The umbilical artery lumen closes rapidly at birth, preventing neonatal blood loss, whereas the umbilical vein remains patent longer. Here, analysis of umbilical cords from humans and other mammals identified differential arterial-venous proteoglycan dynamics as a determinant of these contrasting vascular responses. The umbilical artery, but not the vein, has an inner layer enriched in the hydrated proteoglycan aggrecan, external to which lie contraction-primed smooth muscle cells (SMC). At birth, SMC contraction drives inner layer buckling and centripetal displacement to occlude the arterial lumen, a mechanism revealed by biomechanical observations and confirmed by computational analyses. This vascular dimorphism arises from spatially regulated proteoglycan expression and breakdown. Mice lacking aggrecan or the metalloprotease ADAMTS1, which degrades proteoglycans, demonstrate their opposing roles in umbilical vascular dimorphism, including effects on SMC differentiation. Umbilical vessel dimorphism is conserved in mammals, suggesting that differential proteoglycan dynamics and inner layer buckling were positively selected during evolution.
umbilical cordproteoglycansextracellular matrixvascular smooth musclebirthvascular engineeringResearch organismHumanMousehttp://dx.doi.org/10.13039/100000002National Institutes of HealthHL107147ApteSuneel Shttp://dx.doi.org/10.13039/100000002National Institutes of HealthHL141130ApteSuneel Shttp://dx.doi.org/10.13039/100000968American Heart Association17DIA33820024ApteSuneel SSabrina's FoundationPhilipsonElliot HNational Children's StudyFormative Research Project L01-3-RT-01-EVeiglMartinaSedwickDavidMark Lauer Pediatric Research GrantNandadasaSumedahttp://dx.doi.org/10.13039/100000002National Institutes of HealthCA43703VeiglMartinahttp://dx.doi.org/10.13039/501100003793Swedish Heart-Lung FoundationTran-LundmarkKarinNational Children's StudyContract # HHSN272500800009CVeiglMartinaSedwickDavidThe funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.Author impact statementMorphologic, molecular, biomechanical and computational analyses show that the specialized extracellular matrix architecture of the umbilical artery contributes to its rapid closure at birth and regulates smooth muscle cell differentiation.Introduction
The umbilical cord, typically containing two arteries and one vein in humans, is a crucial fetal structure in placental mammals. Umbilical arteries carry fetal blood to the placental vascular bed, whereas the umbilical vein returns oxygenated blood to the fetus. Neonatal respiration at birth renders the maternal oxygen supply redundant. Umbilical arteries commence closure rapidly after delivery of the newborn whereas the veins remain open longer. The cord is routinely clamped following delivery and divided between the clamps in modern obstetric practice. Timing of cord clamping after birth, whether early or late, is extensively debated (Niermeyer, 2015; Tarnow-Mordi et al., 2017). A recent recommendation suggested clamping no earlier than 30–60 s after birth to facilitate the placental transfusion (TACoOaG, 2017). Although the necessity of clamping is rarely questioned, it appears to be a modern practice (Downey and Bewley, 2012). Cord clamping is rarely practiced in domesticated animals and certainly not in wild animals, yet all current mammalian species have survived evolutionarily. We hypothesized that intrinsic design characteristics of mammalian umbilical arteries prevent blood loss at birth without clamping.
Prior histological work revealed that umbilical arteries have a bilaminar structure (Meyer et al., 1978) but lack elastic lamellae, which endow large arteries with resilience during cyclic loading (Wagenseil and Mecham, 2009). However, the molecular mechanism underlying the bilayered structure and its relationship to arterial occlusion remains obscure. Here, we used a multi-disciplinary approach integrating a variety of morphologic approaches with mechanical testing, computational analysis and mouse mutants to demonstrate the molecular and biomechanical basis for rapid umbilical artery closure. The findings emphasize the dual importance of extracellular matrix proteoglycans in regulation of cell differentiation and conferment of desirable tissue mechanical characteristics.
ResultsThe umbilical artery has a bilaminar wall
Three-dimensional imaging of term human umbilical cords, using synchrotron-based phase contrast micro-CT with effective pixel size 1.63 × 1.63 μm2 (Norvik et al., 2020) and histology, identified a much thicker tunica media (TM) in the umbilical artery than in the vein, with a visibly different structure (Figure 1a–c, Figure 1—figure supplement 1a–c, Figure 1—videos 1, 2). Most umbilical arteries were occluded at birth independent of delivery method or cord region analyzed, whereas umbilical veins remained patent (Figure 1b, Figure 1—figure supplement 1b). Smooth muscle cell (SMC) markers showed similar staining intensities within inner and outer TM of the umbilical arteries and TM of the vein with alternating layers of longitudinal and circumferentially oriented SMCs (Figure 1—figure supplement 1c,d). The veins showed fewer layers of SMCs compared to the arteries (Figure 1—figure supplement 1c,d).
Dimorphism of the human umbilical artery and vein.
(a) Synchrotron imaging of umbilical vessels at birth illustrates a bilayered arterial wall comprising an inner buckled tunica media (TM) (red) and outer TM (purple) but no distinct inner layer or buckling in the vein. X-Y and Y-Z image planes are indicated by red dashed lines (n = 3 umbilical cords). (b) Quantitation of luminal cross-sectional area at birth shows that the umbilical arteries are occluded whereas the veins remain patent (top) and have significantly thicker walls (bottom) (n = 20 cords, error bars indicate mean ± S.E.M., whiskers indicate minimum and maximum values. ***, p<0.001). (c) Alcian blue, eosin (pink) and nuclear fast red staining of umbilical vessel cross-sections shows a proteoglycan-rich (blue) inner TM in the umbilical artery but not the vein. Quantified staining intensity is shown on the right (n = 6 umbilical cords, whiskers indicate minimum and maximum values, ***, p<0.001). (d) Chondroitin sulfate (CS), heparan sulfate (HS), aggrecan and versican immunofluorescence (n = 4 cords for each antibody) showing that CS staining corresponds with aggrecan and versican staining and alcian blue in (c). (e) Volcano plots illustrating differential gene expression between human umbilical artery (red) and vein (green) (top, n = 4 umbilical arteries and veins) and differential gene expression between human umbilical artery inner TM (red) and the outer TM (green) (bottom, n = 2). (f) RNA in situ hybridization shows robust ACAN and VCAN expression (red signal) in the inner artery TM and weak expression in the vein (n = 3 umbilical cords for each in situ probe). * marks the vessel lumen. Brackets in c,d,f mark the TM. Wj, Wharton’s jelly. Scale bars = 100 μm in c,d,f.
Morphological and cellular characteristics of the human umbilical arteries and veins at birth.
(a) Synchrotron image from Figure 1a without red and purple shading illustrates contrast between inner and outer arterial tunica media (TM) as well as inner TM buckling, compared with a uniform appearance of venous TM and lack of buckling (n = 3 umbilical cords). (b) Hematoxylin and eosin stained human umbilical artery cross-sections collected from the placental and fetal ends show occlusion of the umbilical artery with buckling of its interior, while the vein remains patent and lacks buckling (n = 25 umbilical cords). (c) Hematoxylin and eosin stained cross-sections show multiple cell layers composed of alternating circumferentially (C) or longitudinally (L) oriented smooth muscle cells (SMC) in the umbilical artery. Curved white arrows indicate internal protrusion of the inner TM of the umbilical artery arising from buckling. (d) α-SMA (α-smooth muscle actin, red) and DAPI (blue) staining of the umbilical artery and vein shows distinct orientation of the SMC layers as in (c) (n = 3 umbilical cords). (e) (Left) Alcian blue staining shows intense staining of the inner arterial TM, with radially-oriented rounded cells contrasting with outer TM cells having elongated morphology. Eosin (pink) and nuclear fast red counterstaining. (Right) Sox9 immunostaining shows nuclear staining of SMCs of the inner umbilical artery TM (n = 6 umbilical cords, * marks the vessel lumen in panels (c,d,e). White brackets in (c,d and e) mark the TM. Tm, tunica media). Scale bars = 200 μm in (b) and c, 100 μm in d and 50 μm in e.
Transcriptome comparison and pathway analysis of differences in the human umbilical artery and vein.
(a) Heat map of a subset of differentially expressed genes (1.9 fold-change) from umbilical artery vs vein (n = 4 umbilical cords). (b) Ingenuity pathway analysis (IPA) summary of the most significantly different pathways (n = 4 umbilical cords).
Transcriptome comparison and pathway analysis of differences in the human inner umbilical artery tunica media (TM) vs the outer tunica media.
(a) Heat map of a subset of differentially expressed genes (1.9 fold-change) (n = 2 umbilical arteries, two inner TM samples matched to two outer TM samples). (b) Ingenuity pathway analysis (IPA) showing significantly different pathways in the umbilical artery inner and outer tunica media (n = 2 umbilical arteries, two inner TM samples matched to two outer TM samples).
Synchrotron image stack of an umbilical artery.
A human umbilical artery was imaged cross-sectionally and the images reconstructed along the luminal axis using Amira.
Synchrotron image stack of an umbilical vein.
A human umbilical vein was imaged cross-sectionally and the images reconstructed along the luminal axis using Amira.
Alcian blue, which binds sulfated glycosaminoglycans (GAGs), intensely stained the inner layer of the bilayered arterial TM but only the innermost three to four cell layers of the venous TM (Figure 1c). SMCs in this GAG-rich region of the arteries were radially oriented and round, with nuclear-localized Sox9, a chondrogenic factor (Figure 1—figure supplement 1e; Ng et al., 1997). The distribution of chondroitin sulfate (CS) coincided with Alcian blue staining (Figure 1c–d, Figure 1—figure supplement 1e), whereas heparan sulfate was more abundant in the outer arterial TM (Figure 1d), suggesting that the inner TM was enriched in CS-proteoglycans (CSPGs). RNA microarray data from matched human umbilical arteries and veins showed, among many differentially expressed genes (Figure 1e, Figure 1—figure supplement 2, Sup. array data-1), arterial prevalence of mRNAs for ACAN and VCAN encoding CSPGs bearing the most CS-chains, aggrecan and versican, respectively (Figure 1e). Microarray analysis of the inner versus outer arterial TM identified stronger ACAN and VCAN expression in the inner TM, among other differences (Figure 1e, Figure 1—figure supplement 3, Sup. array data-2). RNA in situ hybridization (RNA-ISH) localized strong ACAN and VCAN expression in inner arterial TM SMC, and immunostaining showed versican and aggrecan core proteins in a similar distribution as alcian blue and anti-CS staining (Figure 1c,d,f). Versican is a well-characterized vascular component (Wight and Merrilees, 2004), and aggrecan, which is known as a cartilage and neural proteoglycan (Lauing et al., 2014; Schwartz and Domowicz, 2014), is emerging as a significant CSPG in vascular disease (reviewed in Koch et al., 2020).
ADAMTS proteoglycanases are differentially expressed in the umbilical artery and vein
Aggrecan and versican are proteolytically cleaved by ADAMTS1, 4, 5, and 9 (Dancevic et al., 2016). ADAMTS1 and ADAMTS4 mRNAs had higher levels in the venous wall in microarrays (Figure 1e, Sup. Array data-1), and RNA-ISH demonstrated stronger expression of ADAMTS1, ADAMTS4, ADAMTS5, and ADAMTS9 in the veins (Figure 2a). ADAMTS1 was the most strongly expressed, localizing to venous endothelium and TM, with stronger umbilical artery expression seen in the outer than inner TM (Figure 2a). ADAMTS9 was similarly expressed as ADAMTS1, whereas ADAMTS4 and ADAMTS5 mRNAs were restricted to umbilical vein endothelium and some venous SMC (Figure 2a). Neo-epitope antibodies detecting ADAMTS-cleaved aggrecan and versican (anti-NITEGE and anti-DPEAAE, respectively) (Lark et al., 1995; Sandy et al., 1992; Sandy et al., 2001) showed strong staining throughout the venous TM and in the outer arterial TM, but not the inner arterial TM (Figure 2b). Thus, proteoglycan accumulation in the inner TM of the umbilical artery may result from higher ACAN and VCAN expression and less proteolysis. In contrast, lower ACAN and VCAN expression and greater ADAMTS levels within the umbilical vein may preclude proteoglycan accumulation.
ADAMTS proteoglycanases are highly expressed and active in the human umbilical vein.
(a) RNA in situ hybridization shows robust ADAMTS1 and ADAMTS9 expression in umbilical vein endothelium and tunica media (TM) and in outer arterial TM. Robust ADAMTS4 and ADAMTS5 expression was confined to the venous endothelium, with moderate ADAMTS4 expression and minimal ADAMTS5 expression in SMC (n = 3 umbilical cords for each probe). (b) ADAMTS-cleaved aggrecan (anti-NITEGE, red) and versican (anti-DPEAAE, red) both showed strong ADAMTS proteolytic activity throughout the venous wall and the outer artery TM. Unlike aggrecan, extensive versican proteolysis is seen in the arterial intima and sub-intima (n = 4 umbilical cords for each antibody). Wj, Wharton’s jelly. The brackets mark TM boundaries. Scale bars in a-b = 100 μm.
ADAMTS-mediated differential proteoglycan abundance in the umbilical artery and vein is evolutionarily conserved
We postulated that abundant hydrated proteoglycans in the inner arterial TM provided compressive stiffness that could not only prevent kinking and premature occlusion but could potentially facilitate rapid umbilical artery closure at birth. If so, similar adaptations should be present in other mammals. Analysis of umbilical cords from nine large primate and non-primate mammals disclosed similar dimorphism, namely, umbilical arteries were occluded and had thicker walls with similar infolding of the inner arterial TM (Figure 3a) and strong Alcian blue and CS-staining, contrasting with veins (Figure 3a,b). Anti-aggrecan and anti-NITEGE stained several animal species, confirming aggrecan abundance in the inner arterial TM and robust aggrecan cleavage resulting from ADAMTS protease activity in the outer TM of the artery and the TM of the vein (Figure 3c–d, Figure 3—figure supplement 1).
Aggrecan enrichment in the inner umbilical artery tunica media (TM) and its proteolysis in the umbilical vein is a characteristic of large mammals.
