<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">61083</article-id><article-id pub-id-type="doi">10.7554/eLife.61083</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell Biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Developmental Biology</subject></subj-group></article-categories><title-group><article-title><italic>Drosophila</italic> hedgehog can act as a morphogen in the absence of regulated Ci processing</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-199697"><name><surname>Little</surname><given-names>Jamie C</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/><xref ref-type="fn" rid="pa1">†</xref></contrib><contrib contrib-type="author" id="author-199698"><name><surname>Garcia-Garcia</surname><given-names>Elisa</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/><xref ref-type="fn" rid="pa2">‡</xref></contrib><contrib contrib-type="author" id="author-199699"><name><surname>Sul</surname><given-names>Amanda</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/><xref ref-type="fn" rid="pa3">§</xref></contrib><contrib contrib-type="author" corresp="yes" id="author-14951"><name><surname>Kalderon</surname><given-names>Daniel</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-2149-0673</contrib-id><email>ddk1@columbia.edu</email><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><institution>Department of Biological Sciences, Columbia University</institution><addr-line><named-content content-type="city">New York</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Desplan</surname><given-names>Claude</given-names></name><role>Reviewing Editor</role><aff><institution>New York University</institution><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Banerjee</surname><given-names>Utpal</given-names></name><role>Senior Editor</role><aff><institution>University of California, Los Angeles</institution><country>United States</country></aff></contrib></contrib-group><author-notes><fn fn-type="present-address" id="pa1"><label>†</label><p>Institute of Molecular Life Sciences, University of Zürich, Zürich, Switzerland</p></fn><fn fn-type="present-address" id="pa2"><label>‡</label><p>Max Planck Institute for Plant Breeding Research, Cologne, Germany</p></fn><fn fn-type="present-address" id="pa3"><label>§</label><p>Department of Chemistry, The Scripps Research Institute, La Jolla, United States</p></fn></author-notes><pub-date date-type="publication" publication-format="electronic"><day>21</day><month>10</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e61083</elocation-id><history><date date-type="received" iso-8601-date="2020-07-15"><day>15</day><month>07</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2020-10-20"><day>20</day><month>10</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Little et al</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Little et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-61083-v2.pdf"/><abstract><p>Extracellular Hedgehog (Hh) proteins induce transcriptional changes in target cells by inhibiting the proteolytic processing of full-length <italic>Drosophila</italic> Ci or mammalian Gli proteins to nuclear transcriptional repressors and by activating the full-length Ci or Gli proteins. We used Ci variants expressed at physiological levels to investigate the contributions of these mechanisms to dose-dependent Hh signaling in <italic>Drosophila</italic> wing imaginal discs. Ci variants that cannot be processed supported a normal pattern of graded target gene activation and the development of adults with normal wing morphology, when supplemented by constitutive Ci repressor, showing that Hh can signal normally in the absence of regulated processing. The processing-resistant Ci variants were also significantly activated in the absence of Hh by elimination of Cos2, likely acting through binding the CORD domain of Ci, or PKA, revealing separate inhibitory roles of these two components in addition to their well-established roles in promoting Ci processing.</p></abstract><abstract abstract-type="executive-summary"><title>eLife digest</title><p>Morphogens play a crucial role in determining how cells are organized in developing organisms. These chemical signals act over a wide area, and the amount of signal each cell receives typically initiates a sequence of events that spatially pattern the multiple cells of an organ or tissue. One of the most well-studied groups of morphogens are the hedgehog proteins, which are involved in the development of many animals, ranging from flies to humans.</p><p>In fruit flies, hedgehog proteins kickstart a cascade of molecular changes that switch on a set of 'target' genes. They do this by ultimately altering the activity of a protein called cubitus interruptus, which comes in two lengths: a long version called Ci-155 and a short version called Ci-75. When hedgehog is absent, Ci-155 is kept in an inactive state in the cytoplasm, where it is slowly converted into its shorter form, Ci-75: this repressor protein is then able to access the nucleus, where it switches ‘off’ the target genes. However, when a hedgehog signal is present, the processing of Ci into its shorter form is inhibited. Instead, Ci-155 becomes activated by a separate mechanism that allows the long form protein to enter the nucleus and switch ‘on’ the target genes. But it was unclear whether hedgehog requires both of these mechanisms in order to act as a morphogen and regulate the activity of developmental genes.</p><p>To answer this question, Little et al. mutated the gene for Ci in the embryo of fruit flies, so that the Ci-155 protein could no longer be processed into Ci-75. Examining the developing wings of these flies revealed that the genes targeted by hedgehog are still activated in the correct pattern. In some parts of the wing, Ci-75 is required to switch off specific sets of genes. But when Little et al. blocked these genes, by adding a gene that constantly produces the Ci repressor in the presence or absence of hedgehog, the adult flies still developed normally structured wings. This suggests that hedgehog does not need to regulate the processing of Ci-155 into Ci-75 in order to perform its developmental role.</p><p>Previous work showed that when one of the major mechanisms used by hedgehog to activate Ci-155 is blocked, fruit flies are still able to develop normal wings. Taken together with the findings of Little et al., this suggests that the two mechanisms induced by hedgehog can compensate for each other, and independently regulate the development of the fruit fly wing. These mechanisms, which are also found in humans, have been linked to birth defects and several common types of cancer, and understanding how they work could help the development of new treatments.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>hedgehog</kwd><kwd>signaling</kwd><kwd>Ci</kwd><kwd>morphogen</kwd><kwd>Protein Kinase A</kwd><kwd>costal 2</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>D. melanogaster</italic></kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>RO1 GM041815</award-id><principal-award-recipient><name><surname>Kalderon</surname><given-names>Daniel</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Hedgehog acts as a morphogen by regulating proteolytic processing and activation of full-length Ci/Gli transcriptional effectors but can pattern <italic>Drosophila</italic> wing discs normally in the absence of regulated proteolytic processing.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Hedgehog (Hh) signaling proteins guide development and help maintain adult tissue homeostasis in both invertebrates and vertebrates (<xref ref-type="bibr" rid="bib17">Hui and Angers, 2011</xref>; <xref ref-type="bibr" rid="bib19">Ingham and McMahon, 2001</xref>; <xref ref-type="bibr" rid="bib43">Petrova and Joyner, 2014</xref>). Aberrant Hh protein production, distribution, and responses are common causes of developmental birth defects and cancer, including holoprosencephaly, limb and digit abnormalities, medulloblastoma, and basal cell carcinoma (<xref ref-type="bibr" rid="bib2">Anderson et al., 2012</xref>; <xref ref-type="bibr" rid="bib10">Cortes et al., 2019</xref>; <xref ref-type="bibr" rid="bib38">Ng and Curran, 2011</xref>; <xref ref-type="bibr" rid="bib41">Pak and Segal, 2016</xref>; <xref ref-type="bibr" rid="bib43">Petrova and Joyner, 2014</xref>; <xref ref-type="bibr" rid="bib50">Sasai et al., 2019</xref>). Understanding the basic molecular mechanisms of Hh communication is the first step in combating these various Hh-related disorders. Many conserved Hh components were initially identified in <italic>Drosophila melanogaster</italic> and then found to have a mammalian ortholog, including the key transducing protein Smoothened (Smo), which is now the target of several anticancer drugs (<xref ref-type="bibr" rid="bib10">Cortes et al., 2019</xref>; <xref ref-type="bibr" rid="bib38">Ng and Curran, 2011</xref>; <xref ref-type="bibr" rid="bib41">Pak and Segal, 2016</xref>). There are also differences between <italic>Drosophila</italic> and mammalian Hh signal transduction but neither pathway is fully understood (<xref ref-type="bibr" rid="bib7">Briscoe and Thérond, 2013</xref>; <xref ref-type="bibr" rid="bib16">Huangfu and Anderson, 2006</xref>; <xref ref-type="bibr" rid="bib25">Kong et al., 2019</xref>; <xref ref-type="bibr" rid="bib27">Lee et al., 2016</xref>; <xref ref-type="bibr" rid="bib30">Liu, 2019</xref>). It is therefore important to understand the fundamental molecular mechanisms involved in the pathway in <italic>Drosophila</italic> which is well suited to precise and detailed genetic tests conducted under physiological conditions. Hh signaling depends on a complex set of protein interactions, so it is imperative to investigate mechanisms under conditions of normal stoichiometry of signaling proteins in their normal setting.</p><p>In flies, Hh alters the interactions among a set of core signaling components to elicit the transcriptional induction and de-repression of Hh target genes through Cubitus Interruptus (Ci), the singular transcription factor of the pathway (<xref ref-type="bibr" rid="bib12">Domínguez et al., 1996</xref>; <xref ref-type="bibr" rid="bib34">Méthot and Basler, 2001</xref>; <xref ref-type="bibr" rid="bib65">Xiong et al., 2015</xref>). Notably, Hh can act as a morphogen that signals through Ci to transcribe different Hh target gene products depending on how much ligand is present at the cell membrane. In third instar larval <italic>Drosophila</italic> wing discs, Hh is expressed in posterior compartment cells and Ci is expressed only in anterior cells, so that Hh signals to a band of anterior cells at the anterior-posterior (AP) border with declining strength from posterior to anterior (<xref ref-type="bibr" rid="bib6">Blair, 2003</xref>; <xref ref-type="bibr" rid="bib26">Lawrence and Struhl, 1996</xref>). Within this AP border territory, Ci induces <italic>decapentaplegic</italic> (<italic>dpp</italic>) in a broad region, <italic>patched</italic> (<italic>ptc</italic> or a <italic>ptc-lacZ</italic> transcriptional reporter) in a gradient within a narrower domain, and <italic>engrailed (en</italic>) only in the cells closest to the source of Hh (see Figure 8; <xref ref-type="bibr" rid="bib6">Blair, 2003</xref>; <xref ref-type="bibr" rid="bib61">Vervoort, 2000</xref>). Hh controls Ci activity by regulating the processing, activation, and degradation of full-length Ci (known as Ci-155).</p><p>In the absence of Hh, the ligand-free receptor, Patched (Ptc), actively inhibits the actions of another transmembrane protein Smoothened (Smo), which is present under these conditions at relatively low levels and mainly associated with internal vesicles (<xref ref-type="bibr" rid="bib11">Denef et al., 2000</xref>; <xref ref-type="bibr" rid="bib37">Nakano et al., 2004</xref>; <xref ref-type="bibr" rid="bib57">Strigini and Cohen, 1997</xref>; <xref ref-type="bibr" rid="bib71">Zhao et al., 2007</xref>). Costal2 (Cos2), a kinesin-family protein, complexed to Fused (Fu), acts as a scaffold to bring Protein Kinase A (PKA), Glycogen Synthase Kinase-3 (GSK3), and Casein Kinase-1 (CK1) to C-155 and facilitate phosphorylation of Ci-155 at a series of clustered PKA, CK1 and GSK3 sites (<xref ref-type="bibr" rid="bib48">Ranieri et al., 2014</xref>; <xref ref-type="bibr" rid="bib67">Zhang et al., 2005</xref>). This creates a binding site for Slimb, the substrate recognition component of a Cul1-SCF ubiquitin ligase complex, which promotes Ci-155 ubiquitination and subsequent partial proteolysis (‘processing’) by the proteasome to a repressor form (Ci-75). Ci-75 lacks the C-terminal half of Ci-155, which includes its transcriptional activation domain and an epitope for a monoclonal antibody (2A1) commonly used to detect full-length Ci-155 (<xref ref-type="bibr" rid="bib3">Aza-Blanc et al., 1997</xref>; <xref ref-type="bibr" rid="bib20">Jia et al., 2005</xref>; <xref ref-type="bibr" rid="bib21">Jiang, 2006</xref>; <xref ref-type="bibr" rid="bib56">Smelkinson and Kalderon, 2006</xref>; <xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>). Ci-75 has a critical role in anterior wing disc cells, silencing transcription of <italic>dpp</italic> and <italic>hh</italic> (<xref ref-type="bibr" rid="bib12">Domínguez et al., 1996</xref>).</p><p>Hh binding to Ptc leads to Smo activation in a process that involves Smo phosphorylation by PKA, CK1, and G-protein-coupled receptor kinase 2 (Gprk2), Smo accumulation at the plasma membrane and a change in Smo conformation or oligomerization (<xref ref-type="bibr" rid="bib23">Kalderon, 2008</xref>; <xref ref-type="bibr" rid="bib31">Maier et al., 2014</xref>; <xref ref-type="bibr" rid="bib71">Zhao et al., 2007</xref>). Activation enhances and likely alters the nature of binding of Smo to Cos2-Fu complexes, with two important consequences. First, Ci-155 processing is inhibited, due to titration of Cos2 complexes away from Ci-155 and perhaps also to partial dissociation of PKA, CK1 or GSK3 from Cos2/Fu complexes (<xref ref-type="bibr" rid="bib28">Li et al., 2014</xref>; <xref ref-type="bibr" rid="bib48">Ranieri et al., 2014</xref>; <xref ref-type="bibr" rid="bib67">Zhang et al., 2005</xref>). Second, Cos2-associated Fu molecules are brought together to cross-phosphorylate activation loop residues, leading to full activation of Fu protein kinase activity (<xref ref-type="bibr" rid="bib53">Shi et al., 2011</xref>; <xref ref-type="bibr" rid="bib70">Zhang et al., 2011</xref>; <xref ref-type="bibr" rid="bib73">Zhou and Kalderon, 2011</xref>). Activated Fu protein kinase is critical for the full activation of Ci-155. If Ci-155 processing is blocked but there is no Fu kinase activity, Ci-155 is largely maintained in an inactive cytoplasmic form through direct associations with Suppressor of fused (Su(fu)) and Cos2 (<xref ref-type="bibr" rid="bib14">Forbes et al., 1993</xref>; <xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>; <xref ref-type="bibr" rid="bib45">Préat et al., 1993</xref>). Fu protein associations, but not kinase activity, are required for Ci-155 processing; the role of Fu kinase activity in Ci-155 activation is therefore generally studied in isolation by using point mutations in the kinase domain that only eliminate protein kinase activity and reduce Ci-155 activation (<xref ref-type="bibr" rid="bib58">Thérond et al., 1996</xref>; <xref ref-type="bibr" rid="bib66">Zadorozny et al., 2015</xref>).</p><p>Dose-dependent inhibition of Ci-155 processing at the AP border of wing discs might be expected to lead to a profile of increasing Ci-155 levels from anterior to posterior, with maximal levels immediately adjacent to the posterior compartment. However, Ci-155 levels actually peak near the middle of the AP border region and decline substantially over the posterior half where Hh target gene activation is strongest (<xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>; <xref ref-type="bibr" rid="bib57">Strigini and Cohen, 1997</xref>). This decline is dependent on high pathway activity and is absent, for example, in wing discs lacking Fu kinase activity (<xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>). The decline in Ci-155 levels has generally been attributed to the transcriptional induction of Roadkill (Rdx), also known as Hedgehog-induced BTB protein (Hib), the substrate recognition component of a Cul3 ubiquitin ligase, culminating in the complete proteolytic destruction of ubiquitinylated Ci-155 (<xref ref-type="bibr" rid="bib21">Jiang, 2006</xref>; <xref ref-type="bibr" rid="bib24">Kent et al., 2006</xref>; <xref ref-type="bibr" rid="bib68">Zhang et al., 2006</xref>). Loss of Rdx/Hib was initially reported to increase Ci-155 levels at the AP border (<xref ref-type="bibr" rid="bib24">Kent et al., 2006</xref>; <xref ref-type="bibr" rid="bib68">Zhang et al., 2006</xref>) and Rdx/Hib can target Ci-155 directly (<xref ref-type="bibr" rid="bib69">Zhang et al., 2009</xref>). However, later studies reported that Rdx/Hib can also affect Ci-155 indirectly by modulating Su(fu) levels (<xref ref-type="bibr" rid="bib29">Liu et al., 2014</xref>) and provided evidence that Ci-155 levels in the posterior half of the AP border of wing discs remained low in null Rdx/Hib mutant clones (<xref ref-type="bibr" rid="bib51">Seong et al., 2010</xref>). Moreover, the simple idea that Rdx/Hib-induced Ci-155 degradation serves to limit pathway activity in wing discs has only limited and mixed support (<xref ref-type="bibr" rid="bib24">Kent et al., 2006</xref>; <xref ref-type="bibr" rid="bib51">Seong et al., 2010</xref>; <xref ref-type="bibr" rid="bib52">Seong and Ishii, 2013</xref>; <xref ref-type="bibr" rid="bib68">Zhang et al., 2006</xref>). Thus, the mechanisms and consequences of Hh-promoted Ci-155 reduction at the AP border remain uncertain. One indisputable consequence is that Hh-stimulated Ci-155 reduction obscures direct visualization of the pattern of Hh-inhibited Ci-155 processing at the AP border.</p><p>Ci-155 activator and Ci-75 repressor share the same zinc finger DNA-binding domain and have opposing transcriptional effects, so the concentration of each species is potentially important for all Hh target genes. However, individual target genes have different sensitivities to Ci repressor and activator depending on the arrangement of Ci binding sites and the tonic influence of other transcription factors (<xref ref-type="bibr" rid="bib4">Biehs et al., 2010</xref>; <xref ref-type="bibr" rid="bib34">Méthot and Basler, 2001</xref>; <xref ref-type="bibr" rid="bib36">Müller and Basler, 2000</xref>; <xref ref-type="bibr" rid="bib42">Parker et al., 2011</xref>). For example, repression by Ci is essential to silence <italic>dpp</italic> but not <italic>ptc</italic> or <italic>en</italic> in anterior cells away from the wing disc AP border. It is not clear what exactly are the spatial profiles of Ci-155 processing, Ci-155 activation or Hh-stimulated Ci-155 reduction, to what extent each regulated mechanism contributes independently to Hh morphogen action, or whether these Hh-stimulated changes are inter-dependent. To address these issues, we set out to study how processing-resistant Ci variants affected Ci-155 protein levels and activity.</p><p>The processing of Ci variants in wing discs has been investigated with some success using convenient conditions of non-physiological levels of <italic>GAL4</italic>-responsive <italic>UAS</italic>-driven transgene expression (<xref ref-type="bibr" rid="bib20">Jia et al., 2005</xref>; <xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>). However, we previously found that Ci-155 activation, in contrast to Ci-155 processing, cannot be studied reliably in this way (<xref ref-type="bibr" rid="bib15">Garcia-Garcia et al., 2017</xref>). Specifically, <italic>ci</italic>-null animals are very rarely rescued to adulthood using different combinations of <italic>ci-Gal4</italic> and <italic>UAS-Ci</italic> transgenes at a variety of temperatures, and anterior En expression at the AP border was not rescued in <italic>ci</italic>-null clones by <italic>UAS-Ci</italic> expressed with the commonly used wing disc driver <italic>C765-Gal4</italic>, with transgene expression alone sometimes eliciting a dominant-negative effect on Hh target gene expression (<xref ref-type="bibr" rid="bib15">Garcia-Garcia et al., 2017</xref>). We therefore developed genomic <italic>ci</italic> transgenes (<xref ref-type="bibr" rid="bib15">Garcia-Garcia et al., 2017</xref>) and an efficient CRISPR strategy to directly alter the <italic>ci</italic> gene itself in order to study the full range of variant Ci activities under strictly physiological conditions.</p><p>In this study, we examined several processing-resistant Ci variants and found that Ci-155 protein was elevated to uniformly high levels in anterior wing disc cells away from the AP border, confirming inhibition of Ci-155 processing. At the AP border there was a prominent graded decline of Ci-155 protein from anterior to posterior for those variants fully activated by Hh, providing the clearest image yet of Hh-stimulated effects on Ci-155 levels independent of processing. Remarkably, the pattern and strength of <italic>ptc-lacZ</italic> and En induction in those wing discs was normal. Moreover, processing-resistant Ci variants were also found to support the development of adults with normal wing patterning, provided a constitutive source of Ci repressor was present to suppress ectopic <italic>dpp</italic> expression in anterior cells. Thus, Ci can mediate normal Hh morphogen action in wing discs in the complete absence of regulated processing. We also used processing-resistant Ci variants to study the effects of inhibition of processing on Ci-155 activation by Fu, as well as the potential roles of PKA and Cos2 in regulating Ci-155 activity in isolation from their well-established role in Ci-155 processing. We found that, in the absence of Hh, PKA inhibits Ci activity independent of the phosphorylation sites that regulate processing and that Cos2 inhibits Ci-155 activity, most likely by binding to the CORD region on Ci-155.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Functional transgenes and CRISPR ci alleles</title><p>We developed strategies to study Ci expressed at physiological levels from ‘genomic <italic>ci</italic>’ transgenes (<italic>gCi</italic>) and CRISPR-engineered <italic>ci</italic> alleles (<italic>crCi</italic>). The former strategy used a 16 kb genomic region of <italic>ci</italic> that included upstream and downstream regulatory regions (<xref ref-type="fig" rid="fig1">Figure 1A</xref>) previously used within a second chromosome P-element insertion to rescue <italic>ci</italic> null animals (<xref ref-type="bibr" rid="bib32">Méthot and Basler, 1999</xref>), inserted into an <italic>att</italic> site on the third chromosome (<xref ref-type="bibr" rid="bib15">Garcia-Garcia et al., 2017</xref>). A <italic>gCi-WT</italic> transgene was readily able to rescue homozygous <italic>ci</italic> null (<italic>ci<sup>94</sup></italic>) animals to adulthood, with normal morphology, and behaved almost like a normal <italic>ci</italic> allele but with marginally lower <italic>ci</italic> expression and activity in wing discs (<xref ref-type="fig" rid="fig1">Figure 1C,G</xref>). We created <italic>gCi</italic> variants using this strategy.</p><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Wild-type genomic ci transgene and CRISPR ci alleles are fully functional.