name><surname>Wienhold</surname> <given-names>MD</given-names></name><name><surname>Sun</surname> <given-names>X</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Pulmonary neuroendocrine cells function as airway sensors to control lung immune response</article-title><source>Science</source><volume>351</volume><fpage>707</fpage><lpage>710</lpage><pub-id pub-id-type="doi">10.1126/science.aad7969</pub-id><pub-id pub-id-type="pmid">26743624</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brennaman</surname> <given-names>LH</given-names></name><name><surname>Moss</surname> <given-names>ML</given-names></name><name><surname>Maness</surname> <given-names>PF</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>EphrinA/EphA-induced ectodomain shedding of neural cell adhesion molecule regulates growth cone repulsion through ADAM10 metalloprotease</article-title><source>Journal of Neurochemistry</source><volume>128</volume><fpage>267</fpage><lpage>279</lpage><pub-id pub-id-type="doi">10.1111/jnc.12468</pub-id><pub-id pub-id-type="pmid">24117969</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brenner</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="1974">1974</year><article-title>The genetics of <italic>Caenorhabditis elegans</italic></article-title><source>Genetics</source><volume>77</volume><fpage>71</fpage><lpage>94</lpage><pub-id pub-id-type="pmid">4366476</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cameron</surname> <given-names>S</given-names></name><name><surname>McAllister</surname> <given-names>AK</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Immunoglobulin-Like receptors and their impact on wiring of brain synapses</article-title><source>Annual Review of Genetics</source><volume>52</volume><fpage>567</fpage><lpage>590</lpage><pub-id pub-id-type="doi">10.1146/annurev-genet-120417-031513</pub-id><pub-id pub-id-type="pmid">30212237</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chia</surname> <given-names>PH</given-names></name><name><surname>Chen</surname> <given-names>B</given-names></name><name><surname>Li</surname> <given-names>P</given-names></name><name><surname>Rosen</surname> <given-names>MK</given-names></name><name><surname>Shen</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Local F-actin network links synapse formation and axon branching</article-title><source>Cell</source><volume>156</volume><fpage>208</fpage><lpage>220</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2013.12.009</pub-id><pub-id pub-id-type="pmid">24439377</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Coleman</surname> <given-names>HA</given-names></name><name><surname>Labrador</surname> <given-names>JP</given-names></name><name><surname>Chance</surname> <given-names>RK</given-names></name><name><surname>Bashaw</surname> <given-names>GJ</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>The adam family metalloprotease kuzbanian regulates the cleavage of the roundabout receptor to control axon repulsion at the midline</article-title><source>Development</source><volume>137</volume><fpage>2417</fpage><lpage>2426</lpage><pub-id pub-id-type="doi">10.1242/dev.047993</pub-id><pub-id pub-id-type="pmid">20570941</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dickson</surname> <given-names>BJ</given-names></name><name><surname>Gilestro</surname> <given-names>GF</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Regulation of commissural axon pathfinding by slit and its robo receptors</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>22</volume><fpage>651</fpage><lpage>675</lpage><pub-id pub-id-type="doi">10.1146/annurev.cellbio.21.090704.151234</pub-id><pub-id pub-id-type="pmid">17029581</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fields</surname> <given-names>RD</given-names></name><name><surname>Woo</surname> <given-names>DH</given-names></name><name><surname>Basser</surname> <given-names>PJ</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Glial Regulation of the Neuronal Connectome through Local and Long-Distant Communication</article-title><source>Neuron</source><volume>86</volume><fpage>374</fpage><lpage>386</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2015.01.014</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fricke</surname> <given-names>C</given-names></name><name><surname>Lee</surname> <given-names>JS</given-names></name><name><surname>Geiger-Rudolph</surname> <given-names>S</given-names></name><name><surname>Bonhoeffer</surname> <given-names>F</given-names></name><name><surname>Chien</surname> <given-names>CB</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Astray, a zebrafish roundabout homolog required for retinal axon guidance</article-title><source>Science</source><volume>292</volume><fpage>507</fpage><lpage>510</lpage><pub-id pub-id-type="doi">10.1126/science.1059496</pub-id><pub-id pub-id-type="pmid">11313496</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ghenea</surname> <given-names>S</given-names></name><name><surname>Boudreau</surname> <given-names>JR</given-names></name><name><surname>Lague</surname> <given-names>NP</given-names></name><name><surname>Chin-Sang</surname> <given-names>ID</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>The VAB-1 eph receptor tyrosine kinase and SAX-3/Robo neuronal receptors function together during <italic>C. elegans</italic> embryonic morphogenesis</article-title><source>Development</source><volume>132</volume><fpage>3679</fpage><lpage>3690</lpage><pub-id pub-id-type="doi">10.1242/dev.01947</pub-id><pub-id pub-id-type="pmid">16033794</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gilmour</surname> <given-names>DT</given-names></name><name><surname>Maischein</surname> <given-names>HM</given-names></name><name><surname>Nüsslein-Volhard</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Migration and function of a glial subtype in the vertebrate peripheral nervous system</article-title><source>Neuron</source><volume>34</volume><fpage>577</fpage><lpage>588</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(02)00683-9</pub-id><pub-id pub-id-type="pmid">12062041</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Grieshammer</surname> <given-names>U</given-names></name><name><surname>Ma</surname> <given-names>L</given-names></name><name><surname>Plump</surname> <given-names>AS</given-names></name><name><surname>Wang</surname> <given-names>F</given-names></name><name><surname>Tessier-Lavigne</surname> <given-names>M</given-names></name><name><surname>Martin</surname> <given-names>GR</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>SLIT2-mediated ROBO2 signaling restricts kidney induction to a single site</article-title><source>Developmental Cell</source><volume>6</volume><fpage>709</fpage><lpage>717</lpage><pub-id pub-id-type="doi">10.1016/S1534-5807(04)00108-X</pub-id><pub-id pub-id-type="pmid">15130495</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gupta</surname> <given-names>BP</given-names></name><name><surname>Sternberg</surname> <given-names>PW</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>The draft genome sequence of the nematode Caenorhabditis briggsae</article-title><source>Genome Biology</source><volume>4</volume><elocation-id>238</elocation-id><pub-id pub-id-type="doi">10.1186/gb-2003-4-12-238</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hao</surname> <given-names>JC</given-names></name><name><surname>Yu</surname> <given-names>TW</given-names></name><name><surname>Fujisawa</surname> <given-names>K</given-names></name><name><surname>Culotti</surname> <given-names>JG</given-names></name><name><surname>Gengyo-Ando</surname> <given-names>K</given-names></name><name><surname>Mitani</surname> <given-names>S</given-names></name><name><surname>Moulder</surname> <given-names>G</given-names></name><name><surname>Barstead</surname> <given-names>R</given-names></name><name><surname>Tessier-Lavigne</surname> <given-names>M</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title><italic>C. elegans</italic> slit acts in Midline, dorsal-ventral, and anterior-posterior guidance via the SAX-3/Robo receptor</article-title><source>Neuron</source><volume>32</volume><fpage>25</fpage><lpage>38</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(01)00448-2</pub-id><pub-id pub-id-type="pmid">11604136</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heiman</surname> <given-names>MG</given-names></name><name><surname>Shaham</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>DEX-1 and DYF-7 establish sensory dendrite length by anchoring dendritic tips during cell