(a) Alcian blue-eosin staining of umbilical cord sections shows proteoglycan enrichment (blue) in the inner arterial tunica media (TM). The elephant umbilical vein was unavailable. (b) Anti-CS immunofluorescence (7D4, green) shows enrichment in the inner arterial TM. Bonobo cords lacked 7D4 reactivity. (c,d) Aggrecan and anti-NITEGE immunostaining from reactive species showed aggrecan enrichment in the inner arterial TM and aggrecan proteolysis in the vein and outer artery TM. n = 3 for Gazelle and n = 1 for other mammals. Triplicate sections were stained from each animal cord. Scale bars = 100 μm and 200 μm. * indicates the vessel lumen.
Aggrecan cleavage site conservation in mammals.
The cleavage site location is shown over the sequence alignment by scissors, and the critical Glu(E) residue essential for cleavage is shown by red highlighting. Bold text identifies the cleavage-revealed neo-epitope NITEGE. Residue numbers are indicated for human and mouse aggrecan only.
Aggrecan and ADAMTS1 are necessary for normal umbilical cord morphogenesis
Mouse umbilical cords also demonstrated vascular dimorphism (Figure 4a), suggesting that genetically modified mice would provide mechanistic insights into proteoglycan dynamics and its impact. Aggrecan and versican immunofluorescence showed strong staining in the mouse umbilical artery inner TM and adventitia, with weaker staining in the veins (Figure 4b). Acan, Vcan and Adamts1,4,5,9 RNA-ISH at early (E12.5) and late (E18.5) gestational stages showed that Acan and Vcan were strongly expressed in the umbilical arteries (Figure 4—figure supplement 1a). Adamts1 was the most highly expressed proteoglycanase in the mouse umbilical vein just prior to parturition (E18.5) (Figure 4—figure supplement 1a), evidenced by strong β-gal staining in venous TM, adventitia and endothelium; the inner umbilical artery TM and endothelium of Adamts1lacZ/+ embryos lacked β-gal staining (Figure 4c). Although Adamts9 mutant embryos were previously observed to have short umbilical cords, abnormal umbilical artery development, and to die by 14.5 days of gestation (Nandadasa et al., 2015), umbilical cord development was not previously investigated in mutants of the two genes implicated here as potentially critical for umbilical cord vascular dimorphism, Acan and Adamts1.
Defective morphogenesis in <italic>Acan</italic> and <italic>Adamts1</italic> mutant mouse umbilical cords.
(a) H and E staining of E18.5 wild-type cords showing thicker umbilical arterial (A) and thinner venous (V) wall (n = 6 umbilical cords). (b) Aggrecan and versican localization (red, DAPI counterstain blue) in E18.5 wild-type cords showing staining in the arterial inner tunica media (TM) and adventitia but not the vein (n = 3 umbilical cords). (c) β-gal (blue) and eosin (red) staining of E18.5 Adamts1LacZ/+ (Adamts1+/-) cord showing strong Adamts1 expression in venous endothelium and TM and outer artery TM (n = 3 umbilical cords). (d) Short umbilical cords in E18.5 Adamts1-/- and Acan-/- embryos compared to wild type. Red arrowhead indicates an omphalocele in Adamts1-/- embryos. (e) H & E staining of E18.5 wild type, Acan-/- and Adamts1-/- cord cross-sections showing thinner walls in Acan-/- umbilical vessels and thicker walls in Adamts1-/- umbilical vessels. (f–g) Cord length, TM thickness and vessel luminal area quantifications for Adamts1-/- (f) and Acan-/- mice (g) at E18.5 compared to wild-type littermates. Acan-/- umbilical cords show larger lumens and Adamts1-/- vessels show smaller lumens in (n = 7–11 umbilical cords each, whiskers indicate minimum and maximum values, *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001). (h) Phospho-histone H3 (pHH3) staining shows significantly fewer proliferating cells (white arrowheads) in Acan-/- umbilical vessels. Dotted white lines mark the boundaries of vessel lumens (n = 4 cords each, whiskers indicate minimum and maximum values, **, p<0.001; *, p<0.05). Scale bars = 100 μm in (a), 25 μm in (c), 100 μm and 50 μm in (e).
ADAMTS, <italic>Vcan</italic> and <italic>Acan</italic> expression and impact of aggrecan loss on early mouse umbilical cord and vessel development.
(a) RNA in situ hybridization analysis of E12.5 and E18.5 mouse umbilical cord sections Acan, Vcan and relevant ADAMTS genes (n = 3 umbilical cords for each probe). (b) E12.5 and E14.5 wildtype and Acan-/- embryos have a comparable umbilical cord length (n = 2 Acan-/- at E12.5 and n = 3 at E14.5). (c) Observed and expected genotype ratios at different embryonic stages from Acan+/- and Adamts1+/- intercrosses. (d) Hematoxylin and eosin staining of E14.5 wild type and Acan-/- umbilical cords shows completion of longitudinal to circumferential reorientation of smooth muscle cells in the mutant arterial tunica media (TM). Upper panels show tangential longitudinal sections whereas the lower panels are taken through the approximate center of each vessel (n = 3 umbilical cords of each genotype). Adv, adventitia; Tm, tunica media. Scale bars in a = 100 μm, 3 mm and 7 mm in (b) and 50 μm in (d).
The Adamts1-/- mutant is an insertion of an IRES lacZ-bearing cassette into intron 1 of the gene (Oller et al., 2017). This insertion reveals Adamts1 expression via staining for ß-galactosidase activity, and eliminated expression from the targeted allele but in its hemizygous state, the insertion led to reduction in both mRNA and protein (Oller et al., 2017). The Acancmd-Bc allele is a spontaneous mutation found in a BALB/C colony (Bell et al., 1986) and resulted from deletion of exon 2 through exon 18 (Krueger et al., 1999). Acan-/- embryos do not survive past birth (Krueger et al., 1999; Lauing et al., 2014) and few surviving Adamts1-/- mice were identified at the time of weaning (Oller et al., 2017). Acan mutants are thought to succumb to respiratory failure resulting from soft tracheal cartilages and ribs, whereas the cause of Adamts1-/- lethality is unknown. At E18.5, Acan-/- and Adamts1-/- mutants each had significantly short umbilical cords (Figure 4d) demonstrating their requirement for proper umbilical cord development. Umbilical cord histology showed thinner vascular walls in Acan-/- umbilical vessels, and conversely, thicker vascular walls in Adamts1-/- umbilical vessels (Figure 4e–g). At earlier developmental stages (E12.5 to E14.5), lack of aggrecan did not affect either umbilical cord length or circumferential SMC reorientation (Figure 4—figure supplement 1b–d), which occurs around E13.5 and is defective in Adamts9 mutants (Nandadasa et al., 2015). Furthermore, lack of aggrecan did not impair the survival of mouse embryos until parturition, since Acan-/- embryos were observed at the expected Mendelian ratio at E18.5 (Figure 4—figure supplement 1c). Thus, Acan and Adamts1 appear to be involved in umbilical vessel development from early gestation, but their functions manifest near parturition.
Contrasting SMC phenotypes in <italic>Acan</italic> and <italic>Adamts1</italic>-deficient umbilical cords
The arterial and venous lumina were smaller in Adamts1-/- mice relative to wild-type, indicating that their thicker vascular walls compromised luminal diameter, and larger in Acan-/- mice (Figure 4e–g). Phospho-histone H3 staining revealed fewer proliferating cells in Acan-/- umbilical cords at E18.5 (Figure 4h). Immunostaining for SMC markers smooth muscle α-actin (SMA), smooth muscle myosin heavy chain (SMMHC), and phosphorylated myosin light chain (pMLC) showed weaker intensity in Acan-/- umbilical arteries compared to wild-type (Figure 5a,b). In contrast, Adamts1-/- umbilical vessels showed stronger SMA, SMMHC and pMLC staining than wild-type littermates and apparent overgrowth of the arterial and venous walls (Figure 5c). Intriguingly, endomucin, a venous endothelium-specific marker (dela Paz and D'Amore, 2009), also stained Adamts1-/- umbilical arterial endothelium (Figure 5c) suggesting that ADAMTS1 may have a role in specifying artery/vein identity. Immunostaining of E17.5 Adamts1-/- umbilical cords indicated a crucial role for ADAMTS1 in regulating proteoglycan dynamics in the mouse umbilical cord. Specifically, we observed robust aggrecan and versican accumulation in the Adamts1-/- umbilical vein and in the outer TM of the Adamts1-/- umbilical artery (Figure 6a–d) with severe reduction of aggrecan and versican neo-epitope staining (Figure 6a–d).
Contrasting smooth muscle cell (SMC) phenotype modulation in <italic>Acan</italic> and <italic>Adamts1</italic>-deficient umbilical vessels.
(a) Aggrecan (green) and α-SMA staining (red) in E18.5 umbilical cords show loss of aggrecan and weak α-SMA staining in Acan-/- vessels (n = 3 umbilical cords each genotype). (b) Smooth muscle myosin heavy chain (SMMHC, red) and phosphorylated myosin light chain (pMLC, green) staining in E18.5 umbilical cords showing dramatic signal attenuation in the Acan-/- vessels (n = 3 umbilical cords each genotype) (c) pMLC (green), endomucin (red), α-SMA (red, center panels) and SMMHC (red, right-hand panels) staining shows blunted dimorphism of Adamts1-/- umbilical artery and vein with stronger expression of differentiated SMC markers in Adamts1-/- umbilical vessels and acquisition of endomucin, a venous endothelium marker, by arterial endothelium (n = 3 umbilical cords each genotype) Scale bars = 100 μm in (a–c).
Reduced aggrecan and versican proteolysis in <italic>Adamts1</italic><sup>-/-</sup>umbilical vessels.
(a,b) E17.5 Adamts1-/- umbilical vessels show increased aggrecan staining and reduced anti-NITEGE staining in (a), quantified in (b) (n = 3 cords each genotype, error bars indicate mean ±S.D.*, p<0.05; **, p<0.01; ***, p<0.001). (c,d) Adamts1-/- umbilical vessels show increased versican (c) and reduced anti-DPEAAE staining quantified in (d) (n = 3 cords each genotype, error bars indicate mean ±S.D. *, p<0.05; **, p<0.01). Scale bars = 50 μm in (a–c).
Differential SMC contraction in the bilayered umbilical arteries
Despite uniform staining with SMC markers in human umbilical vascular SMC, co-staining with serine20-phosphorylated myosin light chain (pMLC) marking contractile SMCs (Dougherty et al., 2014) revealed that human umbilical arteries had more contractile SMCs than the vein, predominantly in the outer TM (Figure 7a,b). This suggests that outer umbilical artery SMCs are principally responsive to vasoconstriction stimuli at birth, whereas inner SMCs are relatively non-contractile. We hypothesized that an outer ring of contracting SMCs could drive the CSPG-rich inner arterial TM centripetally, occluding the lumen, and addressed this possibility initially using ex vivo biomechanical testing of late-gestation mouse umbilical vessels (Figure 7c, Figure 7—figure supplement 1). Mouse umbilical arteries had a smaller lumen, as expected at E18.5, and deformed less when loaded mechanically, namely, they exhibited lower (circumferential) distensibility and especially (axial) extensibility under passive conditions compared to the umbilical veins (Figure 7—figure supplement 1a–d). Umbilical arteries constricted significantly (30–50% reduction in measured outer diameter at 25 mm Hg fixed pressure), causing complete luminal occlusion verified by optical coherence (OCT) imaging, which was not observed in the umbilical veins (Figure 7c). Cross-sectional area measurements at fixed lengths revealed wall volume reductions during vasoconstriction (Figure 7—figure supplement 1e), less in the umbilical vein (~35%) than the umbilical artery (~50%), suggesting fluid exudation from the wall under forceful SMC contraction.
Contraction-induced buckling ensures effective closure of the umbilical artery at birth.
(a) Smooth muscle myosin heavy chain (SMMHC-red) and serine-20 phosphorylated myosin light-chain (pMLC-green) show more contraction-primed SMCs in the outer arterial tunica media (TM, white brackets) than the umbilical vein. Scale bars are 100 µm. (b) Quantitation of pMLC+ SMCs in the artery (red) and vein (blue) (top, n = 5 arteries, four veins, whiskers indicate minimum and maximum values, *, p<0.05) and inner and outer TM of both reveal similar distributions but more pMLC+ SMC in the outer artery TM (bottom, n = 3 arteries, four veins, error bars indicate mean ±S.D. *, p<0.05; **, p<0.01). (c) Differential contraction of murine umbilical artery and vein stimulated by 100 mM potassium chloride (KCl) under biaxial loading confirms greater contractility in the artery, with OCT images prior to and following contraction-induced arterial closure (n = 4 arteries and n = 4 veins). (d) Computational simulations of a bilayered artery with contractile SMCs in the outer layer and swollen inner layer: critical contractile stress values leading to buckling for (left) different numbers of folds for a normalized inner layer volume of 0.5 and (right) decreasing values of normalized volume of the inner layer for seven folds. (e) Normalized inner radius as a function of contractile stress for inner layer volume change of 0.5 and 7 folds. The states for the inflection (square) and critical active stress (star) are illustrated by the schematics; complete closure achieved with contraction-induced buckling. All simulations were run for 25 mmHg pressure. Due to the linear stability analysis, the amplitude of the folds in the buckled schematics is illustrative. (f) Number of buckles observed in human (top, indicated as umbilical cord (UC)1–25) and other large mammalian (bottom) umbilical arteries. Both arteries per cord were included. Open vessel lumens are indicated where observed.
Differential biomechanical properties of arteries and veins of the mouse umbilical cord.
Biaxial structural (a,b) and material (c,d) behaviors exhibited by umbilical arteries and veins harvested from wild type E18.5 umbilical cords. The curves show model predicted results for the mean behaviors based on best-fit parameters determined from seven different testing protocols performed individually on n = 4 arteries and n = 4 veins. Though based on data from all seven protocols, for illustrative purposes results are shown for pressure-diameter behaviors during quasi-static pressurization at a fixed vessel-specific in vivo length and quasi-static axial extension at fixed pressures (25 mmHg for the arteries, and 5 mmHg for the veins). Grey-shaded regions show S.D. (e) Change in normalized cross-sectional area for the umbilical vein at 5 mm Hg and for the umbilical artery at 25 mm Hg during isobaric contraction. Error bars indicate S.E.M, **, p<0.01.
Computational results for a model umbilical artery.
