We previously demonstrated that BTBR × C57 N2 littermates display a spectrum of CCD phenotypes (Jones-Davis et al., 2013; Edwards et al., 2020). Here, we further classified these phenotypes into full CC (CC length ≥3 mm, according to typical C57 wildtype CC lengths in Jones-Davis et al., 2013; Figure 1A, B), partial CCD (CC length >0 and <3 mm), and complete CCD (CC length = 0 mm; Figure 1A, B). We identified variable HC size in animals with complete CCD, suggesting that distinct subpopulations of CCD with variable HC dysgenesis may occur within the BTBR × C57 N2 mouse (Figure 1C, D). Furthermore, the severity of CCD was correlated with HC dysgenesis; HC length was reduced in complete CCD compared to full CC littermates, and was reduced in complete CCD compared to partial CCD (Figure 1C and Supplementary file 1). These results demonstrate that the BTBR × C57 N2 mice display a range of CC phenotypes suitable for further investigation of underlying aetiologies. Moreover, the association between CC length and HC length (as observed in our initial quantitative trait locus (QTL)-based manuscript on CC and HC morphology; Jones-Davis et al., 2013) suggests that a common aetiology may underlie the observed variance in commissural size in this mouse cross.

To investigate potential structural correlates of complete and partial CCD, we first examined the midline of BTBR and BTBR × C57 N2 mice. We previously demonstrated that remodelling of the IHF is a critical developmental step required for subsequent midline crossing of callosal axons, and that failure of this process to occur results in an unfused septum; an MRI feature that is strongly associated with complete CCD in humans (Gobius et al., 2016). To determine whether incomplete IHF remodelling may underlie the spectrum of CCD seen in the BTBR × C57 N2 mouse, we acquired high-resolution structural MRI scans of adult C57 and complete CCD BTBR mice, as well as a subset of BTBR × C57 N2 mice with complete and partial CCD.

C57 adult mice demonstrated a fused septum and IHF positioned anteriorly and superiorly to the CC and HC (Figure 2A). In contrast, the acallosal BTBR adult mouse demonstrated an unfused septum and an IHF that is aberrantly retained across almost the full extent of the telencephalic midline (Figure 2B, yellow bracket). Consistent with what has been shown previously, the only crossing white matter identified in the dorsal telencephalon of the BTBR mouse was a small, ventrally positioned HC (Wahlsten et al., 2003). Full CC BTBR × C57 N2 mice demonstrated similar midline anatomy to the C57 mice (Figure 2C). Partial CCD mice demonstrated an intact HC; however, the anterior-posterior extent of the CC was reduced and was associated with dorsal retention of the IHF, suggesting that the IHF had not been fully remodelled (Figure 2D). In support of an aetiological link between an IHF remodelling defect and CCD severity, complete CCD mice had a more severe IHF remodelling defect, with near complete retention of the IHF (Figure 2E). A subset of complete CCD mice displayed a more severe IHF phenotype with an associated dysgenesis of the HC that recapitulates that seen in the BTBR parental strain (Figure 2E, left panels) compared to complete CCD mice with an intact HC (Figure 2E, right panels). Together, these data suggest that the underlying pathogenesis of CCD in the BTBR × C57 N2 mouse is incomplete IHF remodelling, leading to aberrant retention of the IHF. This further suggests that the severity of the HC and callosal phenotypes is related to the degree of IHF remodelling that occurs.

An unfused septum and deep IHF are invariably present in humans with complete CCD, who commonly have associated HC malformations (Gobius et al., 2016; Hetts et al., 2006). To determine whether an analogous relationship between septal and IHF abnormalities and CCD severity to that seen in the BTBR × C57 N2 mouse might exist in humans with partial CCD irrespective of genetic cause, we examined the septum and IHF in structural MRI scans of 10 adult individuals with partial CCD and compared these to 9 neurotypical controls (Figure 3A, Figure 3—figure supplement 1). Partial CCD individuals demonstrated variably positioned CC remnants comprising one or more, but not all, of the normal CC segments. These individuals often had other mild brain abnormalities that were deemed to be not related to midline formation and IHF remodelling, except for two individuals that demonstrated interhemispheric cysts.