migration</article-title><source>Cell</source><volume>137</volume><fpage>344</fpage><lpage>355</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2009.01.057</pub-id><pub-id pub-id-type="pmid">19344940</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hinck</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>The versatile roles of &quot;axon guidance&quot; cues in tissue morphogenesis</article-title><source>Developmental Cell</source><volume>7</volume><fpage>783</fpage><lpage>793</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2004.11.002</pub-id><pub-id pub-id-type="pmid">15572123</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hivert</surname> <given-names>B</given-names></name><name><surname>Liu</surname> <given-names>Z</given-names></name><name><surname>Chuang</surname> <given-names>CY</given-names></name><name><surname>Doherty</surname> <given-names>P</given-names></name><name><surname>Sundaresan</surname> <given-names>V</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Robo1 and Robo2 are homophilic binding molecules that promote axonal growth</article-title><source>Molecular and Cellular Neuroscience</source><volume>21</volume><fpage>534</fpage><lpage>545</lpage><pub-id pub-id-type="doi">10.1006/mcne.2002.1193</pub-id><pub-id pub-id-type="pmid">12504588</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jarjour</surname> <given-names>AA</given-names></name><name><surname>Manitt</surname> <given-names>C</given-names></name><name><surname>Moore</surname> <given-names>SW</given-names></name><name><surname>Thompson</surname> <given-names>KM</given-names></name><name><surname>Yuh</surname> <given-names>SJ</given-names></name><name><surname>Kennedy</surname> <given-names>TE</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Netrin-1 is a chemorepellent for oligodendrocyte precursor cells in the embryonic spinal cord</article-title><source>The Journal of Neuroscience</source><volume>23</volume><fpage>3735</fpage><lpage>3744</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.23-09-03735.2003</pub-id><pub-id pub-id-type="pmid">12736344</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jarjour</surname> <given-names>AA</given-names></name><name><surname>Kennedy</surname> <given-names>TE</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Oligodendrocyte precursors on the move: mechanisms directing migration</article-title><source>The Neuroscientist</source><volume>10</volume><fpage>99</fpage><lpage>105</lpage><pub-id pub-id-type="doi">10.1177/1073858403260751</pub-id><pub-id pub-id-type="pmid">15070484</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Killeen</surname> <given-names>MT</given-names></name><name><surname>Sybingco</surname> <given-names>SS</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Netrin, slit and wnt receptors allow axons to choose the Axis of migration</article-title><source>Developmental Biology</source><volume>323</volume><fpage>143</fpage><lpage>151</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2008.08.027</pub-id><pub-id pub-id-type="pmid">18801355</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kinrade</surname> <given-names>EF</given-names></name><name><surname>Brates</surname> <given-names>T</given-names></name><name><surname>Tear</surname> <given-names>G</given-names></name><name><surname>Hidalgo</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Roundabout signalling, cell contact and trophic support confine longitudinal Glia and axons in the <italic>Drosophila</italic> CNS</article-title><source>Development</source><volume>128</volume><fpage>207</fpage><lpage>216</lpage><pub-id pub-id-type="pmid">11124116</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Klämbt</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Modes and regulation of glial migration in vertebrates and invertebrates</article-title><source>Nature Reviews Neuroscience</source><volume>10</volume><fpage>769</fpage><lpage>779</lpage><pub-id pub-id-type="doi">10.1038/nrn2720</pub-id><pub-id pub-id-type="pmid">19773781</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>Z</given-names></name><name><surname>Patel</surname> <given-names>K</given-names></name><name><surname>Schmidt</surname> <given-names>H</given-names></name><name><surname>Andrews</surname> <given-names>W</given-names></name><name><surname>Pini</surname> <given-names>A</given-names></name><name><surname>Sundaresan</surname> <given-names>V</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Extracellular ig domains 1 and 2 of robo are important for ligand (Slit) binding</article-title><source>Molecular and Cellular Neuroscience</source><volume>26</volume><fpage>232</fpage><lpage>240</lpage><pub-id pub-id-type="doi">10.1016/j.mcn.2004.01.002</pub-id><pub-id pub-id-type="pmid">15207848</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mommersteeg</surname> <given-names>MT</given-names></name><name><surname>Andrews</surname> <given-names>WD</given-names></name><name><surname>Ypsilanti</surname> <given-names>AR</given-names></name><name><surname>Zelina</surname> <given-names>P</given-names></name><name><surname>Yeh</surname> <given-names>ML</given-names></name><name><surname>Norden</surname> <given-names>J</given-names></name><name><surname>Kispert</surname> <given-names>A</given-names></name><name><surname>Chédotal</surname> <given-names>A</given-names></name><name><surname>Christoffels</surname> <given-names>VM</given-names></name><name><surname>Parnavelas</surname> <given-names>JG</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Slit-roundabout signaling regulates the development of the cardiac systemic venous return and pericardium</article-title><source>Circulation Research</source><volume>112</volume><fpage>465</fpage><lpage>475</lpage><pub-id pub-id-type="doi">10.1161/CIRCRESAHA.112.277426</pub-id><pub-id pub-id-type="pmid">23255421</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mori</surname> <given-names>T</given-names></name><name><surname>Buffo</surname> <given-names>A</given-names></name><name><surname>Götz</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>The novel roles of glial cells revisited: the contribution of radial Glia and astrocytes to neurogenesis</article-title><source>Current Topics in Developmental Biology</source><volume>69</volume><fpage>67</fpage><lpage>99</lpage><pub-id pub-id-type="doi">10.1016/S0070-2153(05)69004-7</pub-id><pub-id pub-id-type="pmid">16243597</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Neuhaus-Follini</surname> <given-names>A</given-names></name><name><surname>Bashaw</surname> <given-names>GJ</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>The intracellular domain of the frazzled/DCC receptor is a transcription factor required for commissural axon guidance</article-title><source>Neuron</source><volume>87</volume><fpage>751</fpage><lpage>763</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2015.08.006</pub-id><pub-id pub-id-type="pmid">26291159</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oikonomou</surname> <given-names>G</given-names></name><name><surname>Shaham</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The Glia of <italic>Caenorhabditis elegans</italic></article-title><source>Glia</source><volume>59</volume><fpage>1253</fpage><lpage>1263</lpage><pub-id pub-id-type="doi">10.1002/glia.21084</pub-id><pub-id pub-id-type="pmid">21732423</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ou</surname> <given-names>CY</given-names></name><name><surname>Poon</surname> <given-names>VY</given-names></name><name><surname>Maeder</surname> <given-names>CI</given-names></name><name><surname>Watanabe</surname> <given-names>S</given-names></name><name><surname>Lehrman</surname> <given-names>EK</given-names></name><name><surname>Fu</surname> <given-names>AK</given-names></name><name><surname>Park</surname> <given-names>M</given-names></name><name><surname>Fu</surname> <given-names>WY</given-names></name><name><surname>Jorgensen</surname> <given-names>EM</given-names></name><name><surname>Ip</surname> <given-names>NY</given-names></name><name><surname>Shen</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Two Cyclin-Dependent kinase pathways are essential for polarized trafficking of presynaptic components</article-title><source>Cell</source><volume>141</volume><fpage>846</fpage><lpage>858</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2010.04.011</pub-id><pub-id