<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">58191</article-id><article-id pub-id-type="doi">10.7554/eLife.58191</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Immunology and Inflammation</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Drainage of inflammatory macromolecules from the brain to periphery targets the liver for macrophage infiltration</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-163078"><name><surname>Yang</surname><given-names>Linlin</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-5602-4157</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-163079"><name><surname>Jiménez</surname><given-names>Jessica A</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-163081"><name><surname>Earley</surname><given-names>Alison M</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0003-1889-9221</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-186311"><name><surname>Hamlin</surname><given-names>Victoria</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-186312"><name><surname>Kwon</surname><given-names>Victoria</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-163080"><name><surname>Dixon</surname><given-names>Cameron T</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-104877"><name><surname>Shiau</surname><given-names>Celia E</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-9347-9158</contrib-id><email>shiauce@unc.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Biology, University of North Carolina at Chapel Hill</institution><addr-line><named-content content-type="city">Chapel Hill</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution>Department of Microbiology and Immunology, University of North Carolina at Chapel Hill</institution><addr-line><named-content content-type="city">Chapel Hill</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Bagnat</surname><given-names>Michel</given-names></name><role>Reviewing Editor</role><aff><institution>Duke University</institution><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Stainier</surname><given-names>Didier YR</given-names></name><role>Senior Editor</role><aff><institution>Max Planck Institute for Heart and Lung Research</institution><country>Germany</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>31</day><month>07</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e58191</elocation-id><history><date date-type="received" iso-8601-date="2020-04-23"><day>23</day><month>04</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2020-07-27"><day>27</day><month>07</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Yang et al</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Yang et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-58191-v3.pdf"/><abstract><p>Many brain pathologies are associated with liver damage, but a direct link has long remained elusive. Here, we establish a new paradigm for interrogating brain-periphery interactions by leveraging zebrafish for its unparalleled access to the intact whole animal for in vivo analysis in real time after triggering focal brain inflammation. Using traceable lipopolysaccharides (LPS), we reveal that drainage of these inflammatory macromolecules from the brain led to a strikingly robust peripheral infiltration of macrophages into the liver independent of Kupffer cells. We further demonstrate that this macrophage recruitment requires signaling from the cytokine IL-34 and Toll-like receptor adaptor MyD88, and occurs in coordination with neutrophils. These results highlight the possibility for circulation of brain-derived substances to serve as a rapid mode of communication from brain to the liver. Understanding how the brain engages the periphery at times of danger may offer new perspectives for detecting and treating brain pathologies.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>inflammation</kwd><kwd>macrophage</kwd><kwd>liver infiltration</kwd><kwd>neutrophils</kwd><kwd>brain drainage</kwd><kwd>kupffer cells</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Zebrafish</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>1R35GM124719</award-id><principal-award-recipient><name><surname>Shiau</surname><given-names>Celia E</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>T32 ES007126</award-id><principal-award-recipient><name><surname>Jiménez</surname><given-names>Jessica A</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100007890</institution-id><institution>University of North Carolina at Chapel Hill</institution></institution-wrap></funding-source><award-id>UNC SURF fellowship</award-id><principal-award-recipient><name><surname>Yang</surname><given-names>Linlin</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Circulation of molecules from the brain can serve as a rapid mode of communication from the brain to the liver.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Whether a diseased or injured brain transmits signals to the periphery to activate a response is an interesting prospect in understanding brain-periphery communication, but remains underexplored. Interestingly, liver damage and neutrophil recruitment to the liver are common features in sepsis-related injury (<xref ref-type="bibr" rid="bib79">McDonald et al., 2012</xref>) and several central nervous system (CNS) pathologies (<xref ref-type="bibr" rid="bib21">Campbell et al., 2010</xref>; <xref ref-type="bibr" rid="bib36">Estrada et al., 2019</xref>), including traumatic brain injury, multiple sclerosis, and Alzheimer’s disease. A few recent studies have implicated a systemic, albeit most prominently a hepatic response to CNS inflammation due to CNS trauma or injury in mammals (<xref ref-type="bibr" rid="bib20">Campbell et al., 2005</xref>; <xref ref-type="bibr" rid="bib5">Anthony et al., 2012</xref>). However, the underlying mechanisms that may link brain inflammation with liver impairment remain unclear. The ability to track the cellular and molecular processes from the brain to the liver in vivo provides a direct means to understand the brain-liver association.</p><p>To investigate components of communication between the brain and periphery, we hypothesized that macrophages, key innate immune cells, capable of long-range migration and signaling (<xref ref-type="bibr" rid="bib35">Eom and Parichy, 2017</xref>), could act as mediators of brain-periphery communication. To this end, we investigated if a brain perturbation triggering inflammation, using a brain-localized LPS microinjection as an experimental means, could trigger a peripheral organ response mediated by macrophages. We employed the zebrafish because it offers unparalleled access to in vivo tracking and manipulation of molecular and cellular processes in the intact whole vertebrate animal from brain to peripheral organs, which are largely conserved from zebrafish to human (<xref ref-type="bibr" rid="bib100">Santoriello and Zon, 2012</xref>). Using zebrafish, we were able to directly capture the dynamic changes in macrophages occurring in the body after a focal brain challenge and found the liver to be the most prominent target peripheral organ for immune infiltration. Our data support the notion that infiltrating and resident macrophages in the liver may critically modulate CNS and systemic inflammation by shaping the hepatic response to circulating or widely distributed molecules that may be infectious, toxic, or exogenous.</p><p>A possible route through which the brain may affect liver function may simply be a drainage of effector molecules into circulation, albeit even at a trace level, to initiate systemic inflammation, rather than direct brain to liver signaling. While much research has focused on mechanisms penetrating the blood-brain barrier (BBB) or the blood-cerebrospinal fluid (BCSF) barrier to enable entry of a peripheral agent into the brain parenchyma such as those relating to infectious diseases causing brain dysfunction (for example, by neurotropic viruses including <italic>Rabies lyssavirus</italic>, West Nile virus, and cytomegalovirus) and drug delivery to the brain (<xref ref-type="bibr" rid="bib50">Hladky and Barrand, 2016</xref>; <xref ref-type="bibr" rid="bib114">van den Pol, 2009</xref>), far less attention has been given to investigating the reciprocal transfer from brain to circulation and its consequences. Limiting the free passage of solutes and large molecules into the CNS is tightly-regulated by both BBB and BCSF barriers to ensure protection of the CNS from inappropriate tissue damage and inflammation. By contrast, the removal of waste and toxic agents from the brain interstitial space to ensure normal brain health and function requires appropriate metabolism or efflux of these substances (<xref ref-type="bibr" rid="bib51">Hladky and Barrand, 2018</xref>). Previous studies on movement of CNS fluid and solutes indicate several possible routes of drainage of substances from the brain parenchyma including perivascular pathways that may exit through the CSF or lymph tracts, and the BBB (<xref ref-type="bibr" rid="bib51">Hladky and Barrand, 2018</xref>). Therefore, if the net outcome is some degree of systemic inflammation due to an efflux of inflammatory cues from the brain to circulation, even at a low level, then it could effectively target the liver, but this remains to be investigated.</p><p>Given that the liver is equipped to process a large fraction of the total blood circulation from two major blood supplies (<xref ref-type="bibr" rid="bib33">Eipel et al., 2010</xref>), the hepatic artery and portal vein from the gastrointestinal tract, it may not be surprising that the liver would be highly sensitive and responsive to inflammatory mediators and foreign agents in the blood flow. In fact, common and infectious bacteria (including <italic>Escherichia coli</italic>, <italic>Klebsiella pneumoniae</italic>, <italic>Salmonella typhimurium</italic> and <italic>Listeria monocytogenes</italic>) in the bloodstream have often been found to be cleared by the liver (<xref ref-type="bibr" rid="bib2">Adams, 2003</xref>; <xref ref-type="bibr" rid="bib43">Gregory et al., 1996</xref>). However, the mechanisms that specifically make the liver susceptible to systemic inflammation remain incompletely understood. Besides metabolic functions, the liver provides critical immune surveillance by recognizing and clearing away infectious, toxic, and microbial substances in the blood, a function that has largely been attributed to the Kupffer cells (<xref ref-type="bibr" rid="bib12">Bilzer et al., 2006</xref>; <xref ref-type="bibr" rid="bib65">Kubes and Jenne, 2018</xref>; <xref ref-type="bibr" rid="bib95">Racanelli and Rehermann, 2006</xref>). Systemic inflammation stemming from infection, toxic insults, and autoimmunity (<xref ref-type="bibr" rid="bib32">Edwards and Wanless, 2013</xref>) can cause chronic infiltration of leukocytes into the liver leading to liver damage and subsequent progression to fibrosis, cirrhosis or liver cancer (<xref ref-type="bibr" rid="bib61">Karlmark et al., 2008</xref>; <xref ref-type="bibr" rid="bib84">Mossanen and Tacke, 2013</xref>; <xref ref-type="bibr" rid="bib53">Huang et al., 2016</xref>). However, how the liver responds and contributes to systemic inflammation by way of leukocyte infiltration remains poorly understood, a process that has not been directly visualized in vivo for an open dissection.</p><p>Here, we reveal new insights into the cellular dynamics and critical roles of the IL-34 and MyD88 signaling pathways as well as Kupffer-cell-independent mechanisms in mediating immune infiltration of the liver in response to systemic lipopolysaccharides (LPS), classic pro-inflammatory bacteria-derived stimuli, after brain intraparenchymal LPS microinjection. By using fluorescently traceable LPS in the brain as an experimental paradigm, we show that inflammatory cues could originate from the brain and trigger immune infiltration of the liver, a process not previously appreciated involving drainage of the macromolecules from brain to circulation. Using comparative analyses, time-lapse imaging, and blocking circulation, we found that the effects of brain-LPS injection were largely recapitulated by intravenous LPS injection, and stemmed from systemic inflammation akin to sepsis or endotoxemia. We can block infiltration of immune cells into the liver by disrupting MyD88, a key adaptor of Toll-like receptors responsible for LPS recognition, or by eliminating the cytokine IL-34 pathway, and by reducing inflammation pharmacologically. Additionally, coordination between macrophages and neutrophils is also essential for the liver infiltration. Infiltration by macrophages and neutrophils negatively impacts the liver by promoting inflammation and disrupting normal hepatic growth. Taken together, changes in macrophage behavior involving immune cell infiltration of the liver may be triggered by drainage of inflammatory cues coming from the brain, providing a possible readout for an altered brain.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Brain immune activation is associated with macrophages infiltrating the liver prior to Kupffer cell establishment</title><p>Reciprocal connections between brain and liver are apparent in various conditions, including encephalopathy and encephalitis after severe liver damage (<xref ref-type="bibr" rid="bib18">Butterworth, 2013</xref>; <xref ref-type="bibr" rid="bib38">Felipo, 2013</xref>), liver disruption after traumatic brain injury (<xref ref-type="bibr" rid="bib120">Villapol, 2016</xref>; <xref ref-type="bibr" rid="bib75">Lustenberger et al., 2011</xref>), and intracerebral injection of pro-inflammatory cytokines (<xref ref-type="bibr" rid="bib20">Campbell et al., 2005</xref>). However, the routes of communication directly linking brain to liver remain poorly understood. To investigate one possible avenue of this, we sought to determine whether a brain perturbation such as inflammation could trigger macrophage activities corresponding to a response by the liver or other peripheral organs. To this end, we directly microinjected bacterial lipopolysaccharides (LPS) or <italic>E. Coli</italic> cells, well-established immune activators, into the brain tectum at four days post-fertilization (dpf) at a stage known to have a well formed brain with an established BBB (<xref ref-type="bibr" rid="bib58">Jeong et al., 2008</xref>) and choroid plexus/ventricle system (<xref ref-type="bibr" rid="bib48">Henson et al., 2014</xref>; <xref ref-type="bibr" rid="bib37">Fame et al., 2016</xref>) as previously described (<xref ref-type="bibr" rid="bib31">Earley et al., 2018</xref>). Stage-matched animals that were not injected or injected with the water vehicle in the brain were used as the control group (<xref ref-type="fig" rid="fig1">Figure 1</xref> and <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). To analyze a possible change in peripheral macrophages after brain-LPS injection at four dpf, we used whole-mount RNA in situ hybridization for a macrophage marker, <italic>mfap4</italic>, to characterize the macrophage distribution in the whole body. Strikingly, we found a robust and distinctive aggregation of macrophages in the liver and near the brain injection site, but not apparently elsewhere (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). By contrast, the uninjected and water injected controls at four dpf were devoid of macrophages in the liver (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). We also found at least some of these macrophages in the liver to be activated based on their expression of the mitochondrial enzyme gene <italic>irg1/acod1</italic> (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>) known to be highly upregulated during inflammation and specifically induced in inflammatory macrophages in zebrafish (<xref ref-type="bibr" rid="bib68">Lampropoulou et al., 2016</xref>; <xref ref-type="bibr" rid="bib99">Sanderson et al., 2015</xref>). Both injections of LPS or live <italic>E. coli</italic> cells into the brain led to macrophage presence in the liver, albeit LPS effects were consistently stronger (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>).</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Induction of brain inflammation triggers macrophage infiltration into the liver.</title><p>(<bold>a</bold>) Time-course of Kupffer cell development. Total macrophage numbers (<italic>mpeg1:GFP</italic>+) per liver from 4 to 14 days post-fertilization (dpf) and macrophage density (number per field of view) from dissected livers at juvenile adult stages from 26 to 40 dpf. Standard length corresponding to each stage is shown. Kupffer cells are not present at four dpf at the time of brain microinjection and during most of the experimental period (orange box). Feeding began after six dpf to ensure normal animal development. Fluorescent images on the right show dissected whole liver with the typical three-lobed structure at 40 dpf (top) and high magnification of top dotted box region showing Kupffer cells (bottom). LL, Left lobe; RL, right lobe; VL, ventral lobe. (<bold>b</bold>) Schematic of brain microinjection at four dpf and analysis of the hepatic response at 8–10 hr post injection (hpi), 24–30 hpi, and 48 hpi. A, anterior; P, posterior; V, ventral; D, dorsal. (<bold>c</bold>) Quantification of macrophage infiltration in the liver comparing between LPS and control water injections in the brain at four dpf and analyzed at different timepoints. Numbers below bar graphs represent <italic>n</italic>, number of animals analyzed. (<bold>d</bold>) At eight hpi, single-plane image from a z-stack shows infiltrated macrophages (GFP+, arrows) nested between hepatocytes (DsRed+) in the liver (dotted region) after brain-LPS injection, but no macrophages observed in control brain-water injection. (<bold>e</bold>) At 48 hpi, images from two separate z-planes show an abnormally large number of macrophages in the liver that persists after brain-LPS injection (arrows), while few presumably Kupffer cells begin to appear in control brain-water injected animals at this timepoint (arrow). Two-tailed Welch’s t-test was used to determine statistical significance for each pair-wise comparison. One-way ANOVA test for comparing the three LPS injection groups. sem, standard error of means; ns, not significant; **, p&lt;0.01; ***, p&lt;0.001.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig1-v3.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Whole-body analysis using RNA in situ hybridization shows abnormal localization of macrophages in the liver after brain injection of LPS or bacteria.</title><p>(<bold>a</bold>) Schematic showing injection of substances (yellow) in the tectum parenchyma (blue) in the four dpf zebrafish larva and subsequent analysis of the periphery that highlights the most prominent change in the liver (red). A, anterior; P, posterior; D, dorsal; V, ventral. (<bold>b</bold>) In the four dpf zebrafish, macrophages (<italic>mfap4</italic>+) are normally absent in the liver (dotted region) while sparsely spread throughout the body (arrowheads) as shown in larvae which were uninjected or water vehicle injected in the brain at six hpi. By contrast, after LPS injection in the brain, strong expression of macrophage marker <italic>mfap4</italic> is found in the liver (dotted region), while the brain injection site is often also accompanied by a <italic>mfap4</italic> expression increase (arrow). (<bold>c</bold>) Analysis of zebrafish macrophage-specific markers <italic>mfap4</italic> and <italic>irg1</italic> in the liver (dotted region) after brain injections with water vehicle, <italic>E. coli</italic>, or LPS. Results indicate that both LPS and <italic>E. coli</italic> injections induce ectopic localization of macrophages in the liver, which appear to be activated (expressing <italic>irg1</italic>) at least in a subset, but no macrophages in the liver in control animals.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig1-figsupp1-v3.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 2.</label><caption><title>In vivo time-lapse imaging shows dynamic movements and processes of infiltrating macrophages in the liver at short- (10 hpi) and long- (48 hpi) term timepoints after brain-LPS injection.</title><p>Single slice images from z-stacks taken using a 40x objective correspond to <xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref>. (<bold>a</bold>) Representative single-slice images of three timepoints from time-lapse imaging of macrophage infiltration at 10 hr post injection of LPS in the brain. Top, merged channels of <italic>mpeg1:GFP</italic> labeling macrophages and <italic>fabp10a:DsRed</italic> labeling hepatocytes; middle, DsRed channel showing hepatocytes and pronephros; bottom, GFP channel showing macrophages. Pronephros are labeled because the red fluorescent dextran used as a tracer for the brain injection gets into circulation and is filtered by the pronephros. (<bold>b</bold>) Representative static single-slice images of the whole liver and macrophages at 48 hpi of LPS in the brain. Yellow arrows, infiltrating macrophages; red arrow in <bold>a</bold>), circulating monocyte/macrophage; red arrow in <bold>b</bold>), macrophage with elaborate long processes intercalated between hepatocytes. Blue arrows in <bold>b</bold>), peripheral macrophages not in the liver.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig1-figsupp2-v3.tif"/></fig><fig id="fig1s3" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 3.</label><caption><title>Brain-LPS injection was not found to induce <italic>mfap4</italic> expression in the liver.</title><p>(<bold>a</bold>) Comparison between control uninjected and brain-LPS injected in double transgenic four dpf larvae was made at 16 hpi. Fluorescent reporters for liver (<italic>fabp10a:BFP</italic>) and macrophages (<italic>mfap4:tdTomato</italic>) were used for in vivo imaging to determine whether ectopic induction of <italic>mfap4</italic> may occur in hepatocytes due to LPS activation. Representative single 2 µm z-plane images do not show ectopic expression of <italic>mfap4</italic> other than in infiltrating macrophages in the liver (which are stereotypically located near or within liver sinusoids or gaps between hepatocytes) after LPS injection. Coinciding with a lack of macrophage infiltration in the control animals, no <italic>mfap4</italic> expression was observed in the liver (demarcated by dotted line). (<bold>b</bold>) Scatter plot shows analysis of macrophage infiltration in the liver using the double transgenic larvae. Brain-LPS injection causes infiltration of <italic>mfap4:tdTomato</italic> expressing macrophages but not in the control uninjected animals. (<bold>c</bold>) Quantification of liver cells expressing <italic>mfap4</italic> shows none did. Individual slices through entire z-stack of whole liver were assessed for co-expression of hepatocyte reporter with the <italic>mfap4</italic> reporter. In all plots, each symbol represents an independent larva analyzed. Two-tailed student’s t-test was used to determine statistical significance.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig1-figsupp3-v3.tif"/></fig><fig id="fig1s4" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 4.</label><caption><title>Macrophages infiltrate the liver through vasculature and vasculature-independent routes.</title><p>Double transgenic zebrafish expressing the macrophage <italic>mpeg1:GFP</italic> and endothelial <italic>kdrl:mCherry</italic> reporters were used to localize infiltrating macrophages after brain-LPS injection at 8–10 hpi in the four dpf zebrafish. (<bold>a–f</bold>) Representative images corresponding to <xref ref-type="video" rid="video3">Video 3</xref>. a, b, c 3D volumetric view of whole liver (demarcated by a dotted line) and surrounding region taken from three timepoints of a confocal time-lapse imaging (see <xref ref-type="video" rid="video3">Video 3</xref>) of an 80 µm z-stack at 40x. d, e, f High magnification of the boxed region shown in the corresponding left panels. Representative infiltrating macrophages are labeled numerically 1–5 with their relative position to the vasculature: inside (white arrow), associated (blue arrow), or independent of vasculature (yellow arrow).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig1-figsupp4-v3.tif"/></fig><fig id="fig1s5" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 5.</label><caption><title>Long-term in vivo tracking of infiltrating macrophages shows that occupation time in the liver can be used for their classification.</title><p>(<bold>a</bold>) Representative 3D images from six timepoints corresponding to <xref ref-type="video" rid="video4">Video 4</xref> from a four dpf zebrafish which was brain-LPS injected and imaged starting at 12 hpi. Infiltrating macrophages can be classified into three groups (examples shown by arrows of different colors): circulating (present in only a single timepoint), transient (<underline>&lt;</underline>2 hr) and residing cell (&gt;2 hr). Double transgenic zebrafish labeling macrophages (<italic>mpeg1:GFP</italic>) and hepatocytes (<italic>fabp10a:DsRed</italic>) were used to track macrophage infiltration over a 10 hr period. Color overlay of both channels and single GFP channel in grayscale for macrophages are shown. LPS was co-injected with Alexa 568 conjugated dextran to validate brain injections and detect systemic distribution of the injected material based on labeling of the pronephros by the fluorescent dextran. Labeling of pronephros has been previously described after intravenous injection of a fluorescent tracer (<xref ref-type="bibr" rid="bib89">Oltrabella et al., 2015</xref>), but labeling of proximal kidney tubules can also be observed in transgenic lines expressing a red fluorescent protein. (<bold>b</bold>) 2D projection of the tracking of infiltrating macrophages in the entire liver over all timepoints of analysis. Each traced cell is represented by a circle for its location at each timepoint if present in the liver, and a line for its movement between the timepoints. Different colors represent different cells. (<bold>c</bold>) Relative percentage of the different types of infiltrating macrophages based on liver occupation. n = 47 macrophages were tracked and analyzed. (<bold>d</bold>) Scatter plot shows the total duration of each traced infiltrating macrophage in the ‘transient’ and ‘residing’ groups. (<bold>e</bold>) Total distance and average speed of each macrophage in the ‘transient’ and ‘residing’ groups. Total distance was not significantly different, but the ‘transient’ macrophages moved faster with a significantly higher average speed than the ‘residing’ cells. sd, standard deviation; ns, not significant.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig1-figsupp5-v3.tif"/></fig></fig-group><p>To relate macrophage presence in the liver after brain-LPS injection to macrophages that normally reside in the liver (which we refer to as Kupffer cells), we analyzed the developmental timing of Kupffer cells, which had not been previously described, starting at the four dpf larval stage to the 40 dpf juvenile adult stage (<xref ref-type="fig" rid="fig1">Figure 1a</xref>). We found normally an absence of Kupffer cells at the stage of our brain microinjection at four dpf (0.2 ± 0.4 standard deviation (s.d.) per liver), few to none at 5–6 dpf (4.0 ± 2.2 s.d. per liver), and once larvae were fed and moved into the fish facility, Kupffer cell numbers grew substantially (78.2 ± 14.9 s.d. per area of liver at 26 dpf) reaching to hundreds per liver in the juvenile adults (26–40 dpf at 9–12.5 mm standard length) (<xref ref-type="fig" rid="fig1">Figure 1a</xref>). Prior to this work, Kupffer cells were thought to be missing or sparse in zebrafish and other teleost species (<xref ref-type="bibr" rid="bib42">Goessling and Sadler, 2015</xref>; <xref ref-type="bibr" rid="bib98">Sakano and Fujita, 1982</xref>), but recent work tracing adult zebrafish Kupffer cells to their hematopoietic origin (<xref ref-type="bibr" rid="bib47">He et al., 2018</xref>), and the data presented here collectively provide the first evidence for the prevalence of Kupffer cells in the zebrafish liver akin to their mammalian counterpart. Since the brain-LPS injection and subsequent analysis were conducted at four dpf, before the establishment of Kupffer cells, the presence of macrophages in the liver was likely because of active recruitment of peripheral macrophages and monocytes.</p><p>We subsequently conducted a time-course analysis of macrophage activities after brain-LPS injection at four dpf to determine if macrophages were actively infiltrating the liver. Using in vivo static and time-lapse imaging in double transgenic zebrafish expressing both the macrophage reporter <italic>mpeg1:GFP</italic> and the liver hepatocyte reporter <italic>fabp10a:DsRed</italic>, we observed macrophages actively migrating or circulating into the liver, affirming the in situ results (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). We captured macrophage dynamics in the liver region at 8–10 hr post-injection (hpi) of LPS in the brain (<xref ref-type="video" rid="video1">Video 1</xref> and <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>) when substantial numbers of infiltrating macrophages can be observed. Conversely, the brain-water injected controls mostly had zero macrophages in the liver (average of 1.4 ± 1.2 standard deviation (s.d.) macrophages per liver) compared with an average of 13.2 ± 6.6 s.d. macrophages per liver after brain-LPS injection (<xref ref-type="fig" rid="fig1">Figure 1b–e</xref>). Later at 24–30 hpi and 48 hpi, significant numbers of macrophages in the liver persisted even two days after brain-LPS injection (11.2 ± 6.3 s.d. and 13.1 ± 6.1 s.d. macrophages per liver, respectively) (<xref ref-type="fig" rid="fig1">Figure 1c</xref>, <xref ref-type="video" rid="video2">Video 2</xref> and <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). At these later timepoints, a few Kupffer cells may begin to emerge at less than five per liver (<xref ref-type="fig" rid="fig1">Figure 1c</xref>). In agreement with the timeline of Kupffer cell development (<xref ref-type="fig" rid="fig1">Figure 1a</xref>), only a few macrophages were detectable in uninjected and water-injected controls at the two later timepoints (3.1 ± 1.8 s.d. and 3.9 ± 2.8 s.d. macrophages per liver, respectively) (<xref ref-type="fig" rid="fig1">Figure 1c</xref>). Macrophages in the liver at 48 hpi appeared more stationary than earlier at 8–10 hpi (<xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref>, and <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). In all timepoints of analysis, infiltrated macrophages in the liver were found in several locations, including inside the sinusoids (liver microvessels) similar to that described during mammalian liver injury (<xref ref-type="bibr" rid="bib56">Iwakiri et al., 2014</xref>), and surprisingly also in the parenchyma intermingling with hepatocytes (<xref ref-type="fig" rid="fig1">Figure 1d–e</xref>, <xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref>, <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>), a macrophage behavior previously not known. Due to some examples of broad liver <italic>mfap4</italic> in situ expression (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>) in comparison to a discrete number of infiltrating macrophages by live imaging after brain-LPS injection (<xref ref-type="fig" rid="fig1">Figure 1</xref>), we assessed whether this could be explained by an induction of ectopic <italic>mfap4</italic> expression in the liver upon LPS activation (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>). Using a transgenic line <italic>mfap4:tdTomato</italic> to mark cells expressing the <italic>mfap4</italic> gene, we found <italic>mfap4</italic> restricted to macrophages and absent in liver cells (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>), suggesting the broad liver <italic>mfap4</italic> expression may be diffuse in situ signals coming from a liver more densely populated by infiltrated macrophages. To analyze the nature of physical contact of infiltrated macrophages to the hepatic sinusoids after brain-LPS injection, we imaged double transgenic zebrafish expressing the endothelial (<italic>kdrl:mCherry</italic>) and macrophage (<italic>mpeg1:GFP</italic>) reporters. Time-lapse imaging showed that macrophages can actively infiltrate the hepatic sinusoids, as well as be associated or entirely independent of the hepatic vasculature (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref> and <xref ref-type="video" rid="video3">Video 3</xref>).</p><media id="video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video1.mp4"><label>Video 1.</label><caption><title>Time-lapse imaging of macrophages infiltrating the liver 10 hr after brain-LPS injection.</title><p>Representative single z-plane through the liver (<italic>fabp10a:DsRed</italic>+) shown from confocal imaging of one z-stack every 1 min and 15 s for ~1 hr using a 40x objective. A range of dynamic macrophage (<italic>mpeg1:GFP</italic>+) behaviors is shown: some nestled in gaps between hepatocytes presumably in the sinusoids while others either circulate or traverse the liver back and forth with long processes. Left panel shows the merge channel and the right panel shows single GFP channel for macrophages. Movie file shown at 30 fps. See <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref> for additional description. Arrows, infiltrated macrophages. Dotted line, liver area.</p></caption></media><media id="video2" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video2.mp4"><label>Video 2.</label><caption><title>Time-lapse imaging of macrophages infiltrating the liver 48 hr after brain-LPS injection.</title><p>Representative single z-plane through the liver (<italic>fabp10a:DsRed</italic>+) shown from confocal imaging of one z-stack every 1 min for ~1 hr using a 40x objective. Macrophages (<italic>mpeg1:GFP</italic>+) in the liver (<italic>fabp10a:DsRed</italic>+) appear to be more stationary than at the earlier timepoint at eight hpi. Varied morphology still apparent from individual macrophages with long processes to a rounded cell shape with little to no apparent processes. Movie file shown at 30 fps. See <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref> for additional description.</p></caption></media><media id="video3" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video3.mp4"><label>Video 3.</label><caption><title>Association of infiltrating macrophages with the vasculature in vivo 8 hr after brain-LPS injection.</title><p>3D view of a time-lapse imaging of an 80 µm volume from four dpf zebrafish injected with LPS showing the liver region encompassing the hepatic vasculature (<italic>kdrl:mCherry</italic>+) and macrophages (<italic>mpeg1:GFP</italic>+). One z-stack was acquired every 90 s for over a 5 hr period using a 40x objective. Three types of macrophage association with vasculature observed: inside, associated, or independent of vasculature. See <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref> for additional description.</p></caption></media><p>To determine whether this infiltration endured over time, we examined the number of liver-infiltrating macrophages over a two-day period after brain-LPS injection. Results indicate no significant change in macrophage presence in liver, suggesting that infiltrated macrophages either stayed in the liver, moved in and out of the liver at similar rates, or both. To distinguish these possibilities, we tracked these infiltrating macrophages directly in vivo over a continuous 10 hr period after brain-LPS injection at four dpf starting at 12 hpi. Using live cell tracking, we found a small number (~13%) of infiltrating macrophages that stayed in the liver longer than 2 hr, including occasional infiltrates which remained in the liver past the total duration of imaging (&gt;9 hr) (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref> and <xref ref-type="video" rid="video4">Video 4</xref>). Infiltrating macrophages were coined ‘residing’ when they occupied the liver for more than 2 hr, and these were on average moving slower at 1.1 ± 0.7 µm/min than the ‘transient’ population at 2.2 ± 1.1 µm/min which occupied the liver for more than one timepoint (2 min) but less than 2 hr (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref>). We found a significant fraction (~30%) of infiltrating macrophages to be of the ‘transient’ type, while the majority at 57.4% were circulating (detected only in a single timepoint) (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref>). Both the ‘residing’ and ‘transient’ populations were not truly stationary but rather moved dynamically back and forth across the liver parenchyma amounting to large total distances traveled over time (309.2 ± 285.9 µm s.d. and 62.8 ± 66.7 µm s.d. in 560 min of tracking, respectively) (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref> and <xref ref-type="video" rid="video4">Video 4</xref>). These results indicated that both the presence of short- and long-term occupying macrophages accounted for the sustained large macrophage number in the liver even two days after brain-LPS injection (<xref ref-type="fig" rid="fig1">Figure 1c</xref>).</p><media id="video4" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video4.mp4"><label>Video 4.</label><caption><title>In vivo long-term tracking of infiltrating macrophages in the liver at 12 hr after brain-LPS injection for a 10 hr continuous period.</title><p>3D view of a time-lapse imaging corresponding to a 6 µm volume collected every 2 min for a 10 hr period starting at 12 hpi at four dpf using a 40x objective. Left panel, merged channel for hepatocytes (<italic>fabp10a:DsRed</italic>) and macrophages (<italic>mpeg1:GFP</italic>). Right panel, GFP channel alone for showing macrophages. Dextran-Alexa 568 was co-injected into the brain as a tracer to validate injections, and can be seen labeling the pronephros in the DsRed channel. Circulating, transient, and residing macrophages can be observed within the liver tissue with varied cellular dynamics from being rounded and rapidly flowing through the liver to being ramified and migrating back and forth traversing the liver, respectively. See <xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref> for additional description. Movie file shown at 30 fps.