</title><p>(<bold>A</bold>) The ‘genomic Ci’ transgene (<italic>gCi</italic>) was derived from a 16 kb genomic region of <italic>ci</italic> cloned into an att-Pacman vector and inserted at <italic>att ZH-86FB</italic> located at 86F on the third chromosome. It includes a 6.7 kb upstream promoter region, exons1-6 (blue boxes), introns (blue line), and 0.7 kb of the 3’UTR. (<bold>A’–A”</bold>) <italic>CRISPR ci</italic> (<italic>crCi</italic>) alleles were generated in two rounds. (<bold>A’</bold>) The first round inserted a mini-white gene (pink box) into the first intron of endogenous <italic>ci</italic> using two guide RNAs (orange) in the first intron and altered PAM sites on the donor template (green star). (<bold>A”</bold>) The second round replaced intron 1 and exons 2–6 (blue lines and boxes) including the mini-white gene; the donor template had mutated PAM sites (purple stars) corresponding to the gRNA4 site, approximately 30 bp outside the mutated PAM site for gRNA1, and in the 3’UTR 5 kb away from gRNA 2, labeled gRNA 3. (<bold>B–E</bold>) Third instar wing discs showing <italic>ptc-lacZ</italic> reporter gene expression, visualized by Beta-galactosidase antibody staining (red), with the posterior edge of AP border expression marked by yellow arrowheads, and (<bold>B’–E’</bold>) full-length Ci-155, visualized by 2A1 antibody staining (gray-scale). Anterior is left and ventral is up. (<bold>B</bold>) Two copies and (<bold>D</bold>) one copy of <italic>crCi-WT</italic>, or (<bold>C</bold>) one copy of <italic>gCi-WT</italic> supported normal patterns of elevated <italic>ptc-lacZ</italic> and Ci-155 at the AP border but (<bold>D, E, I’</bold>) sporadic ectopic posterior <italic>ptc-lacZ</italic> expression (white arrows) was seen whenever a single <italic>ci<sup>94</sup></italic> allele was present, even (<bold>E</bold>) in discs with no synthetic <italic>ci</italic> transgene or allele (<italic>Dp[y<sup>+</sup>]</italic> has wild-type <italic>ci</italic>). (<bold>F–I</bold>) Induction of En (green) at the AP border was detected by using the posterior boundary (yellow dashed line) of <italic>ptc-lacZ</italic> (red) to distinguish anterior (left) from posterior compartment cells, which express En independent of Hh signaling. En induction was normal in the presence of (<bold>F</bold>) two copies of <italic>cr-Ci-WT</italic>, (<bold>H</bold>) one copy of <italic>crCi-WT</italic> or (<bold>I</bold>) one wild-type <italic>ci</italic> allele and (<bold>G</bold>) was slightly reduced in the presence of one copy of <italic>gCi-WT</italic>. Scale bars are (<bold>B–E</bold>) 100 μm and (<bold>F–I</bold>) 40 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig1-v2.tif"/></fig><p>We also created mutant <italic>ci</italic> alleles by using CRISPR in two rounds: in the first round, we put a <italic>mini-white</italic> marker gene in the first intron of <italic>ci</italic> (<xref ref-type="fig" rid="fig1">Figure 1A’</xref>); in the second round, we selected against the <italic>mini-white</italic> gene and introduced our mutation of interest, replacing the DNA between the first intron and the 3’UTR by homologous recombination (<xref ref-type="fig" rid="fig1">Figure 1A”</xref>). A single copy of <italic>crCi-WT</italic> in combination with <italic>ci<sup>94</sup></italic> resulted in efficient development of normal adults and larval wing discs with normal patterns of En, <italic>ptc-lacZ</italic> and Ci-155 expression in the anterior compartment (<xref ref-type="fig" rid="fig1">Figure 1D,H</xref>).</p><p>During these studies, we also became aware of an artifact, whereby low levels of ptc-<italic>lacZ</italic> product were detected sporadically in posterior cells of wing discs when there was a single <italic>ci<sup>94</sup></italic>allele; this occurred in flies with a normal <italic>ci</italic> allele (on the <italic>Dp(y<sup>+</sup>)</italic> ‘balancer’) (<xref ref-type="fig" rid="fig1">Figure 1E</xref>) or with the <italic>crCi-WT</italic> allele (<xref ref-type="fig" rid="fig1">Figure 1D</xref>). The artifact was also seen with <italic>gCi-WT</italic> when <italic>ci<sup>94</sup></italic> was heterozygous (data not shown) but not when <italic>ci<sup>94</sup></italic> was homozygous (<xref ref-type="fig" rid="fig1">Figure 1C</xref>) or when <italic>crCi-WT</italic> was homozygous (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). We sequenced the relevant region of the <italic>ci<sup>94</sup></italic> allele and confirmed that it was the same deletion originally reported (<xref ref-type="bibr" rid="bib32">Méthot and Basler, 1999</xref>; <xref ref-type="bibr" rid="bib54">Slusarski et al., 1995</xref>) and in FlyBase. We also induced homozygous <italic>ci<sup>94</sup></italic> clones (by <italic>FRT</italic>-mediated recombination to remove a second chromosome genomic <italic>ci</italic> transgene) and confirmed that <italic>ci<sup>94</sup></italic> encoded no detectable Ci-155 protein (data not shown). Thus, despite the observed sporadic expression of <italic>ptc-lacZ</italic> in posterior cells in some genetic backgrounds, we are confident that the activity of Ci variants can be assayed in anterior wing disc cells in a null background under physiological conditions using either <italic>crCi</italic> alleles or <italic>gCi</italic> transgenes.</p></sec><sec id="s2-2"><title>Processing-resistant Ci variants have elevated Ci-155 levels in anterior cells</title><p>PKA phosphorylates Ci-155 at amino acids S838, S856, and S892 to create recognition sites for both GSK3 and CK1, which further phosphorylate Ci-155 at a consecutive series of primed phosphorylation sites (<xref ref-type="bibr" rid="bib56">Smelkinson and Kalderon, 2006</xref>; <xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>). The phosphorylation series creates a binding site for Slimb that includes the core peptide pSpTYYGpS<sub>849</sub>MQpS, spanning residues 844–852. Ci-S849A lacks the last CK1 target site initially primed by PKA phosphorylation of S838 and Ci-P(1-3)A has alterations to all three PKA sites (S838A, S856A, and S892A). Ci fragments with those alterations showed complete loss of Slimb binding in vitro after phosphorylation by PKA, CK1 and GSK3, while <italic>UAS-Ci</italic> transgene products with those changes showed no processing in wing discs, judged by a sensitive assay of repressor function in posterior compartment wing disc cells (<xref ref-type="bibr" rid="bib56">Smelkinson and Kalderon, 2006</xref>; <xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>). The activity of these proteins has not previously been measured under physiological conditions. We therefore used <italic>ci</italic> alleles with those alterations to determine how loss of processing affects Ci protein levels and activity at normal physiological levels.</p><p>The wing discs of animals with <italic>crCi-S849A</italic> or <italic>crCi-P(1-3)A</italic> in combination with <italic>ci<sup>94</sup></italic> had expanded anterior regions (<xref ref-type="fig" rid="fig2">Figure 2A–D</xref>), as expected because Ci-75 repressor, normally produced from Ci-155 processing, is required to silence <italic>dpp</italic> expression in anterior cells and ectopic anterior Dpp induces anterior growth (<xref ref-type="bibr" rid="bib32">Méthot and Basler, 1999</xref>). We also found that these wing discs had strongly elevated Ci-155 levels throughout the anterior, indicating that full-length Ci-155 was not being processed in the absence of the Hh signal, as expected (<xref ref-type="fig" rid="fig2">Figure 2A–D</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A–D,G,H</xref>).</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Processing-resistant Ci variants reveal the gradients of Hh-stimulated Ci-155 degradation and Hh inhibition of Ci-155 processing.</title><p>(<bold>A–J</bold>) <italic>ptc-lacZ</italic> (red) and (<bold>A’–J’</bold>) Ci-155 (gray-scale) in wing discs with one copy of the indicated <italic>crCi</italic> alleles (with <italic>ci<sup>94</sup></italic>) at (<bold>A–F</bold>) low (20x objective) and (<bold>G–J</bold>) high (63x objective) magnification, with AP boundary (dotted yellow line at posterior <italic>ptc-lacZ</italic> boundary). Scale bars are (<bold>A–F</bold>) 100 μm and (<bold>G–J</bold>) 40 μm. (<bold>G”–J”</bold>) Intensity profiles for <italic>ptc-lacZ</italic> (red) and Ci-155 (black) from anterior (left) to posterior. Vertical lines indicate <italic>ptc-lacZ</italic> peak (green), initial rise (orange) and 50% increase to peak (brown). Profiles are from two wing discs for <italic>crCi-Δ1270–1370</italic> and three discs for all other samples, aligned and measured as described in Materials and methods. Note that the green line corresponding to maximal <italic>ptc-lacZ</italic> effectively represents the AP compartment boundary. The profile of <italic>ptc-lacZ</italic> posterior to that location does not decline precipitously but the decline is not informative (it likely results in part because the columnar cells are not uniformly shaped, so that the measured z-sections include portions of anterior and posterior cells). Territory posterior to the <italic>ptc-lacZ</italic> peak has yellow shading in (<bold>G”–J”</bold>) and (<bold>K, L</bold>) to indicate that it does not contain useful information. The profiles of <italic>ptc-lacZ</italic> and Ci-155 that report responses to Hh are in the territory anterior to the <italic>ptc-lacZ</italic> peak. (<bold>K</bold>) Normalized Ci-155 profiles for indicated <italic>crCi</italic> alleles derived from G’-J’ but with a smoothing function that calculates average intensity for five successive locations centered on each x-axis location. Arrows indicated locations of <italic>ptc-lacZ</italic> initial rise, 50% increase and peak for <italic>crCi-WT</italic> discs. (<bold>L</bold>) <italic>ptc-lacZ</italic> (red) and Ci-155 (black) smoothened profiles for <italic>crCi-WT</italic>, with red guide lines for locations of initial rise, 50% increase and peak <italic>ptc-lacZ</italic>. The difference between the average Ci-155 intensity for Ci-P(1-3)A and Ci-S849A at each point along the x-axis was subtracted from the maximum Ci-155 intensity for those genotypes (observed in cells anterior to the AP border) to calculate values for Hh-stimulated Ci-155 reduction. These values were added to the Ci-WT Ci-155 profile at each location to produce the blue curve, representing Ci-155 levels in the absence of Hh-stimulated reduction. Blue guide lines show the locations where inferred Ci-155 processing is first inhibited, 50% inhibited, and fully inhibited. See also <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref> and <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>.</p><p> <supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Numerical data for graphs in <xref ref-type="fig" rid="fig2">Figure 2</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-61083-fig2-data1-v2.xlsx"/></supplementary-material> </p><p> <supplementary-material id="fig2sdata2"><label>Figure 2—source data 2.</label><caption><title>Numerical data for graphs In <xref ref-type="fig" rid="fig2">Figure 2</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-61083-fig2-data2-v2.xlsx"/></supplementary-material> </p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Loss of Hib binding sites does not greatly affect Ci-155 activity or Hh-stimulated proteolysis.</title><p>(<bold>A–F</bold>) <italic>ptc-lacZ</italic> (red) and Ci-155 (black) intensity profiles for wing discs expressing one copy of the designated <italic>ci</italic> transgene or alleles from <xref ref-type="fig" rid="fig2">Figure 2A–F</xref>. Profiles are from three wing discs for all samples, aligned and measured as described in Materials and methods. (<bold>G–K</bold>) <italic>ptc-lacZ</italic> (red) and (<bold>G’–K’</bold>) Ci-155 (gray-scale) in wing discs with one copy of the indicated <italic>crCi</italic> alleles (with <italic>ci<sup>94</sup></italic>) and (<bold>J, K</bold>) homozygous loss of Su(fu) at high (63x objective) magnification, with AP boundary (dashed yellow line at posterior <italic>ptc-lacZ</italic> boundary). Scale bars are (<bold>G–K</bold>) 40 μm. (<bold>L, M</bold>) Intensity profiles for (<bold>L</bold>) Ci-155 and (<bold>M</bold>) <italic>ptc-lacZ</italic> for <italic>crCi-WT</italic> and <italic>crCi-S3-5</italic> in the presence (black and red, respectively) or absence (gray and green, respectively) of Su(fu). Arrows in (<bold>L</bold>) indicate the locations of <italic>ptc-lacZ</italic> initial rise (orange), 50% increase (brown) and peak (green) for <italic>crCi-WT</italic> discs. Note that the green arrow corresponding to maximal <italic>ptc-lacZ</italic> effectively represents the AP compartment boundary. Thus, the profiles of <italic>ptc-lacZ</italic> and Ci-155 that report responses to Hh are in the territory anterior to the <italic>ptc-lacZ</italic> peak; territory posterior to the <italic>ptc-lacZ</italic> peak has yellow shading to indicate that it does not contain useful information. (<bold>N, O</bold>) Anterior En (green) induction, revealed by <italic>ptc-lacZ</italic> (red) marking of the AP boundary (yellow line) extended further anterior for (<bold>N</bold>) <italic>crCi-WT</italic> than (<bold>O</bold>) <italic>crCi-S3-5</italic>. Scale bars 40 μm. (<bold>P</bold>) <italic>ptc-lacZ</italic> intensity profiles (from <xref ref-type="fig" rid="fig2">Figure 2G”–J”</xref>) for <italic>crCi-P(1-3)A</italic> (green), <italic>crCi-S849A</italic> (red) and <italic>crCi-WT</italic> (black) were overlapping, while <italic>ptc-lacZ</italic> induction was much lower for <italic>crCi-Δ1270–1370</italic> (gray).</p><p> <supplementary-material id="fig2s1sdata1"><label>Figure 2—figure supplement 1—source data 1.</label><caption><title>Numerical data for graphs in <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-61083-fig2-figsupp1-data1-v2.xlsx"/></supplementary-material> </p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig2-figsupp1-v2.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Processing-resistant Ci-155 induces ectopic dpp expression and anterior disc expansions are suppressed by adding a constitutive Ci repressor.</title><p>(<bold>A, B</bold>) Wing discs with <italic>gCi-S849A</italic> and no other source of functional Ci (<bold>B</bold>) induced ectopic anterior <italic>dpp-lacZ</italic> (gray-scale) in addition to the AP border stripe but (<bold>A</bold>) ectopic <italic>dpp-lacZ</italic> expression is suppressed by a wild-type <italic>ci</italic> allele (on the <italic>Dp[y<sup>+</sup>]</italic> chromosome). (<bold>C, D</bold>) Wing discs with one copy of (<bold>C</bold>) <italic>gCi-WT</italic> or (<bold>D</bold>) <italic>gCi-S849A</italic> have similar expression of <italic>ptc-lacZ</italic> (red) confined to the AP border (at a lower level than in wing discs without <italic>ci<sup>Ce</sup></italic>) and normal morphology in the presence of a <italic>ci</italic> allele that produces constitutive Ci repressor <italic>(ci<sup>Ce</sup>)</italic>. 2A1 antibody staining (gray-scale) is high throughout the anterior in both cases because the <italic>ci<sup>Ce</sup></italic> product includes the 2A1 epitope and does not undergo regulated processing. (<bold>E</bold>) Wing discs with anterior clones (GFP, green, yellow arrows) that have lost a second chromosome <italic>gCi</italic> transgene, leaving one copy of the <italic>crCi</italic> allele as a source of Ci. <italic>ptc-lacZ</italic> was not detected in clones expressing Ci∆1270–1370 (arrows), in contrast to the AP border (arrowheads). (<bold>F</bold>) Anterior En was much reduced for Ci∆1270–1370 in wing discs expressing one copy of the <italic>crCi</italic> allele as the only source of Ci. Scale bars (<bold>A–D</bold>) 100 μm and (<bold>E, F</bold>) 40 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig2-figsupp2-v2.tif"/></fig></fig-group></sec><sec id="s2-3"><title>Processing-resistant Ci variants reveal the pattern of Hh-stimulated Ci-155 reduction at the AP border</title><p>Although normal wing discs have a clear stripe of elevated Ci-155 at the AP border relative to anterior cells (<xref ref-type="fig" rid="fig2">Figure 2A</xref>), Ci-155 levels actually decline over the posterior half of the AP border (<xref ref-type="fig" rid="fig2">Figure 2G</xref>) in a manner that depends on strong activation of the Hh pathway (<xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>; <xref ref-type="bibr" rid="bib57">Strigini and Cohen, 1997</xref>). Although Ci-155 protein levels were strongly elevated compared to normal for Ci-S849A and Ci-P(1-3)A in anterior cells, there was a sharp decline toward the posterior of AP border territory (<xref ref-type="fig" rid="fig2">Figure 2H,I</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A–D,G,H</xref>). This profile represents the gradient of Hh-stimulated Ci-155 loss that has generally been attributed to full degradation. It has not previously been seen in isolation because it is normally super-imposed on an unknown profile due to inhibition of Ci processing for wild-type Ci (<xref ref-type="fig" rid="fig2">Figure 2K</xref>). Moreover, if the observed pattern of Ci-155 reduction is the same for wild-type Ci (see later), we can subtract this profile from the observed Ci-155 profile of wild-type Ci to deduce a profile of wild-type Ci-155 processing (<xref ref-type="fig" rid="fig2">Figure 2L</xref>). The result shows that the inhibition of Ci-155 processing is graded, with a spatial profile broadly similar to that of <italic>ptc-lacZ</italic> activation, but with a slightly higher sensitivity to low levels of Hh (<xref ref-type="fig" rid="fig2">Figure 2L</xref>). Thus, comparison of the Ci-155 profiles of wild-type and processing-resistant variants provided the best evidence to date of the spatial patterns of graded inhibition by Hh of Ci-155 processing (<xref ref-type="fig" rid="fig2">Figure 2L</xref>) and of graded, Hh-promoted Ci-155 loss at the AP border (<xref ref-type="fig" rid="fig2">Figure 2H,I,K</xref>).</p><p>We also created a <italic>ci</italic> allele, Ci∆1270–1370, resembling a C-terminal deletion variant that had previously been found not to undergo processing in assays using cultured cells and <italic>UAS-Ci</italic> transgenes in wing discs (<xref ref-type="bibr" rid="bib64">Wang and Price, 2008</xref>; <xref ref-type="bibr" rid="bib72">Zhou and Kalderon, 2010</xref>). Ci∆1270–1370 also had uniformly elevated Ci levels in anterior wing disc cells, consistent with a lack of processing (<xref ref-type="fig" rid="fig2">Figure 2E,J</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1E</xref>). However, unlike Ci-S849A and Ci-P(1-3)A, this Ci variant induced <italic>ptc-lacZ</italic> and En only weakly at the AP border (<xref ref-type="fig" rid="fig2">Figure 2A–E,G–J</xref>; <xref ref-type="fig" rid="fig3">Figure 3A–C</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1P</xref>; <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2E</xref>). There was also no decline of Ci-155 protein within AP territory (<xref ref-type="fig" rid="fig2">Figure 2J,K</xref>), consistent with prior evidence that Hh-stimulated Ci-155 reduction, visualized clearly with the other processing-resistant Ci variants, is only observed at high levels of Hh signaling.</p><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Processing-resistant Ci variants support normal Hh signaling and wing patterning (<bold>A–C</bold>) Wing discs with one copy of indicated <italic>crCi</italic> alleles.</title><p><italic>ptc-lacZ</italic> (red) indicates the AP compartment boundary (yellow line) to reveal induction of the high-level Hh target gene En (green) in anterior cells at the AP border. (<bold>D–F</bold>) Wing discs with anterior clones (GFP, green, yellow arrows) that have lost a second chromosome <italic>gCi</italic> transgene, leaving one copy of the indicated <italic>crCi</italic> alleles as a source of Ci. (<bold>D’–F’</bold>) Little (<bold>E’</bold>) or no (<bold>D’, F’</bold>) <italic>ptc-lacZ</italic> induction was observed in the clones (arrows) relative to the AP border (arrowheads). Scale bars are (<bold>A–F</bold>) 40 μm. (<bold>G–L</bold>) Wings from adult flies with the indicated <italic>ci</italic> transgenes and alleles (<italic>ci<sup>Ce</sup></italic> encodes a constitutive repressor). The spacing between veins 3 and 4 is (<bold>J–L</bold>) normal for two copies of WT or S849A <italic>ci</italic> alleles and (<bold>G–I</bold>) similarly reduced for one copy of WT or S849A alleles. At least five high-quality mounted wings were examined for each genotype. Scale bars are (<bold>G–I</bold>) 500 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig3-v2.tif"/></fig></sec><sec id="s2-4"><title>Hh-promoted Ci-155 reduction is not eliminated by altering major Rdx/Hib-binding sites</title><p>To study Hh-promoted Ci-155 reduction further we created an allele encoding a Ci variant with compromised Rdx/Hib binding. Rdx/Hib binds to Ci-155 through multiple sites; altering three principal binding regions (designated S3,4,5 in the cited study) through clustered point mutations rendered the altered Ci-155 (‘Ci-S3-5’) largely insensitive to Rdx/Hib in a tissue culture assay (<xref ref-type="bibr" rid="bib69">Zhang et al., 2009</xref>). We found that animals expressing one copy of <italic>crCi-S3-5</italic> (in combination with <italic>ci<sup>94</sup></italic>) developed efficiently into adults with normally patterned wings (data not shown). In larval wing discs, the peak of <italic>ptc-lacZ</italic> expression was slightly elevated at the AP border compared to normal but the domain of induction of En (a high-level Hh target) was not expanded (<xref ref-type="fig" rid="fig2">Figure 2F</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1F,I,M–O</xref>). The Ci-155 profile included low anterior levels, suggesting normal processing, and declined in the posterior regions of the AP border much like wild-type Ci-155, showing that Hh-stimulated Ci-155 reduction remained robust (<xref ref-type="fig" rid="fig2">Figure 2F</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1I,L</xref>). The properties of Ci-S3-5 suggest that direct action of Rdx/Hib on Ci-155 does not account for a significant fraction of the reduction of Ci-155 stimulated by the highest levels of Hh signaling. Previous studies have not specifically tested only the direct effects of Rdx/Hib on Ci-155 in wing discs; some studies found that elimination or reduction of Rdx/Hib activity increased Ci-155 levels (<xref ref-type="bibr" rid="bib24">Kent et al., 2006</xref>; <xref ref-type="bibr" rid="bib68">Zhang et al., 2006</xref>), while others found no change in Ci-155 levels in the posterior half of the AP border region (<xref ref-type="bibr" rid="bib51">Seong et al., 2010</xref>; <xref ref-type="bibr" rid="bib52">Seong and Ishii, 2013</xref>).</p></sec><sec id="s2-5"><title>Su(fu) is involved in Hh-promoted Ci-155 reduction at the AP border</title><p>Suppressor of fused (Su(fu)) may participate in the Hh-stimulated reduction of Ci-155 at the AP border, potentially in more than one way. It has been found that Rdx/Hib indirectly reduces Su(fu) protein levels at the AP border (<xref ref-type="bibr" rid="bib29">Liu et al., 2014</xref>) and it has been suggested that Su(fu) competes with Rdx/Hib for Ci-155 binding (<xref ref-type="bibr" rid="bib68">Zhang et al., 2006</xref>). It has also been shown that loss of Su(fu) leads to greatly reduced Ci-155 levels, presumed to be due to enhanced degradation of Su(fu)-free Ci-155, throughout the wing disc (<xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>) and it has been conjectured that Hh may activate Ci-155 in part through Su(fu) dissociation from Ci-155, as suggested by studies of Gli activation (<xref ref-type="bibr" rid="bib18">Humke et al., 2010</xref>; <xref ref-type="bibr" rid="bib27">Lee et al., 2016</xref>; <xref ref-type="bibr" rid="bib59">Tukachinsky et al., 2010</xref>).</p><p>We examined Ci-155 AP border profiles for wild-type Ci and Ci-S3-5 in the absence of Su(fu). The two profiles were extremely similar; Ci-155 levels appeared to peak at, or very close to the AP compartment boundary, suggesting little or no Hh-stimulated loss (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1J–L</xref>). The results are consistent with the hypothesis that Su(fu) is a key factor in the regulation of Hh-stimulated Ci-155 reduction at the AP border. This role of Su(fu) was apparent even in the absence of normal Rdx/Hib binding to Ci-155, suggesting that Su(fu) is not acting principally by competing with Rdx/Hib for Ci-155 binding.