pub-id-type="pmid">20510931</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Packer</surname> <given-names>JS</given-names></name><name><surname>Zhu</surname> <given-names>Q</given-names></name><name><surname>Huynh</surname> <given-names>C</given-names></name><name><surname>Sivaramakrishnan</surname> <given-names>P</given-names></name><name><surname>Preston</surname> <given-names>E</given-names></name><name><surname>Dueck</surname> <given-names>H</given-names></name><name><surname>Stefanik</surname> <given-names>D</given-names></name><name><surname>Tan</surname> <given-names>K</given-names></name><name><surname>Trapnell</surname> <given-names>C</given-names></name><name><surname>Kim</surname> <given-names>J</given-names></name><name><surname>Waterston</surname> <given-names>RH</given-names></name><name><surname>Murray</surname> <given-names>JI</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>A lineage-resolved molecular atlas of <italic>C. elegans</italic> embryogenesis at single-cell resolution</article-title><source>Science</source><volume>365</volume><elocation-id>eaax1971</elocation-id><pub-id pub-id-type="doi">10.1126/science.aax1971</pub-id><pub-id pub-id-type="pmid">31488706</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pak</surname> <given-names>JS</given-names></name><name><surname>DeLoughery</surname> <given-names>ZJ</given-names></name><name><surname>Wang</surname> <given-names>J</given-names></name><name><surname>Acharya</surname> <given-names>N</given-names></name><name><surname>Park</surname> <given-names>Y</given-names></name><name><surname>Jaworski</surname> <given-names>A</given-names></name><name><surname>Özkan</surname> <given-names>E</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>NELL2-Robo3 complex structure reveals mechanisms of receptor activation for axon guidance</article-title><source>Nature Communications</source><volume>11</volume><elocation-id>1489</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-020-15211-1</pub-id><pub-id pub-id-type="pmid">32198364</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Perkins</surname> <given-names>LA</given-names></name><name><surname>Hedgecock</surname> <given-names>EM</given-names></name><name><surname>Thomson</surname> <given-names>JN</given-names></name><name><surname>Culotti</surname> <given-names>JG</given-names></name></person-group><year iso-8601-date="1986">1986</year><article-title>Mutant sensory cilia in the nematode <italic>Caenorhabditis elegans</italic></article-title><source>Developmental Biology</source><volume>117</volume><fpage>456</fpage><lpage>487</lpage><pub-id pub-id-type="doi">10.1016/0012-1606(86)90314-3</pub-id><pub-id pub-id-type="pmid">2428682</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sasakura</surname> <given-names>H</given-names></name><name><surname>Inada</surname> <given-names>H</given-names></name><name><surname>Kuhara</surname> <given-names>A</given-names></name><name><surname>Fusaoka</surname> <given-names>E</given-names></name><name><surname>Takemoto</surname> <given-names>D</given-names></name><name><surname>Takeuchi</surname> <given-names>K</given-names></name><name><surname>Mori</surname> <given-names>I</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Maintenance of neuronal positions in organized ganglia by SAX-7, a <italic>Caenorhabditis elegans</italic> homologue of L1</article-title><source>The EMBO Journal</source><volume>24</volume><fpage>1477</fpage><lpage>1488</lpage><pub-id pub-id-type="doi">10.1038/sj.emboj.7600621</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sasse</surname> <given-names>S</given-names></name><name><surname>Klämbt</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Repulsive epithelial cues direct glial migration along the nerve</article-title><source>Developmental Cell</source><volume>39</volume><fpage>696</fpage><lpage>707</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2016.11.016</pub-id><pub-id pub-id-type="pmid">27997826</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seeger</surname> <given-names>M</given-names></name><name><surname>Tear</surname> <given-names>G</given-names></name><name><surname>Ferres-Marco</surname> <given-names>D</given-names></name><name><surname>Goodman</surname> <given-names>CS</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Mutations affecting growth cone guidance in <italic>Drosophila</italic>: genes necessary for guidance toward or away from the midline</article-title><source>Neuron</source><volume>10</volume><fpage>409</fpage><lpage>426</lpage><pub-id pub-id-type="doi">10.1016/0896-6273(93)90330-T</pub-id><pub-id pub-id-type="pmid">8461134</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seki</surname> <given-names>M</given-names></name><name><surname>Watanabe</surname> <given-names>A</given-names></name><name><surname>Enomoto</surname> <given-names>S</given-names></name><name><surname>Kawamura</surname> <given-names>T</given-names></name><name><surname>Ito</surname> <given-names>H</given-names></name><name><surname>Kodama</surname> <given-names>T</given-names></name><name><surname>Hamakubo</surname> <given-names>T</given-names></name><name><surname>Aburatani</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Human ROBO1 is cleaved by metalloproteinases and gamma-secretase and migrates to the nucleus in Cancer cells</article-title><source>FEBS Letters</source><volume>584</volume><fpage>2909</fpage><lpage>2915</lpage><pub-id pub-id-type="doi">10.1016/j.febslet.2010.05.009</pub-id><pub-id pub-id-type="pmid">20471383</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shaham</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Chemosensory organs as models of neuronal synapses</article-title><source>Nature Reviews Neuroscience</source><volume>11</volume><fpage>212</fpage><lpage>217</lpage><pub-id pub-id-type="doi">10.1038/nrn2740</pub-id><pub-id pub-id-type="pmid">20029439</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shaham</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Glial Development and Function in the Nervous System of <italic>Caenorhabditis elegans</italic></article-title><source>Cold Spring Harbor Perspectives in Biology</source><volume>7</volume><elocation-id>a020578</elocation-id><pub-id pub-id-type="doi">10.1101/cshperspect.a020578</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shen</surname> <given-names>K</given-names></name><name><surname>Fetter</surname> <given-names>RD</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Synaptic specificity is generated by the synaptic guidepost protein SYG-2 and its receptor, SYG-1</article-title><source>Cell</source><volume>116</volume><fpage>869</fpage><lpage>881</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(04)00251-X</pub-id><pub-id pub-id-type="pmid">15035988</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shen</surname> <given-names>K</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>The immunoglobulin superfamily protein SYG-1 determines the location of specific synapses in <italic>C. elegans</italic></article-title><source>Cell</source><volume>112</volume><fpage>619</fpage><lpage>630</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(03)00113-2</pub-id><pub-id pub-id-type="pmid">12628183</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Singhvi</surname> <given-names>A</given-names></name><name><surname>Liu</surname> <given-names>B</given-names></name><name><surname>Friedman</surname> <given-names>CJ</given-names></name><name><surname>Fong</surname> <given-names>J</given-names></name><name><surname>Lu</surname> <given-names>Y</given-names></name><name><surname>Huang</surname> <given-names>X-Y</given-names></name><name><surname>Shaham</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC</article-title><source>Cell</source><volume>165</volume><fpage>936</fpage><lpage>948</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2016.03.026</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Spassky</surname> <given-names>N</given-names></name><name><surname>de Castro</surname> <given-names>F</given-names></name><name><surname>Le Bras</surname> <given-names>B</given-names></name><name><surname>Heydon</surname> <given-names>K</given-names></name><name><surname>Quéraud-LeSaux</surname> <given-names>F</given-names></name><name><surname>Bloch-Gallego</surname> <given-names>E</given-names></name><name><surname>Chédotal</surname> <given-names>A</given-names></name><name><surname>Zalc</surname> <given-names>B</given-names></name><name><surname>Thomas</surname> <given-names>JL</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Directional guidance of oligodendroglial migration by class 3 semaphorins and netrin-1</article-title><source>The Journal of Neuroscience</source><volume>22</volume><fpage>5992</fpage><lpage>6004</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.22-14-05992.2002</pub-id><pub-id