</p></caption></media></sec><sec id="s2-2"><title>Microinjection of LPS into brain leads to systemic LPS distribution triggering immune infiltration of the liver</title><p>To understand how LPS in the brain may lead to liver effects, we first determined whether the injected LPS remained restricted to the brain or possibly transferred to the periphery over time. We used fluorescently tagged LPS to directly track the LPS molecules after brain tectum microinjection in the whole body for a continuous 24 hr period (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="video" rid="video5">Video 5</xref>). This provides a means to visualize binding, transport, and internalization of LPS in the brain and body. Fluorescently tagged dextran was used as a control tracer to analyze the general molecular distribution independent of LPS (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="video" rid="video6">Video 6</xref>) and to verify successful injections. Initially the LPS macromolecules injected into the brain parenchyma were restricted to the focal location of the injection site but quickly within seconds they filled the cerebral ventricles joining the cerebrospinal fluid (CSF) as they continue to flow into the spinal canal in an anteroposterior direction (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="video" rid="video7">Video 7</xref>), thus our zebrafish brain microinjections are comparable to mammalian intracerebroventricular injections (<xref ref-type="bibr" rid="bib41">Glascock et al., 2011</xref>).</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Brain-LPS microinjection leads to drainage of LPS molecules into circulation, and causes a hepatic response similar to intravenous LPS injection.</title><p>(<bold>a</bold>) Schematic showing time-course of LPS and macrophage distribution. Fluorescently Alexa 594 tagged LPS shown in red, co-tracer dextran-cascade blue shown in blue, and detection of both is shown in magenta. (<bold>b</bold>) Left, representative 3D images from three timepoints of a 24-hour time-lapse imaging of a large frame stitched from four z-stack tiles (corresponding to <xref ref-type="video" rid="video5">Video 5</xref>). Right, high magnification of the 3D images in dotted box region on the left panel showing liver (dotted region) and surrounding area. Merged overlays and individual channels showing Dex-CB (blue), LPS-594 (red), and macrophages (<italic>mpeg1:GFP</italic>+). (<bold>c</bold>) Live recording of the brain microinjection at four dpf using Alexa 594 or Alexa 488 conjugated LPS was conducted to trace the distribution of LPS in real time at 1 frame per second using an automated acquisition software on a Leica M165 FC stereomicroscope with a high speed and high sensitivity deep-cooled sCMOS camera (DFC9000 GT). Kinetic time plot of relative fluorescence change ± sem of fluorescently tagged LPS starting before the injection at 0 seconds; data from three independent injected animals were used to generate plot. Time of injection was at the 4 seconds timepoint. Arrows indicate the timepoint at which initial LPS signals were detected in the corresponding anatomical location. In some injected animals, LPS also flowed anteriorly from the midbrain ventricle into the telencephalon ventricle starting at about 2.5 minutes after injection (see <xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3</xref>). (<bold>d</bold>) Still images representing key events of the dispersion of LPS starting from before to nearly 1 hour after the brain microinjection corresponding to <xref ref-type="video" rid="video7">Video 7</xref>. hb, hindbrain; tele, telencephalon; hbv, hindbrain ventricle; mb, midbrain; FL, facial lymphatics; blec, brain lymphatic endothelial cells; CSF, cerebrospinal fluid; ISF, interstitial fluid. (<bold>e</bold>) Schematic showing the major route through which LPS were transferred from the site of brain microinjection to peripheral circulation. (<bold>f</bold>) Top, illustration of brain and intravenous LPS injections. Bottom, 3D tectum brain volume from confocal live imaging at four dpf at 6 hours after brain or intravenous LPS injection using a 40x objective. Microglia (<italic>mpeg1:GFP</italic>+) and surrounding neurons (<italic>nbt:DsRed</italic>+) shown. Small panels show high magnification of microglia (arrows) and neurons corresponding to arrows in the large 3D brain volume image on the left. LPS injection in the brain led to a striking morphological activation of rounded and clustering microglia (arrows), but not by intravenous injection of LPS at 6 hpi. Superficial planes of the head are eliminated to allow visualization of the internal microglia, because the cranial skin surface is highly auto-fluorescent in the GFP channel. (<bold>g</bold>) Quantification of macrophage infiltration at 8-10 hpi in the four dpf zebrafish larvae. Two-tailed Welch’s t-test was used to determine statistical significance. sd, standard deviation; ns, not significant; ****, p&lt;0.0001; LPS-594, LPS-Alexa 594; Dex-CB, cascade blue conjugated dextran, sem, standard error of means. Numbers in parenthesis represent <italic>n</italic>, number of animals analyzed.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig2-v3.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Injected LPS macromolecules disperse from the hindbrain ventricle into the hindbrain and spinal cord/trunk interstitial spaces and are localized within the head and trunk lymphatics.</title><p>Wild-type double transgenic zebrafish at four dpf were microinjected with fluorescently tagged LPS in the tectal brain. To localize the LPS relative to the lymphatic and vasculature structures, two transgenes were used: <italic>mrc1a:GFP </italic>(<xref ref-type="bibr" rid="bib60">Jung et al., 2017</xref>) and <italic>kdrl:mCherry </italic>(<xref ref-type="bibr" rid="bib39">Fujita et al., 2011</xref>), respectively. Since <italic>mrc1a:GFP</italic> is known to also be expressed by macrophages (<xref ref-type="bibr" rid="bib60">Jung et al., 2017</xref>), we generated a new macrophage reporter (<italic>mpeg1:BFP</italic>) to provide a third channel in blue to distinguish lymphatic from macrophage expressions. Blue arrows point to microglia/macrophage. (<bold>a</bold>) Three multi-tiled representative frontal plane optical slices from an in vivo confocal z-stack at 1.5 hpi show top, middle, and bottom sections through the head and anterior trunk of the LPS-injected animal. (<bold>b</bold>) Schematic of the frontal plane optical sections imaged. (<bold>c, d</bold>) High magnification images corresponding to dotted region in top slice in <bold>a</bold>). Most superficial layer of the CNS where LPS (red) is concentrated in the hindbrain ventricle and adjacent interstitial parenchymal space (c, asterisk) as well as the most-dorsal junction of the hindbrain-spinal cord (d, asterisk). (<bold>e, f</bold>) High magnification images of dotted region in middle slice shown in <bold>a</bold>). LPS is found localized to the lymphatic structures (blec and islv), and abundant in the interstitial space extending from the hindbrain ventricle (asterisk). (<bold>g,h</bold>) High magnification images corresponding to bottom slice in <bold>a</bold>). LPS is highly abundant in the spinal canal (sc) as well as tectal and hindbrain lymphatic cells (blec). (<bold>i</bold>) Top and middle slices of a different LPS-injected animal show the same distribution of LPS at 1.5 hpi. LPS does not appear to localize within the blood vasculature in the CNS or trunk to the same extent as it overlaps with the lymphatic cells. Top slice shows vasculature DLAV surrounded by but not overlap with LPS, arrows. *, interstitial space; DLAV, dorsal longitudinal anastomotic vessels; DLLV, dorsal longitudinal lymphatic vessel; blec, brain lymphatic endothelial cells; islv, intersomitic lymphatic vessels; sc, spinal canal; hv, hindbrain ventricle; hb, hindbrain; lym, lymphatics. Skin is highly auto-fluorescent and labeled by all channels at the border of every tissue. Scale bars all show 50 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig2-figsupp1-v3.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Injected LPS macromolecules into tectal brain results in distribution of LPS within the facial lymphatic network and peripheral vasculature.</title><p>(<bold>a</bold>) Schematic of the sagittal optical planes taken by in vivo multi-tiled z-stack confocal imaging. (<bold>b</bold>) Whole-mount side view of a representative LPS-injected four dpf larvae carrying the vasculature reporter <italic>kdrl:mCherry</italic> at 12 hpi showing LPS strongly retained in the hindbrain ventricle (hv) and surrounding brain interstitial space as well as the brain and facial lymphatics (blec and FL, arrows) and the peripheral vasculature (PCV and PHS, arrows), but not in the brain blood vessels (vas). (<bold>c</bold>) High magnification of dotted region in <bold>b</bold>) showing uptake of LPS as fluorescent puncta (arrows) by the PCV, but LPS is absent in the hepatic region. (<bold>d</bold>) Characterization of the same timepoint at 12 hpi as in <bold>b–c</bold>) using fish carrying the lymphatic reporter clearly show localization of LPS within the facial lymphatics (FL, arrows). By stark contrast, LPS is not localized to the brain vessels, thereby providing evidence for drainage of LPS from brain to peripheral circulation through the lymphatics via the interstitial fluid. (<bold>e</bold>) Higher magnification of dotted box region in <bold>d</bold>). FL, facial lymphatics; PHS, primary head sinus; PCV, posterior cardinal vein; blec, brain lymphatic endothelial cells; sc, spinal canal; hv, hindbrain ventricle; vas, brain vessels; mb, midbrain; *, interstitial space. Scale bars all show 50 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig2-figsupp2-v3.tif"/></fig><fig id="fig2s3" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 3.</label><caption><title>Microinjection of fluorescent LPS into brain tectum at four dpf results in low LPS transfer from hindbrain ventricle into brain interstitial space at around 30% and into the periphery at less than 15% of injected LPS level.</title><p>(<bold>a</bold>) Time plot showing LPS level changes in different regions as a ratio of injected fluorescent LPS. Injected LPS level was determined by the relative saturation level of fluorescence in the hindbrain ventricle as it is the immediate site filled in by LPS at time of injection. Both hindbrain and telencephalon ventricles reach 100% maximum LPS level based on fluorescence, while hindbrain interstitial space reaches around 30% of maximum and the periphery based on accumulation in the pronephros as a proxy reaches less than 15% of maximum. This plot illustrates a small fraction of maximum LPS that does get passed onto the periphery. Plot shows average and s.e.m. (standard error of means) of data from three independent LPS-injected animals. See <xref ref-type="fig" rid="fig2">Figure 2</xref> for related analysis of tracing LPS from brain microinjection. (<bold>b</bold>) Still images of key events from tracing LPS-Alexa 594 after brain injection by high-resolution time-lapse stereomicroscopy, taken from a different LPS-injected animal than the example shown in <xref ref-type="fig" rid="fig2">Figure 2</xref>. Injection occurred at the 4s timepoint. Some injected animals such as this one, LPS is detected to also move anteriorly from midbrain/hindbrain ventricle into telencephalon ventricle. By 48 min post injection, we detected broad distribution of LPS in circulation at a low intensity. FL, facial lymphatics; blec, brain lymphatic endothelial cells; hbv, hindbrain ventricle; mb, midbrain; hb, hindbrain; tele, telencephalon; m, minute; s, second.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig2-figsupp3-v3.tif"/></fig><fig id="fig2s4" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 4.</label><caption><title>Blocking circulation by a morpholino-mediated <italic>tnnt2</italic> knockdown prevented macrophage infiltration into the liver 8 hr after brain injection with LPS.</title><p>(<bold>a</bold>) Representative 3D volumetric and single z-plane images shown for after LPS or water vehicle injection in the brain. Dotted region shows liver in the single channel panels. Transgenes <italic>fabp10a:DsRed</italic> and <italic>mpeg1:GFP</italic> were used to label hepatocytes and macrophages, respectively. (<bold>b</bold>) Quantification of the number of macrophages found in the liver at 8hpi in four dpf zebrafish. No difference was found between the control and LPS injected groups as they both lacked macrophage infiltration. Each symbol represents an independent animal. Statistical test was determined by a two-tailed t-test. ns, not significant; MO, morpholino.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig2-figsupp4-v3.tif"/></fig></fig-group><media id="video5" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video5.mp4"><label>Video 5.</label><caption><title>Time-lapse imaging of whole-body response to LPS microinjection in the brain shows recruitment of macrophages to the liver.</title><p>3D images of whole-body from time-lapse imaging of 4 × 200 µm z-stack tiles stitched into one large frame taken at 5 µm z-steps using a Plan Apo lambda 20x objective every 10 min over a 24 hr total period starting at ~15–20 min post brain-LPS injection at four dpf. A sub-volume of the whole stack is shown from 60 µm beneath the most exterior body surface in order to remove obstructive tissue layers blocking the view of the liver. Macrophages are shown by the <italic>mpeg1:GFP</italic> reporter, LPS-Alexa 594 is labeled by red fluorescence, and dextran is visualized by its cascade blue fluorescent tag. Macrophages throughout the body are highly mobile upon brain perturbation, but over time, a number of these cells is found to be restricted inside the liver in contrast to their fast movement through most of other organs and tissues. Fast moving macrophages throughout body were found to mostly express bright <italic>mpeg1:GFP</italic> as opposed to the moderately weaker reporter expression by liver-infiltrating macrophages. See <xref ref-type="fig" rid="fig2">Figure 2</xref> for additional description of this imaging analysis. Movie file shown at 30 fps.</p></caption></media><media id="video6" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video6.mp4"><label>Video 6.</label><caption><title>Video showing the initial restriction of brain microinjection to the brain parenchyma, ventricles, and spinal canal using a fluorescent dextran tracer in the four dpf zebrafish.</title><p>Live recording of the brain microinjection of Alexa 568 conjugated dextran (10 kDa) at faster than video rate (&gt;30 frames per second, fps) using a Leica M165 FC stereomicroscope with a high speed and high sensitivity deep-cooled sCMOS camera (DFC9000 GT). Video shows the left side profile of a live wild-type four dpf zebrafish prior to injection using brightfield imaging followed by the fluorescent dextran injection as shown by the overlay of epi-fluorescence with the brightfield. The fine capillary needle is shown penetrating the injection site in the left brain tectum of the zebrafish. Immediately after injection, the injected substance rapidly fills the brain ventricles that contain the cerebrospinal fluid, and subsequently the central canal of the spinal cord. Video represents a total of 5 s in real time.</p></caption></media><media id="video7" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video7.mp4"><label>Video 7.</label><caption><title>Rapid in vivo tracking of LPS movement in real time starting before brain tectal injection to nearly 1 hr post injection.</title><p>Representative live recording of brain microinjection of LPS-Alexa 594 and its immediate aftermath in a four dpf zebrafish larvae at a high temporal resolution at one frame per second (fps) on a Leica M165 FC stereomicroscope with a high speed sCMOS camera (DFC9000 GT). LPS were found to concentrate in the hindbrain ventricle (hbv) immediately after injection and disperse along the ventricular system including the spinal canal. From the hbv, a low level of LPS were exuded out from the posterior end (arrowheads) as well as from the top arms (arrowhead) into the hindbrain interstitial space. Appearance of LPS, albeit weak, can be detected along the facial lymphatics (FL) as well as in the peripheral circulation as represented by the accumulation in the pronephros. Over time, brain lymphatic endothelial cells (blec) were found to accumulate LPS from the brain interstitial fluid. See <xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3</xref> for the kinetic analysis of the LPS tracing, and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplements 1</xref> and <xref ref-type="fig" rid="fig2s2">2</xref> for high cellular resolution analysis of LPS localization. Movie file represents a total of 50 min and 41 s of tracking, shown at 300 fps (300x faster than original process).</p></caption></media><p>To evaluate the dynamics and major routes of LPS passage to the general circulation, we used high-speed and high-sensitivity stereomicroscopy to trace the movement of fluorescently tagged LPS in real time at one frame per second starting before the brain tectum microinjection to almost one hour after the injection (<xref ref-type="fig" rid="fig2">Figure 2c–d</xref> and <xref ref-type="video" rid="video7">Video 7</xref>). While most of the LPS remained restricted within the ventricular system, we found the hindbrain ventricle (hbv) to be the key region from which LPS spread into the parenchyma and surrounding interstitial space, especially in the dorsal-most portion of the junction between the hindbrain and spinal cord encompassing the dorsal longitudinal anastomotic vessels (DLAVs) and the dorsal longitudinal lymphatic vessel (DLLV) (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplements 1</xref> and <xref ref-type="fig" rid="fig2s2">2</xref>, and <xref ref-type="video" rid="video7">Video 7</xref>). LPS at a low level were detected to exude out from the hbv into the hindbrain interstitial fluid (ISF) starting at around 1 min after injection (<xref ref-type="video" rid="video7">Video 7</xref> and <xref ref-type="fig" rid="fig2">Figure 2c</xref>) and reached a maximum of about 30% of LPS injection level at 50 min after injection (<xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3</xref>). After a delay of about 13 min after injection, the first LPS fluorescence signals were faintly measured in the pronephros, a region assessed as a proxy for general circulation (<xref ref-type="fig" rid="fig2">Figure 2c–d</xref> and <xref ref-type="video" rid="video7">Video 7</xref>). Peripheral LPS level increased over time but remained low at less than 15% of the LPS injection level (<xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3</xref>).</p><p>To characterize LPS at the tissue and cellular level along its outflow path, we used high power confocal imaging on the same LPS-injected zebrafish which were tracked by stereomicroscopy (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="video" rid="video7">Video 7</xref>) to carry out further imaging at later timepoints. Interestingly, LPS molecules were taken up by brain lymphatic endothelial cells (blec), also known as fluorescent granular perithelial cells (FGPs), as well as by facial and trunk lymphatic vessels as shown by co-localization of LPS with the lymphatic reporter <italic>mrc1a:GFP</italic> at 1.5 hpi (<xref ref-type="bibr" rid="bib60">Jung et al., 2017</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplements 1</xref> and <xref ref-type="fig" rid="fig2s2">2</xref>), suggesting LPS exited through these lymphatic structures. These results were consistent with the previous LPS tracing within the first hour after injection (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="video" rid="video7">Video 7</xref>), but shown more definitively by high-resolution confocal imaging. By contrast, LPS were not localized within the CNS vasculature using the endothelial reporter <italic>kdrl:mCherry</italic>, but only in the peripheral blood vessels (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>), indicating that transport of LPS did not likely result from a disruption of the BBB or a direct transit through brain blood vessels. Tracing the movement of LPS from the brain to the periphery also revealed its transient flow through the liver sinusoids prior to immune cell infiltration (<xref ref-type="fig" rid="fig2">Figure 2</xref>, <xref ref-type="video" rid="video5">Video 5</xref>). However, LPS did not appear to accumulate or bind to cellular structures within the liver as we did not detect LPS there (<xref ref-type="fig" rid="fig2">Figure 2b</xref>, <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref> and <xref ref-type="video" rid="video5">Video 5</xref>), suggesting either the transient exposure of hepatic cells to LPS, or yet unknown extrahepatic signals trigger the hepatic response to systemic LPS. Taken together, LPS appeared to enter circulation via a mechanism directed by the lymphatics for clearing away excess substances from the brain parenchyma and interstitial fluids (<xref ref-type="fig" rid="fig2">Figure 2e</xref>).</p><p>In light of the broad LPS distribution, we sought to functionally test whether the liver response after brain-LPS activation was due to systemic LPS. To create a systemic LPS condition akin to mammalian models of sepsis or endotoxemia (<xref ref-type="bibr" rid="bib111">Szabo et al., 2002</xref>; <xref ref-type="bibr" rid="bib78">Mathison and Ulevitch, 1979</xref>), we directly injected LPS intravenously at the caudal plexus into the bloodstream and compared its resulting peripheral response to that after brain-LPS injection (<xref ref-type="fig" rid="fig2">Figure 2</xref>). These injections resulted in different outcomes for microglial activation at six hpi, whereby brain-LPS led to a strong activation of microglia but intravenous (IV)-LPS did not (<xref ref-type="fig" rid="fig2">Figure 2f</xref>). Both routes, however, led to the same robust macrophage infiltration of the liver (<xref ref-type="fig" rid="fig2">Figure 2g</xref>). To determine if circulation was required for the liver response after brain-LPS injection, we used a morpholino to knockdown <italic>tnnt2</italic>, a cardiac muscle troponin T gene, a well-established reagent for blocking circulation (<xref ref-type="bibr" rid="bib102">Sehnert et al., 2002</xref>; <xref ref-type="fig" rid="fig2s4">Figure 2—figure supplement 4</xref>). We indeed found that inhibiting circulation prevented macrophage infiltration into liver after brain-LPS injection (<xref ref-type="fig" rid="fig2s4">Figure 2—figure supplement 4</xref>). Taken together, several lines of evidence show that circulating LPS that causes systemic inflammation was driving macrophage infiltration into the liver after brain-LPS injection: 1) systemic distribution of LPS, 2) sufficiency of IV-LPS injection to cause liver infiltration, and 3) blocking circulation prevented macrophage infiltration of the liver.</p></sec><sec id="s2-3"><title>Macrophage recruitment to the liver is a MyD88-dependent inflammatory response requiring the IL-34 pathway</title><p>We next tested the effects of anti-inflammatory drugs on liver response after brain-LPS microinjection to address whether systemic inflammation was indeed responsible for the macrophage recruitment into the liver. We screened five small-molecule drugs (GW2580, 17-DMAG, celastrol, Bay 11–7082, and dexamethasone) known to effectively curb inflammation by attenuating NF-kB mediated transcription or activating glucocorticoid functions in zebrafish and other systems (<xref ref-type="bibr" rid="bib27">Conway et al., 2005</xref>; <xref ref-type="bibr" rid="bib107">Shimp et al., 2012</xref>; <xref ref-type="bibr" rid="bib103">Sevin et al., 2015</xref>; <xref ref-type="bibr" rid="bib26">Coffin et al., 2013</xref>; <xref ref-type="bibr" rid="bib69">Lancet et al., 2010</xref>; <xref ref-type="bibr" rid="bib119">Venkatesha et al., 2012</xref>; <xref ref-type="bibr" rid="bib127">Yu et al., 2010</xref>; <xref ref-type="bibr" rid="bib3">Aghai et al., 2006</xref>; <xref ref-type="bibr" rid="bib124">Yamamoto and Gaynor, 2001</xref>; <xref ref-type="bibr" rid="bib71">Lee et al., 2012</xref>). These small molecules are known to act through different mechanisms: GW2580, a selective inhibitor of cFMS kinase that blocks the receptor tyrosine kinase CSF1R function which can prevent NF-kB activation (<xref ref-type="bibr" rid="bib19">Caescu et al., 2015</xref>; 17-DMAG (a water-soluble geldanamycin analog) and celastrol, both potent inhibitors of the heat-shock protein Hsp90 that cause disruption or degradation of its target proteins, including the NF-kB protein complex (<xref ref-type="bibr" rid="bib107">Shimp et al., 2012</xref>; <xref ref-type="bibr" rid="bib70">Lee et al., 2006</xref>; Bay 11–7082, an inhibitor of E2 ubiquitin (Ub) conjugating enzymes, which target NF-kB inhibitor, IkB-alpha, for proteasomal degradation (<xref ref-type="bibr" rid="bib71">Lee et al., 2012</xref>; and dexamethasone, an agonist of the glucocorticoid receptor (GR) that activates a negative feedback mechanism to reduce inflammation (<xref ref-type="bibr" rid="bib3">Aghai et al., 2006</xref>). We first assessed the effects these small molecules had on macrophage infiltration into the liver after brain-LPS microinjection using whole-mount RNA in situ hybridization with the macrophage marker <italic>mfap4</italic> (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). As positive controls for liver infiltration, we used brain-LPS injected animals that were untreated (water only) for comparison with water-reconstituted drugs (17-DMAG and dexamethasone), and treated with only DMSO for comparison with DMSO-reconstituted drugs (GW2580, celastrol, and Bay 11–7082). Untreated animals without brain microinjection were also used as negative controls. By in situ analysis, we found that Bay 11–7082 and dexamethasone substantially reduced the frequency of macrophage infiltration after brain-LPS injection compared with control groups (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). These effects were further validated by in vivo imaging of macrophage recruitment into the liver, which enabled a precise macrophage count at a high cellular resolution (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). These results indicated that macrophage infiltration into the liver after brain-LPS stimulation can be prevented by suppressing inflammation via mechanisms inhibiting the NF-kB pathway or activating the glucocorticoid signaling.</p><p>To examine possible components affiliated with the NF-kB pathway that may drive macrophage recruitment into the liver, we examined whether an intracellular signal adaptor protein myeloid differentiation protein-88 (MyD88) of Toll-like receptors (TLRs) known for recognizing LPS and mediating cytokine production was essential (<xref ref-type="bibr" rid="bib80">Medzhitov, 2001</xref>). We employed an effective <italic>myd88</italic> specific splice-blocking morpholino to knockdown <italic>myd88</italic> as previously described (<xref ref-type="bibr" rid="bib115">van der Sar et al., 2006</xref>) during the liver response to brain-LPS stimulation (<xref ref-type="fig" rid="fig3">Figure 3a,b</xref>). The efficacy of <italic>myd88</italic> morpholino to mediate splice-blocking was confirmed by RT-PCR analysis (<xref ref-type="fig" rid="fig3">Figure 3c</xref>). By in vivo imaging, we found that the number of liver-infiltrating macrophages after brain-LPS microinjection was significantly reduced when <italic>myd88</italic> function was disrupted (<xref ref-type="fig" rid="fig3">Figure 3a,b</xref>). To further validate these results, we performed the brain-LPS and control injections in <italic>myd88</italic> null mutants and their siblings derived from a heterozygous incross (<xref ref-type="fig" rid="fig3">Figure 3d</xref>). <italic>myd88</italic> mutants showed either few or no macrophages in the liver after brain-LPS injection at 16–24 hpi similar to baseline brain-water injected animals (<xref ref-type="fig" rid="fig3">Figure 3d</xref>), demonstrating a much stronger effect in reversing macrophage infiltration than the partial <italic>myd88</italic> knockdown by morpholinos. These results show that the inflammatory liver response depended on the MyD88 pathway and are consistent with LPS-triggered inflammation as the driver of macrophage infiltration into the liver.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Infiltration of liver by macrophages triggered by brain-LPS injection is dependent on adaptor protein <italic>myd88</italic> and cytokine <italic>il-34</italic>.</title><p>(<bold>a</bold>) Quantification of macrophage infiltration 6 hr after brain-LPS injection or control treatment (brain-water injection and no injection combined) in <italic>myd88</italic>-deficient morpholino-injected animals compared with control wild-type siblings at four dpf. (<bold>b</bold>) Left column, representative single plane of whole liver (DsRed+) showing macrophage infiltration (GFP+) in the control animal but not in the <italic>myd88</italic> morpholino-injected animals. Second to fourth columns, high magnification of the merged overlay and single channels showing a single macrophage (GFP+) stationed between hepatocytes (DsRed+) in control but not in <italic>myd88</italic> morpholino-injected animals. (<bold>c</bold>) RT-PCR analysis showing efficacy of <italic>myd88</italic> morpholino in blocking normal <italic>myd88</italic> splicing at three dpf. Elongation factor one alpha (<italic>ef1a</italic>) PCR used as a sample quality control. (<bold>d</bold>) Complementary experiments using <italic>myd88</italic> mutants derived from a heterozygous incross show either few or no macrophages in the liver after brain-LPS injection at 16–24 hpi similar to baseline brain-water injected animals, demonstrating a much stronger effect in reversing macrophage infiltration than the partial <italic>myd88</italic> knockdown by morpholinos. (<bold>e</bold>) qPCR analysis of <italic>il-34</italic>, <italic>csf1a</italic>, and <italic>csf1b</italic> expression in liver only and body-minus-liver tissues comparing brain-LPS injected animals with the control group (brain-water injected and uninjected animals combined) at 6 hpi in four dpf zebrafish. (<bold>f</bold>) Representative images of control (top) and <italic>il-34</italic> F<sub>0</sub> Crispr-injected (bottom). Microglia reduction observed in transient <italic>il-34</italic> F<sub>0</sub> Crispr-injected animals shown by neutral red staining (microglia, white arrows), phenocopying previously described stable <italic>il-34</italic> mutants (<xref ref-type="bibr" rid="bib67">Kuil et al., 2019</xref>). (<bold>g</bold>) Quantification of macrophage infiltration indicates a significant reduction at 8–10 hpi in four dpf transient <italic>il-34</italic> deficient F<sub>0</sub> Crispr-injected animals. (<bold>h</bold>) Stable <italic>il34</italic> mutants derived from a heterozygous incross show either few or no macrophages in the liver after brain-LPS injection at 16–24 hpi similar to baseline brain-water injected animals, showing a much stronger effect in eliminating macrophage infiltration than in the partial gene knockout in transient <italic>il-34</italic> F<sub>0</sub> Crispr-injected animals. Statistical significance was determined by a two-tailed t-test coupled with a F-test validating equal variances for two-way comparisons, and Kruskal-Wallis multiple comparisons test for three-way comparisons in d and h (shown by the top bar) followed by corrected two-way tests if the multiple comparisons test was significant. *, p&lt;0.05; **, p&lt;0.01; ns, not significant; data points in scatter plots represent <italic>n</italic>, independent biological samples or animals. Numbers below bar graphs represent <italic>n</italic>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig3-v3.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Anti-inflammatory drugs dexamethasone and Bay 11–7082 were effective for preventing liver infiltration by macrophages after brain-LPS injection.</title><p>(<bold>a</bold>) Frequency of liver infiltration at 8–10 hr after brain-LPS injection showed that only Bay 11–7082 (1 µM) and dexamethasone (6.5 µM) treatments were effective for preventing macrophages from infiltrating the liver as determined by in situ hybridization. Number of independent animals as shown in the parenthesis. (<bold>b</bold>) Representative whole-mount RNA hybridization for macrophage marker <italic>mfap4</italic> showing liver in the dotted region. White dotted liver indicates infiltration, while black dotted liver shows no infiltration. (<bold>c</bold>) Quantification of the number of infiltrating macrophages either after water or LPS injection in the brain in the control or drug treated conditions as determined by in vivo imaging. (<bold>d</bold>) Representative single z-plane images from z-stacks that show abundant infiltrating macrophages (arrows) in control treated animals after brain-LPS injection, but no infiltration in dexamethasone or Bay 11–7082 treated larvae. Student’s t-test was used to determine statistical significance.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig3-figsupp1-v3.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>Characterization of indel mutations in Cas9/<italic>il-34</italic> gRNAs injected animals confirms disruption of the <italic>il-34</italic> coding sequence.</title><p>(<bold>a</bold>) Representative sequences of indel mutations from three transient <italic>il-34</italic> F<sub>0</sub> Crispr-injected animals all show frameshift mutations mostly leading to early termination (red boxes highlight corresponding translation). The exon containing the <italic>il-34</italic> start codon (yellow box), three targeting gRNAs (teal boxes) and the <italic>il-34</italic> reverse sequencing primer (green box) are shown. Blue boxes show number of nucleotide change with a ‘+” for insertion and a “– “for deletion (del). Top bar shows consensus in the alignment: green for complete match, yellow and red indicate some mismatches. (<bold>b</bold>) Relative frequency of different indel mutations based on net nucleotide change from the wild-type sequence. Each distinct mutation was counted.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig3-figsupp2-v3.tif"/></fig></fig-group><p>As possible hepatic signals that recruit macrophages into the liver during systemic inflammation, we examined whether the interleukin-34 (IL-34) and colony stimulating factor-1 (CSF-1) that share a common receptor CSF1R have a role. IL-34 and CSF-1 are known to mediate various functions of macrophages including inflammatory processes and promoting production of pro-inflammatory chemokines (<xref ref-type="bibr" rid="bib19">Caescu et al., 2015</xref>; <xref ref-type="bibr" rid="bib101">Sauter et al., 2016</xref>; <xref ref-type="bibr" rid="bib77">Masteller and Wong, 2014</xref>). They have recently been shown to be required for macrophage migration and colonization of the brain to form microglia in zebrafish (<xref ref-type="bibr" rid="bib90">Oosterhof et al., 2018</xref>; <xref ref-type="bibr" rid="bib67">Kuil et al., 2019</xref>; <xref ref-type="bibr" rid="bib122">Wu et al., 2018</xref>). Interestingly, engineering an artificial expression of <italic>il-34</italic> in hepatocytes has been shown to be able to recruit macrophages to the liver in zebrafish, but the physiological relevance was not known (<xref ref-type="bibr" rid="bib59">Jiang et al., 2019</xref>). In light of these previous studies, <italic>il-34</italic> and the two zebrafish orthologs of CSF-1 gene (<italic>csf1a</italic> and <italic>csf1b</italic>) were strong candidates for attracting macrophages to the liver after brain-LPS injection. To examine this possibility, we first determined whether these genes (<italic>il-34</italic>, <italic>csf1a</italic>, and <italic>csf1b</italic>) were upregulated in the liver after brain-LPS injection using quantitative PCR (qPCR) analysis on liver-specific and body-minus-liver tissues compared with control animals without the brain microinjection (<xref ref-type="fig" rid="fig3">Figure 3e</xref>). We found that while <italic>csf1a</italic> and <italic>csf1b</italic> were either not detected or had no difference in the liver with or without LPS injection, <italic>il-34</italic> was significantly upregulated in the liver after brain-LPS microinjection (<xref ref-type="fig" rid="fig3">Figure 3e</xref>). This upregulation was specific to the liver as <italic>il-34</italic> was not elevated in the body-minus-liver tissue after brain-LPS injection (<xref ref-type="fig" rid="fig3">Figure 3e</xref>). To test if <italic>il-34</italic> was a required cytokine for recruiting macrophages in our experimental paradigm, we used CRISPR/Cas9 targeted mutagenesis as previously described (<xref ref-type="bibr" rid="bib31">Earley et al., 2018</xref>; <xref ref-type="bibr" rid="bib90">Oosterhof et al., 2018</xref>) to disrupt <italic>il-34</italic> function to assess the immune infiltration (<xref ref-type="fig" rid="fig3">Figure 3f–g</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). To verify the efficacy of the gene knockdown in transient <italic>il-34</italic> F<sub>0</sub> Crispr-injected animals, we determined whether they phenocopied a reduced microglia phenotype recently described in <italic>il-34</italic> stable mutants (<xref ref-type="bibr" rid="bib67">Kuil et al., 2019</xref>). Indeed we found about 40% of the transient <italic>il-34</italic> F<sub>0</sub> Crispr-injected animals to have highly decreased microglial numbers (<xref ref-type="fig" rid="fig3">Figure 3f</xref>). By Sanger sequencing analysis, we verified that these F<sub>0</sub> Crispr-injected animals induced a high frequency of frameshift indels altering reading frames and introducing early stop codons in the <italic>il-34</italic> locus (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). We found that transient <italic>il-34</italic> F<sub>0</sub> Crispr-injected animals after brain-LPS injection indeed had a significantly reduced number of infiltrating macrophages compared with controls (no Crispr injection) after brain-LPS injections (<xref ref-type="fig" rid="fig3">Figure 3g</xref>). To confirm these results, we also tested the effects of brain injections in stable <italic>il-34</italic> null mutants and their control siblings derived from a heterozygous incross (<xref ref-type="fig" rid="fig3">Figure 3h</xref>). <italic>il-34</italic> mutants had either few or no macrophages in the liver after brain-LPS injection at 16–24 hpi similar to baseline brain-water injected animals (<xref ref-type="fig" rid="fig3">Figure 3h</xref>), providing clear evidence that <italic>il-34</italic> is essential in recruiting macrophages to the liver after brain-LPS activation. Taken together, these results showed that macrophage infiltration into the liver was driven by inflammatory processes that require the <italic>myd88</italic> pathway as well as <italic>il-34</italic> signaling likely coming from the liver.