</p></sec><sec id="s2-6"><title>Processing-resistant Ci variants have normal activity at the AP border</title><p>Remarkably, the pattern of En and <italic>ptc-lacZ</italic> induction at the AP border was normal for Ci-S849A and Ci-P(1-3)A (<xref ref-type="fig" rid="fig3">Figure 3A–C</xref>; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1P</xref>), showing that Ci-155 processing is not essential for dose-dependent induction of these Hh target genes. The unchanged profile of pathway activity suggests that the profile of pathway-induced Ci-155 reduction is also likely to be the same for wild-type Ci and processing-resistant Ci variants, supporting the validity of using the latter profile to deduce the processing pattern of wild-type Ci-155 (<xref ref-type="fig" rid="fig2">Figure 2L</xref>).</p><p>Ci-S849A and Ci-P(1-3A) wing discs expressed <italic>dpp</italic> ectopically in anterior cells, as expected from the absence of Ci-75 repressor (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2A,B</xref>). The expanded anterior regions of these wing discs are likely responsible for the failure to recover adults expressing only processing-resistant Ci variants, precluding analysis of adult wing patterning. The addition of a <italic>ci<sup>Ce</sup></italic> allele, which encodes a constitutive repressor form of Ci (and no activator) (<xref ref-type="bibr" rid="bib32">Méthot and Basler, 1999</xref>; <xref ref-type="bibr" rid="bib54">Slusarski et al., 1995</xref>), restored normal wing disc morphology without significantly affecting <italic>ptc-lacZ</italic> expression at the AP border (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C,D</xref>) and allowed recovery of adults.</p><p>Normal wing morphology depends on long-range patterning elicited by the central stripe of Hh-induced Dpp and on creation of a central inter-vein region between veins 3 and 4 by stronger Hh signaling, sufficient to induce the transcription factor Collier, also known as Knot (<xref ref-type="bibr" rid="bib35">Mohler et al., 2000</xref>; <xref ref-type="bibr" rid="bib61">Vervoort, 2000</xref>; <xref ref-type="bibr" rid="bib60">Vervoort et al., 1999</xref>). The adult wing phenotypes of animals with one copy of <italic>gCi-WT</italic> or <italic>gCi-S849A</italic> in a <italic>ci<sup>94</sup></italic>/<italic>ci<sup>Ce</sup></italic> background were similar to each other, with a consistent moderate pinching between veins 3 and 4 (<xref ref-type="fig" rid="fig3">Figure 3G,H</xref>), although some animals with <italic>gCi-S849A</italic> also showed a greater narrowing of the inter-vein region (<xref ref-type="fig" rid="fig3">Figure 3I</xref>). We then tested the activity of a <italic>gCi</italic> transgene together with a <italic>crCi</italic> allele in trans to <italic>ci<sup>Ce</sup></italic>. We found that wing morphology was absolutely normal for flies with both <italic>gCi</italic> and <italic>crCi</italic> encoded wild-type Ci or when both encoded processing-resistant Ci-S849A (<xref ref-type="fig" rid="fig3">Figure 3J–L</xref>). Hence, we conclude that Hh can fulfill its normal morphogenetic function, culminating in a normally patterned wing in the complete absence of regulated Ci-155 processing.</p></sec><sec id="s2-7"><title>Dependence of Ci-155 activity induced by Fused kinase on inhibition of Ci-155 processing</title><p>Fu can be activated synthetically in the absence of Hh stimulation by overexpression of Fu variants with either a membrane-targeting tag (GAP-Fu) or acidic residue replacements of phosphorylation sites key to normal activation (Fu-EE) (<xref ref-type="bibr" rid="bib9">Claret et al., 2007</xref>; <xref ref-type="bibr" rid="bib73">Zhou and Kalderon, 2011</xref>). Activated Fu can partially activate Smo (<xref ref-type="bibr" rid="bib9">Claret et al., 2007</xref>; <xref ref-type="bibr" rid="bib49">Sanial et al., 2017</xref>) but direct downstream, Smo-independent actions can be measured by assaying responses in <italic>smo</italic> mutant anterior clones expressing Fu-EE or GAP-Fu. Previously, such experiments showed that activated Fu alone was sufficient to elicit strong Hh target gene induction, suggesting that Ci-155 activation can be effective even without the normal inhibition of processing that occurs at the AP border (<xref ref-type="bibr" rid="bib73">Zhou and Kalderon, 2011</xref>). Fu kinase activity is not required for Hh to block Ci-155 processing at the AP border (<xref ref-type="bibr" rid="bib1">Alves et al., 1998</xref>; <xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>; <xref ref-type="bibr" rid="bib66">Zadorozny et al., 2015</xref>). Nevertheless, synthetically activated Fu was observed to increase Ci-155 levels in anterior clones and further tests suggested this likely resulted from partial inhibition of Ci-155 processing mediated by Cos2 phosphorylation (<xref ref-type="bibr" rid="bib73">Zhou and Kalderon, 2011</xref>).</p><p>To clarify the dependence of Ci-155 activation by Fu on Ci-155 processing inhibition we compared the activities of wild-type and processing-resistant Ci variants in <italic>smo</italic> mutant clones expressing activated GAP-Fu. We found that Ci-S849A or Ci∆1270–1370, provided by a single <italic>crCi</italic> allele in trans to <italic>ci<sup>94</sup></italic>, mediated <italic>ptc-lacZ</italic> induction in anterior <italic>smo GAP-Fu</italic> clones to the same level as at the AP border, whereas induction mediated by a single wild-type <italic>crCi</italic> allele was much lower (about 50%) (<xref ref-type="fig" rid="fig4">Figure 4A–D,J</xref>). In each case, the activity in clones was compared to the AP border of the same wing discs and reflects the activity of the same source of Ci. Similar results were seen in GAP-Fu clones that retained a functional <italic>smo</italic> allele, with <italic>ptc-lacZ</italic> induction of the three processing-resistant variants (Ci-S849A, Ci-P(1-3)A, and Ci∆1270–1370) greatly exceeding that of wild-type Ci (<xref ref-type="fig" rid="fig4">Figure 4F–I,K</xref>). Thus, Hh target gene induction by Fu kinase alone was quite weak in the presence of a single wild-type <italic>ci</italic> allele and was substantially increased if Ci-155 processing was also inhibited. The observed increase could in principle be due to an increased supply of Ci-155 or loss of Ci-75 repressor, or both. When slightly lower levels of wild-type Ci protein were provided by a single <italic>gCi</italic> transgene instead of a <italic>cr-Ci</italic> allele, GAP-Fu induced significantly lower levels of <italic>ptc-lacZ</italic> (<xref ref-type="fig" rid="fig4">Figure 4J</xref>), suggesting that the supply of Ci-155 is a key factor. Thus, producing a robust supply of Ci-155 that is not substantially diminished by processing to Ci-75 is important for Fu to elicit high Ci-155 activity. This dependence was highlighted by using only a single functional <italic>ci</italic> allele and by assaying synthetically activated Fu in anterior cells.</p><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Activation by Fused kinase is enhanced by blocking Ci-155 processing.</title><p>(<bold>A–I</bold>) Wing discs from animals with one copy of the designated <italic>ci</italic> transgenes and alleles (together with <italic>ci<sup>94</sup></italic>) with clones (GFP, green, arrows) that express <italic>UAS-GAP-Fu</italic> and (<bold>A–E</bold>) lack <italic>smo</italic> activity or (<bold>F–I</bold>) are heterozygous for <italic>smo</italic> (arrowheads indicate AP border), showing (<bold>A’–I’</bold>) <italic>ptc-lacZ</italic> (red) and (<bold>A”–I”</bold>) Ci-155 (gray-scale). (<bold>A”–I”</bold>) Ci-155 levels were much reduced in clones whenever pathway activity was strongly induced (<bold>A”, B”, D”, F”, G”</bold>). Scale bars are 40 μm. (<bold>J, K</bold>) Average intensity of <italic>ptc-lacZ</italic> in clones (red), Ci-155 in clones (green) or neighboring anterior territory (blue), as a fraction of AP border levels for (<bold>J</bold>) <italic>smo GAP-Fu</italic> clones and (<bold>K</bold>) <italic>GAP-Fu</italic> clones. Mean and SEM shown. Significant differences between values for a given genotype compared to those for <italic>crCi-WT</italic>, calculated by paired t-tests, are indicated for p&lt;0.001 (*) and p&lt;0.05 (#). Additionally, in (<bold>J</bold>) <italic>ptc-lacZ</italic> was significantly increased for <italic>gCi-S849A</italic> versus <italic>gCi-WT</italic> (p&lt;0.0001), as was the anterior level of Ci-155 (p&lt;0.0001).</p><p> <supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Numerical data for graphs in <xref ref-type="fig" rid="fig4">Figure 4</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-61083-fig4-data1-v2.xlsx"/></supplementary-material> </p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig4-v2.tif"/></fig><p>The Ci-155 levels detected within <italic>smo GAP-Fu</italic> clones were much lower than in surrounding territory in wing discs expressing processing-resistant Ci variants (<xref ref-type="fig" rid="fig4">Figure 4A,B,D,J</xref>). The reduction in Ci-155 was similar in magnitude to that observed in posterior regions of the AP border and presumably reflects Ci-155 reduction due to high Hh pathway activity. By contrast, wild-type Ci-155 levels were elevated in <italic>smo GAP-Fu</italic> clones relative to neighboring cells. Since <italic>ptc-lacZ</italic> in these clones was significantly lower than at the AP border (<xref ref-type="fig" rid="fig4">Figure 4C,J</xref>) there is likely little or no reduction in Ci-155 due to high pathway activity. The fact that Ci-155 clone levels were lower than maximal AP border Ci-155 levels for wild-type Ci (<xref ref-type="fig" rid="fig4">Figure 4C</xref>) therefore indicates that GAP-Fu does not inhibit processing to the same degree as Hh inhibits processing at the AP border. Thus, although the absolute steady-state levels of Ci-155 for Ci-WT and Ci-S849A in <italic>smo GAP-Fu</italic> clones were quite similar (<xref ref-type="fig" rid="fig4">Figure 4J</xref>), Ci-155 accumulation was limited by largely different mechanisms; significant continued processing for Ci-WT and pathway-stimulated loss for Ci-S849A.</p><p>In summary, activation of Ci-155 by Fu to produce high levels of Hh target gene expression also requires provision of high levels of primary Ci-155 translation product that is protected from processing. The elevated Ci-155 supply produced by processing-resistant Ci variants is, however, not directly evident from measurement of steady-state Ci-155 levels because of subsequent, robust Ci-155 loss in response to high pathway activity. Even though steady-state Ci-155 levels are similar for Ci-WT and Ci-S849A, the proportion of Ci-155 molecules that are active is presumably higher for Ci-S849A in GAP-Fu clones.</p></sec><sec id="s2-8"><title>PKA and Cos2 silence Ci-155 activity</title><p>It was previously appreciated that Cos2, PKA and Slimb are all necessary for Ci-155 processing but that induction of Hh target genes was higher in anterior <italic>cos2</italic> and <italic>pka</italic> mutant clones than in <italic>slimb</italic> mutant clones (<xref ref-type="bibr" rid="bib22">Jiang and Struhl, 1998</xref>; <xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>; <xref ref-type="bibr" rid="bib62">Wang et al., 1999</xref>). Loss of PKA also increased <italic>ptc-lacZ</italic> induction in <italic>slimb</italic> mutant clones (<xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>). These observations suggested that PKA and Cos2 inhibit Ci-155 activity in addition to promoting Ci-155 processing, with the potential reservations that the <italic>slimb</italic> alleles used in some tests may not have fully blocked Ci-155 processing or that Slimb may have additional relevant actions that reduce Ci-155 activity. The effect of PKA loss on the activity of processing-resistant <italic>UAS-Ci</italic> transgenes has also been investigated previously but the transgenes were expressed at non-physiological levels and such transgenes do not support normal Hh responses at the AP border (<xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>; <xref ref-type="bibr" rid="bib15">Garcia-Garcia et al., 2017</xref>).</p><p>To test the effects of PKA and Cos2 on the activity of processing-resistant Ci-155 expressed at physiological levels, we induced <italic>pka</italic> or <italic>cos2</italic> clones in wing discs expressing Ci-P(1-3A) from a single allele in combination with <italic>ci<sup>94</sup></italic>. We found that in both types of clone, there was a marked increase of <italic>ptc-lacZ</italic> expression compared to surrounding tissue (<xref ref-type="fig" rid="fig5">Figure 5B,C,I,L</xref>) and compared to clones with no change in PKA or Cos2 activities (<xref ref-type="fig" rid="fig3">Figure 3F</xref>). The level of <italic>ptc-lacZ</italic> induced was found to be about 75% (<italic>pka</italic> clones) or 50% (<italic>cos2</italic> clones) of AP border levels in the same wing discs (<xref ref-type="fig" rid="fig5">Figure 5L</xref>). The levels of <italic>ptc-lacZ</italic> induced in equivalent clones in wing discs expressing one allele of wild-type Ci were very similar (<xref ref-type="fig" rid="fig5">Figure 5A,H,L</xref>), indicating that the activity of Ci-P(1-3A) reflected the normal response of wild-type Ci to loss of PKA or Cos2 and hence that the three PKA sites that are key for processing (P1-3) are not required for the regulation of Ci-155 activity by PKA or Cos2.</p><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>PKA and Cos2 reduce the activity of Ci-155 that is not processed.</title><p>(<bold>A–K</bold>) Wing discs from animals with one copy of the designated <italic>ci</italic> transgenes and alleles (together with <italic>ci<sup>94</sup></italic>) with clones (GFP, green, arrows) that lack (<bold>A–G</bold>) <italic>pka</italic> activity or (<bold>H–K</bold>) <italic>cos2</italic> activity (arrowheads indicate AP border), showing (<bold>A’–K’</bold>) <italic>ptc-lacZ</italic> (red) and (<bold>A”, C”–K”</bold>) Ci-155 (gray-scale). (<bold>B”</bold>) En (gray-scale) was weakly induced in <italic>pka</italic> clones from discs expressing Ci-P(1-3)A. Ci-155 levels were (<bold>A”, F”, H”</bold>) increased relative to neighboring anterior territory for Ci-WT but were (<bold>C”–E”, G”, I”–K”</bold>) either unchanged or slightly reduced, presumably from full proteolysis, for processing-resistant Ci variants. Scale bars are 40 μm. (<bold>L</bold>) Average intensity of <italic>ptc-lacZ</italic> in <italic>pka</italic> clones (red) or neighboring anterior territory (pink), and in <italic>cos2</italic> clones (dark blue) or neighboring anterior territory (light blue), as a fraction of AP border levels. Mean and SEM shown. Significant differences between <italic>ptc-lacZ</italic> values in <italic>pka</italic> or <italic>cos2</italic> mutant clones and neighboring anterior <italic>pka/+</italic> or <italic>cos2/+</italic> cells for a given genotype, calculated by paired t-tests, are indicated for p&lt;0.001 (*) and p&lt;0.05 (#).</p><p> <supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Numerical data for graphs in <xref ref-type="fig" rid="fig5">Figure 5</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-61083-fig5-data1-v2.xlsx"/></supplementary-material> </p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig5-v2.tif"/></fig><p>Induction of <italic>ptc-lacZ</italic> was substantially lower for <italic>pka</italic> mutant clones expressing wild-type Ci from a <italic>gCi</italic> transgene rather than from a <italic>cr-Ci</italic> allele (<xref ref-type="fig" rid="fig5">Figure 5F,L</xref>), showing that Ci-155 activity elicited by loss of PKA depends on Ci-155 levels. This dependence was previously shown by comparing wild-type animals and <italic>ci</italic> heterozygotes, and it was further shown that Hh target gene induction depended on the relative stoichiometry of Ci-155 and Su(fu), suggesting the hypothesis that only Su(fu)-free Ci-155 is active in <italic>pka</italic> mutant clones (<xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>). In all cases (<italic>pka</italic> or <italic>cos2</italic> mutant clones, Ci-WT or Ci-P(1-3A), <italic>gCi-WT</italic> or <italic>crCi-WT</italic>), the levels of Ci-155 in clones matched or exceeded the highest levels at the AP border, suggesting little or no loss of Ci-155 due to high pathway activity. Indeed, activity in <italic>pka</italic> and <italic>cos2</italic> clones may depend on Ci-155 levels exceeding the inhibitory capacity of Su(fu). No such requirement is expected in GAP-Fu clones because Fu can relieve inhibition by Su(fu). Thus, in contrast to the situation with GAP-Fu clones, the contribution to activity of a robust supply of Ci-155 that is not processed is reflected in elevated steady-state Ci-155 levels. In summary, the results for Ci-P(1-3A) clearly indicate that PKA and Cos2 inhibit the activity of Ci-155 that is not processed in the absence of Hh stimulation. The magnitude of inhibition is substantial.</p><p>Surprisingly, <italic>ptc-lacZ</italic> induction by Ci-S849A was not clearly higher in <italic>pka</italic> or <italic>cos2</italic> mutant clones than in surrounding cells (<xref ref-type="fig" rid="fig5">Figure 5D,G,J</xref>). Quantitation revealed that this was largely due to significant <italic>ptc-lacZ</italic> expression in heterozygous tissue surrounding the clones (<xref ref-type="fig" rid="fig5">Figure 5L</xref>). Similar, low levels of <italic>ptc-lacZ</italic> activity were observed also for Ci-S849A, but not Ci-WT or Ci-P(1-3A), in clones with normal PKA and Cos2 activity (<xref ref-type="fig" rid="fig3">Figure 3D–F</xref>). These results suggest that S849 is relevant to the regulation of Ci-155 activity by PKA and Cos2.</p><p>Ci∆1270–1370, which is also not subject to processing, did not induce <italic>ptc-lacZ</italic> in wild-type anterior cells (<xref ref-type="fig" rid="fig2">Figure 2E,J</xref>; <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2E</xref>) or in <italic>pka/+</italic> or <italic>cos2/+</italic> cells and was not strongly activated by loss of PKA or Cos2, producing <italic>ptc-lacZ</italic> expression significantly lower than Ci-WT (<xref ref-type="fig" rid="fig5">Figure 5E,K,L</xref>). Ci∆1270–1370 also has lower activity than Ci-WT at the AP border of wild-type discs (<xref ref-type="fig" rid="fig2">Figure 2E,J</xref>), but it is strongly activated by GAP-Fu (<xref ref-type="fig" rid="fig4">Figure 4B,I–K</xref>). Based on these observations and the hypothesis that PKA and Cos2 primarily inhibit Su(fu)-free Ci-155, we speculate that Ci∆1270–1370 may be inhibited more strongly than wild-type Ci by Su(fu), so that release from PKA and Cos2 inhibition is without effect and full relief from Su(fu) inhibition is achieved only by artificially strong GAP-Fu activation and not by normal Fu activation at the AP border.</p></sec><sec id="s2-9"><title>Cos2 likely silences Ci activity by binding to the CORD region</title><p>To investigate how Cos2 silences Ci-155 activity, we further examined the interactions between these proteins. Cos2 can bind to Ci-155 through three regions defined by in vitro binding assays: the CDN region (residues 346–440), the zinc fingers (residues 506–620) and the CORD domain (residues 934–1065) (<xref ref-type="bibr" rid="bib63">Wang and Jiang, 2004</xref>; <xref ref-type="bibr" rid="bib72">Zhou and Kalderon, 2010</xref>). Measurement of processing through Ci-155 levels and generation of repressor activity from <italic>UAS-Ci</italic> transgenes in wing discs previously showed that processing was absent only when the zinc finger and CORD domains were both removed (<xref ref-type="bibr" rid="bib72">Zhou and Kalderon, 2010</xref>). To test whether Cos2-binding domains might be responsible for inhibiting Ci-155 activity we generated <italic>ci</italic> alleles lacking CDN, CORD or both regions. There are no known alterations to the zinc-finger region that affect Cos2 binding without compromising DNA binding and hence transcriptional activity of Ci-155.</p><p>We induced <italic>pka</italic> and <italic>cos2</italic> clones in wing discs expressing only Ci∆CORD, Ci∆CDN or Ci∆CDN∆CORD. The level of <italic>ptc-lacZ</italic> in <italic>pka</italic> mutant clones was similar for wild-type Ci and Ci∆CDN but it was significantly higher for Ci∆CORD and Ci∆CDN∆CORD; it was also higher for Ci∆CORD than Ci-WT expressed from a <italic>gCi</italic> transgene (<xref ref-type="fig" rid="fig6">Figure 6A–F,K</xref>). These results indicate that the presence of the CORD domain reduces Ci-155 activity when Ci-155 is not processed in a <italic>pka</italic> mutant clone, while the CDN domain appears to have no impact on Ci-155 activity. By contrast, <italic>ptc-lacZ</italic> levels in <italic>cos2</italic> mutant clones were very similar for Ci∆CORD, Ci∆CDN, Ci∆CORD∆CDN, and Ci-WT (<xref ref-type="fig" rid="fig6">Figure 6G–K</xref>). The simplest interpretation of these results is that Cos2 inhibits Ci-155 by binding to the CORD domain and that deletion of either the CDN or CORD domain does not affect any significant Ci-155 property other than binding to Cos2. Thus, in clones where Ci-155 is not processed the activity of Ci-155 is increased by loss of either Cos2 or the CORD domain but loss of the CORD domain cannot activate Ci-155 further in a <italic>cos2</italic> mutant clone. Moreover, the greater activity of Ci lacking the CORD domain in <italic>pka</italic> clones than in <italic>cos2</italic> clones shows that Ci-155 activation by loss of PKA activity and loss of Cos2-CORD binding can be additive.</p><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Cos2 reduces Ci-155 activity by binding to the CORD region.</title><p>(<bold>A–J</bold>) Wing discs from animals with one copy of the designated <italic>ci</italic> transgenes and alleles (together with <italic>ci<sup>94</sup></italic>) with clones (GFP, green, arrows) that lack (<bold>A–F</bold>) <italic>pka</italic> activity or (<bold>G–J</bold>) <italic>cos2</italic> activity (arrowheads indicate AP border), showing (<bold>A’–J’</bold>) <italic>ptc-lacZ</italic> (red) and (<bold>A”–F”</bold>) Ci-155 (gray-scale). (<bold>A”–F”</bold>) Ci-155 levels were increased relative to neighboring anterior territory for all Ci proteins, but the increase was relatively small for (<bold>B”</bold>) Ci-ΔCORD, suggesting that processing outside the clones may be inefficient. By contrast, a large change was observed for Ci-ΔCDNΔCORD, suggesting very efficient processing. Scale bars are 40 μm. (<bold>K</bold>) Average intensity of <italic>ptc-lacZ</italic> in <italic>pka</italic> clones (red) and in <italic>cos2</italic> clones (blue), as a fraction of AP border levels. Mean and SEM shown. Significant differences between values for a given genotype compared to those for <italic>crCi-WT</italic>, calculated by paired t-tests, are indicated for p&lt;0.001 (*) and p&lt;0.05 (#). Additionally, <italic>ptc-lacZ</italic> was significantly increased for <italic>gCi-ΔCORD</italic> versus <italic>gCi-WT</italic> in <italic>pka</italic> mutant clones (p&lt;0.0001).</p><p> <supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>Numerical data for graphs in <xref ref-type="fig" rid="fig6">Figure 6</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-61083-fig6-data1-v2.xlsx"/></supplementary-material> </p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig6-v2.tif"/></fig><p>In wing discs with no additional alterations, Ci∆CORD, Ci∆CDN, and Ci∆CORD∆CDN all supported a near-normal Ci-155 profile, indicating substantially normal regulation of Ci-155 processing, and strong <italic>ptc-lacZ</italic> expression confined to the AP border (<xref ref-type="fig" rid="fig7">Figure 7A–D</xref>). There was a slight enhancement of anterior Ci-155 levels for Ci∆CORD, which was also evident in a <italic>pka</italic> heterozygous background (<xref ref-type="fig" rid="fig6">Figure 6B</xref>) and in a Su(fu) mutant background (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1A,C</xref>). That may indicate a mild processing deficit. However, there was a very strong contrast between low anterior and high AP border Ci-155 levels of Ci∆CORD∆CDN (<xref ref-type="fig" rid="fig6">Figure 6D</xref>; <xref ref-type="fig" rid="fig7">Figure 7D</xref>), supporting previous evidence that Ci-155 lacking both these Cos2-binding domains is processed very efficiently, perhaps even more efficiently than wild-type Ci, and that Hh blocks processing efficiently (<xref ref-type="bibr" rid="bib72">Zhou and Kalderon, 2010</xref>). The experiments reported here, using Ci variants expressed at physiological levels, revealed a dependence on the Cos2-binding CORD domain for inhibiting Ci-155 activity that is not observed for Ci-155 processing or regulation of processing by Hh.