(a) Normalized inner radius as a function of normalized volume of the inner layer alone for different fixed values of the active stress parameter Tact and (b) inner radius as a function of the active stress parameter Tact for different fixed values of normalized volume in the inner layer. Loaded inner radius a was normalized by the unloaded inner radius A; the current volume of the vessel v was normalized by the original volume of the vessel V. (c) Critical value of the active stress parameter Tact as a function of the normalized volume in the inner layer for different numbers of buckling-induced luminal folds n. (d) Mean circumferential stress tθθ across the umbilical artery wall for varying normalized volumes: (i) and (ii) show circumferential stress for the case of shrinkage of the inner layer alone with v/V = 0.5 while (iii) and (iv) show the case of no swelling with v/V = 1.0. All simulations use the loading conditions, luminal pressure p=25 mmHg and fixed axial stretch λz=1.28.
Computational modeling of arterial occlusion
These biomechanical tests of mouse umbilical cords, together with histological and immunostaining findings from human cords, motivated and informed a novel computational model of the umbilical artery incorporating its complex bilayered, multi-constituent structure (GAG-rich inner layer and contractile SMC-rich outer layer; Figure 7d) and multiaxial mechanical loading: axial extension, luminal pressurization, active contraction by SMCs, and intramural swelling of the inner layer that regulates tissue volume locally based on GAG content. Nonlinear regression of biaxial mechanical data from passive tests of the murine vessels identified best-fit values of the material parameters in the baseline constitutive model, while data from active contraction studies guided the selection of the associated active constitutive parameters (Table 1). Model-based parametric studies examined combinations of different levels of GAG-driven swelling and SMC-generated active stress to identify their roles in umbilical artery closure at different levels of fixed luminal pressure. Increasing inner layer swelling in the absence of active outer layer stress narrowed the lumen at a fixed pressure, as expected given the constraining effect of the outer stiff passive matrix (Figure 7—figure supplement 2a). This trend reversed in the presence of active stresses, with increasing inner layer GAGs able to oppose vasoconstriction if overall wall volume remained constant (Figure 7—figure supplement 2b). Thus, increased inner layer swelling attenuates the ability of SMC contraction to prematurely reduce luminal radius, as revealed by varying the active stress parametrically for different fixed values of inner layer swelling. Importantly, the model predicted a sharp transition from a widely patent to a narrowed lumen due to small changes in active stress at lower values of swelling whereas radius changes were more gradual at higher values of swelling (Figure 7—figure supplement 2b). This transition, at which a decrease in volume of the inner layer associates with larger or smaller luminal radii for values of active stress below or above Tact≅50 kPa (a key parameter of active stress generation) appears to be close to the in vivo value. Hence, consistent with ex vivo findings (Figure 7—figure supplement 1), it appears that inner layer volume loss during increased SMC contraction aids vessel narrowing. Regardless, the inner radius reached nearly constant values for increasing levels of active stress (Figure 7—figure supplement 2b). Thus, contraction alone is insufficient to occlude the vessel.
Model parameters fixed for all simulations of the umbilical artery, determined primarily from the biaxial biomechanical data and histological findings.
Parameters
Description
Values
A,B,C
Unloaded inner, interface, outer radius
161.77, 206.86, 236.92 µm
λz
Loaded axial stretch
1.28
μ1,μ2
GAG/matrix shear modulus inner, outer layer
3.0 kPa, 0.1 kPa
c11,c21
Axial fiber family material parameters
0.013 kPa, 11.65
c12,c22
Circumferential fiber family material parameters
2.66 kPa, 1.20
c13,4,c23,4
Diagonal fiber families’ material parameters
3.04 kPa, 4.23
η3,η4
Diagonal fiber families’ alignment parameter
41.92°, −41.92°
λm,λ0
Maximum, minimum contractile stretch
2.5, 0.2
Folding of the arterial inner layer is necessary for vascular occlusion
Given the consistent histological finding of inner arterial TM infolding following birth, we modeled the biomechanics of superimposed inner layer buckling in the bilayered arterial model. Buckling can release energy stored in the inner layer during vasoconstriction-induced compression, thereby reducing the structural stiffness and resistance to SMC contraction. This analysis parametrically considered possible perturbations to the cylindrical geometry achieved at various levels of fixed luminal pressure and different values of swelling and actively generated wall stress. Examining the influence of the number of inner layer folds for different values of swelling disclosed higher inward buckling probability with more folds (Figure 7d). Since Tact needed to cause buckling tended to plateau at 7 folds, we used 7 folds subsequently for illustrative purposes. Tact needed to cause buckling decreased for a more swollen inner layer Figure (7dFigure 7—figure supplement 2c) and increased exponentially with inner layer volume loss. This finding was likely due to the less negative values of circumferential wall stress in the inner layer occurring with shrinkage (Figure 7—figure supplement 2d). We found that an arterial wall consisting solely of SMCs and uniform matrix maintained a mean positive circumferential stress in the inner layer during contraction, that prevented buckling. Thus, a delicate biomechanical balance exists – reduced inner layer volume allows a smaller radius to be achieved via SMC contraction prior to buckling (Figure 7—figure supplement 2b), thus aiding closure, yet excess volume reduction of the inner layer increases the active stress requirement for buckling and achieving complete vessel closure (Figure 7d). The umbilical artery can reduce its cylindrical radius dramatically at Tact near a basal value of ~50 kPa, progressing to buckling and closure via a subsequent near-maximal contraction (Figure 7e). In agreement with the computational modeling, 20/25 of human umbilical arteries had 4 or more buckles, whereas those with no buckles in the area analyzed by histology were patent (Figure 7f). Other large mammalian species analyzed showed a similar phenomenon (Figure 7f). Thus, buckling of the proteoglycan-rich inner tunica media may be a crucial and evolutionarily conserved mechanism employed by all mammals for rapid arterial occlusion at birth.
Discussion
We report two distinct umbilical cord blood vessel specializations that may facilitate rapid umbilical artery occlusion at birth: a distinct proteoglycan-rich inner arterial TM, generating a bilayered arterial wall, and selective contraction of SMCs in the outer layer (Figure 8). The rounded SMCs of the inner TM may be specialized for CSPG production rather than contraction, consistent with nuclear Sox9 staining, a function they exert prior to delivery. During delivery, lack of pMLC staining suggests that despite differentiated SMC marker expression, the inner cells play a passive role. Biomechanical testing and computational analysis confirm that selective proteoglycan enrichment in the inner arterial TM ensures that contracting SMCs in the outer TM can effectively occlude the arterial lumen at birth (Figure 8). Histologic and computational analysis showed buckling of the inner TM and fluid redirection into the resulting TM protrusions as critical mechanisms resulting from specialization of the inner and outer arterial TM. By in silico simulations of umbilical arteries with modulation of the contractile outer layer and proteoglycan-rich inner core, we demonstrate that complete occlusion can be achieved.
The unique bilayered design of the umbilical artery underlies its rapid occlusion at birth.
(a) Differential expression of ADAMTS proteases and large CS-proteoglycans during development results in a bilayered artery with a hydrated proteoglycan-rich inner layer and most contractile SMCs located in the outer layer, contrasting with the umbilical vein (see key at top of figure identifying the illustrated major elements). (b) At birth, SMC contraction in the outer layer and fluid movement-induced inner layer buckling redirects the inner layer into the lumen. The single-layered vein does not undergo buckling. (c) Umbilical artery occlusion at birth prevents neonatal exsanguination, whereas the patent vein allows a final transfusion from the placenta.
Our work suggests that a principal mechanism governing umbilical cord vascular dimorphism resides in extracellular matrix, namely, differentially regulated dynamics of aggrecan and versican, which may then modulate SMC development and differentiation. Other mammalian umbilical vessels examined, from animals as large as the walrus and elephant to as small as the mouse, showed similar CSPG and aggrecan modulation as in humans. Although Vcan mutant mice die before umbilical cord development is completed (Yamamura et al., 1997) and could not be studied, Acan and Adamts1 mutants demonstrated their mechanistic contributions to the observed dimorphism. Our emphasis on aggrecan in the inner layer, with its abundant GAGs and their high fixed charge density, was relevant to the computational findings of the importance of inner layer swelling and buckling in response to SMC contraction. The umbilical vein contains fewer contractile SMCs and has scant aggrecan and versican. Hence, SMC activation in the umbilical vein does not occlude the lumen to the same degree as in the arteries, a contention supported by computational analysis. Given the evolutionary pressure to achieve hemostasis urgently in the artery rather than the vein, these findings suggest a highly evolved mechanism for preventing exsanguination of the newborn that is potentially relevant to other embryonic shunts that occlude rapidly at birth.
The computational model was built on a long history of studying murine arteries and veins (Ferruzzi et al., 2013), but was specialized to the GAG-rich inner layer and SMC-rich outer layer of the umbilical artery. Modeling the dynamics of associated volume changes would have required a mixture or poroelastic model and significantly more experimental data, including measurement of layer-specific permeabilities and fixed-charge densities. Instead, we modeled the quasi-equilibrated states using a well-accepted approach wherein the degree of swelling can be adjusted for each simulation (Demirkoparan and Pence, 2007; Szafron et al., 2017). Interestingly, prior results by others showed that swelling of an initially unloaded, unilayered cylindrical tube consisting of a neo-Hookean material (which we used to model GAG-rich tissue) increases luminal diameter if the tube is unconstrained (Demirkoparan and Pence, 2007). The tube must be constrained, such as by a stiff outer layer surrounding the swollen layer if swelling is to decrease luminal diameter (Szafron et al., 2017). The abundance of contractile SMCs in the stiffer outer layer and their basal tone may in fact enhance outer layer stiffness contributed by extracellular matrix and hence buckling appears to be essential to augment contraction-induced closure of the umbilical artery (cf [Moulton and Goriely, 2011]).
This observed architecture of the umbilical cord is likely to have supported survival of mammalian species, humans included, well before formal obstetric involvement in labor. Cord clamping is the default practice today and has the sanction of convention, offering the option of immediate neonatal resuscitation if needed. In regard to the umbilical artery, it would replicate the effect of a natural and apparently conserved physiologic process that interrupts its blood flow during transition from fetal to neonatal life. The latest recommendation to clamp the cord later rather than immediately after birth appears to align better with the delayed closure of the umbilical vein. The present studies in humans and other mammals show that evolution has devised an umbilical cord-intrinsic mechanism that facilitates rapid arterial occlusion at birth, leaving the vein patent and permitting a placental infusion. This unfailing sequence ensures continuation of mammalian species without other formal intervention, since evolutionary success is not about minimizing poor outcomes, but ensuring survival of a significant majority.
Materials and methods
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Gene (Homo sapiens)
ACAN
GenBank
RRID:HGNC:319
Chondroitin sulphate proteoglycan 1
Gene (Homo sapiens)
VCAN
GenBank
RRID:HGNC:2464
Chondroitin sulphate proteoglycan 2
Gene (Homo sapiens)
ADAMTS1
GenBank
RRID:HGNC:217
ADAM metallopeptidase with thrombospondin type 1 motif 1
Gene (Homo sapiens)
ADAMTS4
GenBank
RRID:HGNC:220
ADAM metallopeptidase with thrombospondin type 1 motif 4
Gene (Homo sapiens)
ADAMTS5
GenBank
RRID:HGNC:221
ADAM metallopeptidase with thrombospondin type 1 motif 5
Gene (Homo sapiens)
ADAMTS9
GenBank
RRID:HGNC:13202
ADAM metallopeptidase with thrombospondin type 1 motif 9
Used for gene expression analysis for all microarray experiments in the study
Software, algorithm
R
Bell Laboratories/R Foundation for Statistical Computing Ver. 3.5.2.
RRID:SCR_001905
Used for statistical computing of microarray data
Software, algorithm
GraphPad Prism
GraphPad
RRID:SCR_002798
Used for statistical computing of other experimental data
Abbreviations, IF, Immunofluorescence.
Human and large mammal cords
Twenty-five human umbilical cords were obtained from uncomplicated term pregnancies either after vaginal birth (n = 13) or Cesarean section for obstetric indications (n = 12), that is, malpresentation or repeat Cesarean section. The samples were collected under an IRB exemption from Cleveland Clinic (EX-0118) for use of discarded tissue without patient identifiers. These cords were used for histological/immunohistologic analysis, synchrotron imaging, RNA in situ hybridization, and transcriptomics of inner versus outer umbilical artery TM. Animal cord sections were provided by Disease Investigations, Institute for Conservation Research, San Diego Zoo Global from the Benirschke archive.
Mutant mice
The Adamts1 transgenic allele (Adamts1tm1Dgen), referred to herein as Adamts1-/-, was produced by insertion of an IRES-lacZ cassette into intron 1 of Adamts1 using homologous recombination in mouse embryonic stem cells (Oller et al., 2017). The Acancmd-Bc allele was previously described (Krueger et al., 1999) and is referred to herein as Acan-/-. Mice were handled under standard conditions under approved IACUC protocols at the Cleveland Clinic (IACUC protocol nos. 18–1996 and 18–2045) and University of Chicago (IACUC protocol no. 43751). Mutant mouse embryos were collected by timed matings of heterozygous mice by the detection of copulation plugs (taken as day 0.5 of gestation). Embryos were dissected out immediately following CO2 mediated euthanasia and cervical dislocation of pregnant mice. Dissected whole embryos, with umbilical cords and placentas attached, were fixed in 4% paraformaldehyde at 4°C overnight. Umbilical cords were dissected out the following day and washed thrice in PBS and embedded in paraffin or in 4% agarose for vibratome sectioning as previously described (Nandadasa et al., 2015).
Biomechanical and computational analysis
The umbilical artery and vein were obtained at E18.5 from mouse embryos (n = 4) following approval by the Yale University IACUC (protocol no 2018–11508), then mounted within a custom computer-controlled biaxial device designed specifically for biomechanical testing of murine vessels (Gleason et al., 2004). Vessel maintenance, pre-conditioning, biaxial loading protocols and data collection are described in Appendix 1. The umbilical artery was modeled computationally as a thick-walled, bilayered cylindrical tube subjected to swelling of the GAG-rich inner layer and active contraction of the smooth muscle-rich outer layer; the model also included a passive contribution of extracellular matrix as revealed by biomechanical tests.