pub-id-type="pmid">12122061</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Unni</surname> <given-names>DK</given-names></name><name><surname>Piper</surname> <given-names>M</given-names></name><name><surname>Moldrich</surname> <given-names>RX</given-names></name><name><surname>Gobius</surname> <given-names>I</given-names></name><name><surname>Liu</surname> <given-names>S</given-names></name><name><surname>Fothergill</surname> <given-names>T</given-names></name><name><surname>Donahoo</surname> <given-names>A-LS</given-names></name><name><surname>Baisden</surname> <given-names>JM</given-names></name><name><surname>Cooper</surname> <given-names>HM</given-names></name><name><surname>Richards</surname> <given-names>LJ</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Multiple slits regulate the development of midline glial populations and the corpus callosum</article-title><source>Developmental Biology</source><volume>365</volume><fpage>36</fpage><lpage>49</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2012.02.004</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Viveiros</surname> <given-names>R</given-names></name><name><surname>Hutter</surname> <given-names>H</given-names></name><name><surname>Moerman</surname> <given-names>DG</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Membrane extensions are associated with proper anterior migration of muscle cells during <italic>Caenorhabditis elegans</italic> embryogenesis</article-title><source>Developmental Biology</source><volume>358</volume><fpage>189</fpage><lpage>200</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2011.07.026</pub-id><pub-id pub-id-type="pmid">21820426</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wai Wong</surname> <given-names>C</given-names></name><name><surname>Dye</surname> <given-names>DE</given-names></name><name><surname>Coombe</surname> <given-names>DR</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>The role of immunoglobulin superfamily cell adhesion molecules in Cancer metastasis</article-title><source>International Journal of Cell Biology</source><volume>2012</volume><fpage>1</fpage><lpage>9</lpage><pub-id pub-id-type="doi">10.1155/2012/340296</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>LJ</given-names></name><name><surname>Zhao</surname> <given-names>Y</given-names></name><name><surname>Han</surname> <given-names>B</given-names></name><name><surname>Ma</surname> <given-names>YG</given-names></name><name><surname>Zhang</surname> <given-names>J</given-names></name><name><surname>Yang</surname> <given-names>DM</given-names></name><name><surname>Mao</surname> <given-names>JW</given-names></name><name><surname>Tang</surname> <given-names>FT</given-names></name><name><surname>Li</surname> <given-names>WD</given-names></name><name><surname>Yang</surname> <given-names>Y</given-names></name><name><surname>Wang</surname> <given-names>R</given-names></name><name><surname>Geng</surname> <given-names>JG</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Targeting Slit-Roundabout signaling inhibits tumor angiogenesis in chemical-induced squamous cell carcinogenesis</article-title><source>Cancer Science</source><volume>99</volume><fpage>510</fpage><lpage>517</lpage><pub-id pub-id-type="doi">10.1111/j.1349-7006.2007.00721.x</pub-id><pub-id pub-id-type="pmid">18201275</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ward</surname> <given-names>S</given-names></name><name><surname>Thomson</surname> <given-names>N</given-names></name><name><surname>White</surname> <given-names>JG</given-names></name><name><surname>Brenner</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="1975">1975</year><article-title>Electron microscopical reconstruction of the anterior sensory anatomy of the <italic>nematode Caenorhabditis elegans</italic>.?2uu</article-title><source>The Journal of Comparative Neurology</source><volume>160</volume><fpage>313</fpage><lpage>337</lpage><pub-id pub-id-type="doi">10.1002/cne.901600305</pub-id><pub-id pub-id-type="pmid">1112927</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname> <given-names>JY</given-names></name><name><surname>Feng</surname> <given-names>L</given-names></name><name><surname>Park</surname> <given-names>HT</given-names></name><name><surname>Havlioglu</surname> <given-names>N</given-names></name><name><surname>Wen</surname> <given-names>L</given-names></name><name><surname>Tang</surname> <given-names>H</given-names></name><name><surname>Bacon</surname> <given-names>KB</given-names></name><name><surname>Jiang</surname> <given-names>ZH</given-names></name><name><surname>Zhang</surname> <given-names>XC</given-names></name><name><surname>Rao</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>The neuronal repellent slit inhibits leukocyte chemotaxis induced by chemotactic factors</article-title><source>Nature</source><volume>410</volume><fpage>948</fpage><lpage>952</lpage><pub-id pub-id-type="doi">10.1038/35073616</pub-id><pub-id pub-id-type="pmid">11309622</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yamamoto</surname> <given-names>N</given-names></name><name><surname>Kashiwagi</surname> <given-names>M</given-names></name><name><surname>Ishihara</surname> <given-names>M</given-names></name><name><surname>Kojima</surname> <given-names>T</given-names></name><name><surname>Maturana</surname> <given-names>AD</given-names></name><name><surname>Kuroda</surname> <given-names>S</given-names></name><name><surname>Niimi</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Robo2 contains a cryptic binding site for neural EGFL-like (NELL) protein 1/2</article-title><source>Journal of Biological Chemistry</source><volume>294</volume><fpage>4693</fpage><lpage>4703</lpage><pub-id pub-id-type="doi">10.1074/jbc.RA118.005819</pub-id><pub-id pub-id-type="pmid">30700556</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zakrys</surname> <given-names>L</given-names></name><name><surname>Ward</surname> <given-names>RJ</given-names></name><name><surname>Pediani</surname> <given-names>JD</given-names></name><name><surname>Godin</surname> <given-names>AG</given-names></name><name><surname>Graham</surname> <given-names>GJ</given-names></name><name><surname>Milligan</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Roundabout 1 exists predominantly as a basal dimeric complex and this is unaffected by binding of the ligand Slit2</article-title><source>Biochemical Journal</source><volume>461</volume><fpage>61</fpage><lpage>73</lpage><pub-id pub-id-type="doi">10.1042/BJ20140190</pub-id><pub-id pub-id-type="pmid">24673457</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zallen</surname> <given-names>JA</given-names></name><name><surname>Yi</surname> <given-names>BA</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>The conserved immunoglobulin superfamily member SAX-3/Robo directs multiple aspects of axon guidance in <italic>C. elegans</italic></article-title><source>Cell</source><volume>92</volume><fpage>217</fpage><lpage>227</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)80916-2</pub-id><pub-id pub-id-type="pmid">9458046</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zallen</surname> <given-names>JA</given-names></name><name><surname>Kirch</surname> <given-names>SA</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Genes required for axon pathfinding and extension in the C-elegans nerve ring</article-title><source>Development</source><volume>126</volume><fpage>3679</fpage><lpage>3692</lpage><pub-id pub-id-type="pmid">10409513</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>A</given-names></name><name><surname>Noma</surname> <given-names>K</given-names></name><name><surname>Yan</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2020">2020a</year><article-title>Regulation of gliogenesis by lin-32/Atoh1 in <italic>Caenorhabditis elegans</italic></article-title><source>G3: Genes, Genomes, Genetics</source><volume>10</volume><elocation-id>401547</elocation-id><pub-id pub-id-type="doi">10.1534/g3.120.401547</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>A</given-names></name><name><surname>Ackley</surname> <given-names>BD</given-names></name><name><surname>Yan</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2020">2020b</year><article-title>Vitamin B12 regulates glial migration and synapse formation through Isoform-Specific control of PTP-3/LAR PRTP expression</article-title><source>Cell Reports</source><volume>30</volume><fpage>3981</fpage><lpage>3988</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2020.02.113</pub-id><pub-id pub-id-type="pmid">32209461</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.57921.