</p><fig-group><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Loss of both Cos2 inhibition and processing combine to activate Ci-155.</title><p>(<bold>A–J</bold>) Wing discs from animals with one copy of the designated <italic>ci</italic> alleles (together with <italic>ci<sup>94</sup></italic>), have (<bold>A–D</bold>) no ectopic anterior <italic>ptc-lacZ</italic> (red) unless (<bold>E</bold>) both the CORD domain is removed and processing blocked (by the S849A alteration). (<bold>A’–E’</bold>) Ci-155 (gray-scale) in the same wing discs. (<bold>F–J</bold>) Anterior En (green) induction, revealed by marking the AP compartment boundary (yellow lines) with the posterior extent of <italic>ptc-lacZ</italic> (red), was reduced for Ci variants (<bold>G, J</bold>) lacking the CORD domain, (<bold>J</bold>) especially together with the S849A alteration. (<bold>K</bold>) Wing disc with anterior clones (GFP, green, yellow arrows) that have lost a second chromosome <italic>gCi</italic> transgene, leaving one copy of <italic>crCi-S849AΔCORD</italic> as the only source of Ci, showing (<bold>K’</bold>) <italic>ptc-lacZ</italic> induction in the clones (arrows) to levels similar to the AP border (arrowheads); (<bold>K”</bold>) Ci-155 (gray-scale) is uniformly high because of blocked processing. Scale bars are (<bold>A–J</bold>) 40 μm. See also <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig7-v2.tif"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 1.</label><caption><title>Reduced AP border activity of Ci lacking the CORD domain.</title><p>(<bold>A–H</bold>) Wing discs expressing one copy of <italic>crCi-WT</italic> or <italic>crCi-ΔCORD</italic> as the only source of Ci, showing (<bold>A, C, E, F</bold>) Ci-155 (gray-scale), (<bold>B, D, G, H, A’–H’</bold>) <italic>ptc-lacZ</italic> (red) or (<bold>B, D, G, H, B”, D”, G”, H”</bold>) En (green) and AP compartment boundary (yellow line). Reduced En induction by Ci-ΔCORD was (<bold>B, D</bold>) not restored to normal by loss of Su(fu). (<bold>E–H</bold>) Loss of Fu kinase activity in <italic>fu<sup>mH63</sup></italic> wing discs produced (<bold>E, F</bold>) similarly strong, broad Ci-155 at the AP border and (<bold>E’, F’</bold>) drastic reduction of <italic>ptc-lacZ</italic> for Ci-WT and Ci-ΔCORD, while (<bold>G, H</bold>) additional loss of Su(fu) restored <italic>ptc-lacZ</italic> without anterior En in both cases. (<bold>I–L</bold>) induction of <italic>ptc-lacZ</italic> (red) in <italic>smo</italic> mutant clones (green, arrows) expressing GAP-Fu was similar for Ci-WT and Ci-ΔCORD encoded by either (<bold>I, J</bold>) <italic>gCi</italic> transgenes or (<bold>K, L</bold>) <italic>crCi</italic> alleles and was much lower than at the AP border (arrowheads) in all cases, as presented graphically in (<bold>N</bold>). (<bold>M, M’</bold>) Much higher <italic>ptc-lacZ</italic> (red), matching AP border levels (arrowheads) were observed in GAP-Fu clones (green, arrows) expressing processing-resistant Ci-S849AΔCORD, accompanied by (<bold>M”</bold>) significant Ci-155 (gray-scale) proteolysis. (<bold>N</bold>) Average intensity of <italic>ptc-lacZ</italic> in clones as a fraction of AP border levels. Significant differences between values for a given genotype compared to those for <italic>crCi-WT</italic>, calculated by paired t-tests, are indicated for p&lt;0.001 (*). There was no significant difference (p&lt;0.05) for <italic>gCi-ΔCORD</italic> versus <italic>gCi-WT</italic>. Scale bars are (<bold>A, C, E, F</bold>) 100 μm and (<bold>D, G, H, I–M</bold>) 40 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig7-figsupp1-v2.tif"/></fig></fig-group><p>The absence of ectopic anterior <italic>ptc-lacZ</italic> in wing discs expressing Ci∆CORD (<xref ref-type="fig" rid="fig7">Figure 7B,D</xref>) suggests that loss of Cos2-CORD association only leads to Ci-155 activity when Ci-155 processing is also inhibited. To test this hypothesis further, we created an allele expressing a processing-resistant Ci variant (S849A) that also lacked the CORD domain. We found that, unlike Ci∆CORD, Ci-S849A∆CORD in combination with <italic>ci<sup>94</sup></italic> resulted in wing discs with expanded anterior compartments and ectopic <italic>ptc-lacZ</italic> throughout the anterior (<xref ref-type="fig" rid="fig7">Figure 7B,E</xref>). Ectopic <italic>ptc-lacZ</italic> was much stronger than observed for Ci-S849A and was also evident cell autonomously in clones lacking a wild-type Ci transgene within wing discs expressing Ci-S849A∆CORD (<xref ref-type="fig" rid="fig7">Figure 7K</xref>). These results confirm that the CORD domain, which is only known to interact with Cos2, reduces Ci-155 activity when Ci-155 is not processed. Moreover, the observations that induction of <italic>ptc-lacZ</italic> in response to loss of PKA, Cos2 or the CORD domain depends on the dose of <italic>ci</italic> and protecting Ci-155 from processing are consistent with the idea that only Su(fu)-free Ci-155 is subject to inhibition by PKA and by Cos2 binding to the CORD domain.</p></sec><sec id="s2-10"><title>Additional CORD domain contributions</title><p>If the CORD domain serves only to permit Ci-155 inhibition by binding to Cos2, it might be expected that Ci∆CORD either has the same activity at the AP border as wild-type Ci, or perhaps greater activity if Hh does not normally fully oppose Cos2-CORD interactions at the AP border. In fact, Ci∆CORD (and Ci∆CDN∆CORD) supported normal levels of <italic>ptc-lacZ</italic> but reduced En induction (<xref ref-type="fig" rid="fig7">Figure 7A,B,D,F,G,I</xref>). Loss of Su(fu) did not restore robust En expression (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1B,D</xref>) and induction of <italic>ptc-lacZ</italic> was much reduced by loss of Fu kinase, just as for Ci-WT (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1E,F</xref>). Wing discs lacking both Fu kinase and Su(fu) had strong <italic>ptc-lacZ</italic> but no En induction at the AP border for both Ci∆CORD and Ci-WT (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1G,H</xref>), consistent with an earlier report that Ci-155 activation by Fu operates substantially, but not entirely by antagonizing inhibition by Su(fu) (<xref ref-type="bibr" rid="bib73">Zhou and Kalderon, 2011</xref>). We also found that Ci∆CORD responded to activated GAP-Fu similarly to Ci-WT (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1I–L,N</xref>). From these results, we speculate that the CORD domain may facilitate a facet of activation of Ci-155 by Fu that does not involve countering Su(fu) inhibition. For example, Fu activated by Hh at the AP border may not engage efficiently with Ci-155 complexes in the absence of the CORD domain, leading to a deficit in En induction, but excess GAP-Fu may largely compensate for that deficiency to produce similar activation of Ci-WT and Ci∆CORD.</p><p>Surprisingly, despite its high constitutive activity, Ci-S849A∆CORD showed markedly lower induction of En at the AP border than Ci∆CORD (<xref ref-type="fig" rid="fig7">Figure 7J</xref>), even though Ci-S849A induced En normally (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). Since Ci-S849A∆CORD is neither processed nor inhibited by Cos2, it is presumably incompletely activated by Fu kinase activity, as hypothesized for Ci∆CORD. The lesser induction of En when processing is fully inhibited suggests the possibility that those Ci-155 molecules spared from processing but failing to engage with activated Fu might compete with activated Ci-155 and thereby limit Hh target gene induction.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Hh signaling in <italic>Drosophila</italic> and in mammals involves two key changes: inhibition of the proteolytic processing of Ci/Gli proteins to repressor forms, thereby also increasing full-length protein levels, and activation of full-length Ci/Gli proteins (<xref ref-type="fig" rid="fig8">Figure 8</xref>). The relative importance of repressor and activator, both of which can potentially regulate the same set of genes, varies in different mammalian tissues in part because of the Gli protein expressed (Gli3 is more efficiently converted to repressor than Gli2) and because Gli1 is itself a Hh target gene, acts only as an activator and therefore has a specialized amplification role (<xref ref-type="bibr" rid="bib7">Briscoe and Thérond, 2013</xref>; <xref ref-type="bibr" rid="bib25">Kong et al., 2019</xref>; <xref ref-type="bibr" rid="bib30">Liu, 2019</xref>). In <italic>Drosophila</italic>, Ci is the only transcriptional effector of Hh signaling, allowing straightforward interrogation of the relative importance of regulation through altering the levels of Ci-75 repressor, latent Ci-155 activator and conversion of Ci-155 to a potent transcriptional activator. Moreover, wing disc development is perhaps the most demanding and easily perturbed patterning challenge for Hh signaling in <italic>Drosophila</italic> and therefore suitable for dissecting essential regulatory influences that support dose-dependent responses. It is therefore remarkable that we found that regulation of Ci-155 processing is not essential for major manifestations of Hh morphogen action in wing discs.</p><fig id="fig8" position="float"><label>Figure 8.</label><caption><title>Summary of graded processing, activation, and proteolysis of Ci-155 and underlying mechanisms at the AP border.</title><p>At the AP border, Hh (emanating from posterior, mustard yellow, territory) inhibits Ci-155 processing stimulated by Cos2, PKA, CK1, and GSK3, and activates Fu protein kinase activity to activate Ci-155, overcoming inhibition by Su(fu) and other factors. Hh also promotes a reduction of Ci-155 levels, most likely by promoting full Ci-155 proteolysis through induction of Rdx/Hib or reducing Su(fu) association. Here we used processing-resistant Ci variants to show that PKA and Cos2 (through binding the CORD domain on Ci-155) limit Ci-155 activity in anterior cells (left) and (right) to deduce the spatial profiles of Hh-stimulated Ci-155 reduction (‘proteolysis’, upward arrows) and inhibition of Ci-155 processing (downward arrows, blue triangle) at the AP border that underlie steady-state Ci-155 levels (brown). Graded target gene (En, Ptc, Dpp) activation is normally elicited by a combination of activated Ci-155 and Ci-75 repressor but was still observed when there was no regulation of Ci-155 processing, indicating that Ci-155 activation must be graded. Although graded Hh signaling was observed when Ci-155 processing is not regulated, Ci-75 repressor must be present in anterior cells to prevent ectopic <italic>dpp</italic> expression and inhibition of processing was shown to be important for activated Fu to induce high levels of <italic>ptc</italic> expression. Thus, Hh normally elicits graded inhibition of Ci-155 processing and graded activation of full-length Ci-155 but the activation gradient can suffice provided there is some repressor in anterior cells and Ci-155 is substantially spared from processing at the AP border.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-61083-fig8-v2.tif"/></fig><sec id="s3-1"><title>Evidence that regulation of Ci-155 processing is not essential for Hh morphogen action</title><p>Processing of Ci-155 is initiated by phosphorylation of three PKA sites (‘P1-3’) and involves the creation of a Slimb-SCF complex binding site that includes phosphorylated S849. It has previously been shown that alteration of the PKA sites (P1-3A) or S849 (S849A) abrogates Slimb binding in vitro, Ci-75 production detected by Western blot of embryo extracts expressing HA-tagged transgenes and all Ci-75 repressor activity, assayed by <italic>hh-lacZ</italic> repression in <italic>smo</italic> mutant clones expressing <italic>ci</italic> transgenes in the posterior compartment of wing discs (<xref ref-type="bibr" rid="bib33">Méthot and Basler, 2000</xref>; <xref ref-type="bibr" rid="bib46">Price and Kalderon, 1999</xref>; <xref ref-type="bibr" rid="bib47">Price and Kalderon, 2002</xref>; <xref ref-type="bibr" rid="bib56">Smelkinson and Kalderon, 2006</xref>; <xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>). Moreover, we found here that Ci-P(1-3)A and Ci-S849A expressed at physiological levels produced high levels of Ci-155 throughout the anterior with no elevation at the AP border, and that <italic>dpp-lacZ</italic> was ectopically expressed in anterior cells, as expected if no Ci repressor is present (<xref ref-type="bibr" rid="bib32">Méthot and Basler, 1999</xref>). Thus, the absence of processing for Ci-P(1-3)A and Ci-S849A has been firmly established.</p><p>We found that normal patterns of induction of the Hh target genes <italic>ptc-lacZ</italic> and En at the AP border were supported by a Ci variant that cannot be processed. We tested only one copy of the <italic>ci-S849A</italic> and <italic>ci-P(1-3)A</italic> alleles, so it remains possible that two copies might impair patterning. We also found that one <italic>crCi-S849A</italic> allele together with a genomic <italic>gCi-S849A</italic> transgene and the constitutive repressor allele <italic>ci<sup>Ce</sup></italic> produced adults with normally patterned wings. The result shows that wing patterning by Hh does not require regulation of the level of either repressor or full-length Ci protein by processing.</p><p>Animals lacking both Fu kinase and Su(fu) also develop normal wings, although late third instar wing discs do lack anterior En induction (<xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>; <xref ref-type="bibr" rid="bib44">Préat, 1992</xref>; <xref ref-type="bibr" rid="bib73">Zhou and Kalderon, 2011</xref>). Thus, regulation of Ci-155 processing and the most prominent regulator of Ci-155 activation, Fu kinase activity, are each largely dispensable for Hh morphogen action, suggesting that each graded patterning mechanism can suffice in the absence of the other. The spatial morphogen action of Hh is aided by the negative feedback loop of <italic>ptc</italic> transcriptional induction leading to increased Hh sequestration by Ptc protein (<xref ref-type="bibr" rid="bib8">Chen and Struhl, 1996</xref>). That feature diminishes Hh spread through cells with hyper-sensitive signal transduction and increases spread through cells of reduced sensitivity, potentially accommodating limited deficiencies in signal transduction due to the loss of one major mode of Ci activity regulation.</p><p>The profile of Hh inhibition of Ci-155 processing had not previously been observed or deduced because wild-type Ci-155 is also subject to Hh-stimulated degradation and potentially other changes that also affect Ci-155 levels. Here, we have derived a clear profile of Hh-stimulated processes that lead to reduced Ci-155 by examining Ci variants that are not subject to processing. The Hh-stimulated decline in Ci-155 levels begins at a location where <italic>ptc-lacZ</italic> induction is roughly half-maximal and is roughly linear, resulting in a reduction of over twofold by the compartment boundary (<xref ref-type="fig" rid="fig2">Figure 2H”, I”, K</xref>; <xref ref-type="fig" rid="fig8">Figure 8</xref>). Although the mechanisms contributing to Hh-stimulated reduction in Ci-155 are not fully understood (see below), they appear always to be in proportion to pathway activity. Since both Ci-P(1-3A) and Ci-S849A have the same pathway activity profiles as Ci-WT, measured by <italic>ptc-lacZ</italic> and En, we assume that the Ci-155 reduction profile observed directly for the processing-resistant variants is very similar for wild-type Ci. We therefore added the observed value of Ci-155 loss at each AP location to the observed Ci-155 profile of wild-type Ci to deduce the normal Ci-155 profile due to processing alone (<xref ref-type="fig" rid="fig2">Figure 2L</xref>; <xref ref-type="fig" rid="fig8">Figure 8</xref>). The inhibition of Ci-155 processing extended from a location slightly anterior to the edge of <italic>ptc-lacZ</italic> induction to the AP border in a clearly graded manner that, in isolation, would alter Ci-155 levels more than two-fold. Thus, we have derived the first clear visualization of graded inhibition of Ci-155 processing and of graded, pathway-stimulated, Ci-155 loss.</p></sec><sec id="s3-2"><title>Hh-stimulated Ci-155 reduction</title><p>Both the mechanism and the purpose of Hh-stimulated Ci-155 reduction at the AP border remain uncertain. It was initially suggested that Hh-stimulated Ci-155 reduction was due to the transcriptional induction of Rdx/Hib, which bound activated Ci-155 directly to promote its degradation and limit the magnitude of Hh target gene induction by the highest levels of Hh (<xref ref-type="bibr" rid="bib24">Kent et al., 2006</xref>; <xref ref-type="bibr" rid="bib69">Zhang et al., 2009</xref>; <xref ref-type="bibr" rid="bib68">Zhang et al., 2006</xref>). However, other studies found that Ci-155 levels remained low in high Hh signaling territory even when Rdx/Hib activity was eliminated and that Rdx/Hib might influence Ci-155 indirectly via modulation of Su(fu) protein levels (<xref ref-type="bibr" rid="bib29">Liu et al., 2014</xref>; <xref ref-type="bibr" rid="bib51">Seong et al., 2010</xref>; <xref ref-type="bibr" rid="bib52">Seong and Ishii, 2013</xref>).</p><p>Here, we specifically tested the contribution of direct targeting of Ci by Rdx/Hib for the first time in a physiological setting by using a Ci variant with multiple alterations to sites of Rdx/Hib association; those alterations had been shown to nearly eradicate direct down-regulation of Ci-155 by Hib E3 ligase complexes under synthetic conditions (<xref ref-type="bibr" rid="bib69">Zhang et al., 2009</xref>). This Ci variant (Ci-S3-5) supported a normal pattern of Hh target gene induction in wing discs and the development of adults with normal wings. The Ci-155 profile was also very similar to wild-type Ci with robust Hh-stimulated Ci-155 reduction in the posterior part of the AP border. While the Ci variant may retain some residual Hib binding, our results suggest that the majority of Hh-promoted Ci-155 reduction is through mechanisms other than degradation due to direct binding of Rdx/Hib.</p><p>The complete absence of Su(fu) greatly reduces Ci-155 levels but not <italic>ci</italic> RNA levels throughout wing discs (<xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>), leading to the hypothesis that direct binding of Su(fu) to Ci-155 protects Ci-155 from degradation. It is also commonly speculated that pathway activation elicits Ci-Su(fu) dissociation, as suggested by studies of mammalian Hh signaling (<xref ref-type="bibr" rid="bib18">Humke et al., 2010</xref>; <xref ref-type="bibr" rid="bib59">Tukachinsky et al., 2010</xref>). Such dissociation, if stimulated in proportion to Fu activation, would promote Ci-155 degradation in proportion to Ci-155 activation without the necessary participation of a transcriptionally induced intermediate, such as Rdx/Hib (<xref ref-type="fig" rid="fig8">Figure 8</xref>). Consistent with this hypothesis, no reduction of Ci-155 levels close to the source of Hh was apparent in wing discs lacking Su(fu). The sensitivity of those measurements was, however, limited by the low Ci-155 levels throughout such wing discs. Whether Ci-155 activation by Fu does involve dissociation of Su(fu) and whether that contributes significantly to pathway-stimulated Ci-155 degradation remain to be thoroughly investigated.</p><p>Although the Rdx/Hib and Su(fu)-dependent proteolytic mechanisms outlined above are prominent candidates for mediating Hh-stimulated reduction of Ci-155 at the AP border, it is possible that transcriptional, RNA processing, or translational mechanisms are also involved. Initial studies of <italic>ci</italic> RNA and a <italic>lacZ</italic> enhancer trap of the <italic>ci</italic> locus (<italic>ci-lacZ</italic>) suggested that third instar larvae have spatially uniform anterior <italic>ci</italic> transcription and RNA (<xref ref-type="bibr" rid="bib13">Eaton and Kornberg, 1990</xref>; <xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>). <italic>ci-lacZ</italic> was, however, seen to be markedly lower in AP border regions 30 hr after pupariation, possibly resulting from transcriptional repression of <italic>ci</italic> by En, which is itself induced in anterior cells only in late third instar larvae (<xref ref-type="bibr" rid="bib5">Blair, 1992</xref>). Other studies have shown that the pattern of <italic>ci</italic> RNA splicing and overall RNA levels can be selectively altered by reduced activity of the exon-junction complex or the splicing factor, Srp54, suggesting the potential to regulate <italic>ci</italic> RNA processing (<xref ref-type="bibr" rid="bib15">Garcia-Garcia et al., 2017</xref>).</p></sec><sec id="s3-3"><title>Ci-155 activation by Fu</title><p>We found that artificially activated Fu (GAP-Fu) can activate processing-resistant Ci in anterior, Hh-free territory as effectively as normal Fu activity at the AP border. Wild-type Ci activated by GAP-Fu induced roughly two-fold lower levels of <italic>ptc-lacZ</italic>, and barely induced <italic>ptc-lacZ</italic> at all if it was produced at slightly lower levels by a <italic>gCi</italic> transgene rather than a <italic>ci</italic> allele. These results are consistent with the simple idea that more activated Ci-155 molecules collectively induce transcription more strongly. However, the steady-state level of Ci-155 in cells with synthetically activated Fu was not significantly higher for processing-resistant variants than for wild-type Ci, presumably because of robust Ci-155 degradation in response to high pathway activity. An analogous circumstance is apparent in posterior regions of the AP border: Ci-155 processing is largely inhibited, Fu kinase and Ci-155 are strongly activated but Ci-155 levels are similar to those in anterior cells because of robust Hh-stimulated Ci-155 reduction. The GAP-Fu experiment reports that high pathway activity causes a high rate of Ci-155 loss and that high pathway activity can only be maintained if there is an adequate, constant supply of fresh Ci-155 protected from processing. This imposed requirement might be the major purpose of Hh-promoted Ci-155 reduction at the AP border, rather than modulating the profile of the Hh signaling gradient. Under this arrangement, cells will continue to express high-level Hh target genes only when constantly stimulated. The arrangement also allows for the possibility of modulating pathway activity through both the degree of Fu activation and the rate of supply of Ci-155 that is protected from processing.</p></sec><sec id="s3-4"><title>Ci-155 activity regulation by PKA and Cos2</title><p>We used the processing-deficient variant Ci-P(1-3A) to show that genetic removal of PKA or Cos2 substantially increased Ci-155 activity in the absence of Hh, providing evidence that both PKA and Cos2 inhibit Ci-155 activation in addition to their well-established roles of promoting Ci-155 processing (<xref ref-type="fig" rid="fig8">Figure 8</xref>). Earlier tests concerning the role of PKA generally reached the same conclusion but were subject to a number of caveats (<xref ref-type="bibr" rid="bib55">Smelkinson et al., 2007</xref>; <xref ref-type="bibr" rid="bib62">Wang et al., 1999</xref>). The findings reported here supersede those conclusions because physiological expression of Ci-155 variants was assayed in normal locations. They also showed that the magnitude of inhibition by Cos2 and PKA was substantial and allowed some exploration of the mechanisms involved.