</p></sec><sec id="s2-4"><title>Liver infiltration by macrophages may be driven and coordinated by neutrophils</title><p>Since inflammation is typically a concerted response of the innate immune system, the liver response after brain-LPS stimulation may involve other immune cells besides macrophages. To examine this possibility, we investigated whether neutrophils, the other functional leukocytes prominent at early larval zebrafish stages (<xref ref-type="bibr" rid="bib10">Bennett et al., 2001</xref>; <xref ref-type="bibr" rid="bib123">Xu et al., 2012</xref>), could participate in infiltrating the liver along with macrophages. Using live imaging in transgenic zebrafish at four dpf prior to Kupffer cell development, we quantified the numbers of neutrophils and macrophages in the liver 8–10 hpi with control water or LPS, as well as in uninjected controls (<xref ref-type="fig" rid="fig4">Figure 4a</xref>). We performed the same brain injection experiments also at 8–10 dpf after Kupffer cell establishment (<xref ref-type="fig" rid="fig4">Figure 4b</xref>). Our data interestingly showed that neutrophils also significantly infiltrated the liver after brain-LPS but not in the control brain-water and uninjected groups. Similar to macrophages, neutrophils infiltrated the liver irrespective of the presence of Kupffer cells (<xref ref-type="fig" rid="fig4">Figure 4a–c</xref>). To test whether liver infiltration would still occur at juvenile adult stages, when the liver, blood and lymphatic vasculature, and brain structures are fully mature, we conducted brain tectum injections in 1 month-old zebrafish which had a standard length of 0.8–1 cm (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). We found at 16–18 hpi that the numbers of macrophages and neutrophils in the liver were significantly increased after LPS injection compared with water vehicle injections and uninjected controls (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>), indicating that the liver infiltration persists even at young adult stages. These results implicate that the hepatic response to brain-LPS injection is independent of Kupffer cells, age, or maturity of the brain vasculature and architecture, and drainage of LPS from brain to periphery may still be evident in adulthood. They also raise the possibility that macrophages coordinate with neutrophils for moving into the liver, and signals other than from Kupffer cells can recruit these leukocytes into the liver during systemic inflammation induced by circulating LPS.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Neutrophils and macrophages coordinate to infiltrate the liver during a systemic inflammatory response.</title><p>(<bold>a–b</bold>) Total count of macrophages or neutrophils in liver in control (uninjected and brain-water injected) or brain-LPS challenged animals before and after development of liver-resident macrophages (Kupffer cells) at four dpf and 8–10 dpf, respectively. (<bold>c</bold>) Diagram showing typical immune infiltration after LPS addition in wild-type animals. (<bold>d-e)</bold> Effects of macrophage ablation by <italic>irf8</italic> knockdown on neutrophil numbers in the liver 3.5–5 hr after brain-LPS injection at four dpf. (<bold>d</bold>) Quantification of neutrophil numbers. (<bold>e</bold>) Confocal 3D volume imaging of the whole liver with high magnification of a small region shown on the right that is showing a single z-plane image: top, merged channels; middle, hepatocytes (DsRed+); and bottom, neutrophils (GFP+). (<bold>f</bold>) Diagram summarizing the effect of macrophage ablation on causing an increase in neutrophil infiltration after LPS injection. (<bold>g–h</bold>) Depletion of neutrophils using the <italic>csf3r</italic> morpholino reduced macrophage infiltration compared with control LPS injections 8–10 hpi at four dpf. (<bold>g</bold>) Quantification of macrophage numbers. Significantly fewer macrophages were observed in the liver after neutrophil ablation in brain-LPS injected animals. (<bold>h</bold>) Same format of images as in e. (<bold>i</bold>) Diagram summarizing the effect of neutrophil reduction. (<bold>j</bold>) Comparison of relative frequency of each type of neutrophil occupation in the liver with normal (Control) or depleted (<italic>irf8</italic> MO-injected) levels of macrophages after brain-LPS injection, as determined by in vivo time-lapse imaging. (<bold>k</bold>) Representative 3D images of normal macrophage and neutrophil interactions around the liver at four dpf (corresponding to <xref ref-type="video" rid="video9">Video 9</xref>). (<bold>l</bold>) 3D image of macrophage and neutrophil interactions after brain-LPS injection at three hpi in the four dpf larvae showing entry of neutrophils into liver prior to macrophages (corresponding to <xref ref-type="video" rid="video8">Video 8</xref>). Statistical significance was determined by a two-tailed t-test and with Welch’s correction for unequal variances as determined by a F-test. MO, morpholino. Each data point in scatter plots represents an independent animal; <italic>n</italic>, number of animals analyzed is shown below each bar graph. Transgenes used: <italic>mpeg1:GFP</italic> for macrophages, <italic>lyz:GFP</italic> for neutrophils, and <italic>fabp10a:DsRed</italic> for hepatocytes.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig4-v3.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Hepatic response to brain-LPS challenge still evident after establishment of Kupffer cells and adult vasculature/brain structures in juvenile adults.</title><p>(<bold>a</bold>) Live ex vivo imaging of dissected liver from juvenile adult zebrafish after microinjection of either water vehicle or LPS in the brain at 16–18 hpi. Top, arrows point to macrophages in liver using the <italic>mpeg1:GFP</italic> transgene. Bottom, arrows point to neutrophils in the liver using the <italic>lyz:mCherry</italic> transgene. (<bold>b</bold>) Quantification of macrophage density (# <italic>mpeg1:GFP</italic>+ cell per field of view, FOV). (<bold>c</bold>) Quantification of neutrophil density (# <italic>lyz:mCherry</italic>+ cell per FOV). Scatter plots show uninjected controls, or animals microinjected with water vehicle or LPS in the brain. Each field of view (FOV) equals 0.045 squared mm. Statistical significance was determined by a two-tailed Student’s t-test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig4-figsupp1-v3.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Clodronate-mediated macrophage depletion results in an increase in neutrophil infiltration after brain-LPS injection.</title><p>(<bold>a</bold>) Schematic illustrating the method. Intravenous injection of clodronate liposome was performed at three dpf to allow time for the clodronate to effectively induce cell death to most macrophages over a 48 hr period. (<bold>b</bold>) Assessment of macrophage depletion by neutral red staining shows that most animals injected with clodronate liposome indeed resulted in an apparent loss of macrophages in the brain (58%, n = 12). Arrows point to microglia in the ‘no depletion’ category. (<bold>c</bold>) Scatter plot shows number of neutrophils infiltrating the liver to be even more increased after macrophage ablation in response to brain-LPS injection. Since clodronate based macrophage depletion is effective only in a proportion of the animals injected, we also used the cluster of the largest numbers of infiltrating neutrophils as a subset to show the animals with the most significant increase. (<bold>d</bold>) 3D volumetric view of the whole liver from imaging transgenic reporters <italic>fabp10a:DsRed</italic> for hepatocytes and <italic>lyz:GFP</italic> for neutrophils. Left, merged channels. Middle, DsRed channel. Right, GFP channel. Brain-water sample is shown 60 µm beneath the first surface of the liver, and the brain-LPS sample is 45 µm below the most outer liver surface. Significantly higher number of neutrophils (arrows) is easily visualized in the brain-LPS sample. Dextran-Alexa 488 was co-injected into the brain as a tracer to validate injections, and can be seen labeling the pronephros in the GFP channel. Statistical significance was determined by a two-tailed t-test and with Welch’s correction for unequal variances as determined by a F-test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig4-figsupp2-v3.tif"/></fig><fig id="fig4s3" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 3.</label><caption><title>CSF3R/GCSFR knockdown was effective in reducing neutrophils for revealing neutrophil effects on macrophages.</title><p>(<bold>a</bold>) <italic>csf3r</italic> morpholino-injected animals have less neutrophils (arrows) compared with controls as assessed by RNA in situ hybridization for a neutrophil marker myeloid-specific peroxidase mpx. Right bar graph, quantification of the area of mpx expression in the body posterior to the head using ImageJ show an average of a 27% reduction. Statistical significance was determined by a two-tailed t-test with Welch’s correction. (<bold>b</bold>) Reduction of neutrophils leads to a decrease in macrophage infiltration as assessed by RNA in situ hybridization as an alternative approach in addition to live transgenic imaging as shown in <xref ref-type="fig" rid="fig4">Figure 4</xref>. As a control, we also verified the level of neutrophil reduction in <italic>csf3r</italic> morpholino-injected animals by <italic>mpx</italic> in situ. Right bar graphs show frequency of liver infiltration by each myeloid cell type. N is shown in parenthesis and represents number of independent animals analyzed. (<bold>c</bold>) Left, scatter plot representing the effects of <italic>csf3r</italic> morpholino-mediated knockdown on macrophages and neutrophils showed no significant change to overall macrophage numbers, but a significant reduction in neutrophils in <italic>csf3r</italic> morpholino-injected animals. In vivo confocal imaging of double transgenic zebrafish carrying the macrophage reporter (<italic>mpeg1:GFP</italic>) and the neutrophil reporter (<italic>lyz:mCherry</italic>) was conducted. Right, representative fluorescent maximum projection, multi-tiled images of the transgenic zebrafish body. Dotted region shows area of cell number quantification. Statistical significance was determined by a one-tailed t-test. Each symbol represents an individual larva. Scale bar represents 500 µm. ns, not significant.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig4-figsupp3-v3.tif"/></fig><fig id="fig4s4" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 4.</label><caption><title><italic>csf3r</italic> F<sub>0</sub> Crispr-injected animals have a significant reduction in macrophage infiltration of liver after brain-LPS injection consistent with results from morpholino-mediated <italic>csf3r</italic> knockdown.</title><p>(<bold>a</bold>) Three gRNAs were used to target the fourth exon of <italic>csf3r</italic> to create a gene loss-of-function. Sanger sequencing of the <italic>csf3r</italic> F0 Crispr animals indicated a range of Crispr-mediated indels leading to frameshift mutations causing premature termination at the <italic>csf3r</italic> target site. Sibling animals without injection of the gRNAs had the expected WT coding sequence and were used as ‘Control’ animals analyzed side-by-side with the Crispr-injected animals for all assays. (<bold>b</bold>) Representative results from the T7 endonuclease assay shows a 100% efficacy of the Crispr injections (<italic>csf3r</italic>-targeting gRNAs + Cas9 mRNA) to cause genome editing in all samples analyzed. Each well represents a pool of 3–5 embryos. ‘Pre’ shows PCR products of the target site before adding T7 endonuclease and ‘Post’ shows the samples in the same order after T7 endonuclease reaction. (<bold>c</bold>) Scatter bar plot shows a significant reduction in number of macrophages infiltrating the liver at 24 hr post brain-LPS injection in four dpf <italic>csf3r</italic>-deficient Crispr-injected animals. Water vehicle injection was used as a control for the brain injection manipulation. Statistical significance was determined by a two-tailed t-test. Each symbol represents an individual larva. <italic>n</italic>, number of larvae analyzed shown below each bar graph.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig4-figsupp4-v3.tif"/></fig></fig-group><p>To interrogate a possible coordination between macrophages and neutrophils, we turned to gene perturbations to examine the functional consequence of eliminating one immune cell type on the other. We utilized a previously established morpholino targeting <italic>irf8</italic>, an essential transcription factor for macrophage formation, whose effect phenocopies the macrophage-lacking <italic>irf8</italic> mutants for ablating all macrophages at embryonic and early larval stages (<xref ref-type="bibr" rid="bib72">Li et al., 2011</xref>; <xref ref-type="bibr" rid="bib105">Shiau et al., 2015</xref>). Assessment of neutrophil infiltration was conducted at 3–5 hpi, which is earlier than the timepoint of macrophage analysis, because we found neutrophils to infiltrate the liver first before macrophages (<xref ref-type="fig" rid="fig4">Figure 4l</xref>, <xref ref-type="video" rid="video8">Video 8</xref>). Strikingly, a highly significant 3-fold increase of liver-infiltrating neutrophils was found in macrophage-ablated <italic>irf8</italic> morpholino-injected animals after brain-LPS injection at four dpf compared with the control brain-LPS animals, while brain-water injected controls had no neutrophil infiltration into the liver with or without macrophages (<xref ref-type="fig" rid="fig4">Figure 4d</xref>). To verify these findings, we used a complementary approach for macrophage depletion by using clodronate-containing liposomes to induce apoptosis in macrophages as previously described (<xref ref-type="bibr" rid="bib117">van Rooijen and Hendrikx, 2010</xref>; <xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>). Significantly increased neutrophil infiltration of liver after brain-LPS injection in clodronate-mediated macrophage depletion was also found compared with the control response to brain-LPS (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>). Both methods of macrophage depletion corroborate to show striking increases in neutrophil recruitment to the liver after brain-LPS microinjection. These results suggest that neutrophils may compensate for macrophage loss, or that they are normally constrained by macrophages in part possibly by being phagocytosed as they become impaired or die, as has been described in an immune response (<xref ref-type="bibr" rid="bib94">Prame Kumar et al., 2018</xref>). However, these infiltrating neutrophils do not appear to fully make up for macrophage functions as they do not exhibit the same dynamic movements or lasting occupation in the liver during the hepatic response to brain-LPS (<xref ref-type="fig" rid="fig4">Figure 4j</xref>). Most of the infiltrating neutrophils are circulating through the liver (&gt;80%) regardless of macrophage presence in the liver during brain-LPS response, albeit a larger fraction is transient (22%) and long-term (1%) after macrophage ablation (<xref ref-type="fig" rid="fig4">Figure 4j</xref>). Our data therefore favor the latter explanation that macrophages may limit ongoing recruitment of inflammatory neutrophils.</p><media id="video8" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video8.mp4"><label>Video 8.</label><caption><title>Dynamic macrophage-neutrophil interactions following brain-LPS microinjection.</title><p>Confocal time-lapse imaging of a 33 µm z-stack was performed in the region surrounding the liver in double transgenic zebrafish carrying the macrophage (<italic>mpeg1:GFP</italic>) and neutrophil (<italic>lyz:mCherry</italic>) reporters at four dpf after brain-LPS injection. Individual macrophages (GFP+) are prevalent around the liver but has not infiltrated the liver at three hpi. By contrast, a few neutrophils (mCherry+) were seen to enter liver, often passing through. A 40x objective was used to acquire a z-stack every 2 min for a total 1 hr period. Movie file shown at 30 fps. See <xref ref-type="fig" rid="fig4">Figure 4l</xref> for additional description.</p></caption></media><p>Conversely, we employed a splice-blocking morpholino targeting the granulocyte colony-stimulating factor receptor (CSF3R/GCSFR) for reducing neutrophil numbers in zebrafish (<xref ref-type="bibr" rid="bib91">Pazhakh et al., 2017</xref>). We verified by in situ gene expression pattern of the neutrophil marker, <italic>mpx</italic>, that <italic>csf3r</italic> morpholino-injected animals indeed had neutrophil numbers reduced on average ~30% with a maximum of a 65% decrease (<xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3</xref>). Also, by in vivo imaging of larval zebrafish carrying both macrophage and neutrophil reporters, the <italic>csf3r</italic> morpholino-injected animals showed no significant change in macrophage number, but a substantial neutrophil reduction (<xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3</xref>). Although we cannot completely rule out this possibility, these results indicate <italic>csf3r</italic> knockdown likely does not impact baseline macrophages, consistent with neutrophil-specific reduction and functional defects shown in zebrafish <italic>csf3r</italic> mutants (<xref ref-type="bibr" rid="bib91">Pazhakh et al., 2017</xref>; <xref ref-type="bibr" rid="bib9">Basheer et al., 2019</xref>). In these neutrophil-reduced <italic>csf3r</italic> morpholino-injected animals after brain-LPS injection, we found significantly reduced macrophage infiltration of liver by in situ and live imaging analyses (<xref ref-type="fig" rid="fig4">Figure 4</xref> and <xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3</xref>). As a complementary approach, we assessed the effect of <italic>csf3r</italic> gene disruption by Crispr injection on macrophage infiltration after brain-LPS injection and also found a significant decrease (<xref ref-type="fig" rid="fig4s4">Figure 4—figure supplement 4</xref>). Both morpholino- and F<sub>0</sub> Crispr injection- mediated <italic>csf3r</italic> knockdown corroborate to suggest a possible neutrophil role in recruitment of macrophages into the liver during inflammation. While neither method yields a total <italic>csf3r</italic> elimination to deplete most neutrophils, a stronger hindrance to macrophage infiltration may be possible from a complete <italic>csf3r</italic> depletion. In agreement, constant and dynamic intermingling of these two immune cell types were found around the liver normally (<xref ref-type="fig" rid="fig4">Figure 4k</xref> and <xref ref-type="video" rid="video9">Video 9</xref>). These results taken together show that during liver inflammation, macrophages and neutrophils coordinate intimately, and macrophages are at least in part driven by neutrophils to enter the liver as they infiltrate the liver first (<xref ref-type="fig" rid="fig4">Figure 4l</xref>, <xref ref-type="video" rid="video8">Video 8</xref>).</p><media id="video9" mime-subtype="mp4" mimetype="video" xlink:href="elife-58191-video9.mp4"><label>Video 9.</label><caption><title>Dynamic macrophage-neutrophil interactions surrounding the liver normally.</title><p>Confocal time-lapse imaging of a 33 µm z-stack was performed in the region surrounding the liver in double transgenic zebrafish carrying the macrophage (<italic>mpeg1:GFP</italic>) and neutrophil (<italic>lyz:mCherry</italic>) reporters at four dpf. Individual macrophages (GFP+) and neutrophils (mCherry+) are readily found to intermingle intimately as shown in this video representative. A 40x objective was used to acquire a z-stack every 2 min for a total 1 hr period. Movie file shown at 30 fps. See <xref ref-type="fig" rid="fig4">Figure 4k</xref> for additional description.</p></caption></media></sec><sec id="s2-5"><title>Immune infiltration of liver promotes inflammation and disrupts liver growth</title><p>The functional consequence of macrophage and neutrophil infiltration on the liver during a systemic inflammatory response remains unclear. To examine this, we assessed transcriptional changes comparing immune infiltration and lack thereof in the absence of macrophages and neutrophils. Previous studies have implicated the role of infiltrating innate immune cells in causing liver injury and inflammation (<xref ref-type="bibr" rid="bib61">Karlmark et al., 2008</xref>) but whether this effect is conserved in this model of brain-triggered systemic inflammation is unknown. We examined by qPCR analysis a set of 8 genes after brain-LPS injection with or without innate immune cells compared with the control brain-water injected group to gauge the long-term effect of immune infiltration at 48 hpi. Disruption in liver homeostasis can be defined by an upregulation of genes associated with inflammation (such as pro-inflammatory cytokines <italic>tnfa</italic> and <italic>il1b</italic>). Liver under stress, trauma and inflammation is also characterized by activating an acute phase response (<xref ref-type="bibr" rid="bib96">Ramadori and Christ, 1999</xref>) (such as serum amyloid A (<italic>saa</italic>) and interleukin six signal transducer (<italic>il6st/gp130</italic>)). Disrupted liver can also exhibit altered expression level of genes associated with liver growth and function (such as alpha-2-macroglobulin-like (<italic>a2ml</italic>) (<xref ref-type="bibr" rid="bib52">Hong and Dawid, 2008</xref>), aryl hydrocarbon receptor 1a (<italic>ahr1a</italic>) (<xref ref-type="bibr" rid="bib4">Andreasen et al., 2002</xref>), and glutathione S-transferase pi 1 (<italic>gstp1</italic>) in zebrafish) (<xref ref-type="bibr" rid="bib1">Abunnaja et al., 2017</xref>). To eliminate myeloid cells, we analyzed mutants with a loss-of-function in an essential myeloid transcription factor <italic>pu.1/spi1b</italic> (<xref ref-type="fig" rid="fig5">Figure 5</xref>) to eliminate macrophages/microglia and neutrophils (<xref ref-type="bibr" rid="bib72">Li et al., 2011</xref>; <xref ref-type="bibr" rid="bib97">Roh-Johnson et al., 2017</xref>). As a complementary approach, we also used an established translation-blocking morpholino targeting <italic>pu.1/spi1b</italic> (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>) previously shown to eliminate macrophages/microglia and varying levels of neutrophils depending on dosage (<xref ref-type="bibr" rid="bib72">Li et al., 2011</xref>; <xref ref-type="bibr" rid="bib110">Su et al., 2007</xref>). The efficacy of <italic>pu.1</italic> morpholino was phenotypically validated by a complete loss of brain macrophages (microglia) in a sub-sample of <italic>pu.1</italic> morpholino-injected animals using a neutral red staining assay (n = 4/4) as previously described (<xref ref-type="bibr" rid="bib104">Shiau et al., 2013</xref>). The qPCR results indicated that in the control situation with the full complement of macrophages and neutrophils at two days after brain-LPS injection in the four dpf zebrafish larvae, all genes associated with inflammation and acute phase response gene s<italic>aa</italic> were significantly upregulated, while genes known to affect zebrafish liver development and function were either not changed or modestly increased (<xref ref-type="fig" rid="fig5">Figure 5</xref> and <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). By contrast, depletion of myeloid cells in <italic>pu.1</italic> mutants and <italic>pu.1</italic> morpholino-injected animals corroborated to show no significant upregulation in all inflammation genes analyzed (<xref ref-type="fig" rid="fig5">Figure 5</xref> and <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>), indicating that the innate immune cells were responsible for the upregulation of inflammatory genes.</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Eliminating myeloid cells disrupts hepatic response to systemic inflammation and causes transcriptional programmatic changes.</title><p>(<bold>a</bold>) Schematic illustrates the impact of myeloid ablation by <italic>pu.1</italic> knockout or knockdown on hepatic response to 48 hr after brain-LPS injection compared with sibling controls. (<bold>b–d</bold>) qPCR was conducted on individual larva 48 hr after either water vehicle or LPS injection in the brain. Brain injections were performed in larvae derived from a <italic>pu.1<sup>fh509</sup></italic> heterozygous incross followed by RNA extraction and genotyping. <italic>pu.1</italic> mutants and their heterozygous and wild-type siblings were processed and analyzed in parallel. (<bold>b</bold>) Acute phase response (APR) appears mostly intact in <italic>pu.1</italic> mutants after LPS injection based on a modest elevation of a major APR marker <italic>saa</italic> although not at a significant level. A more significant upregulation was observed in <italic>pu.1</italic> knockdown animals after LPS injection (see <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). <italic>gp130</italic> is not a specific APR gene and was not significantly changed in all genotypes. (<bold>c</bold>) At 48 hr after brain-LPS injection, relative expressions of all three inflammation genes (<italic>tnfa</italic>, <italic>il1b</italic>, <italic>irg1</italic>) were not significantly upregulated in myeloid-deficient <italic>pu.1</italic> mutants while they remain significantly elevated in control siblings. (<bold>d</bold>) qPCR analysis indicated alteration in two liver-expressing genes affecting zebrafish liver growth or function in myeloid-deficient <italic>pu.1</italic> mutants after brain-LPS injection: <italic>a2ml</italic> was not upregulated, and <italic>ahr1a</italic> was downregulated compared with control siblings, while no significant change was found for <italic>gstp1</italic> in all genotypes. Scatter plots show individual animals; <italic>n</italic>, number of animals analyzed shown below each bar. Statistical significance was determined by a two-tailed t-test and with Welch’s correction for datasets with unequal variances. ns, not significant; *, p&lt;0.05; **, p&lt;0.01; ***, p&lt;0.001. See associated data using complementary morpholino (MO) mediated <italic>pu.1</italic> knockdown in <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig5-v3.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Transcriptional programmatic changes in <italic>pu.1</italic> knockdown are similar to loss-of-<italic>pu.1</italic> mutants after brain-LPS injection.</title><p>(<bold>a</bold>) Schematic illustrates the impact of myeloid ablation by <italic>pu.1</italic> morpholino on hepatic response to brain LPS after 48 hr compared with the sibling controls. (<bold>b–d</bold>) qPCR analysis was conducted on individual larva 48 hr after either water vehicle or LPS injected in the brain in <italic>pu.1</italic> morpholino-injected or control animals. (<bold>b</bold>) Relative expression of inflammation genes (<italic>tnfa</italic>, <italic>il1b</italic>, <italic>irg1</italic>) indicates decreased or reversal of inflammation in myeloid-deficient animals while the inflammatory gene expressions remain highly elevated in wild-type animals after brain-LPS activation. (<bold>c</bold>) Acute phase response (APR) appears intact even in myeloid-deficient <italic>pu.1</italic> morpholino-injected animals after brain-LPS perturbation as <italic>saa</italic>, a major APR markers largely expressed by the liver, remains highly upregulated, although not <italic>gp130</italic> but it is not strictly an APR gene. (<bold>d</bold>) Three genes expressed in the liver that affect liver growth and function in zebrafish (<italic>a2ml</italic>, <italic>ahr1a</italic>, <italic>gstp1</italic>) were found to be all significantly downregulated in myeloid-deficient animals but not in control wild-type at 48 hpi. Scatter plots show individual animals. Statistical significance was determined by a two-tailed t-test and with Welch’s correction for datasets with unequal variances. ns, not significant. p-values are reported above each pair-wise comparison.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig5-figsupp1-v3.tif"/></fig><fig id="fig5s2" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 2.</label><caption><title>Serum amyloid A (<italic>saa</italic>), a major acute phase response gene, is not required for liver infiltration by macrophages after brain-LPS activation.</title><p>Scattered dot and bar plot shows no significant difference in number of macrophage infiltration in the liver between homozygous <italic>saa<sup>rdu60</sup></italic> mutants compared with their wild-type and heterozygous siblings after 16–24 hr post brain-LPS injection at four dpf. As a negative control, brain-water injected siblings at 16–24 hpi in the four dpf zebrafish did not show liver infiltration by macrophages as expected. Each circle represents an individual larva analyzed. Statistical significance was determined by a two-tailed t-test.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig5-figsupp2-v3.tif"/></fig><fig id="fig5s3" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 3.</label><caption><title>Depleting myeloid leukocytes to prevent immune cell infiltration in liver leads to an increase in liver growth during an inflammatory response.</title><p>(<bold>a</bold>) Scattered dot and bar plot shows after brain-LPS injection, a relative liver size decrease in baseline and in control-<italic>p53</italic>-MO injected wild-type animals, whereas a significant increase in relative liver size in myeloid-depleted <italic>pu.1</italic> morpholino-injected animals. Liver size was calculated based on changes in whole liver volume relative to the water-injected controls in each group. Each dot represents an individual larva analyzed. (<bold>b</bold>) Representative 3D rendered volumetric images of the whole liver from all groups and conditions analyzed. Statistical significance was determined by a two-tailed t-test for pair-wise comparison, and one-way ANOVA with Brown-Forsythe correction for the three-way comparisons. All scale bars represent 50 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig5-figsupp3-v3.tif"/></fig></fig-group><p>Furthermore, after brain-LPS injection compared with control siblings, <italic>saa</italic> remained mostly upregulated, but <italic>a2ml</italic> and <italic>ahr1a</italic>, two liver genes associated with growth or function had a net reduction in myeloid-deficient animals either by <italic>pu.1</italic> knockout or knockdown (<xref ref-type="fig" rid="fig5">Figure 5</xref> and <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). The more significant reduction in liver genes as well as the larger change in acute phase response genes in <italic>pu.1</italic> morpholino-injected animals than in <italic>pu.1</italic> mutants may reflect a speedier recovery from the LPS injection in the mutants as they were not subjected to the early embryonic microinjection as the morpholino animals were. Alternatively, the possibility of not a total but partial depletion of macrophages, neutrophils, or both cell types in <italic>pu.1</italic> morpholino-injected animals may also contribute to differences.</p><p>Since <italic>saa</italic> elevation after brain-LPS injection was not eliminated by an absence of macrophages, we further asked whether <italic>saa</italic> may be dispensable for macrophage infiltration. Comparing brain-LPS injections in <italic>saa</italic><sup>-/-</sup> mutants side-by-side with injected control siblings showed no difference between the genotypes (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>), indicating that <italic>saa</italic> is not required for macrophage infiltration into the liver upon LPS activation. The downregulation of liver genes in myeloid cell-depleted animals after brain-LPS injection raised the question as to whether this reflected an actual change in liver growth. To address this, we used in vivo confocal 3D imaging to capture the whole liver at 48 hpi to measure liver size by volume (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3</xref>). We found a decrease in liver size after LPS injection compared with water vehicle injection in both baseline and control-MO groups. Interestingly, by contrast, myeloid-lacking <italic>pu.1</italic> morpholino-injected animals had an increase in liver size after brain-LPS injection (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3</xref>), indicating liver growth was likely impeded by immune cell infiltration during inflammation. Since the expression of some liver genes decreased but the liver size increased in myeloid-deficient animals after brain-LPS injection, these liver genes may not be associated with growth but rather function. These results indicate that the liver infiltration by macrophages and neutrophils promoted inflammation and disrupted liver growth, but had minimal to no effect on the acute phase response gene <italic>saa</italic>, which was not essential for the infiltration (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>). Taken together, they raise the possibility that immune cell infiltration leads to liver resources and functions being redirected from normal developmental growth to a full-fledged inflammatory response.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><sec id="s3-1"><title>Drainage of macromolecules from brain to body engages the periphery to respond to central changes</title><p>As a rapid means by which the brain can engage the periphery in response to possible danger, our study reveals how inflammatory molecules introduced into the brain parenchyma can circulate outside of the brain to initiate a robust hepatic response in zebrafish (<xref ref-type="fig" rid="fig6">Figure 6</xref>). It remains to be explored whether the transport of molecules or substances outside of the brain even at trace levels resulting from CNS trauma or injury can explain at least to some degree the associated hepatic damage described in mammals (<xref ref-type="bibr" rid="bib75">Lustenberger et al., 2011</xref>; <xref ref-type="bibr" rid="bib23">Catania et al., 2009</xref>; <xref ref-type="bibr" rid="bib74">Louveau et al., 2016</xref>). The most likely route through which macromolecules can drain out of the brain is through the lymphatic system that removes interstitial fluids, waste products, and immune cells in zebrafish and mammals (<xref ref-type="bibr" rid="bib74">Louveau et al., 2016</xref>; <xref ref-type="bibr" rid="bib60">Jung et al., 2017</xref>; <xref ref-type="bibr" rid="bib88">Okuda et al., 2012</xref>). Recent new knowledge in meningeal lymphatics and glymphatics indicate that macromolecules in the brain can flow from the parenchymal interstitial space into the cerebrospinal fluid (CSF) which drains into the lymphatic vessels or directly into the major veins (sinuses) to enter general circulation (<xref ref-type="bibr" rid="bib74">Louveau et al., 2016</xref>; <xref ref-type="bibr" rid="bib60">Jung et al., 2017</xref>; <xref ref-type="bibr" rid="bib55">Iliff et al., 2012</xref>; <xref ref-type="bibr" rid="bib76">Ma et al., 2017</xref>). In support of this, previous studies using a number of mammalian species (cat, rabbit, dog, and rat) have shown that injection of tracers at 5–100 ul volume such as horseradish peroxidase, India ink or dextran blue into the CSF or brain parenchyma gets drained rapidly into cervical lymph nodes within seconds as well as in entire vasculature within minutes (<xref ref-type="bibr" rid="bib128">Zhang et al., 1992</xref>; <xref ref-type="bibr" rid="bib28">Cserr and Ostrach, 1974</xref>; <xref ref-type="bibr" rid="bib22">Casley-Smith et al., 1976</xref>; <xref ref-type="bibr" rid="bib15">Bradbury and Cole, 1980</xref>; <xref ref-type="bibr" rid="bib14">Bradbury et al., 1981</xref>; <xref ref-type="bibr" rid="bib112">Szentistvanyi et al., 1984</xref>), while radiolabeled albumin microinjected into the brain parenchyma of different brain regions appear rapidly in the CSF and within 4 hr can be found in cervical lymph nodes and the common carotid arteries (<xref ref-type="bibr" rid="bib112">Szentistvanyi et al., 1984</xref>; <xref ref-type="bibr" rid="bib46">Harling-Berg et al., 1989</xref>). Furthermore, metabolites of glucose from the brain are found to be released in the cervical lymph nodes (<xref ref-type="bibr" rid="bib82">Mergenthaler et al., 2013</xref>), supporting the possibility that drainage of endogenous macromolecules from brain to blood circulation can also happen. Taken together, studies in mammals indicate the ability for molecules to transport from the parenchyma or CSF-filled ventricles into general circulation either through the lymphatics, or blood vessels directly. However, the physiological impact of brain drainage on the periphery had not been investigated, nor directly visualized. Our study demonstrates that such drainage can be directly tracked in vivo to induce a robust hepatic response defined by an active recruitment of inflammatory macrophages and neutrophils into the liver.</p><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Current model for hepatic response to brain drainage of LPS into the periphery.</title><p>Diagram represents events happening prior to Kupffer cell development in the four dpf zebrafish. Left, at steady-state, peripheral macrophages normally do not migrate into the liver. Right, brain-localized microinjection of LPS leads to systemic distribution of LPS that robustly induces a hepatic response whereby macrophages/monocytes infiltrate the liver. Genes conferring inflammation and acute phase response are highly upregulated. Recruitment of macrophages/monocytes into the liver requires MyD88, a common adaptor protein for TLRs that recognize LPS. Since LPS were found to transiently flow through the liver sinusoids but not appear to accumulate in the liver, it raises the possibility that the requirement for MyD88 may also stem from extrahepatic signals. Although our model illustrates its function only within the liver, whether MyD88 also acts outside of the liver remains to be determined. In addition, IL-34 presumably secreted by the liver and downstream of MyD88 signaling can act as a chemoattractant to macrophages/monocytes expressing CSF1R. Macrophage recruitment may also depend on yet unknown direct or indirect signaling from neutrophils, which infiltrate the liver first subsequent to circulation of LPS.