In neurotypical individuals, the CC extends dorsal, anterior, and posterior to the septum, which is fully fused except in a minority of individuals that demonstrate cavum septum pellucidum – a normal anatomical variant that forms ventral to the corpus callosum (Schwidde, 1952). Partial CCD individuals demonstrated significantly increased IHF length in the dorsoventral and anterior-posterior axis (Figure 3A–D, Figure 3—figure supplement 1B, C, and Supplementary file 1), and a significant reduction in the length of fused septum along the anterior-posterior axis as normalised to total midline length (Figure 3—figure supplement 1D and Supplementary file 1). All partial CCD individuals displayed increased length of the posterior IHF in the axial plane outside of the range measured in neurotypical individuals (Figure 3H). Increased length of the anterior and posterior IHF indicates a decrease in IHF remodelling and septal fusion, and therefore a reduced amount of tissue available for callosal midline crossing. This correlated with a reduction in CC width in partial CCD; the posterior CC being the most severely affected since it was absent in all but 1 individual with partial CCD (Figure 3I, J). Notably, the CC remnant in partial CCD individuals was often displaced ventrally within the fused septum where it is not normally evident in neurotypical controls (Figure 3C and Figure 3—figure supplement 1B). Several individuals displayed absence of the septal leaves that occurred in association with an interhemispheric cyst (partial CCD subjects 6 and 10; Figure 3 and Figure 3—figure supplement 1). These results suggest that partial CCD is associated with incomplete IHF remodelling and septal fusion in our cohort. Therefore, developmental failure of IHF remodelling appears to be consistently associated with a spectrum of CCD phenotypes in mice and humans.

Families with CCD can exhibit variable expressivity when carrying the same inherited pathogenic gene variant (Marsh et al., 2017). Because complete and partial CCD BTBR × C57 N2 littermates both display an IHF remodelling defect, the severity of which is associated with the severity of CCD, we sought to determine whether they share a genetic aetiology. Our previously described linkage analysis identified a QTL at the distal end of chromosome 4 which demonstrated a high logarithm of the odds (LOD) score for CC and HC anatomy (Jones-Davis et al., 2013). Variant filtering of exome sequencing within this QTL identified an eight base-pair deletion introducing a premature stop codon in exon 2 of Draxin in the BTBR strain (Jones-Davis et al., 2013; Figure 4A, B). Draxin is a promising candidate to explain CCD in the BTBR × C57 N2 mouse since Draxin knockout mice display CCD (Ahmed et al., 2011; Islam et al., 2009). Moreover, mutations in the gene encoding the DRAXIN receptor, DCC, are also associated with CCD in mice and humans (Fazeli et al., 1997; Finger et al., 2002; Fothergill et al., 2014; Jamuar et al., 2017; Marsh et al., 2018; Marsh et al., 2017). We generated in situ riboprobes for wildtype and mutant Draxin using mRNA isolated from C57 and BTBR mice, respectively, and examined the mRNA expression in the BTBR × C57 N2 and the BTBR parental mice. In situ hybridisation with 3′ Draxin antisense probes from both strains revealed that Draxin is highly expressed in the cingulate cortex and the septum in mid-horizontal sections of the telencephalic midline of C57 mice, consistent with previous findings (Figure 4C; Islam et al., 2009). Draxin mRNA was expressed in both C57 mice and mice homozygous for the Draxin mutation (BTBR and BTBR × C57 N2 mice), but protein expression was undetectable in tissue using a polyclonal antibody generated from an immunogen of whole human DRAXIN via immunohistochemistry and western blot (Figure 4C, D). However, western blot revealed that expression of the BTBR Draxin coding sequence in HEK293T cells produced DRAXIN protein of reduced molecular weight compared to the C57 Draxin coding sequence (Figure 4D). These results suggest that the eight base-pair deletion in Draxin truncates DRAXIN (Figure 4E) and disrupts normal protein expression in vivo.

To further demonstrate linkage of the eight base-pair deletion in Draxin to the observed CCD in BTBR and BTBR × C57 N2 mice, we performed Sanger sequencing of a single-nucleotide polymorphism (SNP) on chromosome 4 (rs6397070), 7.795 megabases downstream of the Draxin deletion as a marker for the BTBR allele in a subset of complete CCD, partial CCD, and normal CC littermates (n ~ 10 of each phenotype, 31 total). Additional SNPs were also sequenced at candidate loci on chromosome 9 (rs29890894) and chromosome 15 (rs31781085), which were previously judged to have a potential genetic influence on commissure size based on LOD scores that did not reach statistical significance (Jones-Davis et al., 2013). We compared commissure length to the allele composition at the chromosome 4 locus (rs6397070) and found that CC length was significantly reduced in mice homozygous for the BTBR allele (C/C) compared to heterozygous mice (C/T; Figure 5A and Supplementary file 1). In contrast, neither HC length (Figure 5B) nor anterior commissure area (Figure 5C) demonstrated a significant difference between homozygous and heterozygous mice (Supplementary file 1). Of the 21 homozygous mice, 19 had CCD (n = 10 complete CCD, n = 9 partial CCD) and 2 had a normal CC. Of the 10 mice heterozygous at the rs6397070 allele, 9 had a normal CC and 1 mouse had partial CCD. No significant differences between genotypes were identified for chromosome 9 (Figure 5E–G and Supplementary file 1) or chromosome 15 (Figure 5I–K and Supplementary file 1) candidate loci for any commissure.