Statistical analysis
Statistical analyses were carried out using GraphPad Prism analytical software (versions 6–8, GraphPad, San Diego, CA) in determining statistical significance using two-tailed Student’s t-test. Statistical details including N and p values are provided in each corresponding figure legend. Statistical analyses for microarray gene expression were performed using Affymetrix’s Transcriptome Analysis Console (TAC 4.0) through the RMA-SST sketch algorithm and R version 3.5.2. Fold changes were calculated by an empirical Bayes ANOVA method through the TAC 4.0 software. Details of these and additional methods are provided in Appendix 1.
Acknowledgements
We acknowledge the Paul Scherrer Institut, Villigen, Switzerland for provision of synchrotron radiation beamtime at the TOMCAT beamline X02DA of the SLS and thank Goran Lovric for assistance. We are grateful to the Disease Investigations team at San Diego Zoo Global for use of sections from the Benirschke archive, and to the late Dr. Kurt Benirschke for collecting the animal umbilical cords used in this study.
Additional informationCompeting interests
No competing interests declared
Author contributions
Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing
Data curation, Formal analysis, Visualization, Writing - review and editing
Formal analysis, Visualization, Methodology, Writing - review and editing
Investigation, Writing - review and editing
Investigation, Writing - review and editing
Investigation, Writing - review and editing
Resources, Writing - review and editing
Resources
Resources, Investigation, Writing - review and editing
Resources, Writing - review and editing
Investigation, Writing - review and editing
Resources, Methodology, Writing - review and editing
Resources, Investigation, Writing - review and editing
Conceptualization, Resources, Supervision, Funding acquisition, Investigation, Writing - original draft, Writing - review and editing
Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Visualization, Writing - original draft, Writing - review and editing
Conceptualization, Data curation, Supervision, Funding acquisition, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing
Ethics
Human subjects: Human umbilical cord samples were collected under an IRB exemption (EX-0118) from Cleveland Clinic for use of discarded tissue without patient identifiers. These cords were used for histological/immunohistologic analysis, in situ hybridization, and transcriptomics of inner vs outer umbilical artery TM. For microarray analysis of umbilical cord artery versus vein, human umbilical cords were collected separately through the National Children's Study under University Hospitals-Case Medical Center approved IRB protocol 01-11-28.
Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols: 18-1996 and 18-2045 (Cleveland Clinic IACUC), 2018-11508 (Yale University IACUC) and 43751 (University of Chicago IACUC).
Additional files
Microarray comparison of transcriptome of the human umbilical artery and vein.
Microarray comparison of the transcriptome of the inner umbilical artery tunica media with the outer umbilical artery tunica media.
Data availability
All data generated or analysed during this study are included in the manuscript and supporting files.
The following datasets were generated:
NandadasaSSzafronJMPathakVMurtadaS-IKraftCMO'DonnellANorvikCHughesCCatersonBDomowiczMSSchwartzNBTran-LundmarkKVeiglMSedwickDPhilipsonEHHumphreyJDApteSS2020Human umbilical cord artery inner tunica media vs outer tunica media.Dryad Digital Repository10.5061/dryad.4j0zpc88k
NandadasaSSzafronJMPathakVMurtadaS-IKraftCMO'DonnellANorvikCHughesCCatersonBDomowiczMSSchwartzNBTran-LundmarkKVeiglMSedwickDPhilipsonEHHumphreyJDApteSS2020Human umbilical cord artery vs veinDryad Digital Repository10.5061/dryad.hdr7sqvfs
ReferencesBaekSGleasonRLRajagopalKRHumphreyJD2007Theory of small on large: potential utility in computations of fluid–solid interactions in arteriesComputer Methods in Applied Mechanics and Engineering1963070307810.1016/j.cma.2006.06.018BellLJuriloffMHarrisMJ1986A new mutation at the cmd locus in the mouseJournal of Heredity7720520610.1093/oxfordjournals.jhered.a1102153734407DancevicCMMcCullochDRWardAC2016The ADAMTS hyalectanase family: biological insights from diverse speciesBiochemical Journal4732011202210.1042/BCJ2016014827407170dela PazNGD'AmorePA2009Arterial versus venous endothelial cellsCell and Tissue Research33551610.1007/s00441-008-0706-518972135DemirkoparanHPenceTJ2007Swelling of an internally pressurized nonlinearly elastic tube with fiber reinforcingInternational Journal of Solids and Structures444009402910.1016/j.ijsolstr.2006.11.006DoughertyPJNepiyushchikhZVChakrabortySWangWDavisMJZawiejaDCMuthuchamyM2014PKC activation increases Ca²⁺ sensitivity of permeabilized lymphatic muscle via myosin light chain 20 phosphorylation-dependent and -independent mechanismsAmerican Journal of Physiology-Heart and Circulatory Physiology306H674H68310.1152/ajpheart.00732.201324414065DowneyCLBewleyS2012Historical perspectives on umbilical cord clamping and neonatal transitionJournal of the Royal Society of Medicine10532532910.1258/jrsm.2012.11031622907549FerruzziJBersiMRHumphreyJD2013Biomechanical phenotyping of central arteries in health and disease: advantages of and methods for murine modelsAnnals of Biomedical Engineering411311133010.1007/s10439-013-0799-1FerruzziJBersiMRUmanSYanagisawaHHumphreyJD2015Decreased elastic energy storage, not increased material stiffness, characterizes central artery dysfunction in Fibulin-5 deficiency independent of sexJournal of Biomechanical Engineering1370310071310071410.1115/1.4029431FoulcerSJNelsonCMQuinteroMVKuberanBLarkinJDours-ZimmermannMTZimmermannDRApteSS2014Determinants of versican-V1 proteoglycan processing by the metalloproteinase ADAMTS5Journal of Biological Chemistry289278592787310.1074/jbc.M114.57328725122765GleasonRLGraySPWilsonEHumphreyJD2004A multiaxial computer-controlled organ culture and biomechanical device for mouse carotid arteriesJournal of Biomechanical Engineering12678779510.1115/1.182413015796337HaughtonDMOgdenRW1978On the incremental equations in non-linear elasticity — I. Membrane theoryJournal of the Mechanics and Physics of Solids269311010.1016/0022-5096(78)90016-9HaughtonDMOgdenRW1979Bifurcation of inflated circular cylinders of elastic material under axial loading—II. Exact theory for thick-walled tubesJournal of the Mechanics and Physics of Solids2748951210.1016/0022-5096(79)90027-9HaughtonDMOrrA1997On the eversion of compressible elastic cylindersInternational Journal of Solids and Structures341893191410.1016/S0020-7683(96)00122-9KochCDLeeCMApteSS2020Aggrecan in cardiovascular development and diseaseJournal of Histochemistry & Cytochemistry24900221554209529010.1369/0022155420952902KruegerRCKurimaKSchwartzNB1999Completion of the mouse aggrecan gene structure and identification of the defect in the cmd-Bc mouse as a near complete deletion of the murine aggrecan geneMammalian Genome101119112510.1007/s00335990117610594233LarkMWGordyJTWeidnerJRAyalaJKimuraJHWilliamsHRMumfordRAFlanneryCRCarlsonSSIwataM1995Cell-mediated catabolism of aggrecan. Evidence that cleavage at the "aggrecanase" site (Glu373-Ala374) is a primary event in proteolysis of the interglobular domainThe Journal of Biological Chemistry2702550255610.1074/jbc.270.6.25507852317LauingKLCortesMDomowiczMSHenryJGBariaATSchwartzNB2014Aggrecan is required for growth plate cytoarchitecture and differentiationDevelopmental Biology39622423610.1016/j.ydbio.2014.10.00525446537LiBCaoY-PFengX-Q2011Growth and surface folding of esophageal mucosa: A biomechanical modelJournal of Biomechanics4418218810.1016/j.jbiomech.2010.09.007LindsayKARooneyCE1992A note on compound matricesJournal of Computational Physics10347247710.1016/0021-9991(92)90417-WMcCullochDRGoffCLBhattSDixonLJSandyJDApteSS2009Adamts5, the gene encoding a proteoglycan-degrading metalloprotease, is expressed by specific cell lineages during mouse embryonic development and in adult tissuesGene Expression Patterns931432310.1016/j.gep.2009.02.006MeadTJApteSS2020Expression analysis by RNAscope in situ hybridizationMethods in Molecular Biology204317317810.1007/978-1-4939-9698-8_1431463911MeyerWWRumpeltHJYaoACLindJ1978Structure and closure mechanism of the human umbilical arteryEuropean Journal of Pediatrics12824725910.1007/BF00445610668732MoultonDEGorielyA2011Circumferential buckling instability of a growing cylindrical tubeJournal of the Mechanics and Physics of Solids5952553710.1016/j.jmps.2011.01.005NandadasaSNelsonCMApteSS2015ADAMTS9-Mediated extracellular matrix dynamics regulates umbilical cord vascular smooth muscle differentiation and rotationCell Reports111519152810.1016/j.celrep.2015.05.00526027930NgLJWheatleySMuscatGEConway-CampbellJBowlesJWrightEBellDMTamPPCheahKSKoopmanP1997SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouseDevelopmental Biology18310812110.1006/dbio.1996.84879119111NiermeyerS2015A physiologic approach to cord clamping: clinical issuesMaternal Health, Neonatology and Perinatology12110.1186/s40748-015-0022-527057338NorvikCWestööCKPeruzziNLovricGvan der HaveOMoksoRJeremiasenIBrunnströmHGalambosCBechMTran-LundmarkK2020Synchrotron-based phase-contrast micro-CT as a tool for understanding pulmonary vascular pathobiology and the 3-D microanatomy of alveolar capillary dysplasiaAmerican Journal of Physiology-Lung Cellular and Molecular Physiology318L65L7510.1152/ajplung.00103.201931596108OgdenRW1984Non-Linear Elastic DeformationsChichester, UKEllis HorwoodOllerJMéndez-BarberoNRuizEJVillahozSRenardMCanelasLIBrionesAMAlbercaRLozano-VidalNHurléMAMilewiczDEvangelistaASalaicesMNistalJFJiménez-BorregueroLJDe BackerJCampaneroMRRedondoJM2017Nitric oxide mediates aortic disease in mice deficient in the metalloprotease Adamts1 and in a mouse model of marfan syndromeNature Medicine2320021210.1038/nm.426628067899SandyJDFlanneryCRNeamePJLohmanderLS1992The structure of aggrecan fragments in human synovial fluid. Evidence for the involvement in osteoarthritis of a novel proteinase which cleaves the glu 373-Ala 374 bond of the interglobular domainJournal of Clinical Investigation891512151610.1172/JCI1157421569188SandyJDWestlingJKenagyRDIruela-ArispeMLVerscharenCRodriguez-MazanequeJCZimmermannDRLemireJMFischerJWWightTNClowesAW2001Versican V1 proteolysis in human aorta in vivo occurs at the Glu441-Ala442 bond, a site that is cleaved by recombinant ADAMTS-1 and ADAMTS-4The Journal of Biological Chemistry276133721337810.1074/jbc.M00973720011278559SanftRPowerANicholsonC2019Modeling the effects of muscle contraction on the mechanical response and circumferential stability of coronary arteriesMathematical Biosciences31510822310.1016/j.mbs.2019.10822331276682SchwartzNBDomowiczMS2014Chemistry and function of glycosaminoglycans in the nervous systemAdvances in Neurobiology98911510.1007/978-1-4939-1154-7_525151376SorrellJMMahmoodianFSchaferIADavisBCatersonB1990Identification of monoclonal antibodies that recognize novel epitopes in native chondroitin/dermatan sulfate glycosaminoglycan chains: their use in mapping functionally distinct domains of human skinJournal of Histochemistry & Cytochemistry3839340210.1177/38.3.16893381689338SzafronJMBreuerCKWangYHumphreyJD2017Stress Analysis-Driven design of bilayered scaffolds for Tissue-Engineered vascular graftsJournal of Biomechanical Engineering13912100810.1115/1.4037856TACoOaG2017Delayed umbilical cord clamping after birthObstetrics and Gynecology129e5e1010.1097/AOG.0000000000001860Tarnow-MordiWMorrisJKirbyARobledoKAskieLBrownREvansNFinlaysonSFogartyMGebskiVGhadgeAHagueWIsaacsDJefferyMKeechAKluckowMPopatHSebastianLAagaardKBelfortMPammiMAbdel-LatifMReynoldsGAriffSSheikhLChenYColditzPLileyHPritchardMde LucaDde WaalKForderPDuleyLEl-NaggarWGillANewnhamJSimmerKGroomKWestonPGullamJPatelHKohGLuiKMarlowNMorrisSSehgalAWallaceESollRYoungLSweetDWalkerSWatkinsAWrightIOsbornDSimesJAustralian Placental Transfusion Study Collaborative Group2017Delayed versus immediate cord clamping in preterm infantsNew England Journal of Medicine3772445245510.1056/NEJMoa171128129081267WagenseilJEMechamRP2009Vascular extracellular matrix and arterial mechanicsPhysiological Reviews8995798910.1152/physrev.00041.200819584318WightTNMerrileesMJ2004Proteoglycans in atherosclerosis and restenosis: key roles for versicanCirculation Research941158116710.1161/01.RES.0000126921.29919.5115142969YamamuraHZhangMMarkwaldRRMjaatvedtCH1997A heart segmental defect in the anterior-posterior Axis of a transgenic mutant mouseDevelopmental Biology186587210.1006/dbio.1997.85599188753YangWFungTCChianKSChongCK2007Instability of the two-layered thick-walled esophageal model under the external pressure and circular outer boundary conditionJournal of Biomechanics4048149010.1016/j.jbiomech.2006.02.02016677658Appendix 1Detailed methodsHuman tissue
After delivery of the neonate, the umbilical cord was doubly clamped and cut. The time from delivery to cord clamping varied between deliveries and in general ranged from 5 to 30 s. Two additional clamps were placed on the cord after a fetal blood sample was obtained for Rhesus typing, and scissors were used to cut between these two clamps to obtain a segment of umbilical cord for analysis. Umbilical cord samples were fixed in 4% paraformaldehyde for 48 hr at 4°C and embedded in paraffin. All human umbilical cord sections analyzed contained all three vessels and both arteries were imaged in addition to the vein. For microarray analysis of umbilical artery versus vein, human umbilical cords were separately collected as a part of the National Children’s Study (NCS) (UHCMC IRB# 01-11-28). Immediately upon delivery, cords were sectioned into 1-inch segments (for a total of 3 segments per cord at 0 hr) and flash frozen in liquid nitrogen. RNA Later-ICE (Ambion) was used to maintain nucleic acid viability during freeze-thaw of tissue. The umbilical vein and both umbilical arteries were dissected from each segment for homogenization. RNA from homogenized vein and artery tissue was extracted using Qiagen’s RNeasy nucleic acid isolation kit. For microarray analysis of the inner versus outer arterial tunica media, human umbilical arteries were dissected immediately upon neonatal delivery and sectioned into 1-inch segments (for a total of three segments per artery) and their inner and outer tunica media were carefully dissected under a dissecting microscope and flash frozen in liquid nitrogen in Trizol reagent (Ambion). RNA from homogenized arteries was extracted using the chloroform-isopropanol precipitation method.