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-58191-fig6-v3.tif"/></fig><p>Similarly, we found that brain tectum microinjection in zebrafish leads to effects comparable to that known of mammalian intracerebroventricular, intracisternal, and intraparenchymal injections (<xref ref-type="bibr" rid="bib41">Glascock et al., 2011</xref>; <xref ref-type="bibr" rid="bib55">Iliff et al., 2012</xref>; <xref ref-type="bibr" rid="bib76">Ma et al., 2017</xref>), such that the injected LPS in the parenchyma rapidly flows into the CSF compartment (or ventricles) likely via bulk flow (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="video" rid="video7">Video 7</xref>), followed by clearance of LPS and ISF predominantly by lymphatic drainage (<xref ref-type="fig" rid="fig2">Figure 2</xref>, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplements 1</xref> and <xref ref-type="fig" rid="fig2s2">2</xref>). After brain-LPS injection, we found a low-level spread of LPS/CSF from the hindbrain ventricle into the brain parenchyma and surrounding interstitial space prior to LPS accumulation in brain lymphatic cells and passage through the extracranial lymphatic vessels. Whether CSF flows to the brain more widely than the major perivascular spaces upon intracranial injection remains controversial in mice (<xref ref-type="bibr" rid="bib55">Iliff et al., 2012</xref>; <xref ref-type="bibr" rid="bib76">Ma et al., 2017</xref>), although this appears to occur easily in the larval zebrafish perhaps due to its small brain size conducive to simple diffusion or bulk flow of fluids. Previous work in mice have shown that injected tracers in the subarachnoid CSF or lateral ventricle can enter the brain parenchyma quickly in less than 30 min, and get cleared through paravascular or perineural pathways via the lymphatic system similarly to intraparenchymal injections (<xref ref-type="bibr" rid="bib55">Iliff et al., 2012</xref>; <xref ref-type="bibr" rid="bib76">Ma et al., 2017</xref>), indicating the process of drainage from the brain parenchyma may be conserved between zebrafish and mammals. On average, at about 13 min after tectum microinjection of fluorescent LPS in larval zebrafish, we begin to detect the LPS in circulation by fluorescence, albeit at a baseline intensity, far less than that at the injection site and in the ventricles. This is about two times faster than the transit time for a lateral ventricle injection in mice with a fluorescent tracer to reach blood circulation (around 25 min) (<xref ref-type="bibr" rid="bib76">Ma et al., 2017</xref>), which is still relatively fast. Two key traits that may endow larval zebrafish a faster rate of drainage of solutes from brain ventricle or parenchyma than in rodents may be: 1) the short physical distances between anywhere in the parenchyma and the nearest ventricle and vasculature, which would span no farther than the width of the brain, approximately a few hundred microns, enabling simple diffusion as a primary mode of transport (<xref ref-type="bibr" rid="bib51">Hladky and Barrand, 2018</xref>, and 2) the lack of lymph nodes, based on the prevailing understanding of the zebrafish anatomy (<xref ref-type="bibr" rid="bib125">Yaniv et al., 2006</xref>; <xref ref-type="bibr" rid="bib66">Küchler et al., 2006</xref>), which are lymphatic structures throughout the lymphatic network in mammals that capture and filter the fluid that exits the CNS before joining circulation. The content and concentration of the molecules leaving the CNS that reach blood circulation may be limited by lymph nodes in mammals, but these restrictions may be more lenient in zebrafish due to a possible lack of these structures. Instead of lymph nodes, we found that the intraparenchymally-injected LPS in larval zebrafish after spreading in the brain parenchyma and interstitial space is engulfed by brain lymphatic endothelial cells (blec), which are non-lumenized (<xref ref-type="bibr" rid="bib118">Venero Galanternik et al., 2017</xref>; <xref ref-type="bibr" rid="bib116">van Lessen et al., 2017</xref>; <xref ref-type="bibr" rid="bib106">Shibata-Germanos et al., 2020</xref>), as well as collected by the facial and trunk lymphatic vessels (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplements 1</xref> and <xref ref-type="fig" rid="fig2s2">2</xref>). These non-lumenized blec also exist in mouse (<xref ref-type="bibr" rid="bib106">Shibata-Germanos et al., 2020</xref>), but their contribution to the clearance of solutes from the CSF/ISF is yet unclear. Interestingly, while facial and trunk lymphatic vessels surrounding the brain were filled with LPS by 1.5 hpi, localization of LPS within the brain blood vessels was not observed (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplements 1</xref> and <xref ref-type="fig" rid="fig2s2">2</xref>), indicating the main route by which LPS exit the CNS to enter general circulation was via the lymphatic tracts. Additionally, in both zebrafish and mammals, it is also possible that macromolecules to some degree get eliminated by ingestion by perivascular and other phagocytic cells before they drain out to the periphery through the lymphatic-vascular system.</p><p>Whether the process of drainage differs during developmental stages when the tissue boundaries and structures of the brain are less mature, we provide evidence that the peripheral hepatic response to brain-LPS injection may be age-independent in zebrafish. The hepatic response was observed from early to late larval stages, and also in juvenile adults, suggesting passage of inflammatory molecules occurs even after establishment of a fully mature brain architecture (including the blood-brain and blood-CSF barriers). This study focused on the early larval stage at four dpf as it offers a timepoint at which infiltrating macrophage cells can be clearly assessed in the liver without the presence of liver-resident macrophages (Kupffer cells). At this age, they are also functionally mature with established functional blood-brain barriers and ventricles with choroid plexus and CSF (<xref ref-type="bibr" rid="bib58">Jeong et al., 2008</xref>; <xref ref-type="bibr" rid="bib48">Henson et al., 2014</xref>; <xref ref-type="bibr" rid="bib37">Fame et al., 2016</xref>). Regardless of the route or quantities at which macromolecules can drain out from the brain, our results implicate the process of drainage from brain as an effective mechanism by which the brain can quickly transmit molecular information to the periphery to engage a prompt hepatic response to potential CNS threats.</p></sec><sec id="s3-2"><title>Responsiveness of liver to systemic inflammation irrespective of Kupffer cells</title><p>Our data demonstrate that the most striking effect of LPS injection into the brain parenchyma was the recruitment of macrophages into the liver in the zebrafish model (<xref ref-type="fig" rid="fig6">Figure 6</xref>). In agreement with the liver being most susceptible to systemic inflammation, previous studies using intravenous injection of the endotoxin LPS in different mammalian models have shown an immediate localization of LPS to the liver and less to other organs by tracking radiolabeled LPS (<xref ref-type="bibr" rid="bib11">Bikhazi et al., 2001</xref>; <xref ref-type="bibr" rid="bib78">Mathison and Ulevitch, 1979</xref>; <xref ref-type="bibr" rid="bib16">Braude et al., 1955</xref>; <xref ref-type="bibr" rid="bib49">Herring et al., 1963</xref>). Prior to our work, it was not known that introduction of endotoxin into the brain parenchyma can result in the same impact on the liver as that from a systemic administration. These findings beg the question as to how the liver is the predominant and conserved target of circulating LPS and systemic inflammation in vertebrates from zebrafish to mammals. One overarching explanation could simply be related to the sheer blood volume coming from the hepatic artery and portal vein (<xref ref-type="bibr" rid="bib33">Eipel et al., 2010</xref>) that the liver constantly processes, making it particularly sensitive to inflammatory cues in circulation.</p><p>Kupffer cells have been considered to be key immune cells responsible for producing cytokines and chemokines to recruit neutrophils and other leukocytes that may further propagate systemic inflammation (<xref ref-type="bibr" rid="bib12">Bilzer et al., 2006</xref>; <xref ref-type="bibr" rid="bib29">Dixon et al., 2013</xref>). In fact, tracking of radiolabeled LPS has shown that circulating LPS was mostly taken up by Kupffer cells (<xref ref-type="bibr" rid="bib11">Bikhazi et al., 2001</xref>; <xref ref-type="bibr" rid="bib78">Mathison and Ulevitch, 1979</xref>), implicating these cells as the main sink for endotoxins or microbes. By contrast, our study shows that the liver is capable of responding to systemic inflammation and recruiting neutrophils first and then macrophages, independent of Kupffer cells. We found that starting in the larval zebrafish at four dpf when the liver is already functional and differentiated with diverse hepatic cell types including hepatocytes, sinusoidal endothelial cells, biliary cells, and stellate cells (<xref ref-type="bibr" rid="bib126">Yin et al., 2012</xref>), but before Kupffer cells are established, other hepatic cells besides the Kupffer cells are capable of signaling to recruit peripheral leukocytes into the liver. Furthermore, while the gut may provide a source of stimulating molecules through the portal vein, we show that the brain is another source of inflammatory cues that can result in immune infiltration of the liver that was not previously appreciated.</p></sec><sec id="s3-3"><title>IL-34 pathway in mediating immune infiltration of liver triggered by systemic inflammation</title><p>The receptor tyrosine kinase CSF1R (also known as Fms) pathway regulates migration, differentiation, proliferation, and survival at varying degrees of different tissue-resident macrophages and monocytes in mammals and zebrafish (<xref ref-type="bibr" rid="bib90">Oosterhof et al., 2018</xref>; <xref ref-type="bibr" rid="bib67">Kuil et al., 2019</xref>). Recent studies have implicated a role for this pathway in macrophage recruitment in disease, including the assembly of tumor-associated macrophages in various cancers (<xref ref-type="bibr" rid="bib87">Noyori et al., 2019</xref>; <xref ref-type="bibr" rid="bib73">Lin et al., 2019</xref>; <xref ref-type="bibr" rid="bib129">Zins et al., 2018</xref>; <xref ref-type="bibr" rid="bib7">Baghdadi et al., 2016</xref>; <xref ref-type="bibr" rid="bib8">Baghdadi et al., 2018</xref>). Of particular interest IL-34 is elevated and implicated in the inflammation process of several inflammatory diseases including rheumatoid arthritis, inflammatory bowel disease, and Sjogren’s syndrome (<xref ref-type="bibr" rid="bib25">Ciccia et al., 2013</xref>; <xref ref-type="bibr" rid="bib54">Hwang et al., 2012</xref>; <xref ref-type="bibr" rid="bib83">Moon et al., 2013</xref>; <xref ref-type="bibr" rid="bib24">Chemel et al., 2012</xref>; <xref ref-type="bibr" rid="bib13">Boulakirba et al., 2018</xref>). Interestingly, among the three known ligands of the zebrafish homolog of the receptor tyrosine kinase CSF1R, namely <italic>csf1a</italic>, <italic>csf1b</italic>, and <italic>il-34</italic>, we found that <italic>il-34</italic> was singly upregulated in the liver upon brain-LPS microinjection. Moreover, we showed that disruption of <italic>il-34,</italic> either by antisense splice-blocking morpholinos or a stable loss-of-function mutation, significantly eliminated macrophage infiltration of liver induced by brain-LPS microinjection (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The requirement for <italic>il-34</italic> signaling presumably from the liver may be coupled with <italic>myd88</italic> known to act downstream of TLR signaling upon LPS recognition, as <italic>myd88</italic> was found to be highly expressed in the normal larval zebrafish liver (<xref ref-type="bibr" rid="bib64">Koch et al., 2018</xref>). Whether these pathways act only in the liver, other cell types, or both, and whether other signaling mechanisms are involved, including CXCR3-CXCL11 known to affect macrophage chemotaxis to infection sites in human and zebrafish (<xref ref-type="bibr" rid="bib113">Torraca et al., 2015</xref>), remain to be explored. Our data indicate an essential role for <italic>il-34</italic> in recruitment of macrophages into the liver, implicating a new function for the <italic>il-34/csf1r</italic> pathway in conjunction with <italic>myd88</italic> dependent mechanisms during hepatic inflammation.</p></sec><sec id="s3-4"><title>Coordination of the innate immune system during hepatic response to systemic inflammation</title><p>Chronic active infiltration of leukocytes into the liver can cause liver damage and subsequent progression to fibrosis, cirrhosis or liver cancer (<xref ref-type="bibr" rid="bib61">Karlmark et al., 2008</xref>; <xref ref-type="bibr" rid="bib84">Mossanen and Tacke, 2013</xref>; <xref ref-type="bibr" rid="bib53">Huang et al., 2016</xref>). This is a common feature shared among liver diseases caused by infection, toxic insults, or autoimmunity (<xref ref-type="bibr" rid="bib32">Edwards and Wanless, 2013</xref>). Using zebrafish, we found that macrophages and neutrophils were co-dependent in the process of infiltrating the liver after brain microinjection of LPS. We further showed by in vivo time-lapse imaging an early recruitment of neutrophils in the first few hours was followed by migration or circulation of peripheral macrophages into the liver. This is consistent with previous studies showing early neutrophil recruitment followed by monocyte-derived macrophages in other contexts of inflammation (<xref ref-type="bibr" rid="bib109">Soehnlein et al., 2009</xref>; <xref ref-type="bibr" rid="bib57">Jenne et al., 2018</xref>; <xref ref-type="bibr" rid="bib62">Kim and Luster, 2015</xref>). While secreted granule proteins from neutrophils that have already infiltrated the liver may directly recruit macrophages (<xref ref-type="bibr" rid="bib44">Gregory et al., 2002</xref>; <xref ref-type="bibr" rid="bib108">Soehnlein et al., 2008</xref>) in our experimental platform of liver infiltration, we cannot exclude the possibility that indirect effects by which neutrophils alter vascular permeability or signaling from endothelial or other hepatic cell types actually direct macrophage recruitment into the liver.</p><p>Conversely, the impact of monocytes and macrophages on neutrophil activity remains less understood. Using two complementary approaches to deplete macrophages either by <italic>irf8</italic> genetic deficiency or liposomal clodronate treatment in zebrafish, we found that macrophages may be important to limit neutrophil infiltration into the liver upon brain drainage of LPS. An excessive level of neutrophil infiltration may lead to a heightened release of toxic metabolic products and proteolytic enzymes (<xref ref-type="bibr" rid="bib94">Prame Kumar et al., 2018</xref>), thereby causing more damage to the liver. Macrophages in the liver are known to remove apoptotic or impaired neutrophils by phagocytosis, which in turn can modulate their own signaling based on the receptor(s) used during neutrophil clearance (<xref ref-type="bibr" rid="bib44">Gregory et al., 2002</xref>). Since deficiency in <italic>irf8</italic> causes an elimination of macrophages but also an increase in baseline neutrophil number (<xref ref-type="bibr" rid="bib105">Shiau et al., 2015</xref>), we cannot completely rule out that a larger neutrophil pool may contribute to the significant increase in neutrophil infiltration after brain-LPS injection in <italic>irf8</italic> morpholino-injected animals. Nonetheless, the agreement in effect from two distinct methods of macrophage ablation, and the observed intimate macrophage-neutrophil contacts in the hepatic region strongly support reciprocal interactions between macrophages and neutrophils.</p></sec><sec id="s3-5"><title>Perspective on the brain-liver connection</title><p>Our study shows that the drainage following microinjection of LPS into the brain robustly caused peripheral macrophages and monocytes to infiltrate the liver, a process mediated by an upregulation of the cytokine IL-34 in the liver presumably downstream of activating the Toll-like receptor adaptor protein MyD88, and signaling from neutrophils. Treatment with a subset of anti-inflammatory drugs indicates that glucocorticoid activity or inhibiting NF-kB activation suppresses immune cell infiltration during hepatic response to systemic inflammation. These results prompt intriguing questions on how a hepatic response to a central disruption may reflect the presence and severity of CNS inflammation; whether a hepatic response contributes to the recovery or disruption of brain homeostasis; and to what extent does drainage of harmful or inflammatory molecules from brain to circulation explains for the peripheral problems associated with primarily CNS pathologies. LPS were used as an effective tool for brain-localized microinjection in this study to allow tracing of inflammatory molecules originating in the brain to assess peripheral consequences, but whether endogenous proteins and other molecules could be secreted by the brain and drained into circulation to cause similar effects as the LPS do on the liver remains to be investigated. Some examples that lend support to this possibility relate to hallmarks of Alzheimer’s disease that has a known association with liver dysfunction, such as brain tau secretion and its presence in the CSF as well as clearance of toxic accumulations of brain amyloid-beta (<xref ref-type="bibr" rid="bib93">Pernègre et al., 2019</xref>; <xref ref-type="bibr" rid="bib6">Bacyinski et al., 2017</xref>; <xref ref-type="bibr" rid="bib86">Nho et al., 2019</xref>); however the link between the brain secretion or drainage and liver disruption is yet unclear. Understanding mechanisms regulating immune infiltration of the liver and brain-periphery interactions can offer new approaches for modulating or detecting central inflammation while limiting damage elsewhere in the body.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Zebrafish</title><p>Embryos from wild-type (TL and AB), mutant and transgenic backgrounds: <italic>il34<sup>re03 </sup></italic>(<xref ref-type="bibr" rid="bib67">Kuil et al., 2019</xref>), <italic>myd88<sup>b1354 </sup></italic>(<xref ref-type="bibr" rid="bib17">Burns et al., 2017</xref>), <italic>saa<sup>rdu60 </sup></italic>(<xref ref-type="bibr" rid="bib85">Murdoch et al., 2019</xref>), <italic>pu.1/spi1b<sup>fh509 </sup></italic>(<xref ref-type="bibr" rid="bib97">Roh-Johnson et al., 2017</xref>), <italic>mpeg1:EGFP</italic> (<xref ref-type="bibr" rid="bib34">Ellett et al., 2011</xref>), <italic>lyz:GFP </italic>(<xref ref-type="bibr" rid="bib45">Hall et al., 2007</xref>), <italic>lyz:mCherry; cmlc2:GFP </italic>(<xref ref-type="bibr" rid="bib81">Meireles et al., 2014</xref>), <italic>fabp10a:DsRed </italic>(<xref ref-type="bibr" rid="bib30">Dong et al., 2007</xref>)<italic>, kdrl:mCherry-CAAX </italic>(<xref ref-type="bibr" rid="bib39">Fujita et al., 2011</xref>), <italic>mrc1a:egfp<sup>y251 </sup></italic>(<xref ref-type="bibr" rid="bib60">Jung et al., 2017</xref>), <italic>mfap4:tdTomato </italic>(<xref ref-type="bibr" rid="bib121">Walton et al., 2015</xref>), <italic>and nbt:DsRed </italic>(<xref ref-type="bibr" rid="bib92">Peri and Nüsslein-Volhard, 2008</xref>) were raised at 28.5°C and staged as described (<xref ref-type="bibr" rid="bib63">Kimmel et al., 1995</xref>). Stable transgenic <italic>mpeg1:BFP</italic> and <italic>fabp10a:BFP</italic> fish lines were generated using Tol2-mediated transgenesis based on cloned constructs combining the BFP coding sequencing (gift from Martin Distel) downstream of their respective regulatory sequences as published for <italic>mpeg1(1.86 kb) </italic>(<xref ref-type="bibr" rid="bib34">Ellett et al., 2011</xref>) and <italic>fabp10a(2.8</italic> kb) (<xref ref-type="bibr" rid="bib85">Murdoch et al., 2019</xref>). This study was carried out in accordance with the approval of UNC-Chapel Hill Institutional Animal Care and Use Committee (protocols 16–160 and 19–132).</p></sec><sec id="s4-2"><title>LPS and bacteria microinjections</title><p>Zebrafish larvae at 4–10 dpf and 1 month old were mounted dorsal side up for brain injections or on their sides for intravenous injections in 1–3% low-melting agarose. A pneumatic microinjector (WPI) with a fine capillary glass pipette was used to inject 1 nL for 4–10 dpf or 2 nL for 1 month old of stimulus into the targeted site (either tectum for brain injections, or caudal vein plexus for intravenous injections). Lipopolysaccharides (LPS) derived from 0111:B4 <italic>E. coli</italic> (L3024 Sigma) at 5 ng/nL, ultra-pure water, or live <italic>Escherichia coli</italic> cells were supplemented with fluorescently labeled dextran (Invitrogen, 10,000 MW at 1:100 dilution of a 5 ng/nL stock) for visualization. <italic>E. coli</italic> cells were prepared for injections as previously described (<xref ref-type="bibr" rid="bib31">Earley et al., 2018</xref>). Fluorescently tagged Alexa 594 conjugated LPS from 055:B5 <italic>E. coli</italic> (L23353 Sigma) at 5 ng/nL was used for brain microinjection at 1 nL per fish. All fish after microinjection are carefully monitored for normal health and behavior, and nearly all injected fish remain healthy and viable, showing no signs of overt change. These healthy post-injection fish are used for further experimentation and analysis.</p></sec><sec id="s4-3"><title>In vivo time-lapse and static confocal imaging</title><p>All time-lapse and static z-stack imaging were performed using a Nikon A1R+ hybrid galvano and resonant scanning confocal system equipped with an ultra-high speed A1-SHR scan head and controller. Images were obtained using an apochromat lambda 40x water immersion objective (NA 1.15) or a plan apochromat lambda 20x objective (NA 0.75). Z-steps at 1–2 µm were taken at 40x and 3–5 µm at 20x. Different stages of zebrafish were mounted on glass-bottom dishes using 1.5% low-melting agarose and submerged in fish water supplemented with 0.003% PTU to inhibit pigmentation. Dissected juvenile and adult liver tissues were mounted in fluoromount-G (Southern Biotech) for imaging.</p></sec><sec id="s4-4"><title>Liver cell counts</title><p>At larval stages 4–10 dpf, the whole liver in the live transgenic larvae was captured in a z-stack that was used for counting total number of macrophages and neutrophils in the liver. Transgenic reporters labeling both the immune cells and hepatocytes were used to count cells through the optical sections. At the juvenile and adult stages, cell counts were made on whole liver dissected and imaged ex vivo using a maximum intensity projection of the z-stack using the ImageJ cell counter tool. Two representative z-stacks were taken for each liver counted.</p></sec><sec id="s4-5"><title>Clodronate-mediated macrophage depletion</title><p>Transgenic larvae were injected at three dpf intravenously with 1 nL clodronate liposomes (Liposoma) supplemented with Alexa 568 conjugated dextran (10 kDa, Invitrogen) used at 1:100 for visualization of injection. Larvae were incubated for two days to allow macrophage depletion to occur before they were subjected to brain microinjection with LPS or water vehicle at five dpf. Clodronate depletion of macrophages in the brain (microglia) was confirmed in a subset of larvae using the neutral red staining assay. After brain injections, analysis of neutrophil numbers in the liver was conducted in live transgenic zebrafish imaging at 3.5 hpi.</p></sec><sec id="s4-6"><title>Whole mount RNA in situ hybridization</title><p>RNA in situ was performed using standard methods. Antisense riboprobes were synthesized from plasmids as described (<xref ref-type="bibr" rid="bib104">Shiau et al., 2013</xref>) encoding <italic>mfap4</italic>, <italic>mpx</italic> (Open Biosystems clone 6960294), and a 739 bp coding fragment of <italic>irg1</italic> (NM_001126456.1; pCES161) cloned from a cDNA library derived from a four dpf <italic>E. coli</italic> injected larva using primers Forward-5’- <named-content content-type="sequence">TCGTTCTGCCAGTAGAGATGTTA</named-content>-3’ and Reverse-5’- <named-content content-type="sequence">GCGAGCTGAGATGCCTCTAAAC</named-content>-3’.</p></sec><sec id="s4-7"><title>RNA isolation, qPCR and RT-PCR</title><p>RNA was isolated following the RNAqueous-Micro kit RNA Isolation Procedure (Ambion). Whole larvae or dissected livers and remaining body were lysed in 100–300 uL RNA lysis buffer. Larval liver dissections were performed on transgenic larvae <italic>Tg</italic>(<italic>fabp10a:DsRed</italic>) to aid in identifying the liver. cDNA was made from 150 or 200 ng of total RNA using oligo (dT) primer with SuperScript IV reverse transcriptase (Invitrogen) for qPCR or RT-PCR analysis. qPCR was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems) using SYBR Green. The delta-delta ct method was used to determine the relative levels of mRNA expression between experimental samples and control. <italic>ef1a</italic> was used as the reference gene for determination of relative expression of all target genes. Primer sequences for qPCR and RT-PCR analysis are listed in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>.</p></sec><sec id="s4-8"><title>Morpholino injections</title><p>Antisense morpholino oligos were purchased from Gene Tools and re-suspended in water to make 1 mM or 3 mM stocks. Morpholino sequences are listed in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>. Morpholinos were heated at 65°C for 5 min and cooled to room temperature before injecting into single-cell embryos at 0.5–1 nL.</p></sec><sec id="s4-9"><title>Neutral red staining</title><p>Microglia were scored in live larvae by neutral red vital dye staining as previously described (<xref ref-type="bibr" rid="bib105">Shiau et al., 2015</xref>; <xref ref-type="bibr" rid="bib104">Shiau et al., 2013</xref>). In brief, 3–4 dpf larvae were stained with neutral red by immersion in fish water supplemented with 2.5 μg/mL neutral red and 0.003% PTU at 28.5°C for 1 hr, followed by 1–2 water changes, and then analyzed 2–3 hr later using a stereomicroscope.</p></sec><sec id="s4-10"><title>CRISPR-Cas9 targeted mutagenesis of <italic>il-34</italic> and <italic>csf3r</italic></title><p>The target genes were <italic>il-34</italic> (NCBI accession: NM_001128701.1; Gene ID: 560193) and <italic>csf3r</italic> (NCBI accession: NM_001113377.1; Gene ID: 100134935). Co-injection of Cas9 mRNA and guide RNAs (gRNAs) was conducted in wild-type 1-cell stage zebrafish embryos. Cas9 mRNA was transcribed from XbaI linearalized pT3TS-nCas9n plasmid (Addgene #46757) using mMessage mMachine T3 Kit (Ambion) according to the manufacturer’s instructions. CRISPR targets for gRNA designs were identified using CHOPCHOP (<ext-link ext-link-type="uri" xlink:href="http://chopchop.cbu.uib.no">http://chopchop.cbu.uib.no</ext-link>) (<xref ref-type="bibr" rid="bib40">Gagnon et al., 2014</xref>). Gene-specific oligonucleotides using T7 promoter were used to make gRNAs as previously described (<xref ref-type="bibr" rid="bib40">Gagnon et al., 2014</xref>). gRNA target sequences and genotyping primers are provided in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>. In vitro transcription of gRNAs from assembled oligonucleotides was conducted using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). To ensure high mutagenesis rate and large deletion mutations, three gRNAs were simultaneously injected with Cas9 mRNA for each gene. Injected clutches of embryos were validated to contain CRISPR mediated mutagenesis by a T7 endonuclease assay. Mutations were analyzed by TOPO TA cloning followed by Sanger sequencing.</p></sec><sec id="s4-11"><title>Small-molecule anti-inflammatory drugs</title><p>Administration of different small-molecule chemicals, DMSO control, or no treatment were performed in parallel starting at three dpf through the time of brain microinjection at four dpf in clean multi-well dishes. Analysis of the effect on macrophages was performed at eight hpi either by RNA in situ hybridization or by live confocal imaging using the liver and macrophage transgenes (<italic>fabp10a:DsRed</italic> and <italic>mpeg1:GFP</italic>). 17-DMAG (5 µM) and dexamethasone (6.5 µM) were reconstituted in water and these treatments were compared to the water controls. GW2580 (25 µM), Celastrol (0.22 µM) and Bay 11–7082 (1 µM) were resuspended in DMSO so these treatments were compared to the DMSO-treated controls. List of small molecules is detailed in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>.</p></sec><sec id="s4-12"><title>Liver size measurement</title><p>Whole liver was imaged 48 hr after LPS or water injection at four dpf in the brain tectum on a confocal Nikon A1R+ using an apochromat lambda 40x water immersion objective (NA 1.15). Four dpf larvae for the brain injections were derived from either uninjected, <italic>pu.1</italic>-MO injected, or negative control <italic>p53</italic>-MO injected wild-type embryos. Z-steps were taken at 1 µm thickness. Surface and 3D rendering of the z-stack to measure the liver volume was conducted using the Imaris 3D/4D Image Analysis Software.</p></sec><sec id="s4-13"><title>Statistical analysis</title><p>Unpaired two-tailed t-tests were performed unless otherwise noted. F test was used to compare variances. For unequal variances, Welch’s correction was used on the two-tailed t-test. For multiple comparisons of 3 or more groups, one-way ANOVA test was applied followed by pair-wise tests to determine the pair(s) showing significant differences. GraphPad Prism eight was used to run statistical tests and create graphs. Scatter bar plots show symbols representing biological replicates.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Jonathan Gable for critical insights and discussions on our manuscript. We are grateful for the generous sharing of fish lines from Tjakko van Ham, John Rawls, David Tobin, and Brant Weinstein, and constructs from Martin Distel. We especially thank the rapid shipment of <italic>spi1b</italic> adult mutant line from Cecilia Moens and Rachel Garcia. We also thank the UNC Neuroscience Microscopy Core Facility for assistance with the Imaris imaging analysis and UNC Zebrafish Aquaculture Core Facility for zebrafish housing and care. L.Y. was funded by a UNC SURF fellowship, and JAJ was supported by a T32 ES007126 training fellowship. This work was supported by NIH NIGMS grant 1R35GM124719 to CES.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Formal analysis, Investigation imaging/morpholino/RNA in situ/drugs test/time course/qPCR, Visualization, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Formal analysis, Investigation morpholino/imaging/adult Kupffer/time course/qPCR, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Formal analysis, Investigation CRISPR/liver size/morpholino/cDNA/transgenic lines generation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con4"><p>Investigation genetic mutants and qPCR, Writing - review and editing</p></fn><fn fn-type="con" id="con5"><p>Investigation genetic mutants and qPCR, Writing - review and editing</p></fn><fn fn-type="con" id="con6"><p>Investigation in situ/imaging, Writing - review and editing</p></fn><fn fn-type="con" id="con7"><p>Conceptualization, Formal analysis, Supervision, Funding acquisition, Investigation drainage/mutants/imaging, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols (#16-160 and #19-132) of the UNC Chapel Hill.</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>Key Reagents used.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-58191-supp1-v3.xlsx"/></supplementary-material><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="pdf" mimetype="application" xlink:href="elife-58191-transrepform-v3.pdf"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>All data generated or analyzed during this study are included in the manuscript and supporting files.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Abunnaja</surname> <given-names>MS</given-names></name><name><surname>Kurogi</surname> <given-names>K</given-names></name><name><surname>Mohammed</surname> <given-names>YI</given-names></name><name><surname>Sakakibara</surname> <given-names>Y</given-names></name><name><surname>Suiko</surname> <given-names>M</given-names></name><name><surname>Hassoun</surname> <given-names>EA</given-names></name><name><surname>Liu</surname> <given-names>M-C</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Identification and characterization of the zebrafish glutathione S-transferase Pi-1</article-title><source>Journal of Biochemical and Molecular Toxicology</source><volume>31</volume><elocation-id>e21948</elocation-id><pub-id pub-id-type="doi">10.1002/jbt.21948</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Adams</surname> <given-names>DH</given-names></name></person-group><year iso-8601-date="2003">2003</year><chapter-title>Philadelphia: Saunders</chapter-title><person-group person-group-type="editor"><name><surname>Zakim</surname> <given-names>B</given-names></name></person-group><source>Hepatology: A Textbook of Liver Disease</source><volume>52</volume><publisher-name>BMJ Publishing Group</publisher-name><fpage>1230</fpage><lpage>1231</lpage></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aghai</surname> <given-names>ZH</given-names></name><name><surname>Kumar</surname> <given-names>S</given-names></name><name><surname>Farhath</surname> <given-names>S</given-names></name><name><surname>Kumar</surname> <given-names>MA</given-names></name><name><surname>Saslow</surname> <given-names>J</given-names></name><name><surname>Nakhla</surname> <given-names>T</given-names></name><name><surname>Eydelman</surname> <given-names>R</given-names></name><name><surname>Strande</surname> <given-names>L</given-names></name><name><surname>Stahl</surname> <given-names>G</given-names></name><name><surname>Hewitt</surname> <given-names>C</given-names></name><name><surname>Nesin</surname> <given-names>M</given-names></name><name><surname>Rahman</surname> <given-names>I</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Dexamethasone suppresses expression of nuclear Factor-kappaB in the cells of tracheobronchial lavage fluid in premature neonates with respiratory distress</article-title><source>Pediatric Research</source><volume>59</volume><fpage>811</fpage><lpage>815</lpage><pub-id pub-id-type="doi">10.1203/01.pdr.0000219120.92049.b3</pub-id><pub-id pub-id-type="pmid">16641216</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Andreasen</surname> <given-names>EA</given-names></name><name><surname>Hahn</surname> <given-names>ME</given-names></name><name><surname>Heideman</surname> <given-names>W</given-names></name><name><surname>Peterson</surname> <given-names>RE</given-names></name><name><surname>Tanguay</surname> <given-names>RL</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>The zebrafish (<italic>Danio rerio</italic>) aryl hydrocarbon receptor type 1 is a novel vertebrate receptor</article-title><source>Molecular Pharmacology</source><volume>62</volume><fpage>234</fpage><lpage>249</lpage><pub-id pub-id-type="doi">10.1124/mol.62.2.234</pub-id><pub-id pub-id-type="pmid">12130674</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Anthony</surname> <given-names>DC</given-names></name><name><surname>Couch</surname> <given-names>Y</given-names></name><name><surname>Losey</surname> <given-names>P</given-names></name><name><surname>Evans</surname> <given-names>MC</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>The systemic response to brain injury and disease</article-title><source>Brain, Behavior, and Immunity</source><volume>26</volume><fpage>534</fpage><lpage>540</lpage><pub-id pub-id-type="doi">10.1016/j.bbi.2011.10.011</pub-id><pub-id pub-id-type="pmid">22085588</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bacyinski</surname> <given-names>A</given-names></name><name><surname>Xu</surname> <given-names>M</given-names></name><name><surname>Wang</surname> <given-names>W</given-names></name><name><surname>Hu</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>The paravascular pathway for brain waste clearance: current understanding, significance and controversy</article-title><source>Frontiers in Neuroanatomy</source><volume>11</volume><elocation-id>101</elocation-id><pub-id pub-id-type="doi">10.3389/fnana.2017.00101</pub-id><pub-id pub-id-type="pmid">29163074</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Baghdadi</surname> <given-names>M</given-names></name><name><surname>Wada</surname> <given-names>H</given-names></name><name><surname>Nakanishi</surname> <given-names>S</given-names></name><name><surname>Abe</surname> <given-names>H</given-names></name><name><surname>Han</surname> <given-names>N</given-names></name><name><surname>Putra</surname> <given-names>WE</given-names></name><name><surname>Endo</surname> <given-names>D</given-names></name><name><surname>Watari</surname> <given-names>H</given-names></name><name><surname>Sakuragi</surname> <given-names>N</given-names></name><name><surname>Hida</surname> <given-names>Y</given-names></name><name><surname>Kaga</surname> <given-names>K</given-names></name><name><surname>Miyagi</surname> <given-names>Y</given-names></name><name><surname>Yokose</surname> <given-names>T</given-names></name><name><surname>Takano</surname> <given-names>A</given-names></name><name><surname>Daigo</surname> <given-names>Y</given-names></name><name><surname>Seino</surname> <given-names>KI</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Chemotherapy-Induced IL34 enhances immunosuppression by Tumor-Associated macrophages and mediates survival of chemoresistant lung Cancer cells</article-title><source>Cancer Research</source><volume>76</volume><fpage>6030</fpage><lpage>6042</lpage><pub-id pub-id-type="doi">10.1158/0008-5472.CAN-16-1170</pub-id><pub-id pub-id-type="pmid">27550451</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Baghdadi</surname> <given-names>M</given-names></name><name><surname>Endo</surname> <given-names>H</given-names></name><name><surname>Takano</surname> <given-names>A</given-names></name><name><surname>Ishikawa</surname> <given-names>K</given-names></name><name><surname>Kameda</surname> <given-names>Y</given-names></name><name><surname>Wada</surname> <given-names>H</given-names></name><name><surname>Miyagi</surname> <given-names>Y</given-names></name><name><surname>Yokose</surname> <given-names>T</given-names></name><name><surname>Ito</surname> <given-names>H</given-names></name><name><surname>Nakayama</surname> <given-names>H</given-names></name><name><surname>Daigo</surname> <given-names>Y</given-names></name><name><surname>Suzuki</surname> <given-names>N</given-names></name><name><surname>Seino</surname> <given-names>KI</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>High co-expression of IL-34 and M-CSF correlates with tumor progression and poor survival in lung cancers</article-title><source>Scientific Reports</source><volume>8</volume><elocation-id>418</elocation-id><pub-id pub-id-type="doi">10.1038/s41598-017-18796-8</pub-id><pub-id pub-id-type="pmid">29323162</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Basheer</surname> <given-names>F</given-names></name><name><surname>Rasighaemi</surname> <given-names>P</given-names></name><name><surname>Liongue</surname> <given-names>C</given-names></name><name><surname>Ward</surname> <given-names>AC</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Zebrafish granulocyte Colony-Stimulating factor receptor maintains neutrophil number and function throughout the life span</article-title><source>Infection and Immunity</source><volume>87</volume><elocation-id>e00793-18</elocation-id><pub-id pub-id-type="doi">10.1128/IAI.00793-18</pub-id><pub-id