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Shen</surname><given-names>Kang</given-names></name><role>Reviewing Editor</role><aff><institution>Howard Hughes Medical Institute, Stanford University</institution><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Shen</surname><given-names>Kang</given-names> </name><role>Reviewer</role><aff><institution>Howard Hughes Medical Institute, Stanford University</institution><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>Your manuscript identified a new function of the SAX-3/ROBO guidance receptor in regulating glial cell migration. The finding that the ROBO ectodomain is secreted and interacts with a Ig adhesion receptor to guide glial cell migration broadens our understanding of receptor-ligand interactions in developmental neurobiology.</p><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;Robo functions as an attractive cue for glial migration through SYG-1/Neph&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, including Kang Shen as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Jonathan Cooper as the Senior Editor.</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is &quot;in revision at <italic>eLife</italic>&quot;. Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)</p><p>Summary:</p><p>All three reviewers found that this work is interesting for several reasons. For example, one reviewers wrote &quot;Dong and colleagues described a slit independent function of the well-known axon guidance receptor ROBO/SAX-3 in the migration of glial cells in <italic>C. elegans</italic>. They found that both ROBO and an IgSF protein SYG-1 were required for the glial cell migration. Through structure-function analyses, they found the extracellular domain of ROBO was sufficient to rescue the phenotype when overexpressed and they proposed that the extracellular domain of ROBO functions as a secreted ligand to attract SYG-1 expressing glial cell migration. The novelty of this manuscript lies in two folds. First, the development of glial cells are poorly understood. Second that this is the first paper to assign a secreted function of ROBO through interaction with SYG-1. The majority of the genetic data supports each other and is consistent with the model they proposed.&quot;</p><p>Essential revisions:</p><p>However, all three reviewers found that there are important experiments that need to be performed in order to fully support the model. They mostly fall into three areas. First, the use of mis-expression constructs using exogenous promoters is potentially risky in drawing conclusions about cellular locus of SAX-3 in this case. Second, inclusion of cleaner genetic experiments such as a knockin will strengthen the model. Three, there are several concerns about the masspec and biochemistry data presented. The detailed comments are as following:</p><p>1) Cell autonomy</p><p>Misexpression of SAX-3 and SYG-1 high-copy transgenes under control of Punc-33 for neurons and Pf53f4.13 for the amphid sheath cell is used to infer cell autonomy. There are three issues with this – first, these promoters are not specific, in particular Punc-33 is expressed prominently in the amphid socket which could also affect amphid sheath migration (Altun-Gultekin et al. Development 2001). Pitr-1 used for the over-migration experiment is also expressed in the amphid socket. Second, promoters can be expressed differently in embryos than larvae, so images of the expression pattern of Pf53f4.13 in 1.5 fold embryos in particular should be provided. Third, it is risky to base such a major claim on misexpression experiments especially since promoters can be expressed transiently in unexpected places, so these experiments should really include mosaic analysis as well. Alternatively, the authors can use additional sets of promoters to strengthen the arguments. For example, an amphid neuron promoter might be able to tested, as well as neurons that do not associate with the glial cells but still has a process in the nerve ring such as PVQ or AVA. There are promoters available for those experiments.</p><p>Figure 3H and I and crucial for the model. These are quite compelling results but I am not entirely sure about the interpretation of these results. The DA9 expression of itr-1 promoter does not turn on consistently until L3-L4. Do the sheath cells continue to grow in the <italic>sax-3</italic> single mutants expressing the transgene? To mimic more endogenous situation, the authors should use the lin-44 promoter which expresses embryonically.</p><p>2) Overexpression issues.</p><p>All rescue experiments are based on overexpression. At least one knockin should be done to show that the FN3(2) is required. For example, if FN3(2) is deleted using crispr, they can try to test if the it is required for slit function and for this new function of <italic>sax-3</italic>.</p><p>3) Binding to SYG-1</p><p>The syg-1 phenotype is convincing but the SAX-3 binding data is less convincing. First, the list of hits from the mass spec screen is not shown. How many other hits were there, what were they, and how did the representation of syg-1 compare? Second, there are no specificity controls (for the antibody or for the SAX-3-SYG-1 binding itself) in the IP experiments. This is especially important because the SAX-3 fragment is running at the wrong size in this experiment compared to all other gels in the paper.</p><p>Related to this issue, A. The mass spectrometric analysis is not explained. Presumably, the authors identified hundreds of peptides, many of which might have been non-specific – a common issue with such analysis. The fact that only two peptides covering 5% of SYG-1 were identified by mass spec (buried in supplement and not mentioned in text) implies that the confidence level for this identification was likely not high. This is generally fine; the authors followed up this finding with additional experiments. But a proper report of total number of peptides identified, cutoffs, and how SYG-1 stands out from the list of peptides is warranted. I suggest authors contact their mass spec facility for details and statistical analysis.</p><p>Additionally, the supplement shows one Asn labeled green in the second peptide by the mass spec analysis software. Does that imply a chemical modification/artifact that affected the mass of the peptide? The supplement, which is essential, could be explained better. Currently, it is a screen snapshot from an unknown piece of software that is not mentioned or cited.</p><p>B) The authors should report exact boundaries of their deletion constructs (ΔC, ΔC+TM, Ig(1-5)FN3(1), etc.) presented in Figures 1, 2 and 3, especially since they would be relevant for judging whether their manipulations (domain deletions or inclusions) could inadvertently cause misfolding of proteins, or where exactly the cleavage might be happening. It would help narrow down a binding site on the sequence for the proposed SYG-1 interaction. In addition, we'd know if they removed the long linker sequences shown to be important between some of the IG and FN domains (Barak et al., 2019; Aleksandrova et al., 2018; Pak et al., 2020), when they removed the domains. It would be of interest to see if proteolysis reported by Qu et al. matches that observed by Pak et al., 2020, between the first and second FN domains of human Robo3. On that remark, I cannot find how they draw their schematics for Figure 4 degradation product (containing two FN domains).</p><p>C) Authors present glial migration phenotypes for a set of truncations and deletions of SAX-3. The data provided is self-consistent with the biochemistry they present (which is sparse but enough for an initial study of this kind). However, they do not present data that shows that these deletions (such as IG(1-5) or FN3(1) in Figure 2, which did not rescue) are successfully expressed, make it to through the secretory machinery and are presented on/secreted from neurons. One exception is the FN3(2)Δ constructs, where they did show protein production, but not necessarily successful display on cells. These are useful controls that actually allow them to support their conclusions. It would also be preferable to see if the expression levels of these deletions are comparable to wild-type, so that the observed phenotypes are not due to underexpression of or overproduction of SAX-3. Due to the current circumstances with the coronavirus pandemic, the authors may be given a dispensation from completing these experiments, as long as they clarify the possibility that some of these constructs might not be produced and secreted/displayed in vivo, and hence the lack of rescue.