</p><p>We found that removal of the CORD domain of Ci conferred significantly higher activity on a processing-resistant Ci variant and increased the response of otherwise normal Ci to loss of PKA, but not to loss of Cos2. These observations are consistent with the hypothesis that the CORD domain is the major mediator of the inhibitory action of Cos2. By contrast, deletion of the CDN Cos2-binding domain did not alter the activity of processing-resistant Ci. Ci-155 processing remained efficient in the absence of both CDN and CORD domains, confirming a previous deduction from <italic>UAS-Ci</italic> transgenes that Cos2 binding to the zinc finger domain of Ci can suffice to promote processing (<xref ref-type="bibr" rid="bib73">Zhou and Kalderon, 2011</xref>). Removal of the CORD domain reduced En induction at the AP border and we hypothesize that this might result from a deficiency in targeting activated Fu to Ci. Thus, although Ci-155 has three domains that can bind to Cos2, it appears that they do not contribute equally to regulate Ci-155 processing, inhibition and activation.</p><p>We did not resolve how PKA inhibits Ci-155. The finding that loss of PKA increased the activity of Ci-P(1-3A) shows that the PKA sites used to direct processing (P1-3) are not essential targets for PKA to inhibit Ci-155. Ci-155 includes two additional consensus sites at residues 962 and 1006. In earlier studies using multiple <italic>UAS-Ci</italic> transgenes at a variety of genomic locations, Ci variants lacking all five PKA sites (P1-5A) were found to be more active than those lacking just sites P1-3 (<xref ref-type="bibr" rid="bib46">Price and Kalderon, 1999</xref>). However, the relative levels of <italic>ci</italic> transgene expression were not measured in that study and all were likely higher than physiological levels. In mouse studies, evidence was provided, albeit with non-physiological expression levels, that alteration of PKA sites in Gli2 analogous to residues 962 and 1006 in Ci-155 increased Gli2 activity (<xref ref-type="bibr" rid="bib39">Niewiadomski et al., 2014</xref>). We were unable to recover a <italic>crCi</italic> allele encoding a variant with all five PKA sites altered. We were similarly unable to recover variants with processing-resistant alterations together with Su(fu)-binding site alterations, and the processing- resistant variant with a CORD domain deletion was also difficult to recover and propagate. We speculate that these difficulties may all derive from a shared characteristic of constitutively high activity, providing a hint that PKA sites 962 and 1006 might be important to restrain Ci-155 activity. However, both these sites are within the CORD domain and Ci lacking the CORD domain is more strongly activated by loss of PKA than by loss of Cos2, indicating that PKA inhibition does not require PKA sites 4 and 5. There may, of course, be more than one target through which PKA inhibits Ci-155 activation, including the possibility that PKA acts separately through sites 1–3 and 4–5.</p><p>Another unresolved issue is to what extent Hh signaling at the AP border antagonizes the inhibitory influences of Cos2 and PKA. When Hh signals, Ci-155 processing is reduced primarily through partial dissociation of Cos2-Ci complexes (<xref ref-type="bibr" rid="bib28">Li et al., 2014</xref>; <xref ref-type="bibr" rid="bib48">Ranieri et al., 2014</xref>) and this processing inhibition occurs even in the absence of Fu kinase activity (<xref ref-type="bibr" rid="bib40">Ohlmeyer and Kalderon, 1998</xref>; <xref ref-type="bibr" rid="bib56">Smelkinson and Kalderon, 2006</xref>). It is not clear what degree of dissociation is elicited at the AP border or whether Cos2-CORD interactions might be altered within intact Cos2-Ci complexes to relieve Cos2 inhibition. Ci-P(1-3)A induced no <italic>ptc-lacZ</italic> in anterior cells, low <italic>ptc-lacZ</italic> levels at the AP border of Fu-kinase deficient discs and significantly higher <italic>ptc-lacZ</italic> levels in <italic>cos2</italic> and <italic>pka</italic> mutant clones. We can therefore deduce that in the absence of Fu kinase there may be some reduction of inhibition by Cos2 and PKA at the AP border, leading to low <italic>ptc-lacZ</italic> induction, but the reduction is much less than from complete elimination of Cos2 or PKA activities. It is possible that Hh additionally counters inhibition by Cos2 or PKA through Fu activation. Indeed, anterior En induction at the AP border requires Fu activity even in the complete absence of Su(fu), showing that Fu opposes Ci-155 inhibition by factors other than Su(fu) (<xref ref-type="bibr" rid="bib73">Zhou and Kalderon, 2011</xref>). Cos2 and PKA are the only other known inhibitory factors.</p><p>In summary, at the AP border of wing discs, Hh inhibits Ci-155 processing, activates full-length Ci-155 and promotes reduction of Ci-155, most likely substantially through proteolytic degradation (<xref ref-type="fig" rid="fig8">Figure 8</xref>). Processing-resistant Ci variants revealed the profiles of Hh-promoted Ci-155 reduction and Ci-155 processing inhibition (<xref ref-type="fig" rid="fig2">Figure 2K,L</xref> and <xref ref-type="fig" rid="fig8">Figure 8</xref>), and showed that Hh can pattern wing discs and wings normally in the absence of regulated processing. Ci variants lacking Rdx/Hib-binding sites showed that Ci-155 reduction likely depends on Hh-stimulated processes other than direct binding to the transcriptionally induced component of an E3 ubiquitin ligase, plausibly involving protection from degradation by Su(fu) association (<xref ref-type="fig" rid="fig8">Figure 8</xref>). We also found that Ci-155 that is not subject to processing is substantially inhibited by PKA and by association with Cos2 through the CORD domain in addition to Su(fu), and that activation by Fu only elicits strong induction of Hh target genes if there is a continued ample supply of Ci-155 protected from processing.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type <break/>(species) or resource</th><th valign="top">Designation</th><th valign="top">Source or reference</th><th valign="top">Identifiers</th><th valign="top">Additional information</th></tr></thead><tbody><tr><td valign="top">Gene (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Ci</td><td valign="top">Flybase ID: <break/>FBgn0004859</td><td valign="top">CG2125</td><td valign="top"/></tr><tr><td valign="top">Gene (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Cos2</td><td valign="top">Flybase ID: <break/>FBgn0000352</td><td valign="top">CG1708</td><td valign="top"/></tr><tr><td valign="top">Gene (<italic>Drosophila melanogaster</italic>)</td><td valign="top">PKA</td><td valign="top">Flybase ID: <break/>FBgn0000273</td><td valign="top">CG4379</td><td valign="top"/></tr><tr><td valign="top">Gene (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Fused</td><td valign="top">Flybase ID: <break/>FBgn0001079</td><td valign="top">CG6551</td><td valign="top"/></tr><tr><td valign="top">Gene (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Suppressor of Fused</td><td valign="top">Flybase ID: <break/>FBgn0005355</td><td valign="top">CG6054</td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">hs-flp</td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/7867064">7867064</ext-link></td><td valign="top">FBti0002738</td><td valign="top">hsp70-driven Flp recombinase on X</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">ci<sup>94</sup></td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/7705626">7705626</ext-link> <break/>PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/10102270">10102270</ext-link></td><td valign="top">FBal0045443</td><td valign="top">5 kb deletion removing promoter and first exon</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">ci<sup>Ce</sup></td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/10102270">10102270</ext-link></td><td valign="top">ci<sup>Ce2</sup> FBal0001657</td><td valign="top">8 bp deletion that is expected to result in a truncation of the protein at amino acid residue 975</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Dp[y<sup>+</sup>]</td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/10102270">10102270</ext-link></td><td valign="top"><italic>Dp(1;4)1021[y<sup>+</sup>] sv<sup>spa-pol</sup></italic> FBab0003151</td><td valign="top"/></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">Su(fu)<sup>LP</sup></td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/1468628">1468628</ext-link></td><td valign="top">FBal0016296</td><td valign="top">Amorphic 1.5 kb deletion extending into neighboring <italic>kar</italic> gene</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">pka-C1<sup>H2</sup></td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/8391504">8391504</ext-link></td><td valign="top">FBal0033960</td><td valign="top">G203D alteration to key kinase domain residue</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">smo<sup>2</sup></td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/15592457">15592457</ext-link></td><td valign="top">FBal0015765</td><td valign="top">Behaves as a null</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">FRT 42D P[Smo<sup>+</sup>]</td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/10102270">10102270</ext-link></td><td valign="top">P[Smo<sup>+</sup>, hsp70-GFP] FBtp0012072</td><td valign="top">Fully rescues loss of <italic>smo</italic> function</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">FRT 42D cos2<sup>2</sup></td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/11090136">11090136</ext-link></td><td valign="top">FBal0001772</td><td valign="top">To generate loss-of-function cos2 clones</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">fu<sup>mH63</sup></td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/8846897">8846897</ext-link></td><td valign="top">FBal0120493</td><td valign="top">G203D loss of kinase activity</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">tub-GAL80 FRT 40A</td><td valign="top">BDSC BL-5192</td><td valign="top"/><td valign="top">For MARCM clones on 2L</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">FRT 42D P[Ci<sup>+</sup>] tub-GAL80</td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/10102270">10102270</ext-link></td><td valign="top"/><td valign="top">P[Ci+] 16 kb segment rescues <italic>ci</italic> null in stock for 2R MARCM clones</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">C765 &gt; Gal4</td><td valign="top">Flybase ID: <break/>FBti0002765</td><td valign="top"/><td valign="top">Spatially uniform wing disc GAL4 driver</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">UAS-GAP-Fu</td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/17658259">17658259</ext-link></td><td valign="top">FBal0284373</td><td valign="top">Fu coding sequence with Myristoylation sequence from hGAP43 at N-terminus and CFP at C-terminus</td></tr><tr><td valign="top">Genetic reagent (<italic>Drosophila melanogaster</italic>)</td><td valign="top">ptc-lacZ</td><td valign="top">PMID:<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pubmed/8898207">8898207</ext-link></td><td valign="top">P[ptcA-lacZ] FBal0047864</td><td valign="top">10.8 kb ptc promoter driving lacZ</td></tr><tr><td valign="top">Antibody</td><td valign="top">Anti-Ci-155 (rat monoclonal)</td><td valign="top">DSHB</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://antibodyregistry.org/AB_2109711">AB_2109711</ext-link></td><td valign="top">(1:3)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Anti-beta-galactosidase (rabbit polyclonal)</td><td valign="top">MP Biomedicals</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://antibodyregistry.org/AB_2334934">AB_2334934</ext-link></td><td valign="top">(1:10,000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Anti-Engrailed (mouse monoclonal)</td><td valign="top">DSHB</td><td valign="top"><ext-link ext-link-type="uri" xlink:href="http://antibodyregistry.org/AB_528224">AB_528224</ext-link></td><td valign="top">(1:5)</td></tr><tr><td valign="top">Antibody</td><td valign="top">AlexaFluor <break/>488, 546, 594, 647</td><td valign="top">Thermofisher Scientific</td><td valign="top">Anti-rabbit, <break/>Anti-mouse <break/>Anti-Rat</td><td valign="top">(1:1000)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pCFD4</td><td valign="top">Mann Lab</td><td valign="top">Addgene: 83954</td><td valign="top">Gibson cloning of gRNA</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">Bluescript genomic Cubitus interruptus</td><td valign="top">Basler Lab</td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">att-Pacman Expression Vector</td><td valign="top">DGRC</td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">Normal Goat Serum</td><td valign="top">Jackson Immunoresearch laboratories</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2336990">AB_2336990</ext-link></td><td valign="top"/></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">Aqua Polymount</td><td valign="top">PolySciences</td><td valign="top">CN: 18606–20</td><td valign="top"/></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">Gibson Assembly</td><td valign="top">New England Biolabs</td><td valign="top">CN: E5510S</td><td valign="top"/></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">PfuUltraII Fusion HS DNA polymerase</td><td valign="top">Agilent Technologies</td><td valign="top">CN: 600670</td><td valign="top"/></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">Zero Blunt Topo cloning vector</td><td valign="top">Invitrogen</td><td valign="top">CN: K270020</td><td valign="top"/></tr><tr><td valign="top">Strain, strain background (<italic>Escherichia coli</italic>)</td><td valign="top">Transformax EPI 300 Electrocompetent <italic>E. coli</italic></td><td valign="top">Epicentre <break/>Now lucigen</td><td valign="top">CN: EC300110</td><td valign="top">Electro-competent cells</td></tr><tr><td valign="top">Strain, strain background (<italic>Escherichia coli</italic>)</td><td valign="top">One Shot TOP10 Chemically Competent <italic>E. coli</italic></td><td valign="top">Thermofisher Scientific</td><td valign="top">CN: C4040-10</td><td valign="top">Chemically Competent cells</td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Image J</td><td valign="top">NIH Bethesda Maryland</td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">A Plasmid Editor (APE)</td><td valign="top"/><td valign="top"/><td valign="top"/></tr></tbody></table></table-wrap><sec id="s4-1"><title>Genomic <italic>ci</italic> cloning</title><p>Genomic transgenes were created by cloning the entire 16 kb genomic <italic>ci</italic> region from a Bluescript-SK (BSK) vector (provided by Dr. K. Basler; <xref ref-type="bibr" rid="bib32">Méthot and Basler, 1999</xref>) into an <italic>att-Pacman</italic> Expression vector (DGRC). To facilitate mutagenesis, the 16 kb fragment was first separated into two parts. The region including the promoter, first exon and part of the first intron (‘Ci fragment 2’) was cloned as a BamHI-NheI fragment into BSK cut with BamHI and XbaI to create BSK-CiF2. The complementary NheI-KpnI fragment containing all other exons and the 3’ UTR (‘Ci Fragment 1’) was cloned into BSK cut with SpeI and KpnI to create BSK-CiF1. BSK-CiF2 was cut with NotI and Bsp1201 to clone the whole CiF2 fragment into the P[acman]-CmR vector cut with NotI, so that RsrII and PmeI vector sites were downstream of <italic>ci</italic> first intron sequences in RP-CiF2. CiF1 was amplified from BSK-CiF1 by long-range PCR using PfuUltraII Fusion HS DNA polymerase (Agilent Technologies), adding RsrII and PmeI at either end and cloning the product into a Zero Blunt Topo cloning vector (Invitrogen). The RsrII-PmeI fragment was then cloned into RP-CiF2 cut with the same enzyme to create the final Pacman vector containing the entire 16 kb genomic ci DNA. The 28 kb <italic>gCi attPacman</italic> transgene was then inserted at the <italic>att ZH-86Fb</italic> landing site at cytological location 86F8 (Rainbow Transgenic Services).</p></sec><sec id="s4-2"><title>Cloning for generating CRISPR alleles</title><sec id="s4-2-1"><title>First round of CRISPR</title><p>A 5kb <italic>mini-white</italic> gene from the <italic>attPacman</italic> construct was cloned into the first intron of ‘Ci Fragment 1’ with the enzyme AaII. The PAM sites associated with guide RNA 1 (TGG-&gt;TGA) and guide RNA 2(TGG-&gt;TTG) were mutated on ‘Ci-Fragment 1’ in the Ci first intron. guide RNA 1 <named-content content-type="sequence">TCACCCAAAAATCTCGTATT</named-content> and guide RNA 2 <named-content content-type="sequence">ATATATATACAAGAGTTCCT</named-content> were cloned in pU6 chiRNA vectors separately. The donor template, guide RNA 1, and guide RNA two were then co-injected into fly embryos (<italic>wlig4; attp40 [nos-Cas9]/Cyo</italic>). Flies and guide RNA vectors were obtained from the Mann Lab and injections were carried out using Rainbow Transgenic Services. The injected flies were crossed to <italic>yw hs-flp; Sp/Cyo; TM2/TM6B; Dp[y+]/Dp[y+]</italic> flies (<italic>Dp[y<sup>+</sup>]</italic> is used throughout as an abbreviation for <italic>Dp(1;4)1021[y<sup>+</sup>]sv<sup>spa-pol</sup></italic>) and progeny screened for male flies that were white<sup>+</sup>. The transformants were balanced and further genotyped to confirm correct placement of the <italic>mini-white</italic> gene (reverse coding orientation compared to <italic>ci</italic>) in the intron. The <italic>ci-[w<sup>+</sup>]</italic> flies (4<sup>th</sup> chromosome) were used to create a stock, <italic>wlig4; attp40 [nos-Cas9]/Cyo; ci-[w<sup>+</sup>]/ci-[w<sup>+</sup>]</italic>.</p></sec><sec id="s4-2-2"><title>Second round of CRISPR</title><p>‘Ci Fragment 1’ was repurposed as donor construct by adding 500 bp extra on the 3’UTR region to create a 1.1 Kb homology region outside of guide RNA 3 and 2 kb homology region outside of guide RNA 4. PAM sites were altered on the donor construct for guide RNA 3 (GGG-&gt;CCG) and guide RNA 4 (CGG-&gt;CAG). guide RNA 3 (<named-content content-type="sequence">GGGCTTACGCCGGTATTAG</named-content>) and guide RNA 4 (<named-content content-type="sequence">GCTTTGGGTGTAGGAGCGTC</named-content>) were cloned into a dual U6 (1+three promoter) expression construct pCFD4 provided by the Mann lab using Gibson assembly (New England Biolabs). The donor construct and the guide RNA construct were injected into <italic>wlig4; attp40 [nos-Cas9]/Cyo; ci-[w<sup>+</sup>]/ci-[w<sup>+</sup>]</italic> embryos. Surviving adults were crossed to <italic>yw hs-flp; Sp/Cyo; TM2/TM6B; Dp[y+]/Dp[y+]</italic> flies. Male <italic>crCi/Dp[y+]</italic> ‘transformants’ were identified by white eyes, amplified into suitable stocks and genotyped for sequences encoding Flag and HA tags upstream and downstream of <italic>ci</italic> coding sequence, respectively. Balanced <italic>ci</italic> alleles were further genotyped to confirm the mutation of interest.</p></sec></sec><sec id="s4-3"><title>Donor template cloning</title><p>For crCi-WT, ∆CORD, P(1-3)A, S849A, S849A∆CORD, ∆1270–1370, ∆CDN, ∆CDN∆CORD plasmid design was developed using APE software. Overlapping primer PCR reactions were used to add, mutate, and delete regions on Ci with PfuUltraII Fusion HS DNA polymerase (Agilent Technologies). PCR products were introduced into the Zero Blunt Topo cloning vector (Invitrogen). The alterations in Ci were then re-introduced from the Zero Blunt Topo cloning Vector into the BSK-F1 Donor construct using compatible enzymes or Gibson Assembly (New England Biolabs). The final constructs were fully sequenced (Genewiz).</p></sec><sec id="s4-4"><title><italic>Drosophila</italic> stocks</title><p><italic>Drosophila</italic> stocks were maintained on standard cornmeal/molasses/agar medium at room temperature.</p><p>Females of the genotype <italic>yw hs-flp; ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to <italic>yw hs-flp; Sp/Cyo; gCi-WT/∆CORD/S849A; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> males, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with third chromosome transgenes as the only source of Ci.</p><p>Females of the <italic>genotype yw hs-flp; ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to <italic>yw hs-flp; Sp/Cyo; crCi-X/Dp[y<sup>+</sup>]</italic> males, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with a single constructed <italic>crCi</italic> allele as the only source of Ci.</p><p>Females of the genotype <italic>yw hs-flp; Su(fu)<sup>LP</sup> ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to <italic>yw hs-flp; Sp/Cyo; Su(fu)<sup>LP</sup>/TM6B, Tb; crCi-X/Dp[y<sup>+</sup>]</italic> males, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with a single constructed <italic>crCi</italic> allele as the only source of Ci in a <italic>Su(fu)</italic> null background.</p><p>Females of the genotype (‘2L’) <italic>yw hs-flp UAS-GFP; tub-Gal80 FRT40A/Cyo; C765-GAL4 ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to males of the genotype <italic>yw hs-flp; pka-C1<sup>H2</sup> FRT40A/Cyo; gCi-WT/∆CORD/S849A/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> or <italic>yw hs-flp; pka-C1<sup>H2</sup> FRT40A/Cyo; crCi-X/Dp[y<sup>+</sup>]</italic>, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with a single constructed <italic>crCi</italic> allele as the only source of Ci and GFP-marked <italic>pka</italic> mutant clones.</p><p>Females of the genotype (‘2b’) <italic>yw hs-flp UAS-GFP; FRT42D P[Ci<sup>+</sup>] tub-Gal80/Cyo; C765-GAL4 ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to males of the genotype <italic>yw hs-flp; FRT42D/Cyo; crCi-X/Dp[y<sup>+</sup>]</italic>, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with a single constructed <italic>crCi</italic> allele as the only source of Ci in GFP-marked clones lacking <italic>P[Ci<sup>+</sup>]</italic> with neighboring cells including <italic>P[Ci<sup>+</sup>]</italic>.</p><p>Females of the genotype (‘2b’) <italic>yw hs-flp UAS-GFP; FRT42D P[Ci<sup>+</sup>] tub-Gal80/Cyo; C765-GAL4 ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to males of the genotype <italic>yw hs-flp; FRT42D cos2<sup>2</sup>/Cyo; gCi-WT/∆CORD/S849A/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> or <italic>yw hs-flp; FRT42D cos2<sup>2</sup>/Cyo; crCi-X/Dp[y<sup>+</sup>]</italic>, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with a single constructed <italic>crCi</italic> allele as the only source of Ci in GFP-marked clones lacking <italic>cos2</italic> activity and <italic>P[Ci<sup>+</sup>]</italic> with neighboring cells expressing <italic>P[Ci<sup>+</sup>]</italic>.</p><p>Females of the genotype (‘2b’) <italic>yw hs-flp UAS-GFP; FRT42D P[Ci<sup>+</sup>] tub-Gal80/Cyo; C765-GAL4 ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to males of the genotype <italic>yw hs-flp; smo<sup>2</sup> FRT42D UAS-GAP-Fu/Cyo; crCi-X/Dp[y<sup>+</sup>]</italic>, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with a single constructed <italic>crCi</italic> allele as the only source of Ci in GFP-marked clones expressing GAP-Fu and lacking <italic>P[Ci<sup>+</sup>]</italic> with neighboring cells expressing <italic>P[Ci<sup>+</sup>]</italic>.</p><p>Females of the genotype (‘2R’) <italic>yw hs-flp UAS-GFP; smo<sup>2</sup> FRT42D P[Smo<sup>+</sup>] tub-Gal80/Cyo; C765-GAL4 ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to males of the genotype <italic>yw hs-flp; FRT42D cos2<sup>2</sup>/Cyo; crCi-X/Dp[y<sup>+</sup>]</italic>, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with a single constructed <italic>crCi</italic> allele as the only source of Ci and GFP-marked clones lacking <italic>cos2</italic> activity.</p><p>Females of the genotype (‘2R’) <italic>yw hs-flp UAS-GFP; smo<sup>2</sup> FRT42D P[Smo<sup>+</sup>] tub-Gal80/Cyo; C765-GAL4 ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to males of the genotype <italic>yw hs-flp; smo<sup>2</sup> FRT42D UAS-GAP-Fu/Cyo; crCi-X/Dp[y<sup>+</sup>]</italic>, selecting third instar larval progeny lacking <italic>y<sup>+</sup></italic> and <italic>Tb</italic> to obtain wing discs with a single constructed <italic>crCi</italic> allele as the only source of Ci in GFP-marked clones expressing GAP-Fu and lacking <italic>smo</italic> activity.