Histological and immuno-staining
Seven-micron-thick paraffin sections were collected using a Leica RM 2255 microtome and stained with hematoxylin and eosin, Alcian blue, or Masson’s trichrome after deparaffinization. For immunostaining, sections were deparaffinized, and boiled in citrate buffer (10 mM citric acid, 0.05% Tween 20, pH 6.0) for 90 s for antigen retrieval, washed with PBST and blocked in 10% normal goat serum before incubation with the following primary antibodies overnight at 4°C: Cy3-conjugated smooth muscle α-actin (α-SMA) (1:400, Sigma C6198), anti-smooth muscle myosin heavy chain (SMMHC) (1:400 Kamiya Biomedical, MC352), anti-serine20-phosphorylated myosin light chain (pMLC) (Abcam, ab2480 1:200), anti-phospho histone H3 (ser10)(1:200, Millipore, 06–570), anti-chondroitin sulfate (7D4) antibody (Sorrell et al., 1990) (1:200), FITC-conjugated anti-heparan sulfate (10E4) antibody (1:200, US biological H-1890), polyclonal anti-versican (Foulcer et al., 2014) (anti-VC; 1:400), polyclonal anti-versican GAG-β (1:400, Milipore Sigma, AB1033), anti- DPEAAE (versican V0/V1 neo epitope antibody, 1:200, Invitrogen, PA1-1748A), polyclonal anti-aggrecan (1:400, Milipore Sigma, AB1031), anti- NITEGE (aggrecan neo epitope antibody, 1:200, Invitrogen, PA1-1746), rat monoclonal anti-endomucin (1:400, Invitrogen, 14-5851-85), anti-Sox9 (1:200, Milipore Sigma Ab5535). Alexa-488 or Alexa-568 conjugated secondary antibodies against rabbit and mouse IgG, respectively, were used at 1:400 dilution. Vectashield mounting medium (H-1200) contained DAPI for staining nuclei. All images were taken using an Olympus BX51 microscope connected to a Leica DFC 7000T camera using bright field or fluorescence modes. Multi-channel fluorescent images were merged using the NIH Image J software.
Synchrotron-based phase contrast micro-CT
Imaging of arteries and veins from three umbilical cords was performed at the X02DA TOMCAT beamline of the Swiss Light Source at the Paul Scherrer Institute (Villigen, Switzerland). A 4x magnifying objective was used, resulting in a field-of-view of 4.2 × 3.5 mm2 and an effective pixel size of 1.63 × 1.63 μm2. For each scanned vessel, a stack of 1080 tomographic images was acquired. Data analysis was performed using NIH Image J and Amira. Amira allowed for visualization of the vessels from any angle and images were created by combining two different tomographic imaging planes at a 90-degree angle. NIH Image J was used for creating Figure 1—videos 1 and 2.
Microarray analysis of human umbilical cords
NCS samples to evaluate changes in expression in artery versus vein were run on the Affymetrix Hu-Gene U219 microarray Peg-plate; 150 ng of input RNA from each sample was labeled using an Affymetrix 3’ IVT labeling protocol. Samples hybridized to the PEG arrays were washed, stained, and scanned by the Affymetrix Gene Titan. RNA from two of the four cords was also evaluated on the Affymetrix Hu-Gene 1.1 ST Peg-plate microarray, using the whole transcriptome (WT) labeling protocol also starting with 150 ng of input total RNA. The hybridized PEG Arrays were washed, stained, and scanned by the Affymetrix Gene Titan according to standard protocols. RNA (150 ng) from inner and outer TM samples was labeled using Affymetrix’s WT PLUS protocol. Labeled samples were hybridized overnight to Affymetrix Hu-Gene 2.0 ST microarray cartridges. The sample was removed, then the microarray cartridges were washed and stained on the Affymetrix GeneChip Fluidics Station450 and scanned by the Affymetrix GeneChip Scanner 3000. Total RNA was labeled using Affymetrix’s FLASH Tag Protocol. Labeled samples were hybridized overnight to Affymetrix GeneChip miRNA 2.0 Array, which interrogates all the mature human miRNA sequences in miRBase Release 20microRNAs. The sample was then removed and the microarray cartridges were washed and stained on the Affymetrix GeneChip Fluidics Station450 and scanned by the Affymetrix GeneChip Scanner 3000. Gene expression analysis for each microarray study was performed using Affymetrix’s Transcriptome Analysis Console (TAC 4.0) through the RMA-SST sketch algorithm and R version 3.5.2. Fold changes were calculated by an empirical Bayes ANOVA method through the TAC 4.0 software. Parameters for gene expression changes include a p-value≤0.05 and a fold change value ≥1.5 and≤−1.5. Data collected from samples labeled by different labeling protocols, obtained using different scanners or hybridized to different arrays were analyzed as independent data sets.
Additional details of transgenic mice
The Adamts1 transgenic allele used here (referred to as Adamts1-) was generated by Deltagen Inc (San Carlos, CA; Deltagen identifier T1288; MGI:5427602 (B6;129P2-Adamts1 < tm1Dgen>/H;)) by inserting an IRES-lacZ-neomycin resistance gene cassette into intron 1. RT-PCR using PCR primers bridging exon 1 and exon two showed that the insertion eliminated gene expression (Deltagen, unpublished data). The allele was deposited in the MRC Harwell, Frozen Embryo and Sperm Archive (Harwell, UK). Frozen Adamts1+/- embryos harvested at the two-cell stage of development from matings of wild-type C57BL/6 females with hemizygous males at MRC Harwell were obtained under an academic use license signed by the Cleveland Clinic with Deltagen. Frozen embryos were implanted into pseudo-pregnant female recipient mice at the Case Transgenic and Targeting Facility (Cleveland, OH). Subsequently, the Adamts1- allele was crossed into the C57BL/6 strain for at least 10 generations and is maintained in this strain. The Acancmd-Bc allele (referred to here as Acan+/-) was back-crossed to C57BL/6 for over 20 generations at the University of Chicago (Lauing et al., 2014) and subsequently transferred to the Cleveland Clinic Lerner Research Institute. β-Galactosidase staining of Adamts1+/- umbilical cords was done as previously described (McCulloch et al., 2009). Both β-galactosidase staining and genotyping were used to identify Adamts1+/- mice obtained from hemizygous with wild-type matings, whereas PCR genotyping was used to distinguish the three genotypes possibly arising from crosses of Adamts1 or Acan hemizygous animals which were used to generate homozygous embryos.
For genotyping, genomic DNA was isolated from clipped toes between 7–10 days after birth or from embryo tails using 100 μl or 50 μl Direct PCR Tail Lysis reagent, respectively (Viagen, catalog number 102 T) containing 1 μl of proteinase K (Milipore Sigma, catalog number 3115879001) followed by digestion overnight at 55°C. Alternatively, tail DNA was extracted using QuickExtract DNA (Lucigen) at 65°C for 15 min and reaction was stopped by incubation at 100°C for 5 min.
The targeted Adamts1 allele was detected by PCR using forward primer 5' GGGCCAGCTCATTCCTCCCACTCAT 3' and reverse primer 5'GCCATCGGGGTCAGCTTTTCAAATG 3' (generating a 356 bp product) and the wild-type Adamts1 allele was detected using forward primer 5' GGTTGTAGTTTCGCGCTGAGTTTTG3' and reverse primer 5'GCCATCGGGGTCAGCTTTTCAAATG 3' (generating a 189 bp product). Acan genotyping was performed using the following primer pairs: Acancmd forward primer 5' ATCAAGACCCTCAGCTTTTATTAATCTTTA 3' and reverse primer 5' CATAAGATGAGAGGAGATGGTTTAGAGTAT 3' (expected product 811 bp); Acan wild type allele forward primer 5' TCCTATTTACACAAAGTCTGAAATTAATGC 3' and reverse primer 5' GAGAATTGGCTATAGCTGTTTATGACTC 3' (expected product 332 bp).
RNA in situ hybridization
Six-micron-thick paraffin sections were probed with RNAscope probes according to manufacturer’s guidelines. The following probes were used: ACAN (Advanced Cell Diagnostics (ACD) Cat. No. 506841), VCAN-exon 8 (ACD Cat. No. 452241), ADAMTS1 (ACD Cat. No. 524501), ADAMTS4 (ACD Cat. No. 537341), ADAMTS5 (ACD Cat. No. 427611), ADAMTS9 (ACD Cat. No. 445321), Acan (ACD Cat. No. 439101), Vcan-exon 8 (ACD Cat. No. 428321), Adamts1 (ACD Cat. No. 463361), Adamts4 (ACD Cat. No. 497161), Adamts5 (ACD Cat. No. 427621) and Adamts9 (ACD Cat. No. 400441). The probes were detected using RNAscope 2.5 HD Red reagent kits (ACD Cat. No. 322350) essentially as recently described (Mead and Apte, 2020).
Biomechanical characterization of mouse umbilical arteries and veins
Umbilical cords were excised and separated from the placenta from wild-type C57BL/6J mice at embryonic day E18.5 (n = 4). The umbilical arteries and veins were identified by opening the abdomen of the embryo and locating an artery by its connection to the iliac artery and a vein by its connection to the inferior vena cava through the ductus venosus. After separating and cleaning the umbilical arteries and veins from excessive adipose tissue, the intact vessels were cannulated on custom-drawn glass micropipettes, secured with silk sutures at each end, and mounted within a custom computer-controlled biaxial test device designed specifically for testing murine vessels. These cylindrical specimens were then immersed in a Krebs-Ringer bicarbonate solution (Krebs) and oxygenated with 95% O2 and 5% CO2 while maintained at 37°C. The lumen of the umbilical artery closed immediately after separating the umbilical cord from the placenta but was relaxed by acclimation within the testing chamber for 5–15 min at 10 mmHg and wash-out with Krebs solution up to three times. The vessels were then subjected to two isobaric (luminal pressure of 5 mmHg, then 10 mmHg) - axially isometric (fixed specimen-specific in vivo axial stretch) contractions by adding 100 mM KCl to the bath to ensure viability of the SMC. The transmural organization of the vessel wall was monitored during different stages of contraction using an optical coherence tomography (OCT) system having an axial (depth) resolution <7 microns and lateral resolution of 8 microns (Callisto Model, Thorlabs, Newton, NJ).
For the subsequent passive tests, the normal Krebs solution was replaced with a Ca2+-free Krebs solution. The vessels were preconditioned via four cycles of pressurization (artery: 0–40 mmHg and vein: 0–25 mmHg) while held fixed at their individual in vivo axial stretch. Subsequently, the vessels were subjected to a series of seven biaxial testing protocols: cyclic pressurization over ranges noted above at three different fixed values of axial stretch and cyclic axial stretching at four different fixed values of luminal pressure (artery at 10, 20, 30 or 40 mmHg and vein at 1, 2, 10 or 20 mmHg). Data collected online included outer diameter, luminal pressure, axial length, and axial force, which facilitated robust parameter estimation of the biaxial biomechanical behavior (Ferruzzi et al., 2015). Toward this end, we used a validated ‘four-fiber family’ type constitutive relation (see below) that has proved useful in characterizing murine arteries (systemic and pulmonary) and veins.
Note that these biaxial data were used to build a baseline, bilayered cylindrical model for the purposes of parametrically exploring possible effects of different levels of smooth muscle contractility in the outer tunica media, GAG-induced swelling of the inner tunica media, and possible buckling of this innermost layer in silico. Hence, rather than focus on specimen-to-specimen differences, we sought ‘mean’ properties of the normal murine umbilical artery. Data from all seven passive biaxial testing protocols from all four mice were grouped as a single data set and best-fit values of the associated eight material parameters were determined simultaneously by minimizing the sum-of-the-squares differences between predicted and measured pressures and axial forces, as described previously (Ferruzzi et al., 2015). To facilitate a global, rather than local, minimization, we used multiple randomly generated initial guesses for the parameter estimation, accomplished using the MATLAB routine (lsqnonlin function). It is important to note that best-fit parameters in exponential constitutive relations need not be unique, hence what is most important is that together they yield correct values of biaxial stress (verified by comparison to measured values) and predict appropriate levels of material stiffness and stored energy. Finally, it is noted that initial parameter estimation was based on data from a representative specimen rather than all data combined; the subsequent model simulations were similar in both cases, suggesting that the baseline model captured salient features as desired.
Computational modeling of the umbilical arterySwelling and contraction
The traction-free, non-swollen configuration (R,Θ,Z) is treated as the reference with inner radius, interfacial radius, and outer radius denoted A,B,C, respectively. Swelling is accounted for via previously outlined methods (Szafron et al., 2017; Demirkoparan and Pence, 2007), which leads to a residually stressed, traction-free configuration with corresponding material points mapped to A*,B*,C* in (R*,Θ*,Z*). The final loaded configuration, pressurized and axially stretched, is then characterized by a,b,c in (r,θ,z).