</p><p>D) I do not understand the comment about FN domains being mostly structural, while IG domains are functional. If this is a general comment about IG/FN proteins such as Robo, one of the most prominent IG/FN receptors DCC/UNC-40 binds its Netrin ligand with the FN domains, not IG. If this is a comment about the FN domains of Robos not being &quot;functional&quot;, that's also not appropriate: While Slits bind the Robo IG domain 1, the other known extracellular ligand of Robos, the NELL proteins, bind the first FN domain of vertebrate Robos (Pak et al., 2020 and Yamamoto et al., 2019), the same domain identified by the authors for SYG-1 binding, and NELLs don't touch the IG domains.</p><p>In fact, the authors may want to discuss the relevance of the FN domains for Robo function, which was recently resolved in a burst of publications (the Pak et al., Yamamoto, et al., Barak et al. and Aleksandrova et al. manuscripts). The cleavage described here might actually act to open Robo receptors for binding other ligands, such as NELLs (not present in <italic>C. elegans</italic>) or SYG-1.</p><p>E).The authors do not show that the interaction is direct at any point in the manuscript. The pull-downs can simply be the result of a third protein mediating this interaction; this is not an uncommon occurrence. This does not make the paper less interesting, but the possibility has to be clearly mentioned across the manuscript.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Robo functions as an attractive cue for glial migration through SYG-1/Neph&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Jonathan Cooper (Senior Editor) and Kang Shen as a Reviewing Editor.</p><p>The manuscript has been improved and but there are some remaining issues that need to be addressed before acceptance, as outlined below: Can you address these points by providing more information and clarification in your writing when providing the revision.</p><p><italic>Reviewer #2:</italic></p><p>1) Cell autonomy experiments still depend exclusively on promoters whose expression and timing in the embryo, relative to AMsh migration, have not been determined. The images of AMsh-specific promoters (Figure 1—figure supplement 1G) appear to show different cells, one much more anterior than the other. Mosaic analysis was not performed.</p><p>2) In the mass spectrometry experiments, it appears that SYG-1 was one of the weakest hits detected, ranking below 1000 in the overall list. Even with aggressive filtering, SYG-1 is among a few dozen hits and appears at the level of background noise, consistent with the presence of a &quot;DECOY&quot; hit with identical results. This is not the impression given in the manuscript.</p><p>3) The relative position of the nerve ring and the AMsh in Figure —figure supplement 1D strongly suggests that the AMsh is tracking with the displaced nerve ring, contrary to the authors' interpretation. Due to COVID, the authors could not obtain videos of glial migration.</p><p>4) <italic>yad10</italic> is expected to encode a protein similar to the Ig(1-5)FN(1-3) fragment used for rescue. One possibility was that the mRNA is not expressed but the authors now show that is not the case. The <italic>yad10</italic> phenotype contradicts the overexpression results in which the N-terminal fragment of SAX-3 is sufficient for rescue.</p><p><italic>Reviewer #3:</italic></p><p>The authors responded to comments satisfactorily as much as I can judge. My geneticist colleagues should review the validity of the new experiments with the new promoters and the CRISPR deletion of the second FN3 domain.</p><p>I am not sure the statement &quot;Recent biochemical and structural studies show that the extracellular domains of Robo can dimerize through the fourth Ig domain, and this dimerization is inhibited by the second FN3 domain in the absent of Slit&quot; is strictly true. It may be safest to define this as &quot;FN3 domains&quot;, since both are involved FN3 domains are involved in a hairpin-like structure. Also, there is plenty of evidence that Robo1 is a dimer even when the FN3 domains are there, so I would say &quot;the dimerization may be inhibited&quot; to allow for multiple possibilities. Also see the typo, &quot;in the absent of&quot;.</p><p>Also, the last statement appears to be false. NELLs bind the first FN3 domain, not second, so they would not be binding the membrane-anchored fragment. NELLs probably should not be mentioned here at the end of the text at all. My initial comment was that the first FN3(1) domain is not a non-functional/only structural domain as implied by the original draft. NELLs do bind the first FN3 domain, and can turn on a repulsive Robo response.</p><p>I should also remind the authors that they still use inconsistent naming of the Fibronectin domains. Figure 1—figure supplement 1 has FN3-a and FN1 for the same domains in panels F and H. Or there is FN1 in Figure 3I, but refers to this domain as FN3-a in Figure 2F. Minor issue, but no reason to confuse readers.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.57921.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential revisions:</p><p>However, all three reviewers found that there are important experiments that need to be performed in order to fully support the model. They mostly fall into three areas. First, the use of mis-expression constructs using exogenous promoters is potentially risky in drawing conclusions about cellular locus of SAX-3 in this case. Second, inclusion of cleaner genetic experiments such as a knockin will strengthen the model. Three, there are several concerns about the masspec and biochemistry data presented. The detailed comments are as following:</p><p>1) Cell autonomy</p><p>Misexpression of SAX-3 and SYG-1 high-copy transgenes under control of Punc-33 for neurons and Pf53f4.13 for the amphid sheath cell is used to infer cell autonomy. There are three issues with this – first, these promoters are not specific, in particular Punc-33 is expressed prominently in the amphid socket which could also affect amphid sheath migration (Altun-Gultekin et al. Development 2001). Pitr-1 used for the over-migration experiment is also expressed in the amphid socket. Second, promoters can be expressed differently in embryos than larvae, so images of the expression pattern of Pf53f4.13 in 1.5 fold embryos in particular should be provided. Third, it is risky to base such a major claim on misexpression experiments especially since promoters can be expressed transiently in unexpected places, so these experiments should really include mosaic analysis as well. Alternatively, the authors can use additional sets of promoters to strengthen the arguments. For example, an amphid neuron promoter might be able to tested, as well as neurons that do not associate with the glial cells but still has a process in the nerve ring such as PVQ or AVA. There are promoters available for those experiments.</p><p>Figure 3H and I and crucial for the model. These are quite compelling results but I am not entirely sure about the interpretation of these results. The DA9 expression of itr-1 promoter does not turn on consistently until L3-L4. Do the sheath cells continue to grow in the sax-3 single mutants expressing the transgene? To mimic more endogenous situation, the authors should use the lin-44 promoter which expresses embryonically.</p></disp-quote><p>In the revised manuscript we repeated the key rescue experiments using a well established Pneuronal promoter, Prgef-1, an amphid neuron specific promoter, Parl-13, and another AMsh specific promoter Pf16f9.3, and all results supported our original conclusions that <italic>sax-3</italic> and syg-1 function in neurons and AMsh, respectively, to regulate AMsh migration (Figure 1D, Figure 2—figure supplement 1D, and Figure 3—figure supplement 1B). We also provided new data to show that both Pf53f4.13 (PAMsh) and Pf16f9.3 (PAMsh(2)) can drive expression in AMsh glia of 1.5-fold stage embryos (Figure 1—figure supplement 1G). To further confirm that ectopic expression of the SAX-3 extracellular cleavage fragment can attract AMsh migration in a syg-1 dependent manner, we expressed SAX-3(Ig1-5-FN3a) under the Plin-44 promoter, as suggested by the reviewer, and found that AMsh glial displayed the same syg-1 dependent AMsh migration defects as that in Pitr-1 transgenes (Figure 3H and 3I).</p><disp-quote content-type="editor-comment"><p>2) Overexpression issues.</p><p>All rescue experiments are based on overexpression. At least one knockin should be done to show that the FN3(2) is required. For example, if FN3(2) is deleted using crispr, they can try to test if the it is required for slit function and for this new function of sax-3.