pub-id-type="pmid">30455199</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bennett</surname> <given-names>CM</given-names></name><name><surname>Kanki</surname> <given-names>JP</given-names></name><name><surname>Rhodes</surname> <given-names>J</given-names></name><name><surname>Liu</surname> <given-names>TX</given-names></name><name><surname>Paw</surname> <given-names>BH</given-names></name><name><surname>Kieran</surname> <given-names>MW</given-names></name><name><surname>Langenau</surname> <given-names>DM</given-names></name><name><surname>Delahaye-Brown</surname> <given-names>A</given-names></name><name><surname>Zon</surname> <given-names>LI</given-names></name><name><surname>Fleming</surname> <given-names>MD</given-names></name><name><surname>Look</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Myelopoiesis in the Zebrafish, <italic>Danio rerio</italic></article-title><source>Blood</source><volume>98</volume><fpage>643</fpage><lpage>651</lpage><pub-id pub-id-type="doi">10.1182/blood.V98.3.643</pub-id><pub-id pub-id-type="pmid">11468162</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bikhazi</surname> <given-names>AB</given-names></name><name><surname>Jurjus</surname> <given-names>AR</given-names></name><name><surname>Kamal</surname> <given-names>MT</given-names></name><name><surname>Al-Housseini</surname> <given-names>AM</given-names></name><name><surname>Saab</surname> <given-names>RN</given-names></name><name><surname>Jaroudi</surname> <given-names>WA</given-names></name><name><surname>Bitar</surname> <given-names>KM</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Kinetics of lipopolysaccharide clearance by kupffer and parenchyma cells in perfused rat liver</article-title><source>Comparative Biochemistry and Physiology Part C: Toxicology &amp; Pharmacology</source><volume>129</volume><fpage>339</fpage><lpage>348</lpage><pub-id pub-id-type="doi">10.1016/S1532-0456(01)00207-1</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bilzer</surname> <given-names>M</given-names></name><name><surname>Roggel</surname> <given-names>F</given-names></name><name><surname>Gerbes</surname> <given-names>AL</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Role of kupffer cells in host defense and liver disease</article-title><source>Liver International</source><volume>26</volume><fpage>1175</fpage><lpage>1186</lpage><pub-id pub-id-type="doi">10.1111/j.1478-3231.2006.01342.x</pub-id><pub-id pub-id-type="pmid">17105582</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Boulakirba</surname> <given-names>S</given-names></name><name><surname>Pfeifer</surname> <given-names>A</given-names></name><name><surname>Mhaidly</surname> <given-names>R</given-names></name><name><surname>Obba</surname> <given-names>S</given-names></name><name><surname>Goulard</surname> <given-names>M</given-names></name><name><surname>Schmitt</surname> <given-names>T</given-names></name><name><surname>Chaintreuil</surname> <given-names>P</given-names></name><name><surname>Calleja</surname> <given-names>A</given-names></name><name><surname>Furstoss</surname> <given-names>N</given-names></name><name><surname>Orange</surname> <given-names>F</given-names></name><name><surname>Lacas-Gervais</surname> <given-names>S</given-names></name><name><surname>Boyer</surname> <given-names>L</given-names></name><name><surname>Marchetti</surname> <given-names>S</given-names></name><name><surname>Verhoeyen</surname> <given-names>E</given-names></name><name><surname>Luciano</surname> <given-names>F</given-names></name><name><surname>Robert</surname> <given-names>G</given-names></name><name><surname>Auberger</surname> <given-names>P</given-names></name><name><surname>Jacquel</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>IL-34 and CSF-1 display an equivalent macrophage differentiation ability but a different polarization potential</article-title><source>Scientific Reports</source><volume>8</volume><elocation-id>256</elocation-id><pub-id pub-id-type="doi">10.1038/s41598-017-18433-4</pub-id><pub-id pub-id-type="pmid">29321503</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bradbury</surname> <given-names>MW</given-names></name><name><surname>Cserr</surname> <given-names>HF</given-names></name><name><surname>Westrop</surname> <given-names>RJ</given-names></name></person-group><year iso-8601-date="1981">1981</year><article-title>Drainage of cerebral interstitial fluid into deep cervical lymph of the rabbit</article-title><source>American Journal of Physiology-Renal Physiology</source><volume>240</volume><fpage>F329</fpage><lpage>F336</lpage><pub-id pub-id-type="doi">10.1152/ajprenal.1981.240.4.F329</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bradbury</surname> <given-names>MW</given-names></name><name><surname>Cole</surname> <given-names>DF</given-names></name></person-group><year iso-8601-date="1980">1980</year><article-title>The role of the lymphatic system in drainage of cerebrospinal fluid and aqueous humour</article-title><source>The Journal of Physiology</source><volume>299</volume><fpage>353</fpage><lpage>365</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.1980.sp013129</pub-id><pub-id pub-id-type="pmid">6155466</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Braude</surname> <given-names>AI</given-names></name><name><surname>Carey</surname> <given-names>FJ</given-names></name><name><surname>Sutherland</surname> <given-names>D</given-names></name><name><surname>Zalesky</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="1955">1955</year><article-title>Studies with radioactive endotoxin. I. the use of Cr51 to label endotoxin of <italic>Escherichia coli</italic></article-title><source>Journal of Clinical Investigation</source><volume>34</volume><fpage>850</fpage><lpage>857</lpage><pub-id pub-id-type="doi">10.1172/JCI103140</pub-id><pub-id pub-id-type="pmid">14381514</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Burns</surname> <given-names>AR</given-names></name><name><surname>Miller</surname> <given-names>E</given-names></name><name><surname>Agarwal</surname> <given-names>M</given-names></name><name><surname>Rolig</surname> <given-names>AS</given-names></name><name><surname>Milligan-Myhre</surname> <given-names>K</given-names></name><name><surname>Seredick</surname> <given-names>S</given-names></name><name><surname>Guillemin</surname> <given-names>K</given-names></name><name><surname>Bohannan</surname> <given-names>BJM</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Interhost dispersal alters microbiome assembly and can overwhelm host innate immunity in an experimental zebrafish model</article-title><source>PNAS</source><volume>114</volume><fpage>11181</fpage><lpage>11186</lpage><pub-id pub-id-type="doi">10.1073/pnas.1702511114</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Butterworth</surname> <given-names>RF</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>The liver-brain Axis in liver failure: neuroinflammation and encephalopathy</article-title><source>Nature Reviews Gastroenterology &amp; Hepatology</source><volume>10</volume><fpage>522</fpage><lpage>528</lpage><pub-id pub-id-type="doi">10.1038/nrgastro.2013.99</pub-id><pub-id pub-id-type="pmid">23817325</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Caescu</surname> <given-names>CI</given-names></name><name><surname>Guo</surname> <given-names>X</given-names></name><name><surname>Tesfa</surname> <given-names>L</given-names></name><name><surname>Bhagat</surname> <given-names>TD</given-names></name><name><surname>Verma</surname> <given-names>A</given-names></name><name><surname>Zheng</surname> <given-names>D</given-names></name><name><surname>Stanley</surname> <given-names>ER</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Colony stimulating factor-1 receptor signaling networks inhibit mouse macrophage inflammatory responses by induction of microRNA-21</article-title><source>Blood</source><volume>125</volume><fpage>e1</fpage><lpage>e13</lpage><pub-id pub-id-type="doi">10.1182/blood-2014-10-608000</pub-id><pub-id pub-id-type="pmid">25573988</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Campbell</surname> <given-names>SJ</given-names></name><name><surname>Perry</surname> <given-names>VH</given-names></name><name><surname>Pitossi</surname> <given-names>FJ</given-names></name><name><surname>Butchart</surname> <given-names>AG</given-names></name><name><surname>Chertoff</surname> <given-names>M</given-names></name><name><surname>Waters</surname> <given-names>S</given-names></name><name><surname>Dempster</surname> <given-names>R</given-names></name><name><surname>Anthony</surname> <given-names>DC</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Central nervous system injury triggers hepatic CC and CXC chemokine expression that is associated with leukocyte mobilization and recruitment to both the central nervous system and the liver</article-title><source>The American Journal of Pathology</source><volume>166</volume><fpage>1487</fpage><lpage>1497</lpage><pub-id pub-id-type="doi">10.1016/S0002-9440(10)62365-6</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Campbell</surname> <given-names>SJ</given-names></name><name><surname>Meier</surname> <given-names>U</given-names></name><name><surname>Mardiguian</surname> <given-names>S</given-names></name><name><surname>Jiang</surname> <given-names>Y</given-names></name><name><surname>Littleton</surname> <given-names>ET</given-names></name><name><surname>Bristow</surname> <given-names>A</given-names></name><name><surname>Relton</surname> <given-names>J</given-names></name><name><surname>Connor</surname> <given-names>TJ</given-names></name><name><surname>Anthony</surname> <given-names>DC</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Sickness behaviour is induced by a peripheral CXC-chemokine also expressed in multiple sclerosis and EAE</article-title><source>Brain, Behavior, and Immunity</source><volume>24</volume><fpage>738</fpage><lpage>746</lpage><pub-id pub-id-type="doi">10.1016/j.bbi.2010.01.011</pub-id><pub-id pub-id-type="pmid">20138139</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Casley-Smith</surname> <given-names>JR</given-names></name><name><surname>Földi-Börsök</surname> <given-names>E</given-names></name><name><surname>Földi</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="1976">1976</year><article-title>The prelymphatic pathways of the brain as revealed by cervical lymphatic obstruction and the passage of particles</article-title><source>British Journal of Experimental Pathology</source><volume>57</volume><fpage>179</fpage><lpage>188</lpage><pub-id pub-id-type="pmid">773400</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Catania</surname> <given-names>A</given-names></name><name><surname>Lonati</surname> <given-names>C</given-names></name><name><surname>Sordi</surname> <given-names>A</given-names></name><name><surname>Gatti</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Detrimental consequences of brain injury on peripheral cells</article-title><source>Brain, Behavior, and Immunity</source><volume>23</volume><fpage>877</fpage><lpage>884</lpage><pub-id pub-id-type="doi">10.1016/j.bbi.2009.04.006</pub-id><pub-id pub-id-type="pmid">19394418</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chemel</surname> <given-names>M</given-names></name><name><surname>Le Goff</surname> <given-names>B</given-names></name><name><surname>Brion</surname> <given-names>R</given-names></name><name><surname>Cozic</surname> <given-names>C</given-names></name><name><surname>Berreur</surname> <given-names>M</given-names></name><name><surname>Amiaud</surname> <given-names>J</given-names></name><name><surname>Bougras</surname> <given-names>G</given-names></name><name><surname>Touchais</surname> <given-names>S</given-names></name><name><surname>Blanchard</surname> <given-names>F</given-names></name><name><surname>Heymann</surname> <given-names>MF</given-names></name><name><surname>Berthelot</surname> <given-names>JM</given-names></name><name><surname>Verrecchia</surname> <given-names>F</given-names></name><name><surname>Heymann</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Interleukin 34 expression is associated with synovitis severity in rheumatoid arthritis patients</article-title><source>Annals of the Rheumatic Diseases</source><volume>71</volume><fpage>150</fpage><lpage>154</lpage><pub-id pub-id-type="doi">10.1136/annrheumdis-2011-200096</pub-id><pub-id pub-id-type="pmid">22039170</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ciccia</surname> <given-names>F</given-names></name><name><surname>Alessandro</surname> <given-names>R</given-names></name><name><surname>Rodolico</surname> <given-names>V</given-names></name><name><surname>Guggino</surname> <given-names>G</given-names></name><name><surname>Raimondo</surname> <given-names>S</given-names></name><name><surname>Guarnotta</surname> <given-names>C</given-names></name><name><surname>Giardina</surname> <given-names>A</given-names></name><name><surname>Sireci</surname> <given-names>G</given-names></name><name><surname>Campisi</surname> <given-names>G</given-names></name><name><surname>De Leo</surname> <given-names>G</given-names></name><name><surname>Triolo</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>IL-34 is overexpressed in the inflamed salivary glands of patients with Sjogren's syndrome and is associated with the local expansion of pro-inflammatory CD14(bright)CD16+ monocytes</article-title><source>Rheumatology</source><volume>52</volume><fpage>1009</fpage><lpage>1017</lpage><pub-id pub-id-type="doi">10.1093/rheumatology/kes435</pub-id><pub-id pub-id-type="pmid">23392590</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Coffin</surname> <given-names>AB</given-names></name><name><surname>Williamson</surname> <given-names>KL</given-names></name><name><surname>Mamiya</surname> <given-names>A</given-names></name><name><surname>Raible</surname> <given-names>DW</given-names></name><name><surname>Rubel</surname> <given-names>EW</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Profiling drug-induced cell death pathways in the zebrafish lateral line</article-title><source>Apoptosis</source><volume>18</volume><fpage>393</fpage><lpage>408</lpage><pub-id pub-id-type="doi">10.1007/s10495-013-0816-8</pub-id><pub-id pub-id-type="pmid">23413197</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Conway</surname> <given-names>JG</given-names></name><name><surname>McDonald</surname> <given-names>B</given-names></name><name><surname>Parham</surname> <given-names>J</given-names></name><name><surname>Keith</surname> <given-names>B</given-names></name><name><surname>Rusnak</surname> <given-names>DW</given-names></name><name><surname>Shaw</surname> <given-names>E</given-names></name><name><surname>Jansen</surname> <given-names>M</given-names></name><name><surname>Lin</surname> <given-names>P</given-names></name><name><surname>Payne</surname> <given-names>A</given-names></name><name><surname>Crosby</surname> <given-names>RM</given-names></name><name><surname>Johnson</surname> <given-names>JH</given-names></name><name><surname>Frick</surname> <given-names>L</given-names></name><name><surname>Lin</surname> <given-names>MH</given-names></name><name><surname>Depee</surname> <given-names>S</given-names></name><name><surname>Tadepalli</surname> <given-names>S</given-names></name><name><surname>Votta</surname> <given-names>B</given-names></name><name><surname>James</surname> <given-names>I</given-names></name><name><surname>Fuller</surname> <given-names>K</given-names></name><name><surname>Chambers</surname> <given-names>TJ</given-names></name><name><surname>Kull</surname> <given-names>FC</given-names></name><name><surname>Chamberlain</surname> <given-names>SD</given-names></name><name><surname>Hutchins</surname> <given-names>JT</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Inhibition of colony-stimulating-factor-1 signaling <italic>in vivo</italic> with the orally bioavailable cFMS kinase inhibitor GW2580</article-title><source>PNAS</source><volume>102</volume><fpage>16078</fpage><lpage>16083</lpage><pub-id pub-id-type="doi">10.1073/pnas.0502000102</pub-id><pub-id pub-id-type="pmid">16249345</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cserr</surname> <given-names>HF</given-names></name><name><surname>Ostrach</surname> <given-names>LH</given-names></name></person-group><year iso-8601-date="1974">1974</year><article-title>Bulk flow of interstitial fluid after intracranial injection of blue dextran 2000</article-title><source>Experimental Neurology</source><volume>45</volume><fpage>50</fpage><lpage>60</lpage><pub-id pub-id-type="doi">10.1016/0014-4886(74)90099-5</pub-id><pub-id pub-id-type="pmid">4137563</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dixon</surname> <given-names>LJ</given-names></name><name><surname>Barnes</surname> <given-names>M</given-names></name><name><surname>Tang</surname> <given-names>H</given-names></name><name><surname>Pritchard</surname> <given-names>MT</given-names></name><name><surname>Nagy</surname> <given-names>LE</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Kupffer cells in the liver</article-title><source>Comprehensive Physiology</source><volume>3</volume><fpage>785</fpage><lpage>797</lpage><pub-id pub-id-type="doi">10.1002/cphy.c120026</pub-id><pub-id pub-id-type="pmid">23720329</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dong</surname> <given-names>PD</given-names></name><name><surname>Munson</surname> <given-names>CA</given-names></name><name><surname>Norton</surname> <given-names>W</given-names></name><name><surname>Crosnier</surname> <given-names>C</given-names></name><name><surname>Pan</surname> <given-names>X</given-names></name><name><surname>Gong</surname> <given-names>Z</given-names></name><name><surname>Neumann</surname> <given-names>CJ</given-names></name><name><surname>Stainier</surname> <given-names>DY</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Fgf10 regulates hepatopancreatic ductal system patterning and differentiation</article-title><source>Nature Genetics</source><volume>39</volume><fpage>397</fpage><lpage>402</lpage><pub-id pub-id-type="doi">10.1038/ng1961</pub-id><pub-id pub-id-type="pmid">17259985</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Earley</surname> <given-names>AM</given-names></name><name><surname>Dixon</surname> <given-names>CT</given-names></name><name><surname>Shiau</surname> <given-names>CE</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Genetic analysis of zebrafish homologs of human FOXQ1, foxq1a and foxq1b, in innate immune cell development and bacterial host response</article-title><source>PLOS ONE</source><volume>13</volume><elocation-id>e0194207</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0194207</pub-id><pub-id pub-id-type="pmid">29534099</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edwards</surname> <given-names>L</given-names></name><name><surname>Wanless</surname> <given-names>IR</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Mechanisms of liver involvement in systemic disease</article-title><source>Best Practice &amp; Research Clinical Gastroenterology</source><volume>27</volume><fpage>471</fpage><lpage>483</lpage><pub-id pub-id-type="doi">10.1016/j.bpg.2013.08.002</pub-id><pub-id pub-id-type="pmid">24090936</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Eipel</surname> <given-names>C</given-names></name><name><surname>Abshagen</surname> <given-names>K</given-names></name><name><surname>Vollmar</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Regulation of hepatic blood flow: the hepatic arterial buffer response revisited</article-title><source>World Journal of Gastroenterology</source><volume>16</volume><fpage>6046</fpage><lpage>6057</lpage><pub-id pub-id-type="doi">10.3748/wjg.v16.i48.6046</pub-id><pub-id pub-id-type="pmid">21182219</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ellett</surname> <given-names>F</given-names></name><name><surname>Pase</surname> <given-names>L</given-names></name><name><surname>Hayman</surname> <given-names>JW</given-names></name><name><surname>Andrianopoulos</surname> <given-names>A</given-names></name><name><surname>Lieschke</surname> <given-names>GJ</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>mpeg1 promoter transgenes direct macrophage-lineage expression in zebrafish</article-title><source>Blood</source><volume>117</volume><fpage>e49</fpage><lpage>e56</lpage><pub-id pub-id-type="doi">10.1182/blood-2010-10-314120</pub-id><pub-id pub-id-type="pmid">21084707</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Eom</surname> <given-names>DS</given-names></name><name><surname>Parichy</surname> <given-names>DM</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A macrophage relay for long-distance signaling during postembryonic tissue remodeling</article-title><source>Science</source><volume>355</volume><fpage>1317</fpage><lpage>1320</lpage><pub-id pub-id-type="doi">10.1126/science.aal2745</pub-id><pub-id pub-id-type="pmid">28209639</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Estrada</surname> <given-names>LD</given-names></name><name><surname>Ahumada</surname> <given-names>P</given-names></name><name><surname>Cabrera</surname> <given-names>D</given-names></name><name><surname>Arab</surname> <given-names>JP</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Liver dysfunction as a novel player in Alzheimer's Progression: Looking Outside the Brain</article-title><source>Frontiers in Aging Neuroscience</source><volume>11</volume><elocation-id>174</elocation-id><pub-id pub-id-type="doi">10.3389/fnagi.2019.00174</pub-id><pub-id pub-id-type="pmid">31379558</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fame</surname> <given-names>RM</given-names></name><name><surname>Chang</surname> <given-names>JT</given-names></name><name><surname>Hong</surname> <given-names>A</given-names></name><name><surname>Aponte-Santiago</surname> <given-names>NA</given-names></name><name><surname>Sive</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Directional cerebrospinal fluid movement between brain ventricles in larval zebrafish</article-title><source>Fluids and Barriers of the CNS</source><volume>13</volume><elocation-id>11</elocation-id><pub-id pub-id-type="doi">10.1186/s12987-016-0036-z</pub-id><pub-id pub-id-type="pmid">27329482</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Felipo</surname> <given-names>V</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Hepatic encephalopathy: effects of liver failure on brain function</article-title><source>Nature Reviews Neuroscience</source><volume>14</volume><fpage>851</fpage><lpage>858</lpage><pub-id pub-id-type="doi">10.1038/nrn3587</pub-id><pub-id pub-id-type="pmid">24149188</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fujita</surname> <given-names>M</given-names></name><name><surname>Cha</surname> <given-names>YR</given-names></name><name><surname>Pham</surname> <given-names>VN</given-names></name><name><surname>Sakurai</surname> <given-names>A</given-names></name><name><surname>Roman</surname> <given-names>BL</given-names></name><name><surname>Gutkind</surname> <given-names>JS</given-names></name><name><surname>Weinstein</surname> <given-names>BM</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Assembly and patterning of the vascular network of the vertebrate hindbrain</article-title><source>Development</source><volume>138</volume><fpage>1705</fpage><lpage>1715</lpage><pub-id pub-id-type="doi">10.1242/dev.058776</pub-id><pub-id pub-id-type="pmid">21429985</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gagnon</surname> <given-names>JA</given-names></name><name><surname>Valen</surname> <given-names>E</given-names></name><name><surname>Thyme</surname> <given-names>SB</given-names></name><name><surname>Huang</surname> <given-names>P</given-names></name><name><surname>Akhmetova</surname> <given-names>L</given-names></name><name><surname>Ahkmetova</surname> <given-names>L</given-names></name><name><surname>Pauli</surname> <given-names>A</given-names></name><name><surname>Montague</surname> <given-names>TG</given-names></name><name><surname>Zimmerman</surname> <given-names>S</given-names></name><name><surname>Richter</surname> <given-names>C</given-names></name><name><surname>Schier</surname> <given-names>AF</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs</article-title><source>PLOS ONE</source><volume>9</volume><elocation-id>e98186</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0098186</pub-id><pub-id pub-id-type="pmid">24873830</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Glascock</surname> <given-names>JJ</given-names></name><name><surname>Osman</surname> <given-names>EY</given-names></name><name><surname>Coady</surname> <given-names>TH</given-names></name><name><surname>Rose</surname> <given-names>FF</given-names></name><name><surname>Shababi</surname> <given-names>M</given-names></name><name><surname>Lorson</surname> <given-names>CL</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Delivery of therapeutic agents through intracerebroventricular (ICV) and intravenous (IV) Injection in mice</article-title><source>Journal of Visualized Experiments</source><volume>56</volume><elocation-id>2968</elocation-id><pub-id pub-id-type="doi">10.3791/2968</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Goessling</surname> <given-names>W</given-names></name><name><surname>Sadler</surname> <given-names>KC</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Zebrafish: an important tool for liver disease research</article-title><source>Gastroenterology</source><volume>149</volume><fpage>1361</fpage><lpage>1377</lpage><pub-id pub-id-type="doi">10.1053/j.gastro.2015.08.034</pub-id><pub-id pub-id-type="pmid">26319012</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gregory</surname> <given-names>SH</given-names></name><name><surname>Sagnimeni</surname> <given-names>AJ</given-names></name><name><surname>Wing</surname> <given-names>EJ</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Bacteria in the bloodstream are trapped in the liver and killed by immigrating neutrophils</article-title><source>Journal of Immunology</source><volume>157</volume><elocation-id>2514</elocation-id><pub-id pub-id-type="pmid">8805652</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gregory</surname> <given-names>SH</given-names></name><name><surname>Cousens</surname> <given-names>LP</given-names></name><name><surname>van Rooijen</surname> <given-names>N</given-names></name><name><surname>Döpp</surname> <given-names>EA</given-names></name><name><surname>Carlos</surname> <given-names>TM</given-names></name><name><surname>Wing</surname> <given-names>EJ</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Complementary adhesion molecules promote neutrophil-Kupffer cell interaction and the elimination of Bacteria taken up by the liver</article-title><source>The Journal of Immunology</source><volume>168</volume><fpage>308</fpage><lpage>315</lpage><pub-id pub-id-type="doi">10.4049/jimmunol.168.1.308</pub-id><pub-id pub-id-type="pmid">11751975</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hall</surname> <given-names>C</given-names></name><name><surname>Flores</surname> <given-names>MV</given-names></name><name><surname>Storm</surname> <given-names>T</given-names></name><name><surname>Crosier</surname> <given-names>K</given-names></name><name><surname>Crosier</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>The zebrafish lysozyme C promoter drives myeloid-specific expression in transgenic fish</article-title><source>BMC Developmental Biology</source><volume>7</volume><elocation-id>42</elocation-id><pub-id pub-id-type="doi">10.1186/1471-213X-7-42</pub-id><pub-id pub-id-type="pmid">17477879</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Harling-Berg</surname> <given-names>C</given-names></name><name><surname>Knopf</surname> <given-names>PM</given-names></name><name><surname>Merriam</surname> <given-names>J</given-names></name><name><surname>Cserr</surname> <given-names>HF</given-names></name></person-group><year iso-8601-date="1989">1989</year><article-title>Role of cervical lymph nodes in the systemic humoral immune response to human serum albumin microinfused into rat cerebrospinal fluid</article-title><source>Journal of Neuroimmunology</source><volume>25</volume><fpage>185</fpage><lpage>193</lpage><pub-id pub-id-type="doi">10.1016/0165-5728(89)90136-7</pub-id><pub-id pub-id-type="pmid">2584396</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>He</surname> <given-names>S</given-names></name><name><surname>Chen</surname> <given-names>J</given-names></name><name><surname>Jiang</surname> <given-names>Y</given-names></name><name><surname>Wu</surname> <given-names>Y</given-names></name><name><surname>Zhu</surname> <given-names>L</given-names></name><name><surname>Jin</surname> <given-names>W</given-names></name><name><surname>Zhao</surname> <given-names>C</given-names></name><name><surname>Yu</surname> <given-names>T</given-names></name><name><surname>Wang</surname> <given-names>T</given-names></name><name><surname>Wu</surname> <given-names>S</given-names></name><name><surname>Lin</surname> <given-names>X</given-names></name><name><surname>Qu</surname> <given-names>JY</given-names></name><name><surname>Wen</surname> <given-names>Z</given-names></name><name><surname>Zhang</surname> <given-names>W</given-names></name><name><surname>Xu</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Adult zebrafish langerhans cells arise from hematopoietic stem/progenitor cells</article-title><source>eLife</source><volume>7</volume><elocation-id>e36131</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.36131</pub-id><pub-id pub-id-type="pmid">29905527</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Henson</surname> <given-names>HE</given-names></name><name><surname>Parupalli</surname> <given-names>C</given-names></name><name><surname>Ju</surname> <given-names>B</given-names></name><name><surname>Taylor</surname> <given-names>MR</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Functional and genetic analysis of choroid plexus development in zebrafish</article-title><source>Frontiers in Neuroscience</source><volume>8</volume><elocation-id>364</elocation-id><pub-id pub-id-type="doi">10.3389/fnins.2014.00364</pub-id><pub-id pub-id-type="pmid">25426018</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Herring</surname> <given-names>WB</given-names></name><name><surname>Herion</surname> <given-names>JC</given-names></name><name><surname>Walker</surname> <given-names>RI</given-names></name><name><surname>Palmer</surname> <given-names>JG</given-names></name></person-group><year iso-8601-date="1963">1963</year><article-title>Distribution and clearance of circulating endotoxin</article-title><source>Journal of Clinical Investigation</source><volume>42</volume><fpage>79</fpage><lpage>87</lpage><pub-id pub-id-type="doi">10.1172/JCI104698</pub-id><pub-id pub-id-type="pmid">13954079</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hladky</surname> <given-names>SB</given-names></name><name><surname>Barrand</surname> <given-names>MA</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Fluid and ion transfer across the blood-brain and blood-cerebrospinal fluid barriers; a comparative account of mechanisms and roles</article-title><source>Fluids and Barriers of the CNS</source><volume>13</volume><elocation-id>19</elocation-id><pub-id pub-id-type="doi">10.1186/s12987-016-0040-3</pub-id><pub-id pub-id-type="pmid">27799072</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hladky</surname> <given-names>SB</given-names></name><name><surname>Barrand</surname> <given-names>MA</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Elimination of substances from the brain parenchyma: efflux via perivascular pathways and via the blood–brain barrier</article-title><source>Fluids and Barriers of the CNS</source><volume>15</volume><elocation-id>30</elocation-id><pub-id pub-id-type="doi">10.1186/s12987-018-0113-6</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hong</surname> <given-names>SK</given-names></name><name><surname>Dawid</surname> <given-names>IB</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Alpha2 macroglobulin-like is essential for liver development in zebrafish</article-title><source>PLOS ONE</source><volume>3</volume><elocation-id>e3736</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0003736</pub-id><pub-id pub-id-type="pmid">19011686</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huang</surname> <given-names>R</given-names></name><name><surname>Wu</surname> <given-names>H</given-names></name><name><surname>Liu</surname> <given-names>Y</given-names></name><name><surname>Yang</surname> <given-names>C</given-names></name><name><surname>Pan</surname> <given-names>Z</given-names></name><name><surname>Xia</surname> <given-names>J</given-names></name><name><surname>Xiong</surname> <given-names>Y</given-names></name><name><surname>Wang</surname> <given-names>G</given-names></name><name><surname>Sun</surname> <given-names>Z</given-names></name><name><surname>Chen</surname> <given-names>J</given-names></name><name><surname>Yan</surname> <given-names>X</given-names></name><name><surname>Zhang</surname> <given-names>Z</given-names></name><name><surname>Wu</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Increase of infiltrating monocytes in the livers of patients with chronic liver diseases</article-title><source>Discovery Medicine</source><volume>21</volume><fpage>25</fpage><lpage>33</lpage><pub-id pub-id-type="pmid">26896599</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hwang</surname> <given-names>S-J</given-names></name><name><surname>Choi</surname> <given-names>B</given-names></name><name><surname>Kang</surname> <given-names>S-S</given-names></name><name><surname>Chang</surname> <given-names>J-H</given-names></name><name><surname>Kim</surname> <given-names>Y-G</given-names></name><name><surname>Chung</surname> <given-names>Y-H</given-names></name><name><surname>Sohn</surname> <given-names>D</given-names></name><name><surname>So</surname> <given-names>M</given-names></name><name><surname>Lee</surname> <given-names>C-K</given-names></name><name><surname>Robinson</surname> <given-names>WH</given-names></name><name><surname>Chang</surname> <given-names>E-J</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Interleukin-34 produced by human fibroblast-like synovial cells in rheumatoid arthritis supports osteoclastogenesis</article-title><source>Arthritis Research &amp; Therapy</source><volume>14</volume><elocation-id>R14</elocation-id><pub-id pub-id-type="doi">10.1186/ar3693</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Iliff</surname> <given-names>JJ</given-names></name><name><surname>Wang</surname> <given-names>M</given-names></name><name><surname>Liao</surname> <given-names>Y</given-names></name><name><surname>Plogg</surname> <given-names>BA</given-names></name><name><surname>Peng</surname> <given-names>W</given-names></name><name><surname>Gundersen</surname> <given-names>GA</given-names></name><name><surname>Benveniste</surname> <given-names>H</given-names></name><name><surname>Vates</surname> <given-names>GE</given-names></name><name><surname>Deane</surname> <given-names>R</given-names></name><name><surname>Goldman</surname> <given-names>SA</given-names></name><name><surname>Nagelhus</surname> <given-names>EA</given-names></name><name><surname>Nedergaard</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>A paravascular pathway facilitates CSF flow through the brain parenchyma and the clearance of interstitial solutes, including amyloid β</article-title><source>Science Translational Medicine</source><volume>4</volume><elocation-id>147ra111</elocation-id><pub-id pub-id-type="doi">10.1126/scitranslmed.3003748</pub-id><pub-id pub-id-type="pmid">22896675</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Iwakiri</surname> <given-names>Y</given-names></name><name><surname>Shah</surname> <given-names>V</given-names></name><name><surname>Rockey</surname> <given-names>DC</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Vascular pathobiology in chronic liver disease and cirrhosis - current status and future directions</article-title><source>Journal of Hepatology</source><volume>61</volume><fpage>912</fpage><lpage>924</lpage><pub-id pub-id-type="doi">10.1016/j.jhep.2014.05.047</pub-id><pub-id pub-id-type="pmid">24911462</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jenne</surname> <given-names>CN</given-names></name><name><surname>Liao</surname> <given-names>S</given-names></name><name><surname>Singh</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Neutrophils: multitasking first responders of immunity and tissue homeostasis</article-title><source>Cell and Tissue Research</source><volume>371</volume><fpage>395</fpage><lpage>397</lpage><pub-id pub-id-type="doi">10.1007/s00441-018-2802-5</pub-id><pub-id pub-id-type="pmid">29392468</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jeong</surname> <given-names>JY</given-names></name><name><surname>Kwon</surname> <given-names>HB</given-names></name><name><surname>Ahn</surname> <given-names>JC</given-names></name><name><surname>Kang</surname> <given-names>D</given-names></name><name><surname>Kwon</surname> <given-names>SH</given-names></name><name><surname>Park</surname> <given-names>JA</given-names></name><name><surname>Kim</surname> <given-names>KW</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Functional and developmental analysis of the blood-brain barrier in zebrafish</article-title><source>Brain Research Bulletin</source><volume>75</volume><fpage>619</fpage><lpage>628</lpage><pub-id pub-id-type="doi">10.1016/j.brainresbull.2007.10.043</pub-id><pub-id pub-id-type="pmid">18355638</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jiang</surname> <given-names>Y</given-names></name><name><surname>Chen</surname> <given-names>J</given-names></name><name><surname>Yen</surname> <given-names>K</given-names></name><name><surname>Xu</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Ectopically expressed IL-34 can efficiently induce macrophage migration to the liver in zebrafish</article-title><source>Zebrafish</source><volume>16</volume><fpage>165</fpage><lpage>170</lpage><pub-id pub-id-type="doi">10.1089/zeb.2018.1685</pub-id><pub-id pub-id-type="pmid">30724719</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jung</surname> <given-names>HM</given-names></name><name><surname>Castranova</surname> <given-names>D</given-names></name><name><surname>Swift</surname> <given-names>MR</given-names></name><name><surname>Pham</surname> <given-names>VN</given-names></name><name><surname>Venero Galanternik</surname> <given-names>M</given-names></name><name><surname>Isogai</surname> <given-names>S</given-names></name><name><surname>Butler</surname> <given-names>MG</given-names></name><name><surname>Mulligan</surname> <given-names>TS</given-names></name><name><surname>Weinstein</surname> <given-names>BM</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Development of the larval lymphatic system in