Consider a deformation from (R,Θ,Z) to (R*,Θ*,Z*) via the deformation gradient tensor F*=diag(∂R*/∂R,R*/R,Λz*), where volume change is imposed by detF*=ν*=v/V with ν* the ratio of volume v in (R*,Θ*,Z*) to volume V in (R,Θ,Z). With ν*=1, there is no swelling and the vessel is considered to have no residual stresses; in contrast, ν∗>1 (expansion) and ν∗<1 (shrinkage) yields self-equilibrating wall stresses in the absence of external loading. Note that ∂R*/∂R=Rν*/Λz*R*. Further deformation to any loaded configuration (r,θ,z) from the swollen configuration (R*,Θ*,Z*) is then described by FP=diag(∂r/∂R*,r/R*,Λz), where the assumption of incompressibility during transient external loading requires detFP=1, thus ∂r/∂R*=R*/(Λzr). A multiplicative decomposition of the deformations yields F=FPF*=diag(Rν*/λzr,r/R,λz) with λz=Λz*Λz for convenience. The matrix component F11 can also be expressed in terms of the original derivatives, such that (∂r/∂R*)(∂R*/∂R)=Rλzν*/r, which allows us to apply the chain rule and integrate ∫arr∂r=∫ARν*R/λz∂R to find any radial point r within the vessel wall.
The vessel is assumed to be quasi-equilibrated in any state, such that linear momentum balance requires divt=0, where t is the Cauchy stress tensor. Circumferential and axial equilibrium is satisfied identically at each (r,θ,z). Radial equilibrium requires ∂trr/∂R+(trr−tθθ)/r=0. The Cauchy stress is specialized as t=tex-pI with p the Lagrange multiplier enforcing incompressibility during transient loading, I the identity tensor, and tex the 'extra' part of the stress due to deformation and the constitutive response. Integration yieldsP=∫ab(tθθex-trrex)/rdr+∫bc(tθθex-trrex)/rdrwhere P is the transmural pressure across the vessel wall, with P>0 indicating internal pressurization. We also calculate the overall axial load required for overall equilibrium,L=π∫ab2tzzex-tθθex-trrexrdr+π∫bc2tzzex-tθθex-trrexrdr+Pπa2
See Figure 7d. The equilibrium problem is solved iteratively for the loaded inner radius a for each luminal pressure P and axial extension λz.
Constitutively, the extra part of the Cauchy stress can be computed from a stored energy density function W for the vessel, with t=2F∂W/∂CFT/detF-pI and C=FTF the right Cauchy-Green tensor. Due to the microstructure of the umbilical vessels, the GAG-rich inner layer is modeled as a neo-Hookean matrix that can swell (Demirkoparan and Pence, 2007), withW=μ12(tr(C)−3ν∗23)∀r<b,with μ1 a shear modulus for this inner layer. As there is no evidence of collagen with a preferred orientation or smooth muscle cells capable of contraction within the inner layer, it is considered isotropic and passive. Fewer GAGs are present in the outer layer, but we include the possibility of a swellable matrix for illustrative purposes and to provide radial stiffness. The outer layer is then modeled using a modified four-fiber family model for a passive nonlinear stress-stretch behavior and a Rachev-type model for SMC contractility (i.e. active behavior), with a potential functionW=μ22(tr(C)−3ν∗23)+∑α=14c1α4c2α(exp(c2α(λα2−1)2)−1)+Tact(λθ+13(λm−λθ)3(λm−λ0)2)∀r>bwhere μ2 is shear modulus for the outer layer, c1α and c2α are material parameters for each fiber family α=1,2,3,4, λα=sqrt(C∶Mα⨂Mα), Tact is the magnitude of the active stress, λm is the stretch at which contraction is maximum, and λ0 is the stretch at which contraction ceases (Baek et al., 2007). Each fiber family has an orientation vector Mα=sinηαeΘ+cosηαeZ with ηα the fiber angle relative to the axial direction. The fiber families are assumed to lie in the circumferential direction (α=1,η1=90°), the axial direction (α=2,η2=0°), and symmetric diagonal directions about the z-axis with ηα fit from the experimental data (α=3,η3=ηd and α=4,η4=-ηd). Parameter values are given in Table 1 based on the aforementioned nonlinear least squares approach (Ferruzzi et al., 2013).
Bifurcation analysis – basic approach
To examine the potential for unstable equilibria (i.e. bifurcations in the solutions) leading to buckling of the wall, consider an incremental deformation added to the finite deformation (Ogden, 1984) with a notation similar to that previously used to describe bifurcation behaviors in growing elastic solids (Li et al., 2011; Moulton and Goriely, 2011), which is mathematically similar to swelling. Quantities related to the intermediate finite deformation are given as ⋅(0) while those related to the incremental motions are denoted as ⋅(1). The current position x from position x(0) is specified as x=x(0)+ϵu(1) with ϵ≪1 scaling the displacement u(1), which allows the deformation gradient to be written as F=F(0)+ϵH(1)F(0) with F(0)=FPF* the deformation gradient from the reference to the finitely deformed configuration and H(1) the incremental displacement gradient with respect to that configuration. The nominal stress P, defined through t=FP/detF, follows as P=P(0)+ϵP(1). As noted previously (Haughton and Ogden, 1978; Sanft et al., 2019), it is convenient to update the reference configuration to the current configuration yielding P0=P0(0)+ϵP0(1), which, along with considering the Lagrange multiplier as p=p(0)+ϵp(1), allows us to write P0(1)=B:H(1)+p(0)H(1)-p(1)I with B=F0(∂2W/∂F0∂F0)F0 the fourth-order stiffness tensor calculated in the finitely deformed configuration and p(1) the increment in the Lagrange multiplier. Linear momentum balance then requires divP0=0, which is satisfied by the finite deformation, leaving divP0(1)=0 to be resolved. We proceed by assuming a form for the incremental displacement describing buckling as u(1)=[ur,θ,vr,θ,0], with no incremental motion in the axial direction. Displacements in the r and θ directions are not a function of z. The incremental displacement gradient then becomesH(1)=uruθ-vr0vru+vθr0000,where ∙r≡∂∙/∂r and ∙θ≡∂∙/∂θ. The incremental deformation is assumed to be isochoric, requiring trH1=0. As there is no axial dependence in the incremental deformation, the equilibrium equations reduce to a system of two differential equations in u, v, and p(1). These functions are assumed to have sinusoidal forms in the buckled configuration, where u=f(r)cos(nθ), v=g(r)sin(nθ), and p(1)=hrcosnθ with n the buckling mode (i.e. the number of folds in the inner portion of the vessel wall). Using the incompressibility condition, it is possible to rewrite g(r) in terms of f(r), and the two equilibrium equations can be combined to eliminate h(r), yielding a single fourth order, ordinary differential equation in f(r) (Haughton and Ogden, 1978; Sanft et al., 2019) of the formA4f''''+A3f'''+A2f''+A1f'+A0f=0,where coefficients A0-A4 are given below and (∙)'=d(∙)/dr. We assume that the incremental tractions on the inner surface are zero with n∙t1=0, which yields two equations[B1,3f‴+B1,2f″+B1,1f′+B1,0f=0]r=aand[B2,2f″+B2,1f′+B2,0f=0]r=a,with coefficients Bn,m given below. As there is little evidence of buckling in the outer layer, and the Rachev-type contractility model generally yields tensile stresses that would inhibit buckling, we specify that the incremental deformation vanishes at the interface of the two layers with fb=0 and f'b=0 and that the incremental shear traction is zero (Yang et al., 2007), which gives[C1,2f″+C1,1f′=0]r=band[C2,2f″+C2,0f=0]r=b,with coefficients Cn,m given below.
We used the compound matrix method (Haughton and Orr, 1997; Lindsay and Rooney, 1992), a modification of the determinantal method commonly used for linear bifurcation analysis (Haughton and Ogden, 1979), to solve the differential equation numerically. The fourth order equation above was rewritten as a system of four, first order differential equations, y'=Ay, where y=f,f',f'',f'''T and A is the corresponding coefficient matrix. Boundary conditions at the inner surface and interface were similarly re-written as By=0a and Cy=0b, respectively. We define two linearly independent initial conditions at r=a, which can be integrated to r=b to create linearly independent solutions y(1) and y(2) such that y=k1y(1)+k2y(2)=Mk. For the determinantal method, one iterates on Tact until detCMb=0. However, this method can fail for stiff systems, thus we use Laplace expansions to write a new bifurcation condition equivalent to the original with detCM=∑k|Ck|ϕk whereϕ1=y1(1)y1(2)y2(1)y2(2)=1,2,ϕ2=y1(1)y1(2)y3(1)y3(2)=1,3,and similarly, ϕ3=(1,4), ϕ4=(2,3), ϕ5=(2,4), ϕ6=(3,4). We evaluate 𝒞k=|Ck| withC1=|C1,1C2,1C1,2C2,2|=(1,2),C2=|C1,1C2,1C1,3C2,3|=(1,3),and similarly, 𝒞3=(1,4), 𝒞4=(2,3), 𝒞5=(2,4), 𝒞6=(3,4), where(n,m)≡|C1,nC2,nC1,mC2,m|.
To evaluate the new bifurcation condition, we create a system of equations ϕ'=Aϕ and identify the components of ϕ' as, for example,ϕ1′=|y1(1)′y1(2)′y2(1)y2(2)|+|y1(1)y1(2)y2(1)′y2(2)′|=|∑i4A1iyi(1)∑i4A1iyi(2)y2(1)y2(2)|+|y1(1)y1(2)∑i4A2iyi(1)∑i4A2iyi(2)|.
The components of A can thus be conveniently defined in terms of the original components of A (Haughton and Orr, 1997), as listed below. This new system is then integrated from a to b using a fourth-order Runge-Kutta method, and Tact is varied iteratively until the boundary condition at b is satisfied, namely ∑k𝒞kϕkb=0. Loading conditions, including the volume change ν*, luminal pressure P, and axial stretch λz, can be varied parametrically to understand their effects on the critical value of Tact needed to induce buckling. Note, one may also fix the value of Tact and identify the critical value of a different loading variable of interest.
Bifurcation analysis – specific functions
For the fourth order governing differential equation for the incremental displacement:A4f''''+A3f'''+A2f''+A1f'+A0f=0we haveA0=(n2−1)(r2Brθrθ″+rBrθrθ′+(n2−1)∗Brθrθ+n2(Bθθθθ−Brrrr))A1=r((r2Brθrθ″+rBrθrθ′−Brθrθ−n2(Bθθθθ+Brrrr))−n2r(B′θθθθ+B′rrrr))A2=r2(r2Brθrθ″+7rBrθrθ′+5Brθrθ−n2(Bθθθθ+Brrrr))A3=r3(2rBrθrθ′+6Brθrθ)A4=r4Brθrθ
Note: These coefficients include only the non-zero components of B for the considered stored energy density function.
For the fourth order differential equationy'=Aynote thatA=010000100001-A0/A4-A1/A4-A2/A4-A3/A4
For boundary conditions on the governing equation at the inner surface:B1,3f'''+B1,2f''+B1,1f'+B1,0f=0r=awe have,
Finally, for the compound matrix method component matrixA=A11+A22A23A24-A13-A140A32A11+A33A34A120-A14A42A43A11+A440A12A13-A31A210A22+A33A34-A24-A410A21A43A22+A44A230-A41A31-A42A32A33+A44with the components of A given above.
10.7554/eLife.60683.sa1Decision letterDownsKarenReviewing EditorUniversity of Wisconsin-Madison School of Medicine and Public HealthUnited StatesWagenseilJessicaReviewer
In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.
Acceptance summary:
We agree that study of the mature umbilical cord has been neglected - especially lacking is understanding how it prevents fetal blood loss during passage from the birth canal. The ground-breaking analyses described in this manuscript, leading to your unprecedented model of umbilical arterial closure at birth, will provide a wealth of new insight into the biology and biomechanics of one of Placentalia's most important vascular structures.
Decision letter after peer review:
Thank you for submitting your article "Vascular dimorphism ensured by regulated proteoglycan dynamics favors rapid umbilical artery closure at birth" for consideration by eLife. Your article has been reviewed by Didier Stainier as the Senior Editor, a Reviewing Editor, and two reviewers. The following individuals involved in review of your submission have agreed to reveal their identity: Jessica Wagenseil (Reviewer #2).
The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.
We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, we are asking editors to accept without delay manuscripts, like yours, that they judge can stand as eLife papers without additional data, even if they feel that they would make the manuscript stronger. Thus the revisions requested below only address clarity and presentation.
Summary:
A comprehensive and elegant combination of gene/protein expression, cross-species analyses, genetic mutants, and biomechanical testing/computer analysis was used to study a universal but generally neglected biological event common to all Placentalia: rapid umbilical closure at birth. The phenomenon is critical to fetal survival because, as the purveyor of fetal blood to the chorionic bed of the placenta, the artery must rapidly close to prevent ex-sanguination of the fetus as it exits the birth canal. By contrast, the vein carries blood from the chorionic bed to the fetus and thus, at least in this regard, is less significant.
This is a highly significant and universally relevant study to all Placentalia, providing new insight into the cell/developmental biology and biomechanics of one of this group's most important vascular structures. The study has been beautifully executed and generally well presented. Every finding is novel. And now, for the first time, closure of the umbilical cord at birth has an experimental precedent. The authors conclude that evolution has made sure that a healthy placenta permits a healthy transition from fetal to neo-natal life.
Essential revisions:
1) Computational Model
Variability in the experimental data, challenges in testing and fitting material parameters for these vessels, and how that might affect the conclusions of the computational model should be briefly discussed. The authors already have all the data and are using it for the computational model to draw conclusions, but they left out a lot of details for the modeling and did not address how some of the assumptions and fitted parameters used in the model would affect their conclusions.
2) Logic of Presentation
Because the biomechanical testing in Figure 4 assumed similarities between mouse and human umbilical arteries and veins in advance of the confirmation that was ultimately presented in Figure 5 (mouse studies), could the authors reverse the order of presentation, both in the text and in the figures which follow, i.e., place the whole of their (descriptive) mouse data immediately after the large animal analysis (current Figure 3) and before the functional biomechanical testing and computer modeling (current Figure 4)?
3) All Figures:
For all of the Figures involving synchrotron, histological, immunofluorescence, and RNA-ISH, please state in the corresponding legend how many samples were imaged.
4) Figure 1.
a) Given that the human umbilical cord has two arteries and a vein, did the authors ever separate out the arteries for analysis and, if not, why not? Please address this somewhere in the manuscript.
b) Similarly, in the Supplemental methods, "Veins and arteries were dissected...." - please clarify here whether both arteries were dissected.
5) Figure 1—figure supplement 1C,D.
These panels appear to show that the smooth muscle cells (SMC) of both vessels are similarly organized with alternating circumferential and longitudinal layers, but that the major difference between them is fewer layers of SMC in the vein. It is not clear from the text or legend whether the authors conclude this, too - could they clarify their interpretation in the text?