</p></disp-quote><p>In the revised manuscript, we generated a deletion allele of <italic>sax-3</italic>(<italic>yad175</italic>) by CRISPR-mediated recombination. <italic>yad175</italic> has an in frame deletion that removes the coding sequence of the second repeat of FN3 (FN3-b). <italic>yad175</italic> displays much stronger AMsh migration defects than <italic>sax-3</italic>(ky123, suggested null allele) and <italic>sax-3</italic>(<italic>yad10</italic>), while having relatively weaker vab head and AVM guidance defects than those in ky123 and <italic>yad10</italic> animals (Figure 1—figure supplement 1F, and Figure 2—figure supplement 1E). The vab head and AVM guidance defects are likely associated with the low <italic>sax-3</italic> mRNA level in <italic>yad175</italic> (about 50% of that in control animals, Figure 2—figure supplement 1D), which is likely caused by the deletion itself. In summary, even though being a weak allele, <italic>sax-3</italic>(<italic>yad175</italic>) has stronger defects in AMsh migration, further arguing the importance of the second FN3 repeat/SAX-3 cleavage in AMsh migration. The stronger AMsh migration defect displayed in <italic>yad175</italic> also suggests that ky123 may not be a completely null allele of <italic>sax-3</italic>.</p><disp-quote content-type="editor-comment"><p>3) Binding to SYG-1</p><p>The syg-1 phenotype is convincing but the SAX-3 binding data is less convincing. First, the list of hits from the mass spec screen is not shown. How many other hits were there, what were they, and how did the representation of syg-1 compare? Second, there are no specificity controls (for the antibody or for the SAX-3-SYG-1 binding itself) in the IP experiments. This is especially important because the SAX-3 fragment is running at the wrong size in this experiment compared to all other gels in the paper.</p><p>Related to this issue, A. The mass spectrometric analysis is not explained. Presumably, the authors identified hundreds of peptides, many of which might have been non-specific – a common issue with such analysis. The fact that only two peptides covering 5% of SYG-1 were identified by mass spec (buried in supplement and not mentioned in text) implies that the confidence level for this identification was likely not high. This is generally fine; the authors followed up this finding with additional experiments. But a proper report of total number of peptides identified, cutoffs, and how SYG-1 stands out from the list of peptides is warranted. I suggest authors contact their mass spec facility for details and statistical analysis.</p></disp-quote><p>In the revised manuscript, we provided a list of all SAX-3 binding proteins that were identified only in the 1.5-3 fold stage embryos (Supplementary file 2). In this experiment, we compared the proteins identified from IP-Mass spec of FLAG::SAX-3 in embryos in 16-44-cell and 1.5-3 fold stages, and identified proteins with specific interactions with SAX-3 only in 1.5-3 fold stage embryos. We also ran a similar experiment using IP of FLAG::INX-3(innexin/gap junction) in 1.5-3 fold stage embryos as a negative control for FLAG IP. All peptides identified were beyond cutoff and have a high confidence as mentioned in the new Materials and methods section. We have also added the detailed description of proteomics and data analyses in the updated Materials and methods section.</p><p>In Figure 2, the HA tag was fused at the end of SAX-3 C-terminal, and the “cleavage” band detected by the anti-HA antibody is the leftover fragment of the extracellular cleavage (about 70 kDa). In Figure 3, the FLAG tag was fused at the beginning of SAX-3 N-terminal (right after the signal peptide), and the cleavage band detected by the anti-FLAG antibody is the extracellular cleavage product (about 50-55 kDa). We apologize for the confusion, and have highlighted the position of HA and FLAG tags and the predicted size of each band in the updated figures. We also included additional controls (IgG control and transgene control) in the updated Figure 3B, and ran the IP products and inputs of SAX-3 in the same gel in which the SYG-1-Co-IPed SAX-3 extracellular fragment is about 55 kDa.</p><disp-quote content-type="editor-comment"><p>Additionally, the supplement shows one Asn labeled green in the second peptide by the mass spec analysis software. Does that imply a chemical modification/artifact that affected the mass of the peptide? The supplement, which is essential, could be explained better. Currently, it is a screen snapshot from an unknown piece of software that is not mentioned or cited.</p></disp-quote><p>The screen shot was the mass spec results analyzed by software called “Scaffold”. The green color of the Asparagine(N) means this amino acid was deamidated to either aspartic acid or isoaspartic acid. We added those details in the updated figure legend and Materials and methods sections. Thanks!</p><disp-quote content-type="editor-comment"><p>B) The authors should report exact boundaries of their deletion constructs (ΔC, ΔC+TM, Ig(1-5)FN3(1), etc.) presented in Figures 1, 2 and 3, especially since they would be relevant for judging whether their manipulations (domain deletions or inclusions) could inadvertently cause misfolding of proteins, or where exactly the cleavage might be happening. It would help narrow down a binding site on the sequence for the proposed SYG-1 interaction. In addition, we'd know if they removed the long linker sequences shown to be important between some of the IG and FN domains (Barak et al., 2019; Aleksandrova et al., 2018; Pak et al., 2020), when they removed the domains. It would be of interest to see if proteolysis reported by Qu et al. matches that observed by Pak et al., 2020, between the first and second FN domains of human Robo3. On that remark, I cannot find how they draw their schematics for Figure 4 degradation product (containing two FN domains).</p></disp-quote><p>In the revised manuscript, we added a description of exact boundaries of their deletion constructs in Figure 1—figure supplement 1H. The linker sequences were maintained in the deletion constructs. We revised the model and the SAX-3 extracellular cleavage fragments now only contain the first FN3 repeat. We apologize for the oversight.</p><disp-quote content-type="editor-comment"><p>C) Authors present glial migration phenotypes for a set of truncations and deletions of SAX-3. The data provided is self-consistent with the biochemistry they present (which is sparse but enough for an initial study of this kind). However, they do not present data that shows that these deletions (such as IG(1-5) or FN3(1) in Figure 2, which did not rescue) are successfully expressed, make it to through the secretory machinery and are presented on/secreted from neurons. One exception is the FN3(2)Δ constructs, where they did show protein production, but not necessarily successful display on cells. These are useful controls that actually allow them to support their conclusions. It would also be preferable to see if the expression levels of these deletions are comparable to wild-type, so that the observed phenotypes are not due to underexpression of or overproduction of SAX-3. Due to the current circumstances with the coronavirus pandemic, the authors may be given a dispensation from completing these experiments, as long as they clarify the possibility that some of these constructs might not be produced and secreted/displayed in vivo, and hence the lack of rescue.</p></disp-quote><p>In the revised manuscript, we provided new data to show that SAX-3(ΔFN3-b)::GFP has similar expression pattern and level as those of the full length of SAX-3::GFP (Figure 2—figure supplement 1C). We also examined the expression of IG(1-5)::GFP and FN1::GFP. However, these fragments are secreted into extracellular space and have very different expression patterns when compared with the full length of SAX-3::GFP, and we were not able to compare their expression with SAX-3 full-length. Therefore we toned down our conclusions regarding IG(1-5) and FN3(1). Thanks!</p><disp-quote content-type="editor-comment"><p>D) I do not understand the comment about FN domains being mostly structural, while IG domains are functional. If this is a general comment about IG/FN proteins such as Robo, one of the most prominent IG/FN receptors DCC/UNC-40 binds its Netrin ligand with the FN domains, not IG. If this is a comment about the FN domains of Robos not being &quot;functional&quot;, that's also not appropriate: While Slits bind the Robo IG domain 1, the other known extracellular ligand of Robos, the NELL proteins, bind the first FN domain of vertebrate Robos (Pak et al., 2020 and Yamamoto et al., 2019), the same domain identified by the authors for SYG-1 binding, and NELLs don't touch the IG domains.