To further validate that the Draxin mutation is a likely cause of CCD in BTBR × C57 N2 mice, we genotyped for the eight base-pair Draxin deletion and examined the influence of the mutation on commissure size. CC length was significantly reduced in BTBR × C57 N2 mice homozygous for the Draxin deletion (Figure 5M and Supplementary file 1), consistent with our results of the candidate SNP on chromosome 4. All 16 mice from a cohort of 68 mice that displayed complete CCD were homozygous for the Draxin deletion (Figure 5P and Supplementary file 1). Of the 47 mice with normal CC length, 11 were homozygous for the Draxin deletion, suggesting incomplete penetrance (Figure 5P and Supplementary file 1), which is also observed in Draxin knockout mice (Hossain et al., 2013; Islam et al., 2009). Contrary to the earlier SNP analysis, we found in this larger, unbiased sample that while anterior commissure area was not influenced by Draxin deletion (Figure 5O and Supplementary file 1), Draxin deletion was associated with reduced HC length (Figure 5N and Supplementary file 1). Together, these results are consistent with the hypothesis that Draxin deletion is the primary genetic aetiology underlying failure for IHF remodelling, which results in CCD and HC dysgenesis in the BTBR × C57 N2 mouse.

To investigate how DRAXIN regulates CC and HC formation in these mice, we first examined cell-type-specific Draxin expression in wildtype CD1 mice. In situ hybridisation for Draxin with immunohistochemistry for glial markers and components of the IHF was performed prior to the onset of IHF remodelling. Draxin mRNA was highly expressed in GLAST-positive radial MZG progenitors in the telencephalic hinge from E12 and was further observed in GLAST-positive MZG migrating to the pan-LAMININ-positive IHF surface at E15 (Figure 6B, E). Immunohistochemistry on wildtype E15 horizontal sections revealed that DRAXIN was widely localised within the telencephalic midline on GLAST-positive radial MZG membranes including migrating cells and progenitors at all stages (Figure 6C, F, K). DRAXIN was also localised to commissural axons at E15 (Figure 6H) and on the basement membrane and leptomeningeal cells within the IHF (Figure 6H’). Thus, DRAXIN, which is known to be secreted (Islam et al., 2009), is expressed within MZG cells and associates with multiple cellular components of the interhemispheric midline, such that it could regulate the development of MZG, leptomeninges and axons, and the interactions between these cellular populations during IHF remodelling and corpus callosum formation.

To further investigate the function of DRAXIN in CC formation, we probed for cellular phenotypes that may explain the loss of IHF remodelling and CC formation in the BTBR parental strain, which is homozygous for the Draxin mutation. Immunohistochemistry for the leptomeningeal marker pan-LAMININ (Gobius et al., 2016), axonal marker GAP43, and mature astroglial marker GFAP in E17 inbred BTBR and wildtype C57 mice revealed that BTBR inbred mice display complete retention of the IHF, which manifests as a significantly higher ratio of IHF length to total midline length in BTBR mice compared to wildtype C57 mice (Figure 7A–C and Supplementary file 1). GFAP-positive MZG remain in two columns of cells that do not intercalate across the IHF in BTBR inbred mice (Figure 7A), suggesting that a defect in the astroglial-IHF interaction results in the failure of midline crossing of CC and HC axons in BTBR mice.

The endfeet of radial MZG progenitors normally form attachments to both the third ventricle and IHF within a region known as the telencephalic hinge. They then proliferate and undergo somal translocation to the IHF between E12 and E15 to initiate IHF remodelling at E15 in mice (Gobius et al., 2016). Immunohistochemistry for radial MZG using NESTIN and GLAST prior to IHF remodelling revealed that while radial MZG are present between the IHF pial surface and the third ventricle in BTBR mice (Figure 7D, F), radial NESTIN-positive MZG fibres were disorganised, and significantly more abundant lateral to the IHF between 100–200 μm from the base of the IHF in BTBR mice (Figure 7F, G and Supplementary file 1). Moreover, altered radial MZG distribution in BTBR mice was associated with abnormal widening of the base of the IHF (Figure 7D, E, Figure 8—figure supplement 1, and Supplementary file 1); a region that normally undergoes selective compression prior to IHF remodelling as increasing numbers of MZG translocate to it (Gobius et al., 2016). Immunohistochemistry for SOX9, a radial glia and astrocyte marker (Sun et al., 2017), revealed significantly more SOX9-positive MZG cell bodies at the pial surface of the IHF in the BTBR inbred strain at E14 and E15 compared to wildtype C57 mice (Figure 7I–K and Supplementary file 1). These MZG clustered along the IHF surface within 200 μm of the base of the IHF at E15 (Figure 7L and Supplementary file 1). This did not result in narrowing the midline space between the adjacent hemispheres, indicating that earlier defects in the generation of the MZG population could underlie the persistence of the IHF in BTBR mice.