6) Figure 4F.
What do the authors make of the differences in the number of buckles within and between human umbilical cords - statistically significant? Can they say anything about those differences in the other mammals?
7) Figure 5. The mutant analyses:
a) In the text, legends, and figures, the notation is inconsistent for the knockout mouse models: Adamts1-/-, Adamts1 KO, Acan-/-, Acancmd/cmd, Acan mutants, and Acan KO are all used. Please choose a consistent notation for each model.
b) Please provide information on genotyping mutant litters in the Methods/Supplemental Methods, and their ratios at each embryonic day examined, especially as the authors claim that mutants did not show intrauterine growth retardation or death (see Figure 5—figure supplement 1). If possible, please indicate the background resorption level in these strains, which would be evident by having included the genotype of the resorptions.
c) Could the authors group presentation of aggregan and adamts1 mutants rather than intermingle the data within the text? - it was difficult to follow which result correlated with which mutant.
d) Figure 5G. The PHH3 staining examples are not very good. How are they being normalized to calculate a percentage?
8) Figure 4—figure supplement 1.
a) Need SD or SEM.
b) The number of samples used for mechanical testing needs to be included.
c) Please include circumferential and axial stress-strain curves which are directly related to the fitted material parameters used for the modeling.
d) Figure 4—figure supplement 1B, subsection “Differential SMC contraction in the bilayered umbilical arteries and vein”of the text state that the artery has a smaller lumen, citing this panel, but this panel shows the outer diameter, and not the inner one.
e) Figure 4—figure supplement 1C and subsection “Differential SMC contraction in the bilayered umbilical arteries and vein”, text: Please define "distensibility" and "extensibility" as used in the text. At what pressures or axial stretches are you comparing the distensibility and extensibility? How do the axial stretch values in Figure 4—figure supplement 1C compare to the in vivo axial stretches?
9) Figure 5—figure supplement 1.
Please support the important conclusion, subsection “Aggrecan and Adamts1 are necessary for normal umbilical cord morphogenesis” based on this figure that "Neither mutant showed intrauterine growth retardation, and intrauterine death was infrequent, suggesting adequate cord circulation.", with actual measurements, especially as the acan KO mutant in Figure 5—figure supplement 1B appears smaller at E14.5 than its wildtype counterpart - assuming the same magnifications, which should be indicated.
10) Figure 8.
- What are the blue cells? Something other than SMCs?
11) Table 1.
a) As c1 for the diagonal fibers is 2-3 orders of magnitude below the circ and axial fibers, are the diagonal fibers really necessary in the constitutive model?
b) Also, the c2 values are 1-2 orders of magnitude higher than values that the group has published previously for mouse elastic arteries. Can the authors comment on the suitability of the constitutive model for fitting such nonlinear data and differences between the mechanical behavior of umbilical artery/vein and elastic arteries in the mouse?
c) Are the values in Table 1 averages of individual values from multiple arteries, fit from a combination of data from multiple arteries, or representative values from a single artery?
[Editors' note: further revisions were suggested prior to acceptance, as described below.]
Thank you for re-submitting your article "Vascular dimorphism ensured by regulated proteoglycan dynamics favors rapid umbilical artery closure at birth" for re-consideration by eLife. Your revised manuscript has been re-reviewed Didier Stainier as the Senior Editor, a Reviewing Editor, and two reviewers. The following individuals involved in review of your submission have agreed to reveal their identity: Jessica Wagenseil (Reviewer #2).
The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.
We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, we are asking editors to accept without delay manuscripts, like yours, that they judge can stand as eLife papers without additional data, even if they feel that they would make the manuscript stronger. Thus the revisions requested below only address clarity and presentation.
Summary:
In their revised manuscript concerning the mechanism of umbilical arterial closure at birth in Placentalia, Nandadasa et al., have satisfactorily addressed the majority of the reviewers' concerns. However, there remain two major concerns: (1) the mouse mutant analyses, and (2) the number of specimens used per experiment; a small number of minor revisions; and requested changes to the Abstract, in accord with eLife's policies.
Essential revisions:
1) Genetic mutants. The reviewers had requested the following (copied from the previous letter to the authors): (b) Please provide information on genotyping mutant litters in the Materials and methods section/Supplemental methods, and their ratios at each embryonic day examined, especially as the authors claim that mutants did not show intrauterine growth retardation or death (see Figure 5—figure supplement 1). If possible, please indicate the background resorption level in these strains, which would be evident by having included the genotype of the resorptions.
Mouse mutant Adamts-/-. As the authors did not provide their method for genotyping this mutant strain, as requested, more investigation was needed on the part of the reviewers to understand what exactly this strain is to consider why the authors ignored the request.
Background (Oller et al., 2017): The Adamts-/- mutant used in this study was described by Oller et al., 2017 as an insertion of a lacZ-bearing cassette into intron 1 of the gene. According to this previous paper, not only does this insertion reveal where Adamts1 is expressed via staining for ß-galactosidase activity, but in its hemizygous state, the insertion also causes a reduction in both mRNA and protein. In its homozygous state, ß-galactosidase activity is still detectable, but the Adamts1 protein is not (Figure 1a of Oller et al., 2017). Oller et al did not provide details on how the animals were maintained and mated (which they really should have been asked to do, alas), but they did explain how their litters were genotyped, the specific sequence used in those PCR genotyping experiments, and the genotypic ratios of their animals at weaning (Supplemental Figure 1b of Oller et al., 2017).
In the current study, the authors distinguished hemizygotes and homozygotes in the figure panels (e.g., Figure 4C versus the other panels), and wildtype and homozygotes in the others that relate to the mutant analysis, implying that they genotyped this material. However, they ignored the reviewers' procedural request, which is repeated and expanded as follows:
Please provide information on
i) genotyping method used, including the exact DNA sequence for PCR analysis;
ii) genotypic ratios according to gestational day;
iii) the genetic background on which the Adamts animals were maintained (according to Oller et al., it seems to be a B/6 background, but please confirm);
iv) the parental genotypes used to produce the specific genotypes (perhaps hemizygous by wildtype matings produced hemizygous embryos detectable by X-gal staining, whilst homozygous embryos were obtained by crossing hemizygous animals and using PCR genotyping to distinguish the three genotypes? - please confirm/clarify);
v) how gestational age was determined. Were timed matings used? if not timed matings, then how was gestational age determined?;
vi) the protocol used for X-gal staining the hemizygotes.
While Oller et al., 2017 used this transgenic mouse line, they did not create it. Please clarify the specific origin of this mutant mouse strain - that information was impossible to locate on the EMMA site.
It would be most helpful for the reader if the authors would introduce the Adamts mutant in the Results section by summarizing Oller et al.'s results concerning the levels of mRNA versus protein in hemizygotes and homozygotes, as under "Background", above.
Finally, if the authors can, would they comment on whether hemizygotes exhibited foreshortened umbilical cords, too, and did their lengths fall between those of the wildtype and homozygous mutants?
Mouse mutant Acan-/-.
Although the authors provided the genotypic ratios of the Acan-/- mutants as requested by the reviewers (new Figure 4—figure supplement 1 Panel 4C), they did not indicate the genotyping procedure. Please add it to Detailed Methods, to include how the DNA was obtained, and the DNA sequence used to PCR the littermates' DNA.
The mutant allele was originally described by Krueger et al., 1999, but from where did the authors procure this mouse strain?
Litters were obtained at E12.5, E14.5, and E18.5; please indicate how matings were carried out to ascertain the timing of gestation, including parental genotypes that produced the Acan litters.
2) The reviewers had requested the number of specimens (n) for every experiment. The following are still missing:
Figure 1D. n, the number of immunostained specimens?
Figure 2B, line 545. "n=3 umbilical cords" - for each probe?, or for both?
Figure 4—figure supplement 1.
S4b. n = ?
S4d. n = ?
10.7554/eLife.60683.sa2Author response
Summary:
A comprehensive and elegant combination of gene/protein expression, cross-species analyses, genetic mutants, and biomechanical testing/computer analysis was used to study a universal but generally neglected biological event common to all Placentalia: rapid umbilical closure at birth. The phenomenon is critical to fetal survival because, as the purveyor of fetal blood to the chorionic bed of the placenta, the artery must rapidly close to prevent ex-sanguination of the fetus as it exits the birth canal. By contrast, the vein carries blood from the chorionic bed to the fetus and thus, at least in this regard, is less significant.
This is a highly significant and universally relevant study to all Placentalia, providing new insight into the cell/developmental biology and biomechanics of one of this group's most important vascular structures. The study has been beautifully executed and generally well presented. Every finding is novel. And now, for the first time, closure of the umbilical cord at birth has an experimental precedent. The authors conclude that evolution has made sure that a healthy placenta permits a healthy transition from fetal to neo-natal life.
Essential revisions:
1) Computational Model
Variability in the experimental data, challenges in testing and fitting material parameters for these vessels, and how that might affect the conclusions of the computational model should be briefly discussed. The authors already have all the data and are using it for the computational model to draw conclusions, but they left out a lot of details for the modeling and did not address how some of the assumptions and fitted parameters used in the model would affect their conclusions.
Thank you for this important comment. Our primary goal was to understand how the umbilical artery closes at birth, which necessitated computational modeling of swelling, contraction, and buckling. We thus focused on the model, though indeed we needed new data to inform the model. We now provide much more detail on these data and how they were collected. We nevertheless emphasize that we sought a general mechanism, not subject-to-subject differences, hence we used “mean data” to inform the modeling, which was then explored via extensive numerical parametric studies in silico.
We used a custom computer-controlled biaxial testing system designed specifically for testing murine arteries, which has proven highly reliable. We used a nonlinear, anisotropic constitutive relation that we have found to be robust in describing diverse murine arteries (systemic and pulmonary) and veins, a relation that has been validated independently by multiple groups. Best-fit material parameters for the 4-fiber family constitutive model (Table 1) were determined using a standard nonlinear regression approach in MATLAB (lsqnonlin function), where differences in predicted vs. measured pressure-diameter data and force-length data were minimized. Multiple random initial guesses were used to ensure convergence of the nonlinear regression to the same minimum. The primary parameters were necessarily obtained from passive, tensile data, yet a key parameter in this study of buckling was the compressive stiffness. We thus studied parametrically the effects of the associated neoHookean parameter in the inner layer, which is greater in compression due to the increased presence of GAGs identified in the immunoassays. Table 1 reports values from our data analysis and many preliminary simulations.
Computational results were initially presented for a representative umbilical artery sample, but, motivated by the reviewer’s excellent suggestion, we went back and fit simultaneously all of the data from all 4 umbilical artery samples, hence yielding best-fit parameters for the truly mean behavior (which is different from using mean values of the individually determined parameters, which we never do). There were some changes in the individual parameter values (based on the mean data) from those used previously (for a single representative sample), particularly for the one fiber-family parameters (which resolved a concern of the reviewer noted below), but these changes in parameter values did not change any of the conclusions from resulting simulation outputs, suggesting further that the buckling phenomenon occurs across different parameter values and is required for closure.
2) Logic of Presentation
Because the biomechanical testing in Figure 4 assumed similarities between mouse and human umbilical arteries and veins in advance of the confirmation that was ultimately presented in Figure 5 (mouse studies), could the authors reverse the order of presentation, both in the text and in the figures which follow, i.e., place the whole of their (descriptive) mouse data immediately after the large animal analysis (current Figure 3) and before the functional biomechanical testing and computer modeling (current Figure 4)?
We agree with the reviewer’s suggestion and have made the requested changes to both the figures and the text. The mouse umbilical cord data is now presented immediately after the large mammal data followed by computational modeling.
3) All Figures:
For all of the Figures involving synchrotron, histological, immunofluorescence, and RNA-ISH, please state in the corresponding legend how many samples were imaged.
We have added the missing n information to the legend of each figure panel.
4) Figure 1.
a) Given that the human umbilical cord has two arteries and a vein, did the authors ever separate out the arteries for analysis and, if not, why not? Please address this somewhere in the manuscript.
In all our experiments the two arteries of human cords appeared identical and indistinguishable in histology and immunostaining. Since it is not possible to identify a distinction between the arteries (assigning for example in each cord, an artery A or B designation), such a comparison would have little basis. Therefore, we did not dissect the two arteries and study them individually. All human umbilical cord sections analyzed contained three vessels and both arteries were imaged in addition to the vein. We have added this information to the methods section of the manuscript. The only differences observed between the two arteries from an individual cord are the number of folds in the areas analyzed. We have illustrated this information in Figure 7F (cord #12,15,16 and 19).
b) Similarly, in the Supplemental Methods, "Veins and arteries were dissected...." - please clarify here whether both arteries were dissected.
We have updated the supplemental methods section to reflect both arteries were used.
5) Figure 1—figure supplement 1C,D.
These panels appear to show that the smooth muscle cells (SMC) of both vessels are similarly organized with alternating circumferential and longitudinal layers, but that the major difference between them is fewer layers of SMC in the vein. It is not clear from the text or legend whether the authors conclude this, too - could they clarify their interpretation in the text?
We agree with the reviewer’s interpretation. Histologically, the major difference observed between the arteries and the vein was the thickness of the tunica media, with the vein having fewer SMC layers overall, as clarified in the revised text.
6) Figure 4F.
What do the authors make of the differences in the number of buckles within and between human umbilical cords - statistically significant? Can they say anything about those differences in the other mammals?
Our conclusions were limited to the very short length of each vessel analyzed (sectioned) in each umbilical cord. The correlation of the number of buckles and the patency of the vessel should also therefore be limited to the small area we analyzed. i.e. an open artery with fewer folds in the area analyzed for a specific specimen may have an area with more buckles and an occluded lumen in a different region of the cord which we have not analyzed. A future, more focused study analyzing the formation of buckles along the length of the cord using a 3D imaging technique may be necessary for completely understanding the number of buckles needed for driving vessel occlusion. However, from the analysis of the cohort of cords in this study, at least 4 buckles observed in a small segment are sufficient to enable arterial occlusion. The computational modeling predicts 3-7 buckles. Since a large number of cords would be required for statistical conclusions in large mammals, and we were only able to obtain a small number, that too with difficulty, we have not done a statistical analysis on these mammalian cords.