</p></disp-quote><p>We apologized for the confusion and have removed the comment about the FN domains in the revised manuscript.</p><disp-quote content-type="editor-comment"><p>In fact, the authors may want to discuss the relevance of the FN domains for Robo function, which was recently resolved in a burst of publications (the Pak et al., Yamamoto, et al., Barak et al. and Aleksandrova et al. manuscripts). The cleavage described here might actually act to open Robo receptors for binding other ligands, such as NELLs (not present in C. elegans) or SYG-1.</p></disp-quote><p>We have revised the Discussion section and highlighted the possibilities of other regulations mediated by the SAX-3 cleavage fragment including NElls. Thanks!</p><disp-quote content-type="editor-comment"><p>E) The authors do not show that the interaction is direct at any point in the manuscript. The pull-downs can simply be the result of a third protein mediating this interaction; this is not an uncommon occurrence. This does not make the paper less interesting, but the possibility has to be clearly mentioned across the manuscript.</p></disp-quote><p>We have updated the manuscript and added a sentence to summarize the IP results as “suggesting that SYG-1 can directly or indirectly bind with the SAX-3 extracellular cleavage fragment”. Thanks</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><disp-quote content-type="editor-comment"><p>The manuscript has been improved and but there are some remaining issues that need to be addressed before acceptance, as outlined below: Can you address these points by providing more information and clarification in your writing when providing the revision.</p><p>Reviewer #2:</p><p>1) Cell autonomy experiments still depend exclusively on promoters whose expression and timing in the embryo, relative to AMsh migration, have not been determined. The images of AMsh-specific promoters (Figure 1—figure supplement 1G) appear to show different cells, one much more anterior than the other. Mosaic analysis was not performed.</p></disp-quote><p>As our data shown in Figure 1—figure supplement 1G, both P<italic>f53f4.13</italic>, and P<italic>f16f9.3</italic> can drive expression of GFP in AMsh glia in embryos, which is consistent with a recent study published in Science ( “A lineage-resolved molecular atlas of <italic>C. elegans</italic> embryogenesis at single-cell resolution”), in which they showed that both <italic>f53f4.13</italic>, and <italic>f16f9.3</italic> mRNA were exclusively expressed in AMsh glia in embryos. In the same manuscript, they also presented data to show that in embryos <italic>arl-13</italic> was exclusively expressed in amphid neurons, and <italic>unc-33</italic> was broadly expressed in neurons. Based on this evidence, we believe that it is appropriate to reach our conclusion using these promoters, and we have cited the Science manuscript in the Materials and methods section to support the use of these promoters. The pictures of P<italic>f53f4.13</italic> and P<italic>f16f9.3</italic> reporters in embryos are not at identical developmental stages, which causes the appearance of slightly different positions of AMsh glia.</p><disp-quote content-type="editor-comment"><p>2) In the mass spectrometry experiments, it appears that SYG-1 was one of the weakest hits detected, ranking below 1000 in the overall list. Even with aggressive filtering, SYG-1 is among a few dozen hits and appears at the level of background noise, consistent with the presence of a &quot;DECOY&quot; hit with identical results. This is not the impression given in the manuscript.</p></disp-quote><p>We agree with the reviewer that SYG-1 was not abundantly detected in our proteomic studies, but as described in the Materials and methods section their interactions were true signals and were beyond the level of “background noise”. In this experiment, we had two control groups: one was the same transgene at the “non-cleavage” stage, and the other one was a membrane channel protein INX-3 at the same developmental stage, and we didn’t detect any SYG-1 peptides in those groups. The proteomic experiments were done twice, and the detection of SYG-1 peptides in 1.5-3 fold stage embryos but not in control groups were observed both times.</p><disp-quote content-type="editor-comment"><p>3) The relative position of the nerve ring and the AMsh in Figure 1—figure supplement 1D strongly suggests that the AMsh is tracking with the displaced nerve ring, contrary to the authors' interpretation. Due to COVID, the authors could not obtain videos of glial migration.</p></disp-quote><p>In the control animals AMsh glia migrate from their birth place, the nose region of the animals, toward the nerve ring, and terminate their migration at the region just past the nerve ring. There were no control adult animals we observed with any AMsh glia cell body anterior to the nerve ring. If the “AMsh is tracking with the displaced nerve ring”, we would not expect to see any change in the relative position of AMsh glia and the nerve ring in <italic>sax-3(lf)</italic> animals. However, that is not case as shown in Figure 1—figure supplement 1D. In <italic>sax-3(lf)</italic> animals about 60% of adult animals had at least one AMsh glia presiding at a region anterior to the nerve ring and closer to their birth place, supporting our conclusion that the AMsh migration defects are not a secondary effect of the displaced nerve ring. We apologize for the possible confusion, and we have revised this part in the manuscript to make it clearer.</p><disp-quote content-type="editor-comment"><p>4) yad10 is expected to encode a protein similar to the Ig(1-5)FN(1-3) fragment used for rescue. One possibility was that the mRNA is not expressed but the authors now show that is not the case. The yad10 phenotype contradicts the overexpression results in which the N-terminal fragment of SAX-3 is sufficient for rescue.</p></disp-quote><p>How a mutation affects gene expression is complicated, and detectable <italic>sax-3</italic> mRNA does not mean the protein can be expressed, folded, and released in a correct manner. It is still to be determined that how <italic>yad10</italic> affects <italic>sax-3,</italic> but the case like <italic>yad10</italic> is not unusual (at least in <italic>C. elegans</italic>).</p><disp-quote content-type="editor-comment"><p>Reviewer #3:</p><p>The authors responded to comments satisfactorily as much as I can judge. My geneticist colleagues should review the validity of the new experiments with the new promoters and the CRISPR deletion of the second FN3 domain.</p><p>I am not sure the statement &quot;Recent biochemical and structural studies show that the extracellular domains of Robo can dimerize through the fourth Ig domain, and this dimerization is inhibited by the second FN3 domain in the absent of Slit&quot; is strictly true. It may be safest to define this as &quot;FN3 domains&quot;, since both are involved FN3 domains are involved in a hairpin-like structure. Also, there is plenty of evidence that Robo1 is a dimer even when the FN3 domains are there, so I would say &quot;the dimerization may be inhibited&quot; to allow for multiple possibilities. Also see the typo, &quot;in the absent of&quot;.</p></disp-quote><p>Corrected.</p><disp-quote content-type="editor-comment"><p>Also, the last statement appears to be false. NELLs bind the first FN3 domain, not second, so they would not be binding the membrane-anchored fragment. NELLs probably should not be mentioned here at the end of the text at all. My initial comment was that the first FN3(1) domain is not a non-functional/only structural domain as implied by the original draft. NELLs do bind the first FN3 domain, and can turn on a repulsive Robo response.</p></disp-quote><p>We have removed the description about the potential interactions between NELLs and the membrane cleavage product.</p><disp-quote content-type="editor-comment"><p>I should also remind the authors that they still use inconsistent naming of the Fibronectin domains. Figure 1—figure supplement 1 has FN3-a and FN1 for the same domains in panels f and h. Or there is FN1 in Figure 3I, but refers to this domain as FN3-a in Figure 2F. Minor issue, but no reason to confuse readers.</p></disp-quote><p>Revised to FN3-a and FN3-b in all figures.</p></body></sub-article></article>