We have previously demonstrated increased proliferation of radial glia within the E14 cingulate cortex of the BTBR inbred mouse strain (Faridar et al., 2014). To determine whether a similar effect may underlie increased somal translocation of MZG in BTBR mice, we performed birth-dating of MZG progenitors by performing ethynyl deoxyuridine (EdU) injections and co-labelling with cell cycle marker, KI67. This analysis revealed an increase in MZG progenitors undergoing division in BTBR mice at E13 and E14, leading to significantly increased labelling of EdU-positive MZG at E14 and E15, respectively (Figure 8A–D, F and Supplementary file 1). Between E14 and E15, more dividing MZG progenitors exited the cell cycle (EdU-positive/KI67-negative; Figure 8H and Supplementary file 1) in BTBR mice compared with C57 controls. These differences were unlikely due to a mismatch in the developmental stage of the embryos since the length of the telencephalic midline was comparable between BTBR and wildtype C57 brains at the age of collection (Figure 8E and Supplementary file 1). We find that increased proliferation and cell cycle exit of MZG progenitors in BTBR mice leads to an over-abundance of NESTIN-positive MZG fibres and increased somal translocation of MZG to the IHF surface prior to IHF remodelling. Since we previously found that precocious generation of MZG is associated with disrupted IHF remodelling in mice with altered FGF8 signalling (Gobius et al., 2016), our results here suggest that disrupted IHF remodelling in BTBR mice could be due to precocious generation of MZG. Thus, loss of DRAXIN expression within MZG in BTBR mice disrupts the proliferation and migration of MZG to the IHF and consequent remodelling.

We further measured proliferation within the base of the IHF at the telencephalic hinge and found a significant increase in EdU-positive cells at E13 and E14, which were dividing at E12 and E13, respectively, in BTBR mice (Figure 8A, B, I and Supplementary file 1). The density of cells that remained in the cell cycle after dividing was significantly increased between E12 and E13 in BTBR mice (EdU-positive/KI67-positive; Figure 8A , K and Supplementary file 1). There were no differences in the density of cells that exited the cell cycle within the BTBR IHF compared to the wildtype C57 IHF (EdU-positive/KI67-negative; Figure 8A–C, K and Supplementary file 1). Cells within the IHF comprise CXCL12- and LAMININ-positive leptomeningeal cells, which are eliminated from the septum during IHF remodelling (Gobius et al., 2016). We conclude that failed IHF remodelling in BTBR mice is correlated with a transient period of Hewitt, 1962 increased proliferation of both leptomeningeal cells within the IHF and MZG progenitors, and subsequent over-generation and migration of MZG to an enlarged IHF in BTBR mice.

BTBR, CD1, and C57 mice were bred and tested at The University of Queensland according to the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes and with prior ethics approval from The University of Queensland Animal Ethics Committee. To generate BTBR × C57 N2 mice with varying degrees of CCD, an N1 intercross was produced and N1 females were crossed with BTBR males to generate N2 mice for analysis. The day of birth was designated postnatal day (P)0. Time-mated females were obtained by housing male and female mice together overnight and the following morning was designated embryonic day (E)0. Animals were anaesthetised and collected as previously described (Suárez et al., 2014). For EdU labelling, pregnant dams were given an intraperitoneal injection of 5-ethynyl-2′-deoxyuridine (EdU; 5 mg per kg body weight at E14 or 7.5 mg per kg body weight at E12 and E13, Invitrogen) and embryos were collected 24 hr later. Sex was not determined for embryonic studies. A total of 112 adult BTBR × C57 N2 mice were analysed (n = 47 males, n = 65 females). For the analysis of adult mouse tissue, mice were perfused at 12 weeks of age.

Genotyping of BTBR × C57 N2 mice was performed by PCR of SNPs associated with CC size in the BTBR × C57 F2 intercross as previously described by us (Jones-Davis et al., 2013). Amplicons were generated for SNP regions using the following primers: chromosome 4, SNP rs6397070, forward TTTATGGCTGGGGACTTCAG and reverse CGAATCCAAAGCTCTCTTGC; chromosome 9, SNP rs29890894, forward AGCTTGGTGGCATCCATATC, reverse GCACTCTCCCTACTGCTTGG; chromosome 15, SNP rs31781085, forward GATCGTTGCAGTGACCACAC, reverse GCTGATTGGCAGGTTCTGAT. Genotyping for the