zebrafish</article-title><source>Development</source><volume>144</volume><fpage>2070</fpage><lpage>2081</lpage><pub-id pub-id-type="doi">10.1242/dev.145755</pub-id><pub-id pub-id-type="pmid">28506987</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Karlmark</surname> <given-names>KR</given-names></name><name><surname>Wasmuth</surname> <given-names>HE</given-names></name><name><surname>Trautwein</surname> <given-names>C</given-names></name><name><surname>Tacke</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Chemokine-directed immune cell infiltration in acute and chronic liver disease</article-title><source>Expert Review of Gastroenterology &amp; Hepatology</source><volume>2</volume><fpage>233</fpage><lpage>242</lpage><pub-id pub-id-type="doi">10.1586/17474124.2.2.233</pub-id><pub-id pub-id-type="pmid">19072358</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kim</surname> <given-names>ND</given-names></name><name><surname>Luster</surname> <given-names>AD</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>The role of tissue resident cells in neutrophil recruitment</article-title><source>Trends in Immunology</source><volume>36</volume><fpage>547</fpage><lpage>555</lpage><pub-id pub-id-type="doi">10.1016/j.it.2015.07.007</pub-id><pub-id pub-id-type="pmid">26297103</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kimmel</surname> <given-names>CB</given-names></name><name><surname>Ballard</surname> <given-names>WW</given-names></name><name><surname>Kimmel</surname> <given-names>SR</given-names></name><name><surname>Ullmann</surname> <given-names>B</given-names></name><name><surname>Schilling</surname> <given-names>TF</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Stages of embryonic development of the zebrafish</article-title><source>Developmental Dynamics</source><volume>203</volume><fpage>253</fpage><lpage>310</lpage><pub-id pub-id-type="doi">10.1002/aja.1002030302</pub-id><pub-id pub-id-type="pmid">8589427</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Koch</surname> <given-names>BEV</given-names></name><name><surname>Yang</surname> <given-names>S</given-names></name><name><surname>Lamers</surname> <given-names>G</given-names></name><name><surname>Stougaard</surname> <given-names>J</given-names></name><name><surname>Spaink</surname> <given-names>HP</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Intestinal microbiome adjusts the innate immune setpoint during colonization through negative regulation of MyD88</article-title><source>Nature Communications</source><volume>9</volume><elocation-id>4</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-018-06658-4</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kubes</surname> <given-names>P</given-names></name><name><surname>Jenne</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Immune responses in the liver</article-title><source>Annual Review of Immunology</source><volume>36</volume><fpage>247</fpage><lpage>277</lpage><pub-id pub-id-type="doi">10.1146/annurev-immunol-051116-052415</pub-id><pub-id pub-id-type="pmid">29328785</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Küchler</surname> <given-names>AM</given-names></name><name><surname>Gjini</surname> <given-names>E</given-names></name><name><surname>Peterson-Maduro</surname> <given-names>J</given-names></name><name><surname>Cancilla</surname> <given-names>B</given-names></name><name><surname>Wolburg</surname> <given-names>H</given-names></name><name><surname>Schulte-Merker</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Development of the zebrafish lymphatic system requires VEGFC signaling</article-title><source>Current Biology</source><volume>16</volume><fpage>1244</fpage><lpage>1248</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2006.05.026</pub-id><pub-id pub-id-type="pmid">16782017</pub-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kuil</surname> <given-names>LE</given-names></name><name><surname>Oosterhof</surname> <given-names>N</given-names></name><name><surname>Geurts</surname> <given-names>SN</given-names></name><name><surname>van der Linde</surname> <given-names>HC</given-names></name><name><surname>Meijering</surname> <given-names>E</given-names></name><name><surname>van Ham</surname> <given-names>TJ</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Reverse genetic screen reveals that Il34 facilitates yolk sac macrophage distribution and seeding of the brain</article-title><source>Disease Models &amp; Mechanisms</source><volume>12</volume><elocation-id>dmm037762</elocation-id><pub-id pub-id-type="doi">10.1242/dmm.037762</pub-id><pub-id pub-id-type="pmid">30765415</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lampropoulou</surname> <given-names>V</given-names></name><name><surname>Sergushichev</surname> <given-names>A</given-names></name><name><surname>Bambouskova</surname> <given-names>M</given-names></name><name><surname>Nair</surname> <given-names>S</given-names></name><name><surname>Vincent</surname> <given-names>EE</given-names></name><name><surname>Loginicheva</surname> <given-names>E</given-names></name><name><surname>Cervantes-Barragan</surname> <given-names>L</given-names></name><name><surname>Ma</surname> <given-names>X</given-names></name><name><surname>Huang</surname> <given-names>SC</given-names></name><name><surname>Griss</surname> <given-names>T</given-names></name><name><surname>Weinheimer</surname> <given-names>CJ</given-names></name><name><surname>Khader</surname> <given-names>S</given-names></name><name><surname>Randolph</surname> <given-names>GJ</given-names></name><name><surname>Pearce</surname> <given-names>EJ</given-names></name><name><surname>Jones</surname> <given-names>RG</given-names></name><name><surname>Diwan</surname> <given-names>A</given-names></name><name><surname>Diamond</surname> <given-names>MS</given-names></name><name><surname>Artyomov</surname> <given-names>MN</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Itaconate links inhibition of succinate dehydrogenase with macrophage metabolic remodeling and regulation of inflammation</article-title><source>Cell Metabolism</source><volume>24</volume><fpage>158</fpage><lpage>166</lpage><pub-id pub-id-type="doi">10.1016/j.cmet.2016.06.004</pub-id><pub-id pub-id-type="pmid">27374498</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lancet</surname> <given-names>JE</given-names></name><name><surname>Gojo</surname> <given-names>I</given-names></name><name><surname>Burton</surname> <given-names>M</given-names></name><name><surname>Quinn</surname> <given-names>M</given-names></name><name><surname>Tighe</surname> <given-names>SM</given-names></name><name><surname>Kersey</surname> <given-names>K</given-names></name><name><surname>Zhong</surname> <given-names>Z</given-names></name><name><surname>Albitar</surname> <given-names>MX</given-names></name><name><surname>Bhalla</surname> <given-names>K</given-names></name><name><surname>Hannah</surname> <given-names>AL</given-names></name><name><surname>Baer</surname> <given-names>MR</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Phase I study of the heat shock protein 90 inhibitor alvespimycin (KOS-1022, 17-DMAG) administered intravenously twice weekly to patients with acute myeloid leukemia</article-title><source>Leukemia</source><volume>24</volume><fpage>699</fpage><lpage>705</lpage><pub-id pub-id-type="doi">10.1038/leu.2009.292</pub-id><pub-id pub-id-type="pmid">20111068</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname> <given-names>J-H</given-names></name><name><surname>Koo</surname> <given-names>TH</given-names></name><name><surname>Yoon</surname> <given-names>H</given-names></name><name><surname>Jung</surname> <given-names>HS</given-names></name><name><surname>Jin</surname> <given-names>HZ</given-names></name><name><surname>Lee</surname> <given-names>K</given-names></name><name><surname>Hong</surname> <given-names>Y-S</given-names></name><name><surname>Lee</surname> <given-names>JJ</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Inhibition of NF-κB activation through targeting iκb kinase by celastrol, a quinone methide triterpenoid</article-title><source>Biochemical Pharmacology</source><volume>72</volume><fpage>1311</fpage><lpage>1321</lpage><pub-id pub-id-type="doi">10.1016/j.bcp.2006.08.014</pub-id></element-citation></ref><ref id="bib71"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname> <given-names>J</given-names></name><name><surname>Rhee</surname> <given-names>MH</given-names></name><name><surname>Kim</surname> <given-names>E</given-names></name><name><surname>Cho</surname> <given-names>JY</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>BAY 11-7082 is a Broad-Spectrum inhibitor with Anti-Inflammatory activity against multiple targets</article-title><source>Mediators of Inflammation</source><volume>2012</volume><fpage>1</fpage><lpage>11</lpage><pub-id pub-id-type="doi">10.1155/2012/416036</pub-id></element-citation></ref><ref id="bib72"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>L</given-names></name><name><surname>Jin</surname> <given-names>H</given-names></name><name><surname>Xu</surname> <given-names>J</given-names></name><name><surname>Shi</surname> <given-names>Y</given-names></name><name><surname>Wen</surname> <given-names>Z</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Irf8 regulates macrophage versus neutrophil fate during zebrafish primitive myelopoiesis</article-title><source>Blood</source><volume>117</volume><fpage>1359</fpage><lpage>1369</lpage><pub-id pub-id-type="doi">10.1182/blood-2010-06-290700</pub-id><pub-id pub-id-type="pmid">21079149</pub-id></element-citation></ref><ref id="bib73"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lin</surname> <given-names>W</given-names></name><name><surname>Xu</surname> <given-names>D</given-names></name><name><surname>Austin</surname> <given-names>CD</given-names></name><name><surname>Caplazi</surname> <given-names>P</given-names></name><name><surname>Senger</surname> <given-names>K</given-names></name><name><surname>Sun</surname> <given-names>Y</given-names></name><name><surname>Jeet</surname> <given-names>S</given-names></name><name><surname>Young</surname> <given-names>J</given-names></name><name><surname>Delarosa</surname> <given-names>D</given-names></name><name><surname>Suto</surname> <given-names>E</given-names></name><name><surname>Huang</surname> <given-names>Z</given-names></name><name><surname>Zhang</surname> <given-names>J</given-names></name><name><surname>Yan</surname> <given-names>D</given-names></name><name><surname>Corzo</surname> <given-names>C</given-names></name><name><surname>Barck</surname> <given-names>K</given-names></name><name><surname>Rajan</surname> <given-names>S</given-names></name><name><surname>Looney</surname> <given-names>C</given-names></name><name><surname>Gandham</surname> <given-names>V</given-names></name><name><surname>Lesch</surname> <given-names>J</given-names></name><name><surname>Liang</surname> <given-names>WC</given-names></name><name><surname>Mai</surname> <given-names>E</given-names></name><name><surname>Ngu</surname> <given-names>H</given-names></name><name><surname>Ratti</surname> <given-names>N</given-names></name><name><surname>Chen</surname> <given-names>Y</given-names></name><name><surname>Misner</surname> <given-names>D</given-names></name><name><surname>Lin</surname> <given-names>T</given-names></name><name><surname>Danilenko</surname> <given-names>D</given-names></name><name><surname>Katavolos</surname> <given-names>P</given-names></name><name><surname>Doudemont</surname> <given-names>E</given-names></name><name><surname>Uppal</surname> <given-names>H</given-names></name><name><surname>Eastham</surname> <given-names>J</given-names></name><name><surname>Mak</surname> <given-names>J</given-names></name><name><surname>de Almeida</surname> <given-names>PE</given-names></name><name><surname>Bao</surname> <given-names>K</given-names></name><name><surname>Hadadianpour</surname> <given-names>A</given-names></name><name><surname>Keir</surname> <given-names>M</given-names></name><name><surname>Carano</surname> <given-names>RAD</given-names></name><name><surname>Diehl</surname> <given-names>L</given-names></name><name><surname>Xu</surname> <given-names>M</given-names></name><name><surname>Wu</surname> <given-names>Y</given-names></name><name><surname>Weimer</surname> <given-names>RM</given-names></name><name><surname>DeVoss</surname> <given-names>J</given-names></name><name><surname>Lee</surname> <given-names>WP</given-names></name><name><surname>Balazs</surname> <given-names>M</given-names></name><name><surname>Walsh</surname> <given-names>K</given-names></name><name><surname>Alatsis</surname> <given-names>KR</given-names></name><name><surname>Martin</surname> <given-names>F</given-names></name><name><surname>Zarrin</surname> <given-names>AA</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Function of CSF1 and IL34 in macrophage homeostasis, inflammation, and Cancer</article-title><source>Frontiers in Immunology</source><volume>10</volume><elocation-id>2019</elocation-id><pub-id pub-id-type="doi">10.3389/fimmu.2019.02019</pub-id><pub-id pub-id-type="pmid">31552020</pub-id></element-citation></ref><ref id="bib74"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Louveau</surname> <given-names>A</given-names></name><name><surname>Da Mesquita</surname> <given-names>S</given-names></name><name><surname>Kipnis</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Lymphatics in neurological disorders: a Neuro-Lympho-Vascular component of multiple sclerosis and Alzheimer's Disease?</article-title><source>Neuron</source><volume>91</volume><fpage>957</fpage><lpage>973</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2016.08.027</pub-id><pub-id pub-id-type="pmid">27608759</pub-id></element-citation></ref><ref id="bib75"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lustenberger</surname> <given-names>T</given-names></name><name><surname>Talving</surname> <given-names>P</given-names></name><name><surname>Lam</surname> <given-names>L</given-names></name><name><surname>Inaba</surname> <given-names>K</given-names></name><name><surname>Branco</surname> <given-names>BC</given-names></name><name><surname>Plurad</surname> <given-names>D</given-names></name><name><surname>Demetriades</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Liver cirrhosis and traumatic brain injury: a fatal combination based on national trauma databank analysis</article-title><source>The American Surgeon</source><volume>77</volume><fpage>311</fpage><lpage>314</lpage><pub-id pub-id-type="doi">10.1177/000313481107700320</pub-id><pub-id pub-id-type="pmid">21375843</pub-id></element-citation></ref><ref id="bib76"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname> <given-names>Q</given-names></name><name><surname>Ineichen</surname> <given-names>BV</given-names></name><name><surname>Detmar</surname> <given-names>M</given-names></name><name><surname>Proulx</surname> <given-names>ST</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Outflow of cerebrospinal fluid is predominantly through lymphatic vessels and is reduced in aged mice</article-title><source>Nature Communications</source><volume>8</volume><elocation-id>6</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-017-01484-6</pub-id></element-citation></ref><ref id="bib77"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Masteller</surname> <given-names>EL</given-names></name><name><surname>Wong</surname> <given-names>BR</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Targeting IL-34 in chronic inflammation</article-title><source>Drug Discovery Today</source><volume>19</volume><fpage>1212</fpage><lpage>1216</lpage><pub-id pub-id-type="doi">10.1016/j.drudis.2014.05.016</pub-id></element-citation></ref><ref id="bib78"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mathison</surname> <given-names>JC</given-names></name><name><surname>Ulevitch</surname> <given-names>RJ</given-names></name></person-group><year iso-8601-date="1979">1979</year><article-title>The clearance, tissue distribution, and cellular localization of intravenously injected lipopolysaccharide in rabbits</article-title><source>Journal of Immunology</source><volume>123</volume><elocation-id>2133</elocation-id></element-citation></ref><ref id="bib79"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McDonald</surname> <given-names>B</given-names></name><name><surname>Urrutia</surname> <given-names>R</given-names></name><name><surname>Yipp</surname> <given-names>BG</given-names></name><name><surname>Jenne</surname> <given-names>CN</given-names></name><name><surname>Kubes</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Intravascular neutrophil extracellular traps capture Bacteria from the bloodstream during Sepsis</article-title><source>Cell Host &amp; Microbe</source><volume>12</volume><fpage>324</fpage><lpage>333</lpage><pub-id pub-id-type="doi">10.1016/j.chom.2012.06.011</pub-id><pub-id pub-id-type="pmid">22980329</pub-id></element-citation></ref><ref id="bib80"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Medzhitov</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Toll-like receptors and innate immunity</article-title><source>Nature Reviews Immunology</source><volume>1</volume><fpage>135</fpage><lpage>145</lpage><pub-id pub-id-type="doi">10.1038/35100529</pub-id><pub-id pub-id-type="pmid">11905821</pub-id></element-citation></ref><ref id="bib81"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Meireles</surname> <given-names>AM</given-names></name><name><surname>Shiau</surname> <given-names>CE</given-names></name><name><surname>Guenther</surname> <given-names>CA</given-names></name><name><surname>Sidik</surname> <given-names>H</given-names></name><name><surname>Kingsley</surname> <given-names>DM</given-names></name><name><surname>Talbot</surname> <given-names>WS</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>The phosphate exporter xpr1b is required for differentiation of tissue-resident macrophages</article-title><source>Cell Reports</source><volume>8</volume><fpage>1659</fpage><lpage>1667</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2014.08.018</pub-id><pub-id pub-id-type="pmid">25220463</pub-id></element-citation></ref><ref id="bib82"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mergenthaler</surname> <given-names>P</given-names></name><name><surname>Lindauer</surname> <given-names>U</given-names></name><name><surname>Dienel</surname> <given-names>GA</given-names></name><name><surname>Meisel</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Sugar for the brain: the role of glucose in physiological and pathological brain function</article-title><source>Trends in Neurosciences</source><volume>36</volume><fpage>587</fpage><lpage>597</lpage><pub-id pub-id-type="doi">10.1016/j.tins.2013.07.001</pub-id><pub-id pub-id-type="pmid">23968694</pub-id></element-citation></ref><ref id="bib83"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moon</surname> <given-names>SJ</given-names></name><name><surname>Hong</surname> <given-names>YS</given-names></name><name><surname>Ju</surname> <given-names>JH</given-names></name><name><surname>Kwok</surname> <given-names>SK</given-names></name><name><surname>Park</surname> <given-names>SH</given-names></name><name><surname>Min</surname> <given-names>JK</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Increased levels of interleukin 34 in serum and synovial fluid are associated with rheumatoid factor and anticyclic citrullinated peptide antibody titers in patients with rheumatoid arthritis</article-title><source>The Journal of Rheumatology</source><volume>40</volume><fpage>1842</fpage><lpage>1849</lpage><pub-id pub-id-type="doi">10.3899/jrheum.130356</pub-id><pub-id pub-id-type="pmid">23996288</pub-id></element-citation></ref><ref id="bib84"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mossanen</surname> <given-names>JC</given-names></name><name><surname>Tacke</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Role of lymphocytes in liver Cancer</article-title><source>OncoImmunology</source><volume>2</volume><elocation-id>e26468</elocation-id><pub-id pub-id-type="doi">10.4161/onci.26468</pub-id><pub-id pub-id-type="pmid">24498546</pub-id></element-citation></ref><ref id="bib85"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Murdoch</surname> <given-names>CC</given-names></name><name><surname>Espenschied</surname> <given-names>ST</given-names></name><name><surname>Matty</surname> <given-names>MA</given-names></name><name><surname>Mueller</surname> <given-names>O</given-names></name><name><surname>Tobin</surname> <given-names>DM</given-names></name><name><surname>Rawls</surname> <given-names>JF</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Intestinal serum amyloid A suppresses systemic neutrophil activation and bactericidal activity in response to Microbiota colonization</article-title><source>PLOS Pathogens</source><volume>15</volume><elocation-id>e1007381</elocation-id><pub-id pub-id-type="doi">10.1371/journal.ppat.1007381</pub-id><pub-id pub-id-type="pmid">30845179</pub-id></element-citation></ref><ref id="bib86"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nho</surname> <given-names>K</given-names></name><name><surname>Kueider-Paisley</surname> <given-names>A</given-names></name><name><surname>Ahmad</surname> <given-names>S</given-names></name><name><surname>MahmoudianDehkordi</surname> <given-names>S</given-names></name><name><surname>Arnold</surname> <given-names>M</given-names></name><name><surname>Risacher</surname> <given-names>SL</given-names></name><name><surname>Louie</surname> <given-names>G</given-names></name><name><surname>Blach</surname> <given-names>C</given-names></name><name><surname>Baillie</surname> <given-names>R</given-names></name><name><surname>Han</surname> <given-names>X</given-names></name><name><surname>Kastenmüller</surname> <given-names>G</given-names></name><name><surname>Trojanowski</surname> <given-names>JQ</given-names></name><name><surname>Shaw</surname> <given-names>LM</given-names></name><name><surname>Weiner</surname> <given-names>MW</given-names></name><name><surname>Doraiswamy</surname> <given-names>PM</given-names></name><name><surname>van Duijn</surname> <given-names>C</given-names></name><name><surname>Saykin</surname> <given-names>AJ</given-names></name><name><surname>Kaddurah-Daouk</surname> <given-names>R</given-names></name><collab>Alzheimer’s Disease Neuroimaging Initiative and the Alzheimer Disease Metabolomics Consortium</collab></person-group><year iso-8601-date="2019">2019</year><article-title>Association of altered liver enzymes with alzheimer disease diagnosis, cognition, neuroimaging measures, and cerebrospinal fluid biomarkers</article-title><source>JAMA Network Open</source><volume>2</volume><elocation-id>e197978</elocation-id><pub-id pub-id-type="doi">10.1001/jamanetworkopen.2019.7978</pub-id><pub-id pub-id-type="pmid">31365104</pub-id></element-citation></ref><ref id="bib87"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Noyori</surname> <given-names>O</given-names></name><name><surname>Komohara</surname> <given-names>Y</given-names></name><name><surname>Nasser</surname> <given-names>H</given-names></name><name><surname>Hiyoshi</surname> <given-names>M</given-names></name><name><surname>Ma</surname> <given-names>C</given-names></name><name><surname>Pan</surname> <given-names>C</given-names></name><name><surname>Carreras</surname> <given-names>J</given-names></name><name><surname>Nakamura</surname> <given-names>N</given-names></name><name><surname>Sato</surname> <given-names>A</given-names></name><name><surname>Ando</surname> <given-names>K</given-names></name><name><surname>Okuno</surname> <given-names>Y</given-names></name><name><surname>Nosaka</surname> <given-names>K</given-names></name><name><surname>Matsuoka</surname> <given-names>M</given-names></name><name><surname>Suzu</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Expression of IL-34 correlates with macrophage infiltration and prognosis of diffuse large B-cell lymphoma</article-title><source>Clinical &amp; Translational Immunology</source><volume>8</volume><elocation-id>e1074</elocation-id><pub-id pub-id-type="doi">10.1002/cti2.1074</pub-id><pub-id pub-id-type="pmid">31417675</pub-id></element-citation></ref><ref id="bib88"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Okuda</surname> <given-names>KS</given-names></name><name><surname>Astin</surname> <given-names>JW</given-names></name><name><surname>Misa</surname> <given-names>JP</given-names></name><name><surname>Flores</surname> <given-names>MV</given-names></name><name><surname>Crosier</surname> <given-names>KE</given-names></name><name><surname>Crosier</surname> <given-names>PS</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>lyve1 expression reveals novel lymphatic vessels and new mechanisms for lymphatic vessel development in zebrafish</article-title><source>Development</source><volume>139</volume><fpage>2381</fpage><lpage>2391</lpage><pub-id pub-id-type="doi">10.1242/dev.077701</pub-id><pub-id pub-id-type="pmid">22627281</pub-id></element-citation></ref><ref id="bib89"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oltrabella</surname> <given-names>F</given-names></name><name><surname>Pietka</surname> <given-names>G</given-names></name><name><surname>Ramirez</surname> <given-names>IB</given-names></name><name><surname>Mironov</surname> <given-names>A</given-names></name><name><surname>Starborg</surname> <given-names>T</given-names></name><name><surname>Drummond</surname> <given-names>IA</given-names></name><name><surname>Hinchliffe</surname> <given-names>KA</given-names></name><name><surname>Lowe</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>The lowe syndrome protein OCRL1 is required for endocytosis in the zebrafish pronephric tubule</article-title><source>PLOS Genetics</source><volume>11</volume><elocation-id>e1005058</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.1005058</pub-id><pub-id pub-id-type="pmid">25838181</pub-id></element-citation></ref><ref id="bib90"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oosterhof</surname> <given-names>N</given-names></name><name><surname>Kuil</surname> <given-names>LE</given-names></name><name><surname>van der Linde</surname> <given-names>HC</given-names></name><name><surname>Burm</surname> <given-names>SM</given-names></name><name><surname>Berdowski</surname> <given-names>W</given-names></name><name><surname>van Ijcken</surname> <given-names>WFJ</given-names></name><name><surname>van Swieten</surname> <given-names>JC</given-names></name><name><surname>Hol</surname> <given-names>EM</given-names></name><name><surname>Verheijen</surname> <given-names>MHG</given-names></name><name><surname>van Ham</surname> <given-names>TJ</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Colony-Stimulating factor 1 receptor (CSF1R) Regulates microglia density and distribution, but not microglia differentiation in Vivo</article-title><source>Cell Reports</source><volume>24</volume><fpage>1203</fpage><lpage>1217</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2018.06.113</pub-id><pub-id pub-id-type="pmid">30067976</pub-id></element-citation></ref><ref id="bib91"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pazhakh</surname> <given-names>V</given-names></name><name><surname>Clark</surname> <given-names>S</given-names></name><name><surname>Keightley</surname> <given-names>MC</given-names></name><name><surname>Lieschke</surname> <given-names>GJ</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A GCSFR/CSF3R zebrafish mutant models the persistent basal neutrophil deficiency of severe congenital neutropenia</article-title><source>Scientific Reports</source><volume>7</volume><elocation-id>44455</elocation-id><pub-id pub-id-type="doi">10.1038/srep44455</pub-id><pub-id pub-id-type="pmid">28281657</pub-id></element-citation></ref><ref id="bib92"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peri</surname> <given-names>F</given-names></name><name><surname>Nüsslein-Volhard</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Live imaging of neuronal degradation by microglia reveals a role for v0-ATPase a1 in Phagosomal fusion in vivo</article-title><source>Cell</source><volume>133</volume><fpage>916</fpage><lpage>927</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2008.04.037</pub-id><pub-id pub-id-type="pmid">18510934</pub-id></element-citation></ref><ref id="bib93"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pernègre</surname> <given-names>C</given-names></name><name><surname>Duquette</surname> <given-names>A</given-names></name><name><surname>Leclerc</surname> <given-names>N</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Tau secretion: good and bad for neurons</article-title><source>Frontiers in Neuroscience</source><volume>13</volume><elocation-id>649</elocation-id><pub-id pub-id-type="doi">10.3389/fnins.2019.00649</pub-id><pub-id pub-id-type="pmid">31293374</pub-id></element-citation></ref><ref id="bib94"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Prame Kumar</surname> <given-names>K</given-names></name><name><surname>Nicholls</surname> <given-names>AJ</given-names></name><name><surname>Wong</surname> <given-names>CHY</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Partners in crime: neutrophils and monocytes/macrophages in inflammation and disease</article-title><source>Cell and Tissue Research</source><volume>371</volume><fpage>551</fpage><lpage>565</lpage><pub-id pub-id-type="doi">10.1007/s00441-017-2753-2</pub-id><pub-id pub-id-type="pmid">29387942</pub-id></element-citation></ref><ref id="bib95"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Racanelli</surname> <given-names>V</given-names></name><name><surname>Rehermann</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>The liver as an immunological organ</article-title><source>Hepatology</source><volume>43</volume><fpage>S54</fpage><lpage>S62</lpage><pub-id pub-id-type="doi">10.1002/hep.21060</pub-id><pub-id pub-id-type="pmid">16447271</pub-id></element-citation></ref><ref id="bib96"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ramadori</surname> <given-names>G</given-names></name><name><surname>Christ</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Cytokines and the hepatic acute-phase response</article-title><source>Seminars in Liver Disease</source><volume>19</volume><fpage>141</fpage><lpage>155</lpage><pub-id pub-id-type="doi">10.1055/s-2007-1007106</pub-id><pub-id pub-id-type="pmid">10422197</pub-id></element-citation></ref><ref id="bib97"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Roh-Johnson</surname> <given-names>M</given-names></name><name><surname>Shah</surname> <given-names>AN</given-names></name><name><surname>Stonick</surname> <given-names>JA</given-names></name><name><surname>Poudel</surname> <given-names>KR</given-names></name><name><surname>Kargl</surname> <given-names>J</given-names></name><name><surname>Yang</surname> <given-names>GH</given-names></name><name><surname>di Martino</surname> <given-names>J</given-names></name><name><surname>Hernandez</surname> <given-names>RE</given-names></name><name><surname>Gast</surname> <given-names>CE</given-names></name><name><surname>Zarour</surname> <given-names>LR</given-names></name><name><surname>Antoku</surname> <given-names>S</given-names></name><name><surname>Houghton</surname> <given-names>AM</given-names></name><name><surname>Bravo-Cordero</surname> <given-names>JJ</given-names></name><name><surname>Wong</surname> <given-names>MH</given-names></name><name><surname>Condeelis</surname> <given-names>J</given-names></name><name><surname>Moens</surname> <given-names>CB</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Macrophage-Dependent cytoplasmic transfer during melanoma invasion in Vivo</article-title><source>Developmental Cell</source><volume>43</volume><fpage>549</fpage><lpage>562</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2017.11.003</pub-id><pub-id pub-id-type="pmid">29207258</pub-id></element-citation></ref><ref id="bib98"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sakano</surname> <given-names>E</given-names></name><name><surname>Fujita</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="1982">1982</year><article-title>Comparative aspects on the fine structure of the teleost liver</article-title><source>Okajimas Folia Anatomica Japonica</source><volume>58</volume><fpage>501</fpage><lpage>519</lpage><pub-id pub-id-type="doi">10.2535/ofaj1936.58.4-6_501</pub-id><pub-id pub-id-type="pmid">7122004</pub-id></element-citation></ref><ref id="bib99"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sanderson</surname> <given-names>LE</given-names></name><name><surname>Chien</surname> <given-names>AT</given-names></name><name><surname>Astin</surname> <given-names>JW</given-names></name><name><surname>Crosier</surname> <given-names>KE</given-names></name><name><surname>Crosier</surname> <given-names>PS</given-names></name><name><surname>Hall</surname> <given-names>CJ</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>An inducible transgene reports activation of macrophages in live zebrafish larvae</article-title><source>Developmental &amp; Comparative Immunology</source><volume>53</volume><fpage>63</fpage><lpage>69</lpage><pub-id pub-id-type="doi">10.1016/j.dci.2015.06.013</pub-id><pub-id pub-id-type="pmid">26123890</pub-id></element-citation></ref><ref id="bib100"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Santoriello</surname> <given-names>C</given-names></name><name><surname>Zon</surname> <given-names>LI</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Hooked! modeling human disease in zebrafish</article-title><source>Journal of Clinical Investigation</source><volume>122</volume><fpage>2337</fpage><lpage>2343</lpage><pub-id pub-id-type="doi">10.1172/JCI60434</pub-id><pub-id pub-id-type="pmid">22751109</pub-id></element-citation></ref><ref id="bib101"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sauter</surname> <given-names>KA</given-names></name><name><surname>Waddell</surname> <given-names>LA</given-names></name><name><surname>Lisowski</surname> <given-names>ZM</given-names></name><name><surname>Young</surname> <given-names>R</given-names></name><name><surname>Lefevre</surname> <given-names>L</given-names></name><name><surname>Davis</surname> <given-names>GM</given-names></name><name><surname>Clohisey</surname> <given-names>SM</given-names></name><name><surname>McCulloch</surname> <given-names>M</given-names></name><name><surname>Magowan</surname> <given-names>E</given-names></name><name><surname>Mabbott</surname> <given-names>NA</given-names></name><name><surname>Summers</surname> <given-names>KM</given-names></name><name><surname>Hume</surname> <given-names>DA</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Macrophage colony-stimulating factor (CSF1) controls monocyte production and maturation and the steady-state size of the liver in pigs</article-title><source>American Journal of Physiology-Gastrointestinal and Liver Physiology</source><volume>311</volume><fpage>G533</fpage><lpage>G547</lpage><pub-id pub-id-type="doi">10.1152/ajpgi.00116.2016</pub-id></element-citation></ref><ref id="bib102"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sehnert</surname> <given-names>AJ</given-names></name><name><surname>Huq</surname> <given-names>A</given-names></name><name><surname>Weinstein</surname> <given-names>BM</given-names></name><name><surname>Walker</surname> <given-names>C</given-names></name><name><surname>Fishman</surname> <given-names>M</given-names></name><name><surname>Stainier</surname> <given-names>DY</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Cardiac troponin T is essential in sarcomere assembly and cardiac contractility</article-title><source>Nature Genetics</source><volume>31</volume><fpage>106</fpage><lpage>110</lpage><pub-id pub-id-type="doi">10.1038/ng875</pub-id><pub-id pub-id-type="pmid">11967535</pub-id></element-citation></ref><ref id="bib103"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sevin</surname> <given-names>M</given-names></name><name><surname>Girodon</surname> <given-names>F</given-names></name><name><surname>Garrido</surname> <given-names>C</given-names></name><name><surname>de Thonel</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>HSP90 and HSP70: implication in inflammation processes and therapeutic approaches for myeloproliferative neoplasms</article-title><source>Mediators of Inflammation</source><volume>2015</volume><fpage>1</fpage><lpage>8</lpage><pub-id pub-id-type="doi">10.1155/2015/970242</pub-id></element-citation></ref><ref id="bib104"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shiau</surname> <given-names>CE</given-names></name><name><surname>Monk</surname> <given-names>KR</given-names></name><name><surname>Joo</surname> <given-names>W</given-names></name><name><surname>Talbot</surname> <given-names>WS</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>An anti-inflammatory NOD-like receptor is required for microglia development</article-title><source>Cell Reports</source><volume>5</volume><fpage>1342</fpage><lpage>1352</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2013.11.004</pub-id><pub-id pub-id-type="pmid">24316075</pub-id></element-citation></ref><ref id="bib105"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shiau</surname> <given-names>CE</given-names></name><name><surname>Kaufman</surname> <given-names>Z</given-names></name><name><surname>Meireles</surname> <given-names>AM</given-names></name><name><surname>Talbot</surname> <given-names>WS</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Differential requirement for irf8 in formation of embryonic and adult macrophages in zebrafish</article-title><source>PLOS ONE</source><volume>10</volume><elocation-id>e0117513</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0117513</pub-id></element-citation></ref><ref id="bib106"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shibata-Germanos</surname> <given-names>S</given-names></name><name><surname>Goodman</surname> <given-names>JR</given-names></name><name><surname>Grieg</surname> <given-names>A</given-names></name><name><surname>Trivedi</surname> <given-names>CA</given-names></name><name><surname>Benson</surname> <given-names>BC</given-names></name><name><surname>Foti</surname> <given-names>SC</given-names></name><name><surname>Faro</surname> <given-names>A</given-names></name><name><surname>Castellan</surname> <given-names>RFP</given-names></name><name><surname>Correra</surname> <given-names>RM</given-names></name><name><surname>Barber</surname> <given-names>M</given-names></name><name><surname>Ruhrberg</surname> <given-names>C</given-names></name><name><surname>Weller</surname> <given-names>RO</given-names></name><name><surname>Lashley</surname> <given-names>T</given-names></name><name><surname>Iliff</surname> <given-names>JJ</given-names></name><name><surname>Hawkins</surname> <given-names>TA</given-names></name><name><surname>Rihel</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Structural and functional