7) Figure 5. The mutant analyses:
a) In the text, legends, and figures, the notation is inconsistent for the knockout mouse models: Adamts1-/-, Adamts1 KO, Acan-/-, Acancmd/cmd, Acan mutants, and Acan KO are all used. Please choose a consistent notation for each model.
We have updated both the text and the figures to consistently use the Adamts1-/- and Acan-/-notations throughout the manuscript.
b) Please provide information on genotyping mutant litters in the Methods/Supplemental Methods, and their ratios at each embryonic day examined, especially as the authors claim that mutants did not show intrauterine growth retardation or death (see Figure 5—figure supplement 1). If possible, please indicate the background resorption level in these strains, which would be evident by having included the genotype of the resorptions.
We have added the observed genotype information as a new figure panel (Figure 4—figure supplement 1C) and rewritten the section of the manuscript better describing the Acan-/- embryos, limiting our conclusions to their umbilical cords. Defective cartilage and impaired skeletal development the Acan-/- embryos was previously extensively characterized. Deficiencies in these processes alter embryo dimensions and we therefore have removed any conclusions or suggestions related to overall growth, and limited the focus to the umbilical cord phenotype. Acan-/- embryos are observed at the expected Mendelian ratio at E18.5 and hence do not die in utero prior to E18.5. We have not observed a higher rate of resorptions of embryos in our crossings in agreement with observations made by others.
In the initial analysis of Acan-/- mice, from a total of 733 offspring, 180 were homozygous (24.6%) as reported in Rittenhouse et al., 1978. The background strain of these mice (C57BL/6J) is reported to have an average litter size of 6.2 pups (Verley et al., 1967) and average resorption sites from embryonic day 11 to term of 1.54 + 0.15 in 3-7 month old mothers and 2.94 + 0.28 in 11-12 month old mothers (cf. Holinka, Tseng and Finch, 1979).
c) Could the authors group presentation of aggregan and adamts1 mutants rather than intermingle the data within the text? - it was difficult to follow which result correlated with which mutant.
We have rearranged this figure and grouped the Acan and Adamts1 data panels (Figure 4F for Adamts1 and Figure 4G for Acan) separately. The manuscript text reflects this change.
d) Figure 5G. The PHH3 staining examples are not very good. How are they being normalized to calculate a percentage?
We enlarged this figure panel and clearly marked pHH3 positive cells with white arrowheads and indicated the vessel lumen using a white dotted line (Figure 4H). The samples were counterstained with DAPI to identify all nuclei. The percentage of pHH3 positive nuclei was determined. At least two sections were stained and quantified from each umbilical cord (a total of 4 umbilical cords for each genotype (16 sections)).
8) Figure 4—figure supplement 1.
As noted above, our primary goal was to determine salient characteristics that drive umbilical artery closure at birth using a (new) computational model via parametric studies. Yet, we needed baseline passive biomechanical properties. Although we tested N=4 umbilical arteries (and N=4 veins), we previously used best-fit material parameters for a single “representative” sample. In the revised manuscript, however, we re-performed all data analysis, now based on a rigorous mean behavior (all pressure-diameter, axial force-length data for all 4 samples were combined into a single large data set and best-fit values were determined). As can be seen from the new Fig 7—figure supplement 2, the model-predicted behavior describes very well the mean responses, noting that the grey regions show standard deviations (not standard errors of the mean) to reveal the full extent of the specimen-to-specimen differences.
a) Need SD or SEM.
Since we informed the model with mean properties, we show the SD as a grey region to enable easy visual comparison of the computed mean against this backdrop.
b) The number of samples used for mechanical testing needs to be included.
Now noted, N=4 umbilical veins and N=4 umbilical arteries were analyzed, now noted.
c) Please include circumferential and axial stress-strain curves which are directly related to the fitted material parameters used for the modeling.
These figures have been added to the supplemental figure.
d) Figure 4—figure supplement 1B, subsection “Differential SMC contraction in the bilayered umbilical arteries and vein”of the text state that the artery has a smaller lumen, citing this panel, but this panel shows the outer diameter, and not the inner one.
Thank you. This has now been corrected to show the inner diameter in Figure 5—figure supplement 1.
e) Figure 4—figure supplement 1C and subsection “Differential SMC contraction in the bilayered umbilical arteries and vein”, text: Please define "distensibility" and "extensibility" as used in the text. At what pressures or axial stretches are you comparing the distensibility and extensibility? How do the axial stretch values in Figure 4—figure supplement 1C compare to the in vivo axial stretches?
Indeed, we needed to be clearer. Unfortunately, there is a clinical definition of “distensibility” that is actually a measure of structural compliance (normalized changes in diameter divided by pulse pressure). Herein, distensibility (circumferential deformation, referring to an enlargement) and extensibility (axial deformation, lengthening) are kinematic measures. Values were computed at the vessel-specific in vivo axial stretch and near physiological pressures (UA: 20 mmHg, UV: 5mmHg).
9) Figure 5—figure supplement 1.
Please support the important conclusion, subsection “Aggrecan and Adamts1 are necessary for normal umbilical cord morphogenesis” based on this figure that "Neither mutant showed intrauterine growth retardation, and intrauterine death was infrequent, suggesting adequate cord circulation.", with actual measurements, especially as the acan KO mutant in Figure 5—figure supplement 1B appears smaller at E14.5 than its wildtype counterpart - assuming the same magnifications, which should be indicated.
Please see response to point 7b above. Both embryos were imaged at the same magnification and we have now added scale bars to this image. We have also limited our conclusions to umbilical cord development and removed any references and conclusions related to growth retardation of these mutants in our study. Acan mutants have a very abnormal skeletal system with short limbs and craniofacial defects as previously characterized, constituting an overall embryo dysmorphology and growth retardation. We observe them at the expected Mendelian ratio at E18.5 just prior to birth and our conclusions from the E14.5 embryos are limited to the reorientation of the umbilical cord SMCs which takes place from E12.5-E14.5.
10) Figure 8.
- What are the blue cells? Something other than SMCs?
The blue cells represent proteoglycan-rich non-contractile SMCs that get redirected centripetally to occlude the lumen. We have modified the cartoon legend to clarify this.
11) Table 1.
a) As c1 for the diagonal fibers is 2-3 orders of magnitude below the circ and axial fibers, are the diagonal fibers really necessary in the constitutive model?
It is well known that best-fit values of material parameters in exponential relations are not unique (with high c1 balancing low c2 and vice versa), hence it is most important to be consistent in the estimation (using random initial guesses, using constrained optimization to ensure non-negative values, using biaxial data, etc.) as we were. It is also important not to ascribe much physiological meaning to individual parameters in phenomenological models, but rather to focus on their collective contributions to calculated stresses, stiffnesses, energy, etc. That said, when re-fitting the data (mean data, not single representative), we found increased c1 values for the diagonal fiber families, whereas the axial family’s value of c1 decreased. The inclusion of all 4 families is, we think, prudent to ensure good fits to account for possible variability in the experimental data and is justified based on prior good fits to diverse murine data.
b) Also, the c2 values are 1-2 orders of magnitude higher than values that the group has published previously for mouse elastic arteries. Can the authors comment on the suitability of the constitutive model for fitting such nonlinear data and differences between the mechanical behavior of umbilical artery/vein and elastic arteries in the mouse?
The magnitude of the c2 values are consistent with those of some past works, cf. Supplemental Table 3 from Bersi et al., 2016 which includes some c2 values even higher than those in this work. While these nonlinear constitutive equations were initially developed for elastic arteries, they have since been used to describe the behavior of pulmonary arteries, veins, and tissue engineered vascular constructs, suggesting that they are a reasonable first approach for understanding the behavior of a new vessel. Furthermore, the key simulations in this work relate to the buckling phenomenon observed experimentally. We sought to determine whether active stress present in an external layer could drive closure and if eventual buckling of a GAG-rich inner layer was necessary for complete occlusion, which were studied parametrically. Using this constitutive approach allowed us to determine the feasibility of such a hypothesis and to understand how changes in volume related to swelling could impact the degree of contractility necessary to cause buckling.
c) Are the values in Table 1 averages of individual values from multiple arteries, fit from a combination of data from multiple arteries, or representative values from a single artery?
The initially presented values were those for a representative sample. We have since re-parameterized for the mean behavior by re-running all estimations. The value of axial stretch was also updated to 1.28
[Editors' note: further revisions were suggested prior to acceptance, as described below.]
In their revised manuscript concerning the mechanism of umbilical arterial closure at birth in Placentalia, Nandadasa et al., have satisfactorily addressed the majority of the reviewers' concerns. However, there remain two major concerns: (1) the mouse mutant analyses, and (2) the number of specimens used per experiment; a small number of minor revisions; and requested changes to the Abstract, in accord with eLife's policies.
Essential revisions:
1) Genetic mutants. The reviewers had requested the following (copied from the previous letter to the authors): (b) Please provide information on genotyping mutant litters in the Materials and methods section/Supplemental methods, and their ratios at each embryonic day examined, especially as the authors claim that mutants did not show intrauterine growth retardation or death (see Figure 5—figure supplement 1). If possible, please indicate the background resorption level in these strains, which would be evident by having included the genotype of the resorptions.
Mouse mutant Adamts-/-. As the authors did not provide their method for genotyping this mutant strain, as requested, more investigation was needed on the part of the reviewers to understand what exactly this strain is to consider why the authors ignored the request.
Background (Oller et al., 2017): The Adamts-/- mutant used in this study was described by Oller et al., 2017 as an insertion of a lacZ-bearing cassette into intron 1 of the gene. According to this previous paper, not only does this insertion reveal where Adamts1 is expressed via staining for ß-galactosidase activity, but in its hemizygous state, the insertion also causes a reduction in both mRNA and protein. In its homozygous state, ß-galactosidase activity is still detectable, but the Adamts1 protein is not (Figure 1a of Oller et al., 2017). Oller et al did not provide details on how the animals were maintained and mated (which they really should have been asked to do, alas), but they did explain how their litters were genotyped, the specific sequence used in those PCR genotyping experiments, and the genotypic ratios of their animals at weaning (Supplemental Figure 1b of Oller et al., 2017).
In the current study, the authors distinguished hemizygotes and homozygotes in the figure panels (e.g., Figure 4C versus the other panels), and wildtype and homozygotes in the others that relate to the mutant analysis, implying that they genotyped this material. However, they ignored the reviewers' procedural request, which is repeated and expanded as follows:
Please provide information on
i) genotyping method used, including the exact DNA sequence for PCR analysis;
This (DNA isolation method, and primer sequences, expected PCR products) is now provided in detailed methods in Appendix 1
ii) genotypic ratios according to gestational day;
This data for both Acan and Adamt1s mutants is in revised Figure 4—figure supplement 1 panel C.
iii) the genetic background on which the Adamts animals were maintained (according to Oller et al., it seems to be a B/6 background, but please confirm);
We maintained them in C57BL/6, as now written in detailed Materials and methods section.
iv) the parental genotypes used to produce the specific genotypes (perhaps hemizygous by wildtype matings produced hemizygous embryos detectable by X-gal staining, whilst homozygous embryos were obtained by crossing hemizygous animals and using PCR genotyping to distinguish the three genotypes? - please confirm/clarify);
Yes, this is correct and added to Appendix 1. Either lacZ staining and genotyping were used to identify hemizygotes obtained from hemizygous X wild-type matings, whereas PCR genotyping was used to distinguish the three genotypes arising from crosses of hemizygous animals, which were used to generate homozygous embryos.
v) how gestational age was determined. Were timed matings used? if not timed matings, then how was gestational age determined?;
Yes, timed matings were used, as specified in the revised Materials and methods section.
vi) the protocol used for X-gal staining the hemizygotes.
We cite one of our previous manuscripts t where the detailed protocol was described.
- While Oller et al., 2017 used this transgenic mouse line, they did not create it. Please clarify the specific origin of this mutant mouse strain - that information was impossible to locate on the EMMA site.
These details are provided in the expanded Appendix 1 subsection “Additional details of transgenic mice”. The details of the mice are no longer listed in EMMA, unfortunately.
- It would be most helpful for the reader if the authors would introduce the Adamts mutant in the Results section by summarizing Oller et al.'s results concerning the levels of mRNA versus protein in hemizygotes and homozygotes, as under "Background", above.
This is now included in the revised results section.
- Finally, if the authors can, would they comment on whether hemizygotes exhibited foreshortened umbilical cords, too, and did their lengths fall between those of the wildtype and homozygous mutants?
We did not measure the lengths of hemizygous cords, but they were visually undistinguishable from wild-type cords.
Mouse mutant Acan-/-.
- Although the authors provided the genotypic ratios of the Acan-/- mutants as requested by the reviewers (new Figure 4—figure supplement 1 Panel 4C), they did not indicate the genotyping procedure. Please add it to Detailed Methods, to include how the DNA was obtained, and the DNA sequence used to PCR the littermates' DNA.
The details of the Acan genotyping are now provided in Appendix 1.
- The mutant allele was originally described by Krueger et al., 1999, but from where did the authors procure this mouse strain?
The colony has long been established in the laboratory of Nancy Schwartz and Miriam Domowicz at the University of Chicago, and mice from that colony were transferred to the Cleveland Clinic Lerner Research Institute. Please see subsection “Additional details of transgenic mice” for details of this allele.
- Litters were obtained at E12.5, E14.5, and E18.5; please indicate how matings were carried out to ascertain the timing of gestation, including parental genotypes that produced the Acan litters.
The homozygous mutants were produced by inter-crossing hemizygous parents. We have specified this in the expanded section in Appendix 1 to explain this as part of this sentence: PCR genotyping was used to distinguish the three genotypes possibly arising from crosses of Adamts1 or Acan hemizygous animals which were used to generate homozygous embryos.
2) The reviewers had requested the number of specimens (n) for every experiment. The following are still missing:
- Figure 1D. n, the number of immunostained specimens?
n=4 cords for each antibody, added to figure legend.
- Figure 2B, line 545. "n=3 umbilical cords" - for each probe?, or for both?
(a) n=3 umbilical cords for each in situ probe
(b) n=4 umbilical cords for each antibody staining
added to figure legend
- Figure 4—figure supplement 1.
S4b. n = ?
n=2 Acan KO at E E12.5 and n=3 for E14.5, added to figure legend.