</p><p>Females of the genotype <italic>yw hs-flp fu<sup>mH63</sup>; FRT42D P[y<sup>+</sup>] P[Fu+]/Cyo; (Su(fu)<sup>LP</sup>) C765-GAL4 ptc-lacZ/TM6B, Tb; ci<sup>94</sup>/Dp[y<sup>+</sup>]</italic> were crossed to males of the genotype <italic>yw hs-flp; Sp/Cyo; (Su(fu)<sup>LP</sup>/TM6B); crCi-X/Dp[y<sup>+</sup>]</italic>, selecting male third instar larval progeny lacking y<sup>+</sup> and Tb to obtain wing discs lacking Fu kinase activity (with or without functional Su(fu)) and a single constructed <italic>crCi</italic> allele as the only source of Ci.</p></sec><sec id="s4-5"><title>Immunohistochemistry</title><p>Wing disc clones were generated by heat-shocking late first or early second instar larvae for 1 hr at 37°C and dissections took place 3.5 to 4 days later in wandering third instar larvae. Wing discs were dissected from late third instar larvae in PBS and fixed in 4% paraformaldehyde (in PBS) for 30 min, rinsed 3X with PBS, blocked with 10% normal goat serum (Jackson ImmunoResearch Laboratories, Inc) in PBS-T (0.1% Triton) for 1 hr, and stained with the following primary antibodies: rabbit anti–β-galactosidase (1:10,000; MP Biomedicals), mouse 4D9 anti-Engrailed (1:5 Developmental Studies Hybridoma Bank), Rat 2A1 anti-Ci (1:3 Developmental Studies Hybridoma Bank), overnight at 4°. Inverted Larvae were then washed three times in PBST for 10 min each and incubated with Alexa Fluor 488, 546, 594, or 647 secondary antibodies (1:1000; Molecular Probes) for 1 hr at room temperature. Larvae were washed twice in PBST for 20 min each, once in PBS for 10 min and mounted in Aqua/Poly mount (Polysciences).</p></sec><sec id="s4-6"><title>Quantitation from fluorescent images</title><p>Fluorescence images were captured using 20x, 63x, or 40x (discs with far anterior clones) objectives using 1.4 NA oil immersion lenses on a confocal microscope (LSM 700 and LSM800; Carl Zeiss). The range indicator was used to set the appropriate laser intensity per experiment for each fluorophore such that the signal was in the linear range.</p><p>Intensity Profiles: To measure intensity profiles along the AP axis, an elongated rectangle was drawn on a central region of the wing pouch, avoiding the D/V border. The y-axis shows the average fluorescence intensity over the height of the rectangle at each point on the x-axis (AP axis) for <italic>ptc-lacZ</italic> expression or Ci-155 protein, measured using Image J software (NIH, Bethesda, Maryland). In general, three wings discs per condition were measured and averaged for each plot, using the posterior edge of <italic>ptc-lacZ</italic> expression as a reference point for the AP border.</p><p>Clone Measurements: The average fluorescent intensity of <italic>ptc-lacZ</italic> or Ci-155 over specific regions was measured using Image J. Multiple clones or clone regions (for large clones), anterior regions (most commonly three per disc), AP border sections (three per disc), posterior regions (three per disc), were analyzed for each disc. To make sure the best region was acquired for measurements in clones, the region was selected using the GFP marker in the central part of the clone and confirmed to not be on a fold or shadowed region. For the AP border, regions were measured avoiding the DV boundary and abnormal folds. For <xref ref-type="fig" rid="fig4">Figures 4</xref> and <xref ref-type="fig" rid="fig6">6</xref>, <italic>ptc-lacZ</italic> clone intensity was calculated relative to AP border levels after subtracting anterior cell intensity values from each because <italic>ptc-lacZ</italic> is sometimes expressed artifactually in posterior cells: (clone-averaged anterior)/(averaged AP border-averaged anterior). In <xref ref-type="fig" rid="fig5">Figure 5</xref> <italic>ptc-lacZ</italic> intensity in clones and anterior cells outside clones was in each case divided by AP border intensity without any subtractions. Ci-155 clone intensity and intensity in anterior cells outside clones (<xref ref-type="fig" rid="fig4">Figure 4</xref>) were calculated relative to AP border levels after subtracting posterior cell intensity values from each: (clone-averaged posterior)/(averaged AP border-averaged posterior) and (anterior-averaged posterior)/(averaged AP border-averaged posterior). For <xref ref-type="fig" rid="fig5">Figure 5</xref>, <italic>ptc-lacZ</italic> intensity measurements in clones and anterior regions were divided by the AP-Border.</p></sec><sec id="s4-7"><title>Adult wings</title><p>Adult wings were pulled off anaesthetized flies and placed in 70% ethanol for 5 min, transferred to 100% ethanol, and then mounted in Aqua/Poly Mount (Polysciences). They were imaged with Transmitted Light on a Nikon Diaphot 300 microscope using a 10x objective.</p></sec><sec id="s4-8"><title>Statistics and reproducibility</title><p>All images shown are representative of at least five examples. No statistical method was used to predetermine sample size but we used prior experience to establish sufficient sample sizes. No samples were excluded from analysis, provided staining was of high quality. The experiments were not randomized; samples presented as groups in the results were often all part of the same experiment and were always treated in exactly analogous ways without regard to the identity of the sample. Investigators were not blinded during outcome assessment, but had no pre-conception of what the outcomes might be. For comparisons between the measured levels of <italic>ptc-lacZ</italic> product or Ci-155 a t-test was used to determine significance between pairs of genotypes (generally Ci variant versus wild-type Ci), and the errors for individual values determined from multiple samples was reported as the standard error of the mean.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>This work was supported by NIH RO1 GM041815 awarded to DK. We thank Aaron Choi, Jason Li and Sarah Finkelstein for research assistance, Hoyon Kim and other lab members for continued discussions and input, Rebecca Delker and Dr. Richard Mann for advice on CRISPR engineering, the Bloomington stock center for provision of genetic reagents, the Developmental Studies Hybridoma Bank (DSHB) for antibodies, FlyBase as an information resource, and the confocal microscope resource provided by the Dept. of Biological Sciences, Columbia University.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Resources, Software, Investigation, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Investigation, Visualization, Writing - review and editing</p></fn><fn fn-type="con" id="con4"><p>Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="docx" mimetype="application" xlink:href="elife-61083-transrepform-v2.docx"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>All data reported in this study are included in the manuscript and supporting files.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Alves</surname> <given-names>G</given-names></name><name><surname>Limbourg-Bouchon</surname> <given-names>B</given-names></name><name><surname>Tricoire</surname> <given-names>H</given-names></name><name><surname>Brissard-Zahraoui</surname> <given-names>J</given-names></name><name><surname>Lamour-Isnard</surname> <given-names>C</given-names></name><name><surname>Busson</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Modulation of hedgehog target gene expression by the fused serine-threonine kinase in wing imaginal discs</article-title><source>Mechanisms of Development</source><volume>78</volume><fpage>17</fpage><lpage>31</lpage><pub-id pub-id-type="doi">10.1016/S0925-4773(98)00130-0</pub-id><pub-id pub-id-type="pmid">9858670</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Anderson</surname> <given-names>E</given-names></name><name><surname>Peluso</surname> <given-names>S</given-names></name><name><surname>Lettice</surname> <given-names>LA</given-names></name><name><surname>Hill</surname> <given-names>RE</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Human limb abnormalities caused by disruption of hedgehog signaling</article-title><source>Trends in Genetics</source><volume>28</volume><fpage>364</fpage><lpage>373</lpage><pub-id pub-id-type="doi">10.1016/j.tig.2012.03.012</pub-id><pub-id pub-id-type="pmid">22534646</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aza-Blanc</surname> <given-names>P</given-names></name><name><surname>Ramírez-Weber</surname> <given-names>FA</given-names></name><name><surname>Laget</surname> <given-names>MP</given-names></name><name><surname>Schwartz</surname> <given-names>C</given-names></name><name><surname>Kornberg</surname> <given-names>TB</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>Proteolysis that is inhibited by hedgehog targets cubitus interruptus protein to the nucleus and converts it to a repressor</article-title><source>Cell</source><volume>89</volume><fpage>1043</fpage><lpage>1053</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)80292-5</pub-id><pub-id pub-id-type="pmid">9215627</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Biehs</surname> <given-names>B</given-names></name><name><surname>Kechris</surname> <given-names>K</given-names></name><name><surname>Liu</surname> <given-names>S</given-names></name><name><surname>Kornberg</surname> <given-names>TB</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Hedgehog targets in the <italic>Drosophila</italic> embryo and the mechanisms that generate tissue-specific outputs of hedgehog signaling</article-title><source>Development</source><volume>137</volume><fpage>3887</fpage><lpage>3898</lpage><pub-id pub-id-type="doi">10.1242/dev.055871</pub-id><pub-id pub-id-type="pmid">20978080</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Blair</surname> <given-names>SS</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Engrailed expression in the anterior lineage compartment of the developing wing blade of <italic>Drosophila</italic></article-title><source>Development</source><volume>115</volume><fpage>21</fpage><lpage>33</lpage><pub-id pub-id-type="pmid">1353439</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Blair</surname> <given-names>SS</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Lineage compartments in <italic>Drosophila</italic></article-title><source>Current Biology</source><volume>13</volume><fpage>R548</fpage><lpage>R551</lpage><pub-id pub-id-type="doi">10.1016/S0960-9822(03)00469-X</pub-id><pub-id pub-id-type="pmid">12867045</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Briscoe</surname> <given-names>J</given-names></name><name><surname>Thérond</surname> <given-names>PP</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>The mechanisms of hedgehog signalling and its roles in development and disease</article-title><source>Nature Reviews Molecular Cell Biology</source><volume>14</volume><fpage>416</fpage><lpage>429</lpage><pub-id pub-id-type="doi">10.1038/nrm3598</pub-id><pub-id pub-id-type="pmid">23719536</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname> <given-names>Y</given-names></name><name><surname>Struhl</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Dual roles for patched in sequestering and transducing hedgehog</article-title><source>Cell</source><volume>87</volume><fpage>553</fpage><lpage>563</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)81374-4</pub-id><pub-id pub-id-type="pmid">8898207</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Claret</surname> <given-names>S</given-names></name><name><surname>Sanial</surname> <given-names>M</given-names></name><name><surname>Plessis</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Evidence for a novel feedback loop in the hedgehog pathway involving smoothened and fused</article-title><source>Current Biology</source><volume>17</volume><fpage>1326</fpage><lpage>1333</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2007.06.059</pub-id><pub-id pub-id-type="pmid">17658259</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cortes</surname> <given-names>JE</given-names></name><name><surname>Gutzmer</surname> <given-names>R</given-names></name><name><surname>Kieran</surname> <given-names>MW</given-names></name><name><surname>Solomon</surname> <given-names>JA</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Hedgehog signaling inhibitors in solid and hematological cancers</article-title><source>Cancer Treatment Reviews</source><volume>76</volume><fpage>41</fpage><lpage>50</lpage><pub-id pub-id-type="doi">10.1016/j.ctrv.2019.04.005</pub-id><pub-id pub-id-type="pmid">31125907</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Denef</surname> <given-names>N</given-names></name><name><surname>Neubüser</surname> <given-names>D</given-names></name><name><surname>Perez</surname> <given-names>L</given-names></name><name><surname>Cohen</surname> <given-names>SM</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Hedgehog induces opposite changes in turnover and subcellular localization of patched and smoothened</article-title><source>Cell</source><volume>102</volume><fpage>521</fpage><lpage>531</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)00056-8</pub-id><pub-id pub-id-type="pmid">10966113</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Domínguez</surname> <given-names>M</given-names></name><name><surname>Brunner</surname> <given-names>M</given-names></name><name><surname>Hafen</surname> <given-names>E</given-names></name><name><surname>Basler</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Sending and receiving the hedgehog signal: control by the <italic>Drosophila</italic> gli protein cubitus interruptus</article-title><source>Science</source><volume>272</volume><fpage>1621</fpage><lpage>1625</lpage><pub-id pub-id-type="doi">10.1126/science.272.5268.1621</pub-id><pub-id pub-id-type="pmid">8658135</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Eaton</surname> <given-names>S</given-names></name><name><surname>Kornberg</surname> <given-names>TB</given-names></name></person-group><year iso-8601-date="1990">1990</year><article-title>Repression of ci-D in posterior compartments of <italic>Drosophila</italic> by engrailed</article-title><source>Genes &amp; Development</source><volume>4</volume><fpage>1068</fpage><lpage>1077</lpage><pub-id pub-id-type="doi">10.1101/gad.4.6.1068</pub-id><pub-id pub-id-type="pmid">2384212</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Forbes</surname> <given-names>AJ</given-names></name><name><surname>Nakano</surname> <given-names>Y</given-names></name><name><surname>Taylor</surname> <given-names>AM</given-names></name><name><surname>Ingham</surname> <given-names>PW</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Genetic analysis of hedgehog signalling in the <italic>Drosophila</italic> embryo</article-title><source>Development</source><volume>119</volume><fpage>115</fpage><lpage>124</lpage></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Garcia-Garcia</surname> <given-names>E</given-names></name><name><surname>Little</surname> <given-names>JC</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>The exon junction complex and Srp54 contribute to hedgehog signaling via <italic>ci</italic> RNA Splicing in <italic>Drosophila melanogaster</italic></article-title><source>Genetics</source><volume>206</volume><fpage>2053</fpage><lpage>2068</lpage><pub-id pub-id-type="doi">10.1534/genetics.117.202457</pub-id><pub-id pub-id-type="pmid">28637711</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huangfu</surname> <given-names>D</given-names></name><name><surname>Anderson</surname> <given-names>KV</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Signaling from smo to ci/Gli: conservation and divergence of hedgehog pathways from <italic>Drosophila</italic> to vertebrates</article-title><source>Development</source><volume>133</volume><fpage>3</fpage><lpage>14</lpage><pub-id pub-id-type="doi">10.1242/dev.02169</pub-id><pub-id pub-id-type="pmid">16339192</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hui</surname> <given-names>CC</given-names></name><name><surname>Angers</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Gli proteins in development and disease</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>27</volume><fpage>513</fpage><lpage>537</lpage><pub-id pub-id-type="doi">10.1146/annurev-cellbio-092910-154048</pub-id><pub-id pub-id-type="pmid">21801010</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Humke</surname> <given-names>EW</given-names></name><name><surname>Dorn</surname> <given-names>KV</given-names></name><name><surname>Milenkovic</surname> <given-names>L</given-names></name><name><surname>Scott</surname> <given-names>MP</given-names></name><name><surname>Rohatgi</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>The output of hedgehog signaling is controlled by the dynamic association between suppressor of fused and the gli proteins</article-title><source>Genes &amp; Development</source><volume>24</volume><fpage>670</fpage><lpage>682</lpage><pub-id pub-id-type="doi">10.1101/gad.1902910</pub-id><pub-id pub-id-type="pmid">20360384</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ingham</surname> <given-names>PW</given-names></name><name><surname>McMahon</surname> <given-names>AP</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Hedgehog signaling in animal development: paradigms and principles</article-title><source>Genes &amp; Development</source><volume>15</volume><fpage>3059</fpage><lpage>3087</lpage><pub-id pub-id-type="doi">10.1101/gad.938601</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jia</surname> <given-names>J</given-names></name><name><surname>Zhang</surname> <given-names>L</given-names></name><name><surname>Zhang</surname> <given-names>Q</given-names></name><name><surname>Tong</surname> <given-names>C</given-names></name><name><surname>Wang</surname> <given-names>B</given-names></name><name><surname>Hou</surname> <given-names>F</given-names></name><name><surname>Amanai</surname> <given-names>K</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Phosphorylation by double-time/CKIepsilon and CKIalpha targets cubitus interruptus for slimb/beta-TRCP-mediated proteolytic processing</article-title><source>Developmental Cell</source><volume>9</volume><fpage>819</fpage><lpage>830</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2005.10.006</pub-id><pub-id pub-id-type="pmid">16326393</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Regulation of hh/Gli signaling by dual ubiquitin pathways</article-title><source>Cell Cycle</source><volume>5</volume><fpage>2457</fpage><lpage>2463</lpage><pub-id pub-id-type="doi">10.4161/cc.5.21.3406</pub-id><pub-id pub-id-type="pmid">17102630</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jiang</surname> <given-names>J</given-names></name><name><surname>Struhl</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Regulation of the hedgehog and wingless signalling pathways by the F-box/WD40-repeat protein slimb</article-title><source>Nature</source><volume>391</volume><fpage>493</fpage><lpage>496</lpage><pub-id pub-id-type="doi">10.1038/35154</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Hedgehog signaling: a smoothened conformational switch</article-title><source>Current Biology</source><volume>18</volume><fpage>R64</fpage><lpage>R66</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2007.11.035</pub-id><pub-id pub-id-type="pmid">18211840</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kent</surname> <given-names>D</given-names></name><name><surname>Bush</surname> <given-names>EW</given-names></name><name><surname>Hooper</surname> <given-names>JE</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Roadkill attenuates hedgehog responses through degradation of cubitus interruptus</article-title><source>Development</source><volume>133</volume><fpage>2001</fpage><lpage>2010</lpage><pub-id pub-id-type="doi">10.1242/dev.02370</pub-id><pub-id pub-id-type="pmid">16651542</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kong</surname> <given-names>JH</given-names></name><name><surname>Siebold</surname> <given-names>C</given-names></name><name><surname>Rohatgi</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Biochemical mechanisms of vertebrate hedgehog signaling</article-title><source>Development</source><volume>146</volume><elocation-id>dev166892</elocation-id><pub-id pub-id-type="doi">10.1242/dev.166892</pub-id><pub-id pub-id-type="pmid">31092502</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lawrence</surname> <given-names>PA</given-names></name><name><surname>Struhl</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Morphogens, compartments, and pattern: lessons from <italic>Drosophila?</italic></article-title><source>Cell</source><volume>85</volume><fpage>951</fpage><lpage>961</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)81297-0</pub-id><pub-id pub-id-type="pmid">8674123</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname> <given-names>RT</given-names></name><name><surname>Zhao</surname> <given-names>Z</given-names></name><name><surname>Ingham</surname> <given-names>PW</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Hedgehog signalling</article-title><source>Development</source><volume>143</volume><fpage>367</fpage><lpage>372</lpage><pub-id pub-id-type="doi">10.1242/dev.120154</pub-id><pub-id pub-id-type="pmid">26839340</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>S</given-names></name><name><surname>Ma</surname> <given-names>G</given-names></name><name><surname>Wang</surname> <given-names>B</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Hedgehog induces formation of PKA-Smoothened complexes to promote smoothened phosphorylation and pathway activation</article-title><source>Science Signaling</source><volume>7</volume><elocation-id>ra62</elocation-id><pub-id pub-id-type="doi">10.1126/scisignal.2005414</pub-id><pub-id pub-id-type="pmid">24985345</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>C</given-names></name><name><surname>Zhou</surname> <given-names>Z</given-names></name><name><surname>Yao</surname> <given-names>X</given-names></name><name><surname>Chen</surname> <given-names>P</given-names></name><name><surname>Sun</surname> <given-names>M</given-names></name><name><surname>Su</surname> <given-names>M</given-names></name><name><surname>Chang</surname> <given-names>C</given-names></name><name><surname>Yan</surname> <given-names>J</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name><name><surname>Zhang</surname> <given-names>Q</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Hedgehog signaling downregulates suppressor of fused through the HIB/SPOP-Crn Axis in <italic>Drosophila</italic></article-title><source>Cell Research</source><volume>24</volume><fpage>595</fpage><lpage>609</lpage><pub-id pub-id-type="doi">10.1038/cr.2014.29</pub-id><pub-id pub-id-type="pmid">24603360</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Proteostasis in the hedgehog signaling pathway</article-title><source>Seminars in Cell &amp; Developmental Biology</source><volume>93</volume><fpage>153</fpage><lpage>163</lpage><pub-id pub-id-type="doi">10.1016/j.semcdb.2018.10.009</pub-id><pub-id pub-id-type="pmid">31429406</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maier</surname> <given-names>D</given-names></name><name><surname>Cheng</surname> <given-names>S</given-names></name><name><surname>Faubert</surname> <given-names>D</given-names></name><name><surname>Hipfner</surname> <given-names>DR</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>A broadly conserved g-protein-coupled receptor kinase phosphorylation mechanism <italic>controls Drosophila</italic> smoothened activity</article-title><source>PLOS Genetics</source><volume>10</volume><elocation-id>e1004399</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.1004399</pub-id><pub-id pub-id-type="pmid">25009998</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Méthot</surname> <given-names>N</given-names></name><name><surname>Basler</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Hedgehog controls limb development by regulating the activities of distinct transcriptional activator and repressor forms of cubitus interruptus</article-title><source>Cell</source><volume>96</volume><fpage>819</fpage><lpage>831</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)80592-9</pub-id><pub-id pub-id-type="pmid">10102270</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Méthot</surname> <given-names>N</given-names></name><name><surname>Basler</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Suppressor of fused opposes hedgehog signal transduction by impeding nuclear accumulation of the activator form of cubitus interruptus</article-title><source>Development</source><volume>127</volume><fpage>4001</fpage><lpage>4010</lpage><pub-id pub-id-type="pmid">10952898</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Méthot</surname> <given-names>N</given-names></name><name><surname>Basler</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>An absolute requirement for cubitus interruptus in hedgehog signaling</article-title><source>Development</source><volume>128</volume><fpage>733</fpage><lpage>742</lpage><pub-id pub-id-type="pmid">11171398</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mohler</surname> <given-names>J</given-names></name><name><surname>Seecoomar</surname> <given-names>M</given-names></name><name><surname>Agarwal</surname> <given-names>S</given-names></name><name><surname>Bier</surname> <given-names>E</given-names></name><name><surname>Hsai</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Activation of knot (kn) specifies the 3-4 intervein region in the <italic>Drosophila</italic> wing</article-title><source>Development</source><volume>127</volume><fpage>55</fpage><lpage>63</lpage><pub-id pub-id-type="pmid">10654600</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Müller</surname> <given-names>B</given-names></name><name><surname>Basler</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>The repressor and activator forms of cubitus interruptus control hedgehog target genes through common generic gli-binding sites</article-title><source>Development</source><volume>127</volume><fpage>2999</fpage><lpage>3007</lpage><pub-id pub-id-type="pmid">10862738</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nakano</surname> <given-names>Y</given-names></name><name><surname>Nystedt</surname> <given-names>S</given-names></name><name><surname>Shivdasani</surname> <given-names>AA</given-names></name><name><surname>Strutt</surname> <given-names>H</given-names></name><name><surname>Thomas</surname> <given-names>C</given-names></name><name><surname>Ingham</surname> <given-names>PW</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Functional domains and sub-cellular distribution of the hedgehog transducing protein smoothened in <italic>Drosophila</italic></article-title><source>Mechanisms of Development</source><volume>121</volume><fpage>507</fpage><lpage>518</lpage><pub-id pub-id-type="doi">10.1016/j.mod.2004.04.015</pub-id><pub-id pub-id-type="pmid">15172682</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ng</surname> <given-names>JM</given-names></name><name><surname>Curran</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The hedgehog's tale: developing strategies for targeting cancer</article-title><source>Nature Reviews. Cancer</source><volume>11</volume><fpage>493</fpage><lpage>501</lpage><pub-id pub-id-type="doi">10.1038/nrc3079</pub-id><pub-id pub-id-type="pmid">21614026</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Niewiadomski</surname> <given-names>P</given-names></name><name><surname>Kong</surname> <given-names>JH</given-names></name><name><surname>Ahrends</surname> <given-names>R</given-names></name><name><surname>Ma</surname> <given-names>Y</given-names></name><name><surname>Humke</surname> <given-names>EW</given-names></name><name><surname>Khan</surname> <given-names>S</given-names></name><name><surname>Teruel</surname> <given-names>MN</given-names></name><name><surname>Novitch</surname> <given-names>BG</given-names></name><name><surname>Rohatgi</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Gli protein activity is controlled by multisite phosphorylation in vertebrate hedgehog signaling</article-title><source>Cell Reports</source><volume>6</volume><fpage>168</fpage><lpage>181</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2013.12.003</pub-id><pub-id pub-id-type="pmid">24373970</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ohlmeyer</surname> <given-names>JT</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Hedgehog stimulates maturation of cubitus interruptus into a labile transcriptional activator</article-title><source>Nature</source><volume>396</volume><fpage>749</fpage><lpage>753</lpage><pub-id pub-id-type="doi">10.1038/25533</pub-id><pub-id pub-id-type="pmid">9874371</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pak</surname> <given-names>E</given-names></name><name><surname>Segal</surname> <given-names>RA</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Hedgehog signal transduction: key players, oncogenic drivers, and Cancer therapy</article-title><source>Developmental Cell</source><volume>38</volume><fpage>333</fpage><lpage>344</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2016.07.026</pub-id><pub-id pub-id-type="pmid">27554855</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parker</surname> <given-names>DS</given-names></name><name><surname>White</surname> <given-names>MA</given-names></name><name><surname>Ramos</surname> <given-names>AI</given-names></name><name><surname>Cohen</surname> <given-names>BA</given-names></name><name><surname>Barolo</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The cis-regulatory logic of hedgehog gradient responses: key roles for gli binding affinity, competition, and cooperativity</article-title><source>Science Signaling</source><volume>4</volume><elocation-id>ra38</elocation-id><pub-id pub-id-type="doi">10.1126/scisignal.2002077</pub-id><pub-id pub-id-type="pmid">21653228</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Petrova</surname> <given-names>R</given-names></name><name><surname>Joyner</surname> <given-names>AL</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Roles for hedgehog signaling in adult organ homeostasis and repair</article-title><source>Development</source><volume>141</volume><fpage>3445</fpage><lpage>3457</lpage><pub-id pub-id-type="doi">10.1242/dev.083691</pub-id><pub-id pub-id-type="pmid">25183867</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Préat</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Characterization of suppressor of fused a complete suppressor of the fused segment polarity gene of <italic>Drosophila melanogaster</italic></article-title><source>Genetics</source><volume>132</volume><fpage>725</fpage><lpage>736</lpage><pub-id pub-id-type="pmid">1468628</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Préat</surname> <given-names>T</given-names></name><name><surname>Thérond</surname> <given-names>P</given-names></name><name><surname>Limbourg-Bouchon</surname> <given-names>B</given-names></name><name><surname>Pham</surname> <given-names>A</given-names></name><name><surname>Tricoire</surname> <given-names>H</given-names></name><name><surname>Busson</surname> <given-names>D</given-names></name><name><surname>Lamour-Isnard</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Segmental polarity in <italic>Drosophila melanogaster</italic> genetic dissection of fused in a suppressor of fused background reveals interaction with costal-2</article-title><source>Genetics</source><volume>135</volume><fpage>1047</fpage><lpage>1062</lpage><pub-id pub-id-type="pmid">8307322</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Price</surname> <given-names>MA</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Proteolysis of cubitus interruptus in <italic>Drosophila</italic> requires phosphorylation by protein kinase A</article-title><source>Development</source><volume>126</volume><fpage>4331</fpage><lpage>4339</lpage></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Price</surname> <given-names>MA</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Proteolysis of the hedgehog signaling effector cubitus interruptus requires phosphorylation by glycogen synthase kinase 3 and casein kinase 1</article-title><source>Cell</source><volume>108</volume><fpage>823</fpage><lpage>835</lpage><pub-id pub-id-type="doi">10.1016/s0092-8674(02)00664-5</pub-id><pub-id pub-id-type="pmid">11955435</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ranieri</surname> <given-names>N</given-names></name><name><surname>Thérond</surname> <given-names>PP</given-names></name><name><surname>Ruel</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Switch of PKA substrates from cubitus interruptus to smoothened in the hedgehog signalosome complex</article-title><source>Nature Communications</source><volume>5</volume><elocation-id>5034</elocation-id><pub-id pub-id-type="doi">10.1038/ncomms6034</pub-id><pub-id pub-id-type="pmid">25289679</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sanial</surname> <given-names>M</given-names></name><name><surname>Bécam</surname> <given-names>I</given-names></name><name><surname>Hofmann</surname> <given-names>L</given-names></name><name><surname>Behague</surname> <given-names>J</given-names></name><name><surname>Argüelles</surname> <given-names>C</given-names></name><name><surname>Gourhand</surname> <given-names>V</given-names></name><name><surname>Bruzzone</surname> <given-names>L</given-names></name><name><surname>Holmgren</surname> <given-names>RA</given-names></name><name><surname>Plessis</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Dose-dependent transduction of hedgehog relies on phosphorylation-based feedback between the G-protein-coupled receptor smoothened and the kinase fused</article-title><source>Development</source><volume>144</volume><fpage>1841</fpage><lpage>1850</lpage><pub-id pub-id-type="doi">10.1242/dev.144782</pub-id><pub-id pub-id-type="pmid">28360132</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sasai</surname> <given-names>N</given-names></name><name><surname>Toriyama</surname> <given-names>M</given-names></name><name><surname>Kondo</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Hedgehog signal and genetic disorders</article-title><source>Frontiers in Genetics</source><volume>10</volume><elocation-id>1103</elocation-id><pub-id pub-id-type="doi">10.3389/fgene.2019.01103</pub-id><pub-id pub-id-type="pmid">31781166</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seong</surname> <given-names>KH</given-names></name><name><surname>Akimaru</surname> <given-names>H</given-names></name><name><surname>Dai</surname> <given-names>P</given-names></name><name><surname>Nomura</surname> <given-names>T</given-names></name><name><surname>Okada</surname> <given-names>M</given-names></name><name><surname>Ishii</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Inhibition of the nuclear import of cubitus interruptus by roadkill in the presence of strong hedgehog signal</article-title><source>PLOS ONE</source><volume>5</volume><elocation-id>e15365</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0015365</pub-id><pub-id pub-id-type="pmid">21179535</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seong</surname> <given-names>KH</given-names></name><name><surname>Ishii</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Su(fu) switches rdx functions to fine-tune hedgehog signaling in the <italic>Drosophila</italic> wing disk</article-title><source>Genes to Cells</source><volume>18</volume><fpage>66</fpage><lpage>78</lpage><pub-id pub-id-type="doi">10.1111/gtc.12018</pub-id><pub-id pub-id-type="pmid">23216924</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shi</surname> <given-names>Q</given-names></name><name><surname>Li</surname> <given-names>S</given-names></name><name><surname>Jia</surname> <given-names>J</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The Hedgehog-induced smoothened conformational switch assembles a signaling complex that activates fused by promoting its dimerization and phosphorylation</article-title><source>Development</source><volume>138</volume><fpage>4219</fpage><lpage>4231</lpage><pub-id pub-id-type="doi">10.1242/dev.067959</pub-id><pub-id pub-id-type="pmid">21852395</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Slusarski</surname> <given-names>DC</given-names></name><name><surname>Motzny</surname> <given-names>CK</given-names></name><name><surname>Holmgren</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Mutations that alter the timing and pattern of cubitus interruptus gene expression in <italic>Drosophila melanogaster</italic></article-title><source>Genetics</source><volume>139</volume><fpage>229</fpage><lpage>240</lpage><pub-id pub-id-type="pmid">7705626</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smelkinson</surname> <given-names>MG</given-names></name><name><surname>Zhou</surname> <given-names>Q</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Regulation of Ci-SCFSlimb binding, ci Proteolysis, and hedgehog pathway activity by ci phosphorylation</article-title><source>Developmental Cell</source><volume>13</volume><fpage>481</fpage><lpage>495</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2007.09.006</pub-id><pub-id pub-id-type="pmid">17925225</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smelkinson</surname> <given-names>MG</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Processing of the <italic>Drosophila</italic> hedgehog signaling effector Ci-155 to the repressor Ci-75 is mediated by direct binding to the SCF component slimb</article-title><source>Current Biology</source><volume>16</volume><fpage>110</fpage><lpage>116</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2005.12.012</pub-id><pub-id pub-id-type="pmid">16386907</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Strigini</surname> <given-names>M</given-names></name><name><surname>Cohen</surname> <given-names>SM</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>A hedgehog activity gradient contributes to AP axial patterning of the <italic>Drosophila</italic> wing</article-title><source>Development</source><volume>124</volume><fpage>4697</fpage><lpage>4705</lpage><pub-id pub-id-type="pmid">9409685</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thérond</surname> <given-names>P</given-names></name><name><surname>Alves</surname> <given-names>G</given-names></name><name><surname>Limbourg-Bouchon</surname> <given-names>B</given-names></name><name><surname>Tricoire</surname> <given-names>H</given-names></name><name><surname>Guillemet</surname> <given-names>E</given-names></name><name><surname>Brissard-Zahraoui</surname> <given-names>J</given-names></name><name><surname>Lamour-Isnard</surname> <given-names>C</given-names></name><name><surname>Busson</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Functional domains of fused a serine-threonine kinase required for signaling in <italic>Drosophila</italic></article-title><source>Genetics</source><volume>142</volume><fpage>1181</fpage><lpage>1198</lpage><pub-id pub-id-type="pmid">8846897</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tukachinsky</surname> <given-names>H</given-names></name><name><surname>Lopez</surname> <given-names>LV</given-names></name><name><surname>Salic</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>A mechanism for vertebrate hedgehog signaling: recruitment to cilia and dissociation of SuFu-Gli protein complexes</article-title><source>Journal of Cell Biology</source><volume>191</volume><fpage>415</fpage><lpage>428</lpage><pub-id pub-id-type="doi">10.1083/jcb.201004108</pub-id><pub-id pub-id-type="pmid">20956384</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vervoort</surname> <given-names>M</given-names></name><name><surname>Crozatier</surname> <given-names>M</given-names></name><name><surname>Valle</surname> <given-names>D</given-names></name><name><surname>Vincent</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>The COE transcription factor Collier is a mediator of short-range Hedgehog-induced patterning of the <italic>Drosophila</italic> wing</article-title><source>Current Biology</source><volume>9</volume><fpage>632</fpage><lpage>639</lpage><pub-id pub-id-type="doi">10.1016/S0960-9822(99)80285-1</pub-id><pub-id pub-id-type="pmid">10375526</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vervoort</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Hedgehog and wing development in <italic>Drosophila</italic>: a morphogen at work?</article-title><source>BioEssays</source><volume>22</volume><fpage>460</fpage><lpage>468</lpage><pub-id pub-id-type="doi">10.1002/(SICI)1521-1878(200005)22:5&lt;460::AID-BIES8&gt;3.0.CO;2-G</pub-id><pub-id pub-id-type="pmid">10797486</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>G</given-names></name><name><surname>Wang</surname> <given-names>B</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Protein kinase A antagonizes hedgehog signaling by regulating both the activator and repressor forms of cubitus interruptus</article-title><source>Genes &amp; Development</source><volume>13</volume><fpage>2828</fpage><lpage>2837</lpage><pub-id pub-id-type="doi">10.1101/gad.13.21.2828</pub-id><pub-id pub-id-type="pmid">10557210</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>G</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Multiple Cos2/Ci interactions regulate ci subcellular localization through microtubule dependent and independent mechanisms</article-title><source>Developmental Biology</source><volume>268</volume><fpage>493</fpage><lpage>505</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2004.01.008</pub-id><pub-id pub-id-type="pmid">15063184</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>Y</given-names></name><name><surname>Price</surname> <given-names>MA</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>A unique protection signal in cubitus interruptus prevents its complete proteasomal degradation</article-title><source>Molecular and Cellular Biology</source><volume>28</volume><fpage>5555</fpage><lpage>5568</lpage><pub-id pub-id-type="doi">10.1128/MCB.00524-08</pub-id><pub-id pub-id-type="pmid">18625727</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xiong</surname> <given-names>Y</given-names></name><name><surname>Liu</surname> <given-names>C</given-names></name><name><surname>Zhao</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Decoding ci: from partial degradation to inhibition</article-title><source>Development, Growth &amp; Differentiation</source><volume>57</volume><fpage>98</fpage><lpage>108</lpage><pub-id pub-id-type="doi">10.1111/dgd.12187</pub-id><pub-id pub-id-type="pmid">25495033</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zadorozny</surname> <given-names>EV</given-names></name><name><surname>Little</surname> <given-names>JC</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Contributions of costal 2-Fused interactions to hedgehog signaling in <italic>Drosophila</italic></article-title><source>Development</source><volume>142</volume><fpage>931</fpage><lpage>942</lpage><pub-id pub-id-type="doi">10.1242/dev.112904</pub-id><pub-id pub-id-type="pmid">25633354</pub-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>W</given-names></name><name><surname>Zhao</surname> <given-names>Y</given-names></name><name><surname>Tong</surname> <given-names>C</given-names></name><name><surname>Wang</surname> <given-names>G</given-names></name><name><surname>Wang</surname> <given-names>B</given-names></name><name><surname>Jia</surname> <given-names>J</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Hedgehog-regulated Costal2-kinase complexes control phosphorylation and proteolytic processing of cubitus interruptus</article-title><source>Developmental Cell</source><volume>8</volume><fpage>267</fpage><lpage>278</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2005.01.001</pub-id><pub-id pub-id-type="pmid">15691767</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>Q</given-names></name><name><surname>Zhang</surname> <given-names>L</given-names></name><name><surname>Wang</surname> <given-names>B</given-names></name><name><surname>Ou</surname> <given-names>CY</given-names></name><name><surname>Chien</surname> <given-names>CT</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>A hedgehog-induced BTB protein modulates hedgehog signaling by degrading ci/Gli transcription factor</article-title><source>Developmental Cell</source><volume>10</volume><fpage>719</fpage><lpage>729</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2006.05.004</pub-id><pub-id pub-id-type="pmid">16740475</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>Q</given-names></name><name><surname>Shi</surname> <given-names>Q</given-names></name><name><surname>Chen</surname> <given-names>Y</given-names></name><name><surname>Yue</surname> <given-names>T</given-names></name><name><surname>Li</surname> <given-names>S</given-names></name><name><surname>Wang</surname> <given-names>B</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Multiple ser/Thr-rich degrons mediate the degradation of ci/Gli by the Cul3-HIB/SPOP E3 ubiquitin ligase</article-title><source>PNAS</source><volume>106</volume><fpage>21191</fpage><lpage>21196</lpage><pub-id pub-id-type="doi">10.1073/pnas.0912008106</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>Y</given-names></name><name><surname>Mao</surname> <given-names>F</given-names></name><name><surname>Lu</surname> <given-names>Y</given-names></name><name><surname>Wu</surname> <given-names>W</given-names></name><name><surname>Zhang</surname> <given-names>L</given-names></name><name><surname>Zhao</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Transduction of the hedgehog signal through the dimerization of fused and the nuclear translocation of cubitus interruptus</article-title><source>Cell Research</source><volume>21</volume><fpage>1436</fpage><lpage>1451</lpage><pub-id pub-id-type="doi">10.1038/cr.2011.136</pub-id><pub-id pub-id-type="pmid">21844892</pub-id></element-citation></ref><ref id="bib71"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhao</surname> <given-names>Y</given-names></name><name><surname>Tong</surname> <given-names>C</given-names></name><name><surname>Jiang</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Hedgehog regulates smoothened activity by inducing a conformational switch</article-title><source>Nature</source><volume>450</volume><fpage>252</fpage><lpage>258</lpage><pub-id pub-id-type="doi">10.1038/nature06225</pub-id><pub-id pub-id-type="pmid">17960137</pub-id></element-citation></ref><ref id="bib72"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname> <given-names>Q</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Costal 2 interactions with cubitus interruptus (Ci) underlying Hedgehog-regulated ci processing</article-title><source>Developmental Biology</source><volume>348</volume><fpage>47</fpage><lpage>57</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2010.09.004</pub-id><pub-id pub-id-type="pmid">20850429</pub-id></element-citation></ref><ref id="bib73"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname> <given-names>Q</given-names></name><name><surname>Kalderon</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Hedgehog activates fused through phosphorylation to elicit a full spectrum of pathway responses</article-title><source>Developmental Cell</source><volume>20</volume><fpage>802</fpage><lpage>814</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2011.04.020</pub-id><pub-id pub-id-type="pmid">21664578</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.61083.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Desplan</surname><given-names>Claude</given-names></name><role>Reviewing Editor</role><aff><institution>New York University</institution><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Holmgren</surname><given-names>Bob</given-names> </name><role>Reviewer</role><aff><institution>Northwestern University</institution><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>Your manuscript addresses the regulation of the Ci transcriptional effector of the Hedgehog pathway: Ci is normally processed into a transcriptional repressor in the absence of ligand, but becomes an activator in the presence of Hedgehog. Your paper provides a novel view of the way the pathway functions: By showing that a Ci protein that cannot be processed still supports normal wing patterning shows that graded processing of Ci is not required: This indicates that there are two independent graded responses to the Hh signal and that regulation of full length Ci activity is sufficient to provide graded expression of target genes.</p><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;<italic>Drosophila</italic> Hedgehog can act as a morphogen in the absence of regulated Ci processing&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Utpal Banerjee as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Bob Holmgren (Reviewer #2).</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>The reviewers are quite positive about the paper that makes the very strong point that it is possible to obtain graded activation of engrailed and patched with uniform repressor, supporting your model that graded processing of Ci is not required, and that regulation of full length Ci activity is sufficient to provide graded expression of target genes. This demonstrates that there are two independent graded responses to the Hh signal.</p><p>Yet, there are some points that need to be addressed before the paper can be published:</p><p>– Ci degradation: Do you know that this is not due to transcriptional regulation of Ci itself? If you have not tested this, you should be more cautious in the way you present these data : If it is Ci transcription that is changing, you might be measuring regions with very high Hh signaling, or looking at constructs that do not support high signaling. You should test whether a <italic>UAS-Ci</italic> construct has weaker Ci in the zone of supposed degradation.</p><p>– Your work yields new questions about how Cos2 and PKA regulate Ci.</p><p>Attributing the effects of deleting CORD in PKA mutants to the lack of Cos2 binding is speculative (this is even in the Abstract). Although this is a potential explanation, other factors may be at work and must be discussed. You should look at whether <italic>cos2</italic> clones do or do not increase signaling in the background carrying the processing-deficient δ-CORD to show that the CORD domains are critical for Cos2-based inhibition. So far, we only know that removing the CORD domain strengthens the unknown PKA effect independently from Cos2.</p><p>– The results from Seoung showed that the boundary reduction of Ci is unaffected in clones homozygous for a Hib nonsense mutant. So it is not surprising that a mutant Ci that does not bind Hib is still reduced in the boundary zone. You must acknowledge and discuss explicitly any discrepancy with the Seoung et al. results.</p><p>– In general, the manuscript is very dense and difficult to follow, and extensive text editing will be necessary to clarify and address many of the reviewers' comments.</p><p>We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in <italic>eLife</italic> but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data.</p><p>Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in <italic>eLife</italic>, either of which would be linked to the original paper.</p><p><italic>Reviewer #1:</italic></p><p>The manuscript extends previous work by the author and others on the activity of Hh pathway in <italic>Drosophila</italic> wing discs, and how Hh components affect the activity and levels of the Ci transcription factor. While most previous work has been performed using altered UAS-Ci constructs, the present study has instead used engineered constructs expressed from endogenous Ci promoters; these express at endogenous levels, avoiding some possible artifacts of previous studies. They use mutant Ci constructs first to show that spatial regulation of Ci processing is not necessary for normal patterning. They then exploit processing deficient and other forms of Ci to examine processing-independent activities of Fu, Su(fu) and Cos2. The manuscript is dense and occasionally speculative, especially in these latter experiments. But the major points are certainly of interest to general readers. However, I had substantial difficulty with several portions of the manuscript that I think need to be clarified before I would recommend acceptance.</p><p>1) The authors spend some time examining a region of the disc with low Ci-155 levels that is induced by very high Hh levels and that most authors assume is caused by wholesale degradation of Ci, rather than processing into its repressor form. Here they show that Ci constructs that cannot bind to Hib, a Hh-induced ubiquitin ligase that is thought to degrade Ci, still have reduced levels just anterior to the AP where Hh signaling is high. However, a previous study has already shown that Ci levels remain low in this region after genetic removal of Hib (Seoung et al., 2010 Figure 3) so this result is not unexpected.</p><p>2) What is the evidence that this region of low Ci is caused by degradation? I ask because Blair '82 (Development) showed that at pupal stages the transcriptional marker ci-plac is reduced in this region; given the stability of βGal this could indicate an earlier loss of Ci transcription. Is there a published in situ of sufficient detail to resolve this point? Alternatively, is the region of reduced Ci seen using <italic>UAS-Ci</italic> constructs that are not regulated by Ci enhancers?</p><p>3) I had difficulty following the logic in the CORD domain section of the manuscript. Although the reasoning is not explained, the conclusion seems to be based on the idea that any Ci construct that increases the effects of a PKA mutant clone must have done so by removing the inhibitory activity of Cos2. Since Ci without the CORD domain has a stronger effect in PKA clones, the authors conclude that this form of Ci is not inhibited by Cos, and thus CORD is critical for Cos2 interactions. But is this really a valid assumption? Might not the CORD domain act in some other way?</p><p>The constructs that lack Cos2 binding domains can also be processed, so unlike the previous section the authors are not examining PKA and Cos2 effects that are independent of processing. Yet the Discussion seems to assume that this effect is the same as the processing-independent effect. While the authors do show that a Ci that lacks both processing and the CORD domain shows increased signaling, they do not examine whether this is mediated by PKA or Cos2.</p><p><italic>Reviewer #2:</italic></p><p>In Little et al. the authors generated a series of ci constructs, which are expressed at near physiological levels using either the endogenous promoter region or ci promoter transgenes. They use these constructs to assay various aspects of Hh signal transduction. There are two important conclusions in this paper; the first of which is profound. By combining a ci gene that encodes a protein that can't be processed with the ci<sup>Ce</sup> mutation, which constitutively expresses a repressor like form of Ci, normal wing patterning is restored. Thus, graded processing of Ci into the repressor is not required, and regulation of full-length Ci activity is sufficient to provide graded expression of target genes. This demonstrates that there are two independent graded responses to the Hh signal. The second result that Hib mediated proteolysis of Ci does not appear to be responsible for decreased Ci levels along the compartment boundary is also quite interesting and surprising. These data are excellent, and the experiments are well controlled, so the work does warrant publication in <italic>eLife</italic>.</p><p>The remaining experiments are less novel. GAP-Fu was shown to activate <italic>ptc-lacZ</italic> in Claret et al., 2007. In this paper the authors show that this effect responds to Ci protein levels.</p><p>The experiments examining regulation by PKA and Cos2 are worthwhile as this lab has shown in the past that overexpression experiments looking at Hh pathway signaling can be subject to artifacts. The authors confirm that PKA and Cos2 can negatively regulate Ci away from the compartment boundary and show that this regulation is not dependent on the three PKA sites involved in proteolytic processing (for PKA regulation) or the CDN and CORD domains for Cos2 regulation. A curious result is that deletion of the CORD domain augmented the activation of <italic>ptc-lacZ</italic> in PKA clones.</p><p><italic>Reviewer #3:</italic></p><p>This manuscript focuses on regulation of the Hedgehog (Hh) transcriptional effector Ci, which is processed to a truncated transcriptional repressor in the absence of ligand, and to a potent transcriptional activator in its presence. Studies are aimed at understanding how the Hh morphogen gradient is interpreted through Ci protein regulation in the <italic>Drosophila</italic> wing imaginal disc. Although this is a research area that has received much attention, prior studies were often performed using over-expressed proteins, calling into question whether the observed regulatory processes were indicative of how the protein is regulated at physiological levels. The strength of this manuscript is the use of CRISPR to alter the endogenous Ci gene so that studies could be carried out on physiologically-expressed protein in an in vivo system. Studies reveal that the Hh morphogen gradient can control activity of Ci to ensure proper wing development, even when regulated processing does not occur. The authors report that in addition to promoting processing of Ci to its truncated repressor species, Costal2 and PKA also contribute to Hh gradient interpretation by controlling Ci-155 activator function.</p><p>Overall, this is a well-executed study that corrects previous assumptions made about how the Ci activity gradient is controlled. The only experimental request I have is that a little more investigation be performed to determine how PKA is inhibiting Ci-155 activity if not through phosphorylating it to control repressor formation. A Ci PKA-insensitive mutant that lacks the phosphorylation sites to facilitate its conversion to repressor, can be further activated following PKA loss. There is speculation that an additional two known PKA sites might contribute to control of activity, but a Ci CORD domain mutant that lacks those 2 additional sites can also be activated by PKA loss. Can you determine whether this additional repression function by PKA depends upon its kinase activity, or is it a scaffolding/binding activity? Can you investigate what happens with a kinase dead PKA? Perhaps in clones?</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.61083.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>The reviewers are quite positive about the paper that makes the very strong point that it is possible to obtain graded activation of engrailed and patched with uniform repressor, supporting your model that graded processing of Ci is not required, and that regulation of full length Ci activity is sufficient to provide graded expression of target genes. This demonstrates that there are two independent graded responses to the Hh signal.</p><p>Yet, there are some points that need to be addressed before the paper can be published:</p><p>– Ci degradation: Do you know that this is not due to transcriptional regulation of Ci itself? If you have not tested this, you should be more cautious in the way you present these data : If it is Ci transcription that is changing, you might be measuring regions with very high Hh signaling, or looking at constructs that do not support high signaling. You should test whether a UAS-Ci construct has weaker Ci in the zone of supposed degradation.</p></disp-quote><p>We have changed the description of reduced Ci-155 levels close to the source of Hh (or reductions in other high pathway situations, such as GAP-Fu clones) to the literal observation of “Ci-155 reduction”. As reviewer 1 states, the reduction has commonly been attributed to full proteolytic degradation. That is a reasonable portrayal if the loss of Ci-155 is due to Rdx/Hib/Cul3 binding to Ci-155, followed by ubiquitination and proteolysis. However, that has never been demonstrated convincingly and the results we present suggest that is not the major means of Ci-155 reduction. Our evidence suggests that Su(fu) is necessary to observe reduced Ci-155 in this region. We suspect that is because Su(fu) protects Ci-155 from degradation and Hh reduces Ci/Su(fu) interactions but that remains a hypothesis. We therefore agree with the reviewer’s point that it is not appropriate to assume that the reduced Ci-155 is due to degradation, although that remains the most likely explanation. We discuss these issues and past findings relevant to potential non-proteolytic mechanisms in the Discussion.</p><p>The relevant results that we report are (i) the profile of CI-155 reduction, (ii) the lack of response to altering Rdx/Hib binding sites and (iii) the consequences of removing Su(fu). None of these conclusions requires knowledge or further exploration of the mechanism(s) underlying Hh-stimulated Ci-155 reduction.</p><p>The suggested experiment of using <italic>UAS-Ci</italic> to remove the variable of ci transcription is unfortunately not feasible because <italic>UAS-Ci</italic> transgenes do not support normal pathway activity (Garcia et al., 2017). That is the reason we are using CRISPR ci alleles (and the large amount of extra work that entails) to study the activity of Ci variants.</p><disp-quote content-type="editor-comment"><p>– Your work yields new questions about how Cos2 and PKA regulate Ci.</p><p>Attributing the effects of deleting CORD in PKA mutants to the lack of Cos2 binding is speculative (this is even in the Abstract). Although this is a potential explanation, other factors may be at work and must be discussed. You should look at whether cos2 clones do or do not increase signaling in the background carrying the processing-deficient δ-CORD to show that the CORD domains are critical for Cos2-based inhibition. So far, we only know that removing the CORD domain strengthens the unknown PKA effect independently from Cos2.</p></disp-quote><p>We have added to the discussion of inferences from deletion of the CORD domain along the lines suggested (including adding “likely” to the Abstract, internal headings and conclusions). We present the deduction that Cos2 inhibits Ci-155 by binding the CORD domain as the simplest and most likely explanation of our results, both at first mention and later.</p><p>I believe a key issue, not mentioned in the reviewers’ summary above, is that loss of the CORD domain increases the activity of processing-resistant Ci (with normal PKA and Cos2 activity). Loss of Cos2 also increases the activity of processing-resistant Ci. Loss of the CORD domain does not, however, change activity in cos2 mutant clones where there is no processing and no Cos2-CORD binding. The simplest explanation is that loss of cos2 and loss of CORD affect the same inhibitory interaction, namely Cos2-CORD binding. This line of reasoning and data always compare the activities of processing-resistant Ci and are all with normal PKA activity.</p><p>Testing processing-deficient Ci lacking the CORD domain in cos2 mutant clones would not test anything new (we already tested the effect of loss of CORD in cos2 mutant clones and there is no processing of any type of Ci in cos2 mutant clones). We did, nevertheless, intend to make the suggested test in order to be thorough. However, the double mutant Ci variant, as with other hyperactive variants, could not be manipulated to yield suitable animals to make the test despite several attempts.</p><p>The observation that Ci lacking the CORD domain had higher activity than wild-type Ci in pka mutant clones provides further evidence of the CORD domain being inhibitory when Ci-155 is not processed (this time in a situation where there is no PKA activity). This evidence is discussed first in the Results but the increased activity of processing-resistant Ci when CORD is deleted is more straightforward (because it does not involve the unknown consequences of eliminating PKA).</p><disp-quote content-type="editor-comment"><p>– The results from Seoung showed that the boundary reduction of Ci is unaffected in clones homozygous for a Hib nonsense mutant. So it is not surprising that a mutant Ci that does not bind Hib is still reduced in the boundary zone. You must acknowledge and discuss explicitly any discrepancy with the Seoung et al. results.</p></disp-quote><p>We now clarify that our test is different from all prior tests because it examines the consequences of direct actions of Rdx/Hib on Ci (by removing Rdx/Hib binding sites), rather than all actions of Rdx/Hib (by eliminating Rdx/Hib). The result (no significant change of Ci-155 in the posterior half of the AP border) was similar to the result of Seong examining all Rdx/Hib actions in null clones (which we cited previously). We also cite the two other studies that presented different results for Rdx/Hib clones. The discrepancy among Rdx/Hib clone phenotypes is present in the literature (the images themselves are not necessarily all compelling but the written conclusions are clearly different) and we do not attempt to resolve it. Our result, concerning the direct effects of Rdx/Hib on Ci is potentially consistent with either result concerning the net effect of Rdx/Hib because Rdx/Hib potentially can also reduce Ci-155 levels indirectly. There is certainly no discrepancy with the Seong result to discuss. We present our results literally, with appropriate caveats, as a contribution towards eventual resolution of what exactly Rdx/Hib accomplishes. We do not make a major conclusion on this, larger issue.</p><disp-quote content-type="editor-comment"><p>– In general, the manuscript is very dense and difficult to follow, and extensive text editing will be necessary to clarify and address many of the reviewers' comments.</p></disp-quote><p>We have re-written many sections, guided by specific reviewer suggestions and acknowledged difficulties, trying to separate relevant prior evidence and steps of complicated arguments into single sentences and in a logical order. The net result is that several dense sentences have been expanded into simpler sets of sentences and we have tried at each step to be clear about distinctions between evidence and assumptions.</p><disp-quote content-type="editor-comment"><p>Reviewer #1:</p><p>The manuscript extends previous work by the author and others on the activity of Hh pathway in <italic>Drosophila</italic> wing discs, and how Hh components affect the activity and levels of the Ci transcription factor. While most previous work has been performed using altered UAS-Ci constructs, the present study has instead used engineered constructs expressed from endogenous Ci promoters; these express at endogenous levels, avoiding some possible artifacts of previous studies. They use mutant Ci constructs first to show that spatial regulation of Ci processing is not necessary for normal patterning. They then exploit processing deficient and other forms of Ci to examine processing-independent activities of Fu, Su(fu) and Cos2. The manuscript is dense and occasionally speculative, especially in these latter experiments. But the major points are certainly of interest to general readers. However, I had substantial difficulty with several portions of the manuscript that I think need to be clarified before I would recommend acceptance.</p><p>1) The authors spend some time examining a region of the disc with low Ci-155 levels that is induced by very high Hh levels and that most authors assume is caused by wholesale degradation of Ci, rather than processing into its repressor form. Here they show that Ci constructs that cannot bind to Hib, a Hh-induced ubiquitin ligase that is thought to degrade Ci, still have reduced levels just anterior to the AP where Hh signaling is high. However, a previous study has already shown that Ci levels remain low in this region after genetic removal of Hib (Seoung et al., 2010 Figure 3) so this result is not unexpected.</p></disp-quote><p>This is addressed above. I imagine that many individuals with an interest in this subject might express a belief, based on earlier papers, that Rdx/Hib is responsible for reducing Ci-155 in posterior regions of the AP border despite the results of Seong (and perhaps also after reading our current report). It is therefore certainly worth highlighting our result and past discrepancies.</p><disp-quote content-type="editor-comment"><p>2) What is the evidence that this region of low Ci is caused by degradation? I ask because Blair '82 (Development) showed that at pupal stages the transcriptional marker ci-plac is reduced in this region; given the stability of βGal this could indicate an earlier loss of Ci transcription. Is there a published in situ of sufficient detail to resolve this point? Alternatively, is the region of reduced Ci seen using UAS-Ci constructs that are not regulated by Ci enhancers?</p></disp-quote><p>In addition to what was addressed above, we have included reference to prior work on RNA in situs and ci-lacZ expression and discuss the possibility of ci regulation at different levels. It seems plausible that En induced at late larval stages might reduce ci transcription (to give the quoted pupal ci-lacZ pattern). Older RNA in situ (and ci-lacZ) for 3<sup>rd</sup> instar (and our own unpublished results for ci-lacZ) suggest uniform transcription but I am not aware of RNA in situs of high resolution with really good quantitation. We may examine that in the future but the main response to the issue raised is to acknowledge that the mechanism(s) for Ci-155 reduction are not clear and may not all involve Ci degradation. Our revised discussion includes the issues and observations raised by the reviewer, which altogether served as an important check on the state of evidence and assumptions underlying the observed reduction of Ci-155 under conditions of high Hh pathway activity.</p><disp-quote content-type="editor-comment"><p>3) I had difficulty following the logic in the CORD domain section of the manuscript. Although the reasoning is not explained, the conclusion seems to be based on the idea that any Ci construct that increases the effects of a PKA mutant clone must have done so by removing the inhibitory activity of Cos2. Since Ci without the CORD domain has a stronger effect in PKA clones, the authors conclude that this form of Ci is not inhibited by Cos, and thus CORD is critical for Cos2 interactions. But is this really a valid assumption? Might not the CORD domain act in some other way?</p><p>The constructs that lack Cos2 binding domains can also be processed, so unlike the previous section the authors are not examining PKA and Cos2 effects that are independent of processing. Yet the Discussion seems to assume that this effect is the same as the processing-independent effect. While the authors do show that a Ci that lacks both processing and the CORD domain shows increased signaling, they do not examine whether this is mediated by PKA or Cos2.</p></disp-quote><p>This has been addressed above. I believe that the caveats the reviewer mentions are acknowledged and that the conclusion we present as the most likely explanation is indeed the most likely. I cannot think of a strong competitor and think that any further speculations would serve only to confuse readers. I think it is unlikely that Cos2 inhibits Ci-155 through a mechanism other than direct binding. Removing the CDN domain has no effect, while removing the CORD domain has an effect equivalent to removing Cos2 (when there is no processing) and does not increase activity further in a cos2 mutant clone (where there is no processing). It would be nice to test the zinc finger region, but we never found an alteration that eliminates Cos2 binding without affecting DNA binding.</p></body></sub-article></article>