conservation of non-lumenized lymphatic endothelial cells in the mammalian leptomeninges</article-title><source>Acta Neuropathologica</source><volume>139</volume><fpage>383</fpage><lpage>401</lpage><pub-id pub-id-type="doi">10.1007/s00401-019-02091-z</pub-id><pub-id pub-id-type="pmid">31696318</pub-id></element-citation></ref><ref id="bib107"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shimp</surname> <given-names>SK</given-names></name><name><surname>Parson</surname> <given-names>CD</given-names></name><name><surname>Regna</surname> <given-names>NL</given-names></name><name><surname>Thomas</surname> <given-names>AN</given-names></name><name><surname>Chafin</surname> <given-names>CB</given-names></name><name><surname>Reilly</surname> <given-names>CM</given-names></name><name><surname>Nichole Rylander</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>HSP90 inhibition by 17-DMAG reduces inflammation in J774 macrophages through suppression of akt and nuclear factor-κB pathways</article-title><source>Inflammation Research</source><volume>61</volume><fpage>521</fpage><lpage>533</lpage><pub-id pub-id-type="doi">10.1007/s00011-012-0442-x</pub-id><pub-id pub-id-type="pmid">22327510</pub-id></element-citation></ref><ref id="bib108"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Soehnlein</surname> <given-names>O</given-names></name><name><surname>Zernecke</surname> <given-names>A</given-names></name><name><surname>Eriksson</surname> <given-names>EE</given-names></name><name><surname>Rothfuchs</surname> <given-names>AG</given-names></name><name><surname>Pham</surname> <given-names>CT</given-names></name><name><surname>Herwald</surname> <given-names>H</given-names></name><name><surname>Bidzhekov</surname> <given-names>K</given-names></name><name><surname>Rottenberg</surname> <given-names>ME</given-names></name><name><surname>Weber</surname> <given-names>C</given-names></name><name><surname>Lindbom</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Neutrophil secretion products pave the way for inflammatory monocytes</article-title><source>Blood</source><volume>112</volume><fpage>1461</fpage><lpage>1471</lpage><pub-id pub-id-type="doi">10.1182/blood-2008-02-139634</pub-id><pub-id pub-id-type="pmid">18490516</pub-id></element-citation></ref><ref id="bib109"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Soehnlein</surname> <given-names>O</given-names></name><name><surname>Lindbom</surname> <given-names>L</given-names></name><name><surname>Weber</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Mechanisms underlying neutrophil-mediated monocyte recruitment</article-title><source>Blood</source><volume>114</volume><fpage>4613</fpage><lpage>4623</lpage><pub-id pub-id-type="doi">10.1182/blood-2009-06-221630</pub-id><pub-id pub-id-type="pmid">19696199</pub-id></element-citation></ref><ref id="bib110"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Su</surname> <given-names>F</given-names></name><name><surname>Juarez</surname> <given-names>MA</given-names></name><name><surname>Cooke</surname> <given-names>CL</given-names></name><name><surname>Lapointe</surname> <given-names>L</given-names></name><name><surname>Shavit</surname> <given-names>JA</given-names></name><name><surname>Yamaoka</surname> <given-names>JS</given-names></name><name><surname>Lyons</surname> <given-names>SE</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Differential regulation of primitive myelopoiesis in the zebrafish by Spi-1/Pu.1 and C/ebp1</article-title><source>Zebrafish</source><volume>4</volume><fpage>187</fpage><lpage>199</lpage><pub-id pub-id-type="doi">10.1089/zeb.2007.0505</pub-id><pub-id pub-id-type="pmid">18041923</pub-id></element-citation></ref><ref id="bib111"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Szabo</surname> <given-names>G</given-names></name><name><surname>Romics</surname> <given-names>L</given-names></name><name><surname>Frendl</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Liver in Sepsis and systemic inflammatory response syndrome</article-title><source>Clinics in Liver Disease</source><volume>6</volume><fpage>1045</fpage><lpage>1066</lpage><pub-id pub-id-type="doi">10.1016/S1089-3261(02)00058-2</pub-id><pub-id pub-id-type="pmid">12516206</pub-id></element-citation></ref><ref id="bib112"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Szentistvanyi</surname> <given-names>I</given-names></name><name><surname>Patlak</surname> <given-names>CS</given-names></name><name><surname>Ellis</surname> <given-names>RA</given-names></name><name><surname>Cserr</surname> <given-names>HF</given-names></name></person-group><year iso-8601-date="1984">1984</year><article-title>Drainage of interstitial fluid from different regions of rat brain</article-title><source>American Journal of Physiology-Renal Physiology</source><volume>246</volume><fpage>F835</fpage><lpage>F844</lpage><pub-id pub-id-type="doi">10.1152/ajprenal.1984.246.6.F835</pub-id></element-citation></ref><ref id="bib113"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Torraca</surname> <given-names>V</given-names></name><name><surname>Cui</surname> <given-names>C</given-names></name><name><surname>Boland</surname> <given-names>R</given-names></name><name><surname>Bebelman</surname> <given-names>JP</given-names></name><name><surname>van der Sar</surname> <given-names>AM</given-names></name><name><surname>Smit</surname> <given-names>MJ</given-names></name><name><surname>Siderius</surname> <given-names>M</given-names></name><name><surname>Spaink</surname> <given-names>HP</given-names></name><name><surname>Meijer</surname> <given-names>AH</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>The CXCR3-CXCL11 signaling Axis mediates macrophage recruitment and dissemination of mycobacterial infection</article-title><source>Disease Models &amp; Mechanisms</source><volume>8</volume><fpage>253</fpage><lpage>269</lpage><pub-id pub-id-type="doi">10.1242/dmm.017756</pub-id><pub-id pub-id-type="pmid">25573892</pub-id></element-citation></ref><ref id="bib114"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van den Pol</surname> <given-names>AN</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Viral infection leading to brain dysfunction: more prevalent than appreciated?</article-title><source>Neuron</source><volume>64</volume><fpage>17</fpage><lpage>20</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2009.09.023</pub-id></element-citation></ref><ref id="bib115"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van der Sar</surname> <given-names>AM</given-names></name><name><surname>Stockhammer</surname> <given-names>OW</given-names></name><name><surname>van der Laan</surname> <given-names>C</given-names></name><name><surname>Spaink</surname> <given-names>HP</given-names></name><name><surname>Bitter</surname> <given-names>W</given-names></name><name><surname>Meijer</surname> <given-names>AH</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>MyD88 innate immune function in a zebrafish embryo infection model</article-title><source>Infection and Immunity</source><volume>74</volume><fpage>2436</fpage><lpage>2441</lpage><pub-id pub-id-type="doi">10.1128/IAI.74.4.2436-2441.2006</pub-id><pub-id pub-id-type="pmid">16552074</pub-id></element-citation></ref><ref id="bib116"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van Lessen</surname> <given-names>M</given-names></name><name><surname>Shibata-Germanos</surname> <given-names>S</given-names></name><name><surname>van Impel</surname> <given-names>A</given-names></name><name><surname>Hawkins</surname> <given-names>TA</given-names></name><name><surname>Rihel</surname> <given-names>J</given-names></name><name><surname>Schulte-Merker</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Intracellular uptake of macromolecules by brain lymphatic endothelial cells during zebrafish embryonic development</article-title><source>eLife</source><volume>6</volume><elocation-id>e25932</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.25932</pub-id></element-citation></ref><ref id="bib117"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>van Rooijen</surname> <given-names>N</given-names></name><name><surname>Hendrikx</surname> <given-names>E</given-names></name></person-group><year iso-8601-date="2010">2010</year><chapter-title>Liposomes for Specific Depletion of Macrophages from Organs and Tissues</chapter-title><person-group person-group-type="editor"><name><surname>Weissig</surname> <given-names>V</given-names></name></person-group><source>Liposomes: Methods and Protocols</source><volume>1</volume><publisher-loc>Totowa</publisher-loc><publisher-name> Humana Press</publisher-name><fpage>189</fpage><lpage>203</lpage></element-citation></ref><ref id="bib118"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Venero Galanternik</surname> <given-names>M</given-names></name><name><surname>Castranova</surname> <given-names>D</given-names></name><name><surname>Gore</surname> <given-names>AV</given-names></name><name><surname>Blewett</surname> <given-names>NH</given-names></name><name><surname>Jung</surname> <given-names>HM</given-names></name><name><surname>Stratman</surname> <given-names>AN</given-names></name><name><surname>Kirby</surname> <given-names>MR</given-names></name><name><surname>Iben</surname> <given-names>J</given-names></name><name><surname>Miller</surname> <given-names>MF</given-names></name><name><surname>Kawakami</surname> <given-names>K</given-names></name><name><surname>Maraia</surname> <given-names>RJ</given-names></name><name><surname>Weinstein</surname> <given-names>BM</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A novel perivascular cell population in the zebrafish brain</article-title><source>eLife</source><volume>6</volume><elocation-id>e24369</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.24369</pub-id><pub-id pub-id-type="pmid">28395729</pub-id></element-citation></ref><ref id="bib119"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Venkatesha</surname> <given-names>SH</given-names></name><name><surname>Astry</surname> <given-names>B</given-names></name><name><surname>Nanjundaiah</surname> <given-names>SM</given-names></name><name><surname>Yu</surname> <given-names>H</given-names></name><name><surname>Moudgil</surname> <given-names>KD</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Suppression of autoimmune arthritis by Celastrus-derived celastrol through modulation of pro-inflammatory chemokines</article-title><source>Bioorganic &amp; Medicinal Chemistry</source><volume>20</volume><fpage>5229</fpage><lpage>5234</lpage><pub-id pub-id-type="doi">10.1016/j.bmc.2012.06.050</pub-id><pub-id pub-id-type="pmid">22854193</pub-id></element-citation></ref><ref id="bib120"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Villapol</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Consequences of hepatic damage after traumatic brain injury: current outlook and potential therapeutic targets</article-title><source>Neural Regeneration Research</source><volume>11</volume><fpage>226</fpage><lpage>227</lpage><pub-id pub-id-type="doi">10.4103/1673-5374.177720</pub-id><pub-id pub-id-type="pmid">27073366</pub-id></element-citation></ref><ref id="bib121"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Walton</surname> <given-names>EM</given-names></name><name><surname>Cronan</surname> <given-names>MR</given-names></name><name><surname>Beerman</surname> <given-names>RW</given-names></name><name><surname>Tobin</surname> <given-names>DM</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>The Macrophage-Specific promoter mfap4 allows live, Long-Term analysis of macrophage behavior during mycobacterial infection in zebrafish</article-title><source>PLOS ONE</source><volume>10</volume><elocation-id>e0138949</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0138949</pub-id><pub-id pub-id-type="pmid">26445458</pub-id></element-citation></ref><ref id="bib122"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname> <given-names>S</given-names></name><name><surname>Xue</surname> <given-names>R</given-names></name><name><surname>Hassan</surname> <given-names>S</given-names></name><name><surname>Nguyen</surname> <given-names>TML</given-names></name><name><surname>Wang</surname> <given-names>T</given-names></name><name><surname>Pan</surname> <given-names>H</given-names></name><name><surname>Xu</surname> <given-names>J</given-names></name><name><surname>Liu</surname> <given-names>Q</given-names></name><name><surname>Zhang</surname> <given-names>W</given-names></name><name><surname>Wen</surname> <given-names>Z</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Il34-Csf1r pathway regulates the migration and colonization of microglial precursors</article-title><source>Developmental Cell</source><volume>46</volume><fpage>552</fpage><lpage>563</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2018.08.005</pub-id></element-citation></ref><ref id="bib123"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname> <given-names>J</given-names></name><name><surname>Du</surname> <given-names>L</given-names></name><name><surname>Wen</surname> <given-names>Z</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Myelopoiesis during zebrafish early development</article-title><source>Journal of Genetics and Genomics</source><volume>39</volume><fpage>435</fpage><lpage>442</lpage><pub-id pub-id-type="doi">10.1016/j.jgg.2012.06.005</pub-id><pub-id pub-id-type="pmid">23021543</pub-id></element-citation></ref><ref id="bib124"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yamamoto</surname> <given-names>Y</given-names></name><name><surname>Gaynor</surname> <given-names>RB</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Therapeutic potential of inhibition of the NF-kappaB pathway in the treatment of inflammation and Cancer</article-title><source>Journal of Clinical Investigation</source><volume>107</volume><fpage>135</fpage><lpage>142</lpage><pub-id pub-id-type="doi">10.1172/JCI11914</pub-id><pub-id pub-id-type="pmid">11160126</pub-id></element-citation></ref><ref id="bib125"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yaniv</surname> <given-names>K</given-names></name><name><surname>Isogai</surname> <given-names>S</given-names></name><name><surname>Castranova</surname> <given-names>D</given-names></name><name><surname>Dye</surname> <given-names>L</given-names></name><name><surname>Hitomi</surname> <given-names>J</given-names></name><name><surname>Weinstein</surname> <given-names>BM</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Live imaging of lymphatic development in the zebrafish</article-title><source>Nature Medicine</source><volume>12</volume><fpage>711</fpage><lpage>716</lpage><pub-id pub-id-type="doi">10.1038/nm1427</pub-id><pub-id pub-id-type="pmid">16732279</pub-id></element-citation></ref><ref id="bib126"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yin</surname> <given-names>C</given-names></name><name><surname>Evason</surname> <given-names>KJ</given-names></name><name><surname>Maher</surname> <given-names>JJ</given-names></name><name><surname>Stainier</surname> <given-names>DY</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>The basic helix-loop-helix transcription factor, heart and neural crest derivatives expressed transcript 2, marks hepatic stellate cells in zebrafish: analysis of stellate cell entry into the developing liver</article-title><source>Hepatology</source><volume>56</volume><fpage>1958</fpage><lpage>1970</lpage><pub-id pub-id-type="doi">10.1002/hep.25757</pub-id><pub-id pub-id-type="pmid">22488653</pub-id></element-citation></ref><ref id="bib127"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yu</surname> <given-names>X</given-names></name><name><surname>Tao</surname> <given-names>W</given-names></name><name><surname>Jiang</surname> <given-names>F</given-names></name><name><surname>Li</surname> <given-names>C</given-names></name><name><surname>Lin</surname> <given-names>J</given-names></name><name><surname>Liu</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Celastrol attenuates hypertension-induced inflammation and oxidative stress in vascular smooth muscle cells via induction of heme oxygenase-1</article-title><source>American Journal of Hypertension</source><volume>23</volume><fpage>895</fpage><lpage>903</lpage><pub-id pub-id-type="doi">10.1038/ajh.2010.75</pub-id><pub-id pub-id-type="pmid">20414191</pub-id></element-citation></ref><ref id="bib128"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>ET</given-names></name><name><surname>Richards</surname> <given-names>HK</given-names></name><name><surname>Kida</surname> <given-names>S</given-names></name><name><surname>Weller</surname> <given-names>RO</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Directional and compartmentalised drainage of interstitial fluid and cerebrospinal fluid from the rat brain</article-title><source>Acta Neuropathologica</source><volume>83</volume><fpage>233</fpage><lpage>239</lpage><pub-id pub-id-type="doi">10.1007/BF00296784</pub-id><pub-id pub-id-type="pmid">1373020</pub-id></element-citation></ref><ref id="bib129"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zins</surname> <given-names>K</given-names></name><name><surname>Heller</surname> <given-names>G</given-names></name><name><surname>Mayerhofer</surname> <given-names>M</given-names></name><name><surname>Schreiber</surname> <given-names>M</given-names></name><name><surname>Abraham</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Differential prognostic impact of interleukin-34 mRNA expression and infiltrating immune cell composition in intrinsic breast Cancer subtypes</article-title><source>Oncotarget</source><volume>9</volume><fpage>23126</fpage><lpage>23148</lpage><pub-id pub-id-type="doi">10.18632/oncotarget.25226</pub-id><pub-id pub-id-type="pmid">29796177</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.58191.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Bagnat</surname><given-names>Michel</given-names></name><role>Reviewing Editor</role><aff><institution>Duke University</institution><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>In the manuscript by Yang et al. the authors use a LPS injection paradigm to investigate how the leakage of pro-inflammatory signals from the brain affect peripheral tissues. Using live imaging and genetic manipulations they reveal that following injection of labeled LPS in the brain robust infiltration of macrophages occurs in the liver. They show this response involves IL-34 and MyD88 and is coordinated with neutrophils. This work illustrates system wide responses to inflammatory stimuli and interactions between organs via the circulation of pro-inflammatory signals.</p><p><bold>Decision letter after peer review:</bold></p><p>[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]</p><p>Thank you for submitting your work entitled &quot;Drainage of inflammatory macromolecules from brain to periphery targets the liver for macrophage infiltration&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, including Jean-Pierre Levraud as the Reviewing Editor and Reviewer #3, and the evaluation has been overseen by a Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Helen Stolp; Jean-Pierre Levraud.</p><p>Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in <italic>eLife</italic>.</p><p>The question of interplay between CNS and peripheral inflammation is important, and a systemic imaging approach, as zebrafish allows, appears well suited. Live imaging experiments are of high quality and the measurements of macrophage infiltration in the liver were compelling. However, it is unclear if needle-mediated LPS injection in the brain of a larva with a not fully mature BBB is properly modelling neurological injury. The mechanism of LPS drainage from the brain, at the very least, requires better characterization. The analysis of the molecular and cellular pathways involved in liver infiltration was also not fully convincing, with modest changes and improper controls.</p><p><italic>Reviewer #1:</italic></p><p>The study by Yang, Jimenez, Earley, Dixon and Shiau, titled &quot;Drainage of inflammatory macromolecules from brain to periphery targets the liver for macrophage infiltration&quot; utilises innovative molecular biological techniques in zebrafish to show that inflammatory mediators drain from the brain to the periphery affecting macrophage and neutrophil infiltration in the liver. There are many aspects of this work that are of interest, but the whole work seems a bit confused.</p><p>This work seems to mix two important points. The first is how brain inflammation signals to the liver and the second is age specific liver recruitment of macrophages and neutrophils in response to inflammation, and the signalling mechanisms involved in this process. The Introduction, such as it is, addresses this first point, suggesting that liver damage is a common occurrence in conjunction with inflammatory brain injury or degeneration.</p><p>However, the authors show the movement of labelled LPS and tracer molecules through the brain interstitial fluid, to the CSF and then on to the periphery within a short period following brain injection. They also show that a systemic LPS injection causes the same response in the liver, and that blocking circulation before doing brain injections inhibits the response. Together these data imply that LPS is being removed from the brain, reaching the periphery and then stimulating its response. While this is interesting, it is not clear that this same pathway exists in normal neurological injury or equivalent interventions in the mammalian brain, where injected substances are found to stay within the parenchyma, and therefore it is unclear how translatable their findings are to other species, or how meaningful they are for an normal injury paradigm. It seems that these authors are studying macrophage and neutrophil recruitment to the liver in the context of peripheral inflammation – it is not clear that the brain has any specific involvement.</p><p>Additionally, the authors are using a very large dose of endotoxin, that possibly models meningitis (at best), so if inflammation is usually passed from the brain to the periphery via this pathway (CSF and lymphatics), it is likely to be to a much less extend that what is being investigated here. This work also does not mention the blood brain barrier in the zebrafish, its stage of development and any potential response to inflammation of the brain barriers or CSF production/flow that might confound their results. The authors did not address any potential confounder of the young animals used in this study.</p><p>The second half of this work, looking at the differential liver response to systemic inflammation (whether it comes via the brain or not) is more interesting, but still has some significant flaws in its current form.</p><p>The myd88 and IL-34 experiments were interesting in showing some involvement of these signalling molecules/systems, however these did not have a large effect, suggesting other signalling systems are also likely to be involved, and the modification of expression was generalised, so the importance of the brain or liver (or other structure) was not investigated.</p><p>While the use of animals with manipulation of their macrophages is interesting, the authors appear to have validated the models by assessing microglial numbers in the brain, rather than cell number in the periphery. Given the different dynamics of macrophage turn over in the brain compared to the periphery, and the lack of any clear central contribution to the results presented in this study, it is not clear that this is a meaningful validation of the models (e.g. PU-1, IL-34).</p><p>The authors also write about the liver response to inflammation as if it is a surprise, rather than one of the major known functions of the liver. That being said, the use of the developing system does show some really interesting results regarding neutrophil and macrophage recruitment to the liver, and these could be the focus of a very interesting paper if followed up appropriately. The idea that the macrophage/neutrophil recruitment is differentially related to functions such as cytokine production, the acute phase response and factors related to liver health and function is certainly interesting. Could authors produced data on liver growth from their imaging studies to support the idea raised in Figure 5?</p><p><italic>Reviewer #2:</italic></p><p>In this manuscript the authors aim to investigate the link between brain pathology and liver inflammation/damage. For this they use the zebrafish as a model system, which is well suited to analyze such responses systemically. Much of the work is quite interesting and well supported by high quality in vivo imaging data and whole mount in situ's analyses.</p><p>As very apparent from the title and Discussion section, the main point the authors want to make is not that systemic LPS/<italic>E. coli</italic> can cause influx of macrophages, and neutrophils, in the liver, which was quite thoroughly investigated. Instead the authors appear most interested in the drainage of bacterial material from the brain. Some of the main conclusions were not really investigated in my opinion. I think there could potentially be several other reasons for the occurrence of LPS material in the blood. Even though brain vasculature of zebrafish at this early embryonic stage have some properties of a mature blood brain barrier, i.e. expression of occludins/claudins and exclusion of dyes with certain molecular size, it is very immature and could permit passage of LPS not by a specific route by diffusion. Additionally, the brain is punctured by a relatively large needle, which could somehow induce leakage. Or perhaps the pressure of the injection somehow forces the LPS into the blood stream. I guess the 10kd dextran data shows that at least molecules of this size don't exit the brain, suggesting the BBB is not massively disrupted. The injection and the LPS likely also cause cell death in the brain and indeed it seems microglia contain cell debris. Could this somehow contribute to cause the drainage? If the brain drainage is to be the main conclusion of this work, I think this would require more experimental support. E.g. perhaps look also at later developmental stages whether LPS still drains.</p><p>Another question is whether the LPS once in circulation accumulates in the liver, causing the attraction of macrophages, or if the influx is caused otherwise. The LPS could also be taken up in endothelial cells or some other vascular cell type, followed by attraction of leukocytes. Please comment on this.</p><p>The cause of the increased neutrophil infiltration could be related not to the absence of macrophages but as a side-effect of the macrophage depletion (irf8 loss of function skews differentiation towards neutrophils and clodronate causes death of macrophages, very likely followed by attraction of neutrophils by the corpses if they're not cleared properly).</p><p>The authors conclude that glucocorticoid activity suppresses the hepatic response to systemic inflammation. The fish were kept in a quite high dose of dexamethason (100 uM) for more than a day. The fish are rapidly developing at this stage, and dex could affect several mechanisms depending on glucocorticoid activity, including the response of the leukocytes. Therefore, I don't understand what the authors base this conclusion on.</p><p><italic>Reviewer #3:</italic></p><p>This is an interesting work, mostly based on elegant live imaging. However, if the fact that injection of LPS injection in the brain induces infiltration of macrophages in liver is convincingly established, much of the rest of the analysis is not so strong.</p><p>Essential revisions:</p><p>1) Morpholino experiments: there are no control morphants, in any experiment! This is particularly critical for Figure 3A where the difference is really small and could be a MO injection side effect.</p><p>2) Same problem with il34 CRISPR experiments: the comparison should be made with control crispants injected with an irrelevant sgRNA+CAS9 (alternatively, and even better, a stable il34 mutant could be used)</p><p>3) Is there a general increase in macrophage numbers (ie, emergency myelopoiesis) consecutive to LPS injection? This has to be measured and compared with the increase in the liver.</p><p>4). Figure 1—figure supplement 1: the strong, compact mfap4 signal seen in the liver after LPS injection is not consistent with the relatively modest macrophage infiltration (no more than 20 cells) seen by live imaging. Could hepatocytes be induced to express mfap4 in these conditions? There are mfap4 reporter lines (to label macrophages), so that would be easy to test.</p><p>5) Regarding the terminology &quot;Kupffer cells&quot;, applied to liver macrophages, a more cautionary tone is needed throughout the text and figures. Localisation in the sinusoids is generally considered a feature defining Kupffer cells. It would also be worth citing some of the ancient but extant literature that established that most teleost fish have very few Kuppfer cells (e.g., Sakano and Fujita, 1982)</p><p>6) Figure 2: an assessment of the fraction of intracranially-injected LPS that leaks to the periphery is necessary.</p><p>7) The brain injection causes a temporary hole in the BBB. Can one exclude that this is how LPS reaches the periphery?</p><p>8) Figure 4D: since total neutrophil numbers increase in irf8 morphants, it is not clear if this result is significant. This measurement should be somehow normalized to the total neutrophil count.</p><p>9) Figure 4—figure supplement 3: a 27% reduction in neutrophil numbers is rather low. Csf3r ablation is also known to have some effect on macrophage populations (Liongue et al., Blood 11::2535, 209). A quantification on the impact of macrophages is required here.</p><p>10) The tnnt2a MO experiment is not conclusive, since circulation was blocked from the onset, resulting, at 4dpf, in a smaller brain, a strong edema, and probably general inflammation. Drug- mediated inhibition of heartbeat, or physical blockade of bloodflow, would be more convincing.</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for submitting your article &quot;Drainage of inflammatory macromolecules from brain to periphery targets the liver for macrophage infiltration&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by Didier Stainier as the Senior Editor, a Reviewing Editor, and three reviewers. The reviewers have opted to remain anonymous.</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is &quot;in revision at <italic>eLife</italic>&quot;. Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)</p><p>In the manuscript by Yang et al., the authors investigate in zebrafish the effect of leakage of pro-inflammatory LPS form the brain in peripheral tissues. Using beautiful live imaging and genetic manipulations, they find that macrophages infiltrate the liver and their recruitment depends on myd88 and il34, thus underscoring the existence of rapid communication between the brain and the liver that may play a role in immune surveillance.</p><p>Summary:</p><p>Two new reviewers and one reviewer that evaluated the previous version of this work agreed in that the manuscript has been greatly improved with substantial new data and an in-depth revision. Two key experimental manipulations, the knock down of myd88 and il34, are now backed by stable loss of function mutations and several experiments have been strengthen with new or improved analyses. However, there are still two important experimental manipulations using morpholinos that have not been properly controlled. In addition, editorial changes are needed to better explain the use of LPS injections as an experimental tool.</p><p>Essential revisions:</p><p>1) The authors use morpholinos targeting csf3r and pu.1 expression and draw important conclusions based on those experiments. Given the inherent problems of morpholinos, particularly for inflammation studies, it is necessary to support the use of those reagents with stable mutants and/or additional controls. If mutants are not available or cannot be generated, the knockdown experiments may be further supported with rescue experiments and or F0 Crispr, in which case the significance of any findings related to those experiments should be tempered with an appropriate discussion of the caveats.</p><p>2) While brain injections of LPS can be a useful tool as used in this work, it is hardly a physiological condition. An editorial revision should address caveats and limitations, perhaps highlighting the use of this experimental approach as a tool.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.58191.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]</p><disp-quote content-type="editor-comment"><p>The question of interplay between CNS and peripheral inflammation is important, and a systemic imaging approach, as zebrafish allows, appears well suited. Live imaging experiments are of high quality and the measurements of macrophage infiltration in the liver were compelling. However, it is unclear if needle-mediated LPS injection in the brain of a larva with a not fully mature BBB is properly modelling neurological injury. The mechanism of LPS drainage from the brain, at the very least, requires better characterization. The analysis of the molecular and cellular pathways involved in liver infiltration was also not fully convincing, with modest changes and improper controls.</p><p>Reviewer #1:</p><p>The study by Yang, Jimenez, Earley, Dixon and Shiau, titled &quot;Drainage of inflammatory macromolecules from brain to periphery targets the liver for macrophage infiltration&quot; utilises innovative molecular biological techniques in zebrafish to show that inflammatory mediators drain from the brain to the periphery affecting macrophage and neutrophil infiltration in the liver. There are many aspects of this work that are of interest, but the whole work seems a bit confused.</p><p>This work seems to mix two important points. The first is how brain inflammation signals to the liver and the second is age specific liver recruitment of macrophages and neutrophils in response to inflammation, and the signalling mechanisms involved in this process. The Introduction, such as it is, addresses this first point, suggesting that liver damage is a common occurrence in conjunction with inflammatory brain injury or degeneration.</p></disp-quote><p>Thank you for the suggestion—we have now expanded the introduction to include a better discussion of the context from which we are addressing how the brain may relay information to the liver. We are interested to explore a possible route through which the brain may affect liver function simply by a drainage of pro-inflammatory substances or molecules, albeit even at a trace level, to instigate systemic inflammation, rather than a direct brain to liver signaling. Regarding the second point, our results do not indicate age-specific recruitment of leukocytes into the liver. We have now included new additional data showing juvenile adults (Figure 4—figure supplement 1) as well as late-stage larvae at 8-10 dpf (Figure 4B), when BBB/brain structures are mature, show liver infiltration consistent with the earlier four dpf larval stage that our study focuses on.</p><disp-quote content-type="editor-comment"><p>However, the authors show the movement of labelled LPS and tracer molecules through the brain interstitial fluid, to the CSF and then on to the periphery within a short period following brain injection. They also show that a systemic LPS injection causes the same response in the liver, and that blocking circulation before doing brain injections inhibits the response. Together these data imply that LPS is being removed from the brain, reaching the periphery and then stimulating its response. While this is interesting, it is not clear that this same pathway exists in normal neurological injury or equivalent interventions in the mammalian brain, where injected substances are found to stay within the parenchyma, and therefore it is unclear how translatable their findings are to other species, or how meaningful they are for a normal injury paradigm.</p></disp-quote><p>There has been a substantial number of studies in mice and other mammalian species (including recent works reviewed by (Hladky and Barrand, 2018), Fluids Barriers CNS and conducted by Ma et al., 2017; Ma et al., 2019; Iliff et al., 2012) that lay out the different evidence for drainage or passage of tracers and molecules from the CSF or parenchyma to blood circulation via the lymphatic system or the venous blood directly through the arachnoid projections. Previous work in mice and other mammalian species have shown that injected tracers in the subarachnoid CSF or lateral ventricle can enter the brain parenchyma quickly in less than 30 minutes, and get cleared through paravascular or perineural pathways via the lymphatic system similarly to intraparenchymal injections (Iliff et al., 2012; Ma et al., 2017). These studies provide the groundwork to suggest that our findings related to brain drainage in zebrafish may be broadly relevant to other species.</p><p>We have improved the discussion of these points with new data and revised text. New experiments were conducted to provide a more detailed analysis of tracing LPS directly (Figure 2A-B, Figure 2—figure supplement 1, Figure 2—figure supplement 2, Figure 2—figure supplement 3 and Video 7) as well as text that include more discussion of previous studies in other species in the Discussion section: “Drainage of macromolecules…” Overall, our study aims to address fundamental questions relating to brain-periphery interaction rather than any specific brain injury or disease model, although results of this work could have relevance to these conditions.</p><disp-quote content-type="editor-comment"><p>It seems that these authors are studying macrophage and neutrophil recruitment to the liver in the context of peripheral inflammation – it is not clear that the brain has any specific involvement.</p></disp-quote><p>At the outset of our study it was not known whether direct signaling between the brain and the liver would occur upon injection of inflammatory activators into the brain; our data support the conclusion that drainage of LPS from the brain into circulation occurs and is sufficient to explain liver inflammation and immune cell recruitment. We therefore focus our analysis and interpretation on the consequences of such transport of molecules from brain to periphery, which addresses an important area yet under-explored and under-appreciated. While much research has focused on mechanisms of penetrating the blood-brain barrier (BBB) or the blood-cerebrospinal fluid (BCSF) barrier to enable entry of a peripheral agent into the brain parenchyma such as those relating to infectious diseases causing brain dysfunction (for example, by neurotropic viruses including <italic>Rabies lyssavirus</italic>, West Nile virus, and cytomegalovirus) and drug delivery to the brain (Hladky and Barrand, 2016; van den Pol, 2009), far less attention has been given to investigating the reciprocal transfer from brain to circulation and its consequences. Therefore, we think our study has significant implications for future work.</p><disp-quote content-type="editor-comment"><p>Additionally, the authors are using a very large dose of endotoxin, that possibly models meningitis (at best), so if inflammation is usually passed from the brain to the periphery via this pathway (CSF and lymphatics), it is likely to be to a much less extend that what is being investigated here. This work also does not mention the blood brain barrier in the zebrafish, its stage of development and any potential response to inflammation of the brain barriers or CSF production/flow that might confound their results. The authors did not address any potential confounder of the young animals used in this study.</p></disp-quote><p>The threshold at which an endotoxin or another inflammatory substance could cause a liver response in other species is an interesting point, however this goes beyond the scope of our current study.</p><p>We agree that a discussion on the brain barriers (BBB and BCSF) would be helpful for our interpretation. We should add that it is known that by four dpf (the stage of our experimentation), the BBB has been shown to be established based on Claudin-5 and ZO-1 expression in the cerebral microvessels as well as restricted permeability to HRP and other tracers (Jeong et al., 2008), as well as the choroid plexus/ventricle flow (Henson et al., 2014; Fame et al., 2016). We have now included new data examining the blood and lymphatic brain vasculatures (Figures 2—figure supplement 1 and Figure 2—figure supplement 2) that suggest the passage of LPS relies largely on the lymphatic and ISF in the brain rather than the brain blood vessels, before entering peripheral circulation. We have also added text in the Introduction, Results section and Discussion section that discuss these points.</p><disp-quote content-type="editor-comment"><p>The second half of this work, looking at the differential liver response to systemic inflammation (whether it comes via the brain or not) is more interesting, but still has some significant flaws in its current form. The myd88 and IL-34 experiments were interesting in showing some involvement of these signalling molecules/systems, however these did not have a large effect, suggesting other signalling systems are also likely to be involved, and the modification of expression was generalised, so the importance of the brain or liver (or other structure) was not investigated</p></disp-quote><p>Since morpholino-based gene knockdown does not completely eliminate the target gene function and can yield partial effects, we have now added new data using stable null mutants which do not have a functional target gene. The results significantly strengthen our previous findings that myd88 and il34 mechanisms are essential for liver infiltration. The effects were clear-cut. Both il34 and myd88 null mutants exhibited no liver infiltration after brain-LPS injection, rather than merely reduced as in the morphants. We added these data in Figure 3D and 3H. Based on our data showing liver specific gene upregulation of il34 after brain-LPS injection (Figure 3) and the known endogenous expression of myd88 in the normal larval liver (Koch et al., 2018), they suggest that myd88/IL-34 mechanism functions in the liver. However, we do agree that the specific cell type(s) and region(s) that require these mechanisms still remain to be fully determined, and it is possible that multiple cell types rely on these pathways to coordinate the liver infiltration. We have added this point to the Discussion section.</p><disp-quote content-type="editor-comment"><p>While the use of animals with manipulation of their macrophages is interesting, the authors appear to have validated the models by assessing microglial numbers in the brain, rather than cell number in the periphery. Given the different dynamics of macrophage turn over in the brain compared to the periphery, and the lack of any clear central contribution to the results presented in this study, it is not clear that this is a meaningful validation of the models (e.g. PU-1, IL-34).</p></disp-quote><p>In zebrafish, LOF mutations in these genes (Pu.1, irf8, and il-34) directly affect microglia development during early embryonic and larval stages. Furthermore, the peripheral macrophage number is directly linked with brain microglial number because these peripheral macrophages in part seed the brain to form microglia. For example, il-34 is required for migration and colonization of peripheral macrophages in the brain, and thus a loss of microglia is a direct readout for disruption of il34 function (Kuil et al., 2019; Wu et al., 2018), whereas phenotype in the peripheral macrophages is not clear-cut due to the intrinsic variation in macrophage cell number between individuals. Loss of peripheral macrophages leading to a complete absence of microglia has also been directly shown in spi1b/pu.1 morphants/mutants (Li et al., 2011; Xu et al., 2015) and irf8 morphants/mutants (Shiau et al., 2015). Therefore, a readout of a loss of microglia has been used to effectively and efficiently demonstrate and validate a loss of function in these genes.</p><disp-quote content-type="editor-comment"><p>The authors also write about the liver response to inflammation as if it is a surprise, rather than one of the major known functions of the liver. That being said, the use of the developing system does show some really interesting results regarding neutrophil and macrophage recruitment to the liver, and these could be the focus of a very interesting paper if followed up appropriately. The idea that the macrophage/neutrophil recruitment is differentially related to functions such as cytokine production, the acute phase response and factors related to liver health and function is certainly interesting. Could authors produced data on liver growth from their imaging studies to support the idea raised in Figure 5?</p></disp-quote><p>As for clarification, we do not think a response by the liver to systemic inflammation is surprising, but the underlying mechanisms that make this organ a usual suspect are interesting and poorly understood. In particular, how might leukocyte infiltration in the liver contribute to the hepatic response. To address an aspect of this, we think the direct visualization of macrophage/neutrophil infiltration during a hepatic response, which had not been conducted prior to our work, offers the much-needed insights to begin to understand this process.</p><p>We agree the differential effects were interesting. As suggested, we have followed up on this result to address whether an absence of immune infiltration affects liver growth after brain-LPS challenge in pu.1 morphants. We used two separate cohorts of controls animals (baseline and control-MO injected WT groups) to determine typical liver growth after 48 hpi comparing LPS injection to water vehicle injection. Interestingly, we found that instead of a reduction in liver size as one might predict from a reduction in liver genes expression, liver sizes increased in LPS injected pu.1 morphants, indicating liver growth was likely impeded by immune cell infiltration during inflammation. We have added new data as presented in Figure 5—figure supplement 1 and relevant text in the Results section. The summary schematic in Figure 5A has also been updated with the new result reflected.</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>In this manuscript the authors aim to investigate the link between brain pathology and liver inflammation/damage. For this they use the zebrafish as a model system, which is well suited to analyze such responses systemically. Much of the work is quite interesting and well supported by high quality in vivo imaging data and whole mount in situ's analyses.</p></disp-quote><p>Thank you for recognizing the value and interest in this work.</p><disp-quote content-type="editor-comment"><p>As very apparent from the title/discussion, the main point the authors want to make is not that systemic LPS/<italic>E. coli</italic> can cause influx of macrophages, and neutrophils, in the liver, which was quite thoroughly investigated. Instead the authors appear most interested in the drainage of bacterial material from the brain. Some of the main conclusions were not really investigated in my opinion. I think there could potentially be several other reasons for the occurrence of LPS material in the blood. Even though brain vasculature of zebrafish at this early embryonic stage have some properties of a mature blood brain barrier, i.e. expression of occludins/claudins and exclusion of dyes with certain molecular size, it is very immature and could permit passage of LPS not by a specific route by diffusion. Additionally, the brain is punctured by a relatively large needle, which could somehow induce leakage. Or perhaps the pressure of the injection somehow forces the LPS into the blood stream. I guess the 10kd dextran data shows that at least molecules of this size don't exit the brain, suggesting the BBB is not massively disrupted. The injection and the LPS likely also cause cell death in the brain and indeed it seems microglia contain cell debris. Could this somehow contribute to cause the drainage? If the brain drainage is to be the main conclusion of this work, I think this would require more experimental support. E.g. perhaps look also at later developmental stages whether LPS still drains.</p></disp-quote><p>These are all good points. We have conducted several new experiments to provide a more thorough characterization of the brain LPS microinjection, in order to provide full confidence of our brain-specific injection method, and to clarify the process of brain drainage of LPS. To do this, we analyzed the detailed kinetics of LPS movement starting from the localized brain tectum injection using a high-speed and high-sensitivity stereoscope cMOS capture at 1 Hz (see new data added in Figure 2A-B, Figure 2—figure supplement 1, Figure 2—figure supplement 2, Figure 2—figure supplement 3, and Video 7) and the same brain injected animals were subjected to confocal imaging at later timepoints to characterize localization of LPS relative to blood and lymphatic vessels (see new data added in Figure 2—figure supplement 1, Figure 2—figure supplement 2). While most of the LPS remained in the ventricular system after tectal injection, we found the hindbrain ventricle to be the key region from which LPS appeared to leak out into interstitial spaces. Interestingly, LPS accumulated within the brain lymphatic endothelial cells (blec) as well as the facial and trunk lymphatic vessels as shown by co-localization of LPS within the lymphatic reporter <italic>mrc1a:GFP</italic> but <italic>not</italic> within the brain vasculature as marked by <italic>kdrl:mCherry</italic> (see Figure 2—figure supplement 1, Figure 2—figure supplement 2), indicating that the presence of peripheral LPS did not likely stem from a disruption of the BBB or a direct passage through brain blood vessels. We also do not see a typical microglial response at the time of LPS passage to indicate a link between these or neuronal cells contributing to drainage, see Figure 2—figure supplement 1, Figure 2—figure supplement 2 where microglia are labeled. We generated a new <italic>mpeg1:BFP</italic> line in order to visualize LPS/blood or lymphatic vasculature/microglia in 3-colored fish. Instead, LPS appeared to enter circulation via a mechanism directed by the lymphatics for clearing away excess substances from interstitial fluids.</p><p>These results are now provided as multiple new data files: Figure 2A-B, Figure 2—figure supplement 1, Figure 2—figure supplement 2, Figure 2—figure supplement 3 and Video 7. We are replacing the previous Figure 1—figure supplement 5 on the drainage and passage of dextran with this new large data set, because the tracing of dextran does not directly nor accurately reflect LPS movement, and the use of a manual image acquisition at only one frame every minute is too slow to yield reliable and clear tracing of the dye. Due to the nature of the previous imaging setup, we also resorted to using a more blunt-ended needle for better visualization purposes than the fine-tipped needle we use for our routine brain microinjections (as shown in Figure 2A-B and Video 7). Our new tracing analyses address LPS drainage directly, and the movie acquisition has significantly improved using an automated capture at a very rapid speed of 1 Hz (60x faster than previous study) for about 1 hour of continuous imaging.</p><p>In terms of the concern of the maturity of the brain structures at the stage of our experiments at 4dpf, we have extended our studies into older stages when the brain structures (including BBB) are fully mature. We conducted experiments in 1 month old juvenile adults, which still showed significant increases in both macrophage and neutrophil numbers in the liver after brain-LPS injection (see Figure 4—figure supplement 1), as well as at late larval stages at 8-10 dpf after several days of feeding, substantial presence of Kupffer cells and BBB maturation that the hepatic response persists after brain-LPS injection (see Figure 4B). These results indicate that the hepatic response to the brain perturbation is independent of age or maturity of the brain vasculature and architecture, and drainage of LPS from brain to periphery may still be evident even in young adults.</p><p>Finally, we should add that our data corroborate previous data shown by others indicating that by four dpf the BBB and brain ventricles are well established with boundaries and restrictions (Jeong et al., 2008; Henson et al., 2014; Fame et al., 2016); what we have observed for LPS passage at four dpf using our injection method matches a stereotypical pathway in every fish we analyzed and does not appear to be a random or broad leakage or diffusion process that allows LPS to get out to the periphery.</p><disp-quote content-type="editor-comment"><p>Another question is whether the LPS once in circulation accumulates in the liver, causing the attraction of macrophages, or if the influx is caused otherwise. The LPS could also be taken up in endothelial cells or some other vascular cell type, followed by attraction of leukocytes. Please comment on this.</p></disp-quote><p>Good question. Tracing the movement of LPS from the brain to the periphery revealed its transient flow through the liver sinusoids prior to infiltration by macrophages/neutrophils (Figure 2, Video 5). However, LPS did not appear to accumulate or bind to cellular structures within the liver as we did not detect LPS there (Figure 2B, Figure 2—figure supplement 2 and Video 5), suggesting either the transient exposure of hepatic cells to LPS, or yet unknown extrahepatic signals trigger the hepatic response to systemic LPS. Although the liver endothelial cells were not found to bind to LPS, other major peripheral blood vessels do, such as the posterior cardinal vein (PCV), which we show in Figure 2—figure supplement 2. This could certainly be a source of cells that could attract macrophages, but how macrophages are signaled to enter the liver where there is no direct LPS accumulation remains an open question. Text has been added in the results to point to these different possibilities.</p><disp-quote content-type="editor-comment"><p>The cause of the increased neutrophil infiltration could be related not to the absence of macrophages but as a side-effect of the macrophage depletion (irf8 loss of function skews differentiation towards neutrophils and clodronate causes death of macrophages, very likely followed by attraction of neutrophils by the corpses if they're not cleared properly).</p></disp-quote><p>These are great points. We had the same concerns so (1) the analysis of control brain-water injections in both irf8 and clodronate based depletions, and (2) use of 2 complementary approaches (irf8 LOF and clodronate) based on very different mechanisms and distinct caveats were critical to provide interpretable results if they both show the same effect. If there were dramatic “side-effects” we expected to see significant baseline neutrophil infiltration in the absence of LPS, but there was not (Figure 4D and Figure 4—figure supplement 2). Examining clodronate-induced macrophage effects in our own hands, we only found partial depletion of the macrophage population, and the remaining macrophages (arrows) either appear morphologically normal or take on a ball-shape but not appearing inflammatory or clustering in groups of corpses, suggesting an unlikely scenario for a mass immune response (representative data provided on right for your reference).</p><p>Although irf8 knockdown causes a significant increase in baseline numbers of neutrophils, we did not observe an apparent increase in neutrophils surrounding the liver after LPS compared with controls (Figure 4E and data not shown), and furthermore, the shift in neutrophil behaviors after LPS towards more “macrophage-like”, taking on a more transient and long-term association with the liver stood out from those infiltrating in controls (with normal macrophages) (Figure 4J). These traits suggest distinct changes in neutrophils that may not be explained merely by an increased baseline number. Nonetheless, we cannot entirely rule out the possibility that an increased baseline neutrophil number could contribute to the increased liver infiltration, so we have added text to address this point in the Discussion section. We believe the agreement in the result from these two different methods logically lend support to this interpretation of the data, although the potential caveat should be stated.</p><disp-quote content-type="editor-comment"><p>The authors conclude that glucocorticoid activity suppresses the hepatic response to systemic inflammation. The fish were kept in a quite high dose of dexamethason (100 uM) for more than a day. The fish are rapidly developing at this stage, and dex could affect several mechanisms depending on glucocorticoid activity, including the response of the leukocytes. Therefore, I don't understand what the authors base this conclusion on.</p></disp-quote><p>Upon reviewing this point, we revisited our documentation, and realized that the water-soluble form of dex we used does not have the normal dex MW of 392.46 g/mol, because the vendor provides this reagent at 65 mg of dex per gram due to cyclodextrin used to balance the chemical (which is in a side note that we unfortunately had missed); product information can be found at https://www.sigmaaldrich.com/catalog/product/Σ/D2915?lang=en&amp;region=US. We very much thank the reviewer for pointing out this issue, which led us to catch this mistake in a timely manner. All places reporting this concentration has been corrected to show 6.5 uM.</p><p>We agree that it is possible that the glucocorticoid activity could be directly affecting the immune cells, liver cells, or both. We have modified the text to specify that it suppresses the macrophage infiltration, which our data shows (Figure 3—figure supplement 1), rather than specifying which cell type it may affect. In the Discussion section, the text now reads: “Treatment with a subset of anti-inflammatory drugs indicates that glucocorticoid activity or inhibiting NF-κB activation suppresses immune cell infiltration during hepatic response to systemic inflammation.”</p><disp-quote content-type="editor-comment"><p>Reviewer #3:</p><p>This is an interesting work, mostly based on elegant live imaging. However, if the fact that injection of LPS injection in the brain induces infiltration of macrophages in liver is convincingly established, much of the rest of the analysis is not so strong.</p></disp-quote><p>Thank you for recognizing this work to be of interest.</p><disp-quote content-type="editor-comment"><p>Essential revisions:</p><p>1) Morpholino experiments: there are no control morphants, in any experiment! This is particularly critical for Figure 3a where the difference is really small and could be a MO injection side effect.</p></disp-quote><p>Point well taken; we now have included mutants to address these concerns for analysis of myd88 and il34 effects, see new data in Figure 3. The mutants resulted in strong and clear-cut reversal of macrophage infiltration providing evidence that both mechanisms are required.</p><disp-quote content-type="editor-comment"><p>2) Same problem with il34 CRISPR experiments: the comparison should be made with control crispants injected with an irrelevant sgRNA+CAS9 (alternatively, and even better, a stable il34 mutant could be used)</p></disp-quote><p>Point well taken. We have now addressed this using stable il34 mutants which became available recently. See Figure 3H.</p><disp-quote content-type="editor-comment"><p>3) Is there a general increase in macrophage numbers (ie, emergency myelopoiesis) consecutive to LPS injection? This has to be measured and compared with the increase in the liver.</p></disp-quote><p>Yes, there appears to be a general increase in overall macrophage number after LPS injection, as expected. However, there is no actual increase in the liver to speak of, because at baseline (uninjected) without LPS there are effectively zero macrophages normally in the liver at four dpf (Figure 1A, Figure 4A); so we are looking at an induction of macrophages in the liver rather than an “increase”. This is the important reason for using four dpf for most of our experiments as it provides a time window when baseline is effectively zero, and any presence of a macrophage in the liver usually marks an extraordinary event due to an immune response. Based on the behaviors of the infiltrated macrophages after LPS injection, a substantial fraction of them (~13%) entered and remained in the liver for a long period of time (several hours)(Figure 1—figure supplement 5), suggesting their actions were not random and fleeting merely due to a general cell number increase, but rather tailored for the liver.</p><disp-quote content-type="editor-comment"><p>4). Figure 1—figure supplement 1: the strong, compact mfap4 signal seen in the liver after LPS injection is not consistent with the relatively modest macrophage infiltration (no more than 20 cells) seen by live imaging. Could hepatocytes be induced to express mfap4 in these conditions? There are mfap4 reporter lines (to label macrophages), so that would be easy to test.</p></disp-quote><p>Good point. First, a point of clarification, we have seen at 4dpf brain-LPS injections that the range of infiltrated macrophage numbers can go well above 20, and also above 30 per liver which is substantial considering the small number of total cells in the liver in larval zebrafish (Figure 1C, Figure 3D, 3G, 3G, Figure 4A), and that normally it would take an age of 14 dpf to reach numbers of ~ 20 resident macrophages per liver (Figure 1A). However, we were also curious about the reason why in some cases of the mfap4 in situ after brain-LPS injection there was seemingly a broad liver expression. We have added the following text and data provided in Figure 1—figure supplement 3 to address these points.</p><p>“Due to some examples of broad liver <italic>mfap4</italic> in situ expression (Figure 1—figure supplement 1) in comparison to a discrete number of infiltrating macrophages by live imaging after brain-LPS injection, we assessed whether this could be explained by an induction of ectopic <italic>mfap4</italic> expression in the liver upon LPS activation. Using a transgenic line <italic>mfap4:tdTomato</italic> to mark cells expressing the <italic>mfap4</italic> gene, we found <italic>mfap4</italic> restricted to macrophages and absent in liver cells (Figure 1—figure supplement 3), suggesting the broad liver <italic>mfap4</italic> expression may be diffuse in situ signals coming from a liver more densely populated by infiltrated macrophages.”</p><disp-quote content-type="editor-comment"><p>5) Regarding the terminology &quot;Kupffer cells&quot;, applied to liver macrophages, a more cautionary tone is needed throughout the text and figures. Localisation in the sinusoids is generally considered a feature defining Kupffer cells. It would also be worth citing some of the ancient but extant literature that established that most teleost fish have very few Kuppfer cells (e.g., Sakano and Fujita, 1982)</p></disp-quote><p>Ultimately, Kupffer cells are defined by their macrophage origin and normal residence in the liver, namely “liver-resident macrophage”. We appreciate the suggestion to make our definition more clear so we have modified the text at the start of the relevant Results section.“To relate macrophage presence in the liver after brain-LPS injection to macrophages that normally reside in the liver (which we refer to as Kupffer cells), we analyzed the developmental timing of Kupffer cells, which had not been previously described, starting at the 4 dpf larval stage to the 40 dpf juvenile adult stage (Figure 1A).” Because in vivo imaging of Kupffer cells has remained scant/absent, we think the dynamic nature of these cells to inform their localization and relationship with the sinusoids remains a very open question and poorly explored in all species. Sakano and Fujita, 1982 used ultrastructural microscopy to examine cells in the hepatic sinusoids in 19 species of teleosts but not directly in zebrafish. Because they were looking in very restricted areas of the liver for Kupffer cells, this could be the reason that they would have missed these macrophages. Currently, a formal and careful analysis of the development of Kupffer cells in zebrafish is lacking, but the first direct analysis of adult Kupffer cells was recently demonstrated (He et al., 2018), in agreement to our findings. To the best of our knowledge, the normal liver-resident macrophages characterization in Figure 1A represents the first dataset describing Kupffer cells in the developing zebrafish. To provide context to these results, we have added the following text in the Results section: “Prior to this work, Kupffer cells were thought to be missing or sparse in zebrafish and other teleost species (Goessling and Sadler, 2015; Sakano and Fujita, 1982), but a recent study tracing adult zebrafish Kupffer cells to their hematopoietic origin (He et al., 2018), and the data presented here collectively provide the first evidence for the prevalence of Kupffer cells in the zebrafish liver akin to their mammalian counterpart.”</p><disp-quote content-type="editor-comment"><p>6) Figure 2: an assessment of the fraction of intracranially-injected LPS that leaks to the periphery is necessary.</p></disp-quote><p>We have now done several experiments to directly trace LPS passage in real time from brain to periphery. Quantification of relative amounts drained out has been calculated based on real time tracking of the fluorescence. Please see new additional data provided in Figure 2C-D, Figure 2—figure supplement 3 and the complementary Video 7.</p><disp-quote content-type="editor-comment"><p>7) The brain injection causes a temporary hole in the BBB. Can one exclude that this is how LPS reaches the periphery?</p></disp-quote><p>We have conducted a more thorough analysis of the brain microinjection method and LPS movement. The original supplemental data (previous Figure 1—figure supplement 5) that analyzed the passage of dextran is not representative of the movement of LPS, so we are replacing it with multiple new data files: Figure 2A-B, Supplementary Figure 2—figure supplement 1, Figure 2—figure supplement 2, Figure 2—figure supplement 3 and Video 7. Due to the nature of the previous imaging setup that required manual image acquisition, we resorted to using a more blunt-ended needle for better visualization purposes than the fine-tipped needle we use for our routine brain microinjections (see Figure 2C-D, Figure 2—figure supplement 3 and Video 7). Therefore, the “hole” as referred does not represent our typical brain injections. Our new tracing analyses address LPS drainage directly, and the movie acquisition has significantly improved using an automated application at a very rapid speed of 1 Hz (60x faster than previous study) to reliably trace LPS for a continued 1 hour of imaging (Video 7).</p><disp-quote content-type="editor-comment"><p>8) Figure 4D: since total neutrophil numbers increase in irf8 morphants, it is not clear if this result is significant. This measurement should be somehow normalized to the total neutrophil count.</p></disp-quote><p>This is a valid concern. Although irf8 deficiency is known to cause a significant increase in baseline numbers of neutrophils, we did not observe an apparent increase in neutrophils surrounding the liver after LPS compared with controls (Figure 4E and data not shown), and furthermore, the shift in neutrophil behaviors after LPS towards more “macrophage-like”, taking on a more transient and long-term association with the liver stood out from those infiltrating in controls (Figure 4J). These traits suggest distinct changes in neutrophils that may not be explained merely by an increased baseline number. Nonetheless, we cannot entirely rule out the possibility that an increased baseline neutrophil number could contribute to the increased liver infiltration, so we have added this point in the Discussion section. We believe the agreement in the result from the two different methods (irf8 MO and clodronate) logically lend support to our interpretation of the data, and have added text to point out the potential caveat in the Discussion section.</p><disp-quote content-type="editor-comment"><p>9) Figure 4—figure supplement 3: a 27% reduction in neutrophil numbers is rather low. Csf3r ablation is also known to have some effect on macrophage populations (Liongue et al. Blood 11::2535, 209). A quantification on the impact of macrophages is required here.</p></disp-quote><p>Good point. We have conducted this control experiment by using in vivo imaging in double transgenic zebrafish carrying both macrophage and neutrophil reporters for control and csf3r MO conditions. We found again an average reduction in neutrophil number at ~30% in csf3r morphants compared with controls, but no significant change in macrophage number, suggesting no general effect on macrophage cell number due to csf3r MO (data added to Figure 4—figure supplement 3C). We also want to add that although the reduction of overall neutrophil number is modest on <italic>average</italic> ~30%, the maximum decrease in our cohort was as high as a 65% drop in number (Figure 4—figure supplement 3). Our assessment did not show macrophage reduction as that indicated by Liongue et al., but matched the csf3r zebrafish mutant which was reported to have normal macrophage numbers but ~ 50% reduction in neutrophils (Pazhakh et al., 2017). Liongue et al., however, examined at younger stages using only the csf1ra (fms) marker which may explain for the difference, but these results appear overturned by their own later publication showing that csf3r mutants have only neutrophil-specific phenotypes, and normal macrophages (Liongue and colleagues in Basheer et al., 2019) consistent with Pazhakh et al., 2017. Taken together, csf3r perturbation appears to target neutrophils specifically.</p><disp-quote content-type="editor-comment"><p>10) The tnnt2a MO experiment is not conclusive, since circulation was blocked from the onset, resulting, at 4dpf, in a smaller brain, a strong edema, and probably general inflammation. Drug- mediated inhibition of heartbeat, or physical blockade of bloodflow, would be more convincing.</p></disp-quote><p>We are not aware of a more effective method better suited for this experiment that could block circulation without substantial levels of side effects (including pharmacological chemicals we have read). We would welcome any specific suggestion on a proven method to block blood flow in zebrafish. To our knowledge, tnnt2a MO has been the most robust and frequently used for the purpose of stopping blood flow. It indeed affects development since blood flow is completely blocked from the beginning, but it does still allow us to perform an injection of LPS into the brain tectum to examine liver effects and macrophage behaviors, because these structures are still intact. For example, we found few to zero macrophages in the liver of tnnt2 morphants after brain-LPS injection similar to control brain-water injections despite presence of macrophages all around the liver (Figure 2—figure supplement 4). Despite the developmental hindrance due to a lack of blood flow, we think this reagent is effective for our intended purpose.</p><p>[Editors’ note: what follows is the authors’ response to the second round of review.]</p><disp-quote content-type="editor-comment"><p>Summary:</p><p>Two new reviewers and one reviewer that evaluated the previous version of this work agreed in that the manuscript has been greatly improved with substantial new data and an in-depth revision. Two key experimental manipulations, the knock down of myd88 and il34, are now backed by stable loss of function mutations and several experiments have been strengthen with new or improved analyses. However, there are still two important experimental manipulations using morpholinos that have not been properly controlled. In addition, editorial changes are needed to better explain the use of LPS injections as an experimental tool.</p><p>Essential revisions:</p><p>1) The authors use morpholinos targeting csf3r and pu.1 expression and draw important conclusions based on those experiments. Given the inherent problems of morpholinos, particularly for inflammation studies, it is necessary to support the use of those reagents with stable mutants and/or additional controls. If mutants are not available or cannot be generated, the knockdown experiments may be further supported with rescue experiments and or F0 Criprs, in which case the significance of any findings related to those experiments should be tempered with an appropriate discussion of the caveats.</p></disp-quote><p>We have conducted new experiments to address reviewers’ concerns on the pu.1 and csf3r morpholinos.</p><p>1) We have obtained stable pu.1/spi1b mutants to support the pu.1 morpholino experiments. We used these mutants and their siblings as controls to examine the transcriptional impact of immune infiltration on liver genes, acute phase response, and inflammatory response, previously answered by the pu.1 morpholino manipulation. We present the pu.1 mutant data in Figure 5, and the pu.1 morpholino data previously in Figure 5 has been moved to Figure 5—figure supplement 1. Text has been added to discuss the data in the Results section. Overall, we found that data from the <italic>pu.1</italic> mutants corroborated and strengthened the effects we observed in <italic>pu.1</italic> morpholino-injected after brain-LPS injection.</p><p>2) Unfortunately, it has not been possible to obtain the stable csf3r mutant lines from either of the two currently published sources (Basheer et al., 2019; Pazhakh et al., 2017). We therefore have used F0 Crispr injection targeting the csf3r to address neutrophil effects on macrophage infiltration in the liver after brain-LPS injection to further support the csf3r morpholino experiments. We provide molecular analysis showing that the gene editing in csf3r was highly efficient in causing missense mutations and premature termination in the F0 Crispr injected animals followed by our phenotypic analysis. All data are presented in Figure 4—figure supplement 4.</p><p>We add the following text in the paper to describe the results as well as possible caveats due to the nature of the partial knockdown.</p><p>“As a complementary approach, we assessed the effect of <italic>csf3r</italic> gene disruption by Crispr injection on macrophage infiltration after brain-LPS injection and also found a significant decrease (Figure 4—figure supplement ). Both morpholino- and F0 Crispr injection- mediated <italic>csf3r</italic> knockdown corroborate to suggest a possible neutrophil role in recruitment of macrophages into the liver during inflammation. While neither method yields a total <italic>csf3r</italic> elimination to deplete most neutrophils, a stronger hindrance to macrophage infiltration may be possible from a complete <italic>csf3r</italic> depletion.” Additionally, we have edited text to soften the conclusion made from csf3r knockdown, instead of a requirement for neutrophil signaling for macrophage infiltration of liver, our revised text states macrophages coordinate with neutrophils. These changes were also made in the Abstract and the subsection “Liver infiltration by macrophages may be driven and coordinated by neutrophils”.</p><disp-quote content-type="editor-comment"><p>2) While brain injections of LPS can be a useful tool as used in this work, it is hardly a physiological condition. An editorial revision should address caveats and limitations, perhaps highlighting the use of this experimental approach as a tool.</p></disp-quote><p>Point well taken; thank you for the great suggestion. We have made several text modifications in the manuscript to address its limitations and highlight the use of LPS as our tool to trace molecules starting from the brain to understand its possible impact on the periphery. We list here all the major edits.</p><p>In the Abstract we have modified the text to say: “Using traceable lipopolysaccharides (LPS), we reveal that drainage of these inflammatory macromolecules from the brain led to a strikingly robust peripheral infiltration of macrophages into the liver independent of Kupffer cells.”</p><p>In the Introduction, we highlighted it as a tool: “To this end, we investigated if a brain perturbation triggering inflammation, using a brain-localized LPS microinjection as an experimental means, could trigger a peripheral organ response mediated by macrophages. [….] By using fluorescently traceable LPS in the brain as an experimental paradigm, we show that inflammatory cues could originate from the brain and trigger immune infiltration of the liver, a process not previously appreciated involving drainage of the macromolecules from brain to circulation.”</p><p>In the Discussion section, we provide a more thorough explanation as well as limitations to the use of LPS: “LPS were used as an effective tool for brain-localized microinjection in this study to allow tracing of inflammatory molecules originating in the brain to assess peripheral consequences, but whether endogenous proteins and other molecules could be secreted by the brain and drained into circulation to cause similar effects as the LPS do on the liver remains to be investigated. Some examples that lend support to this possibility relate to hallmarks of Alzheimer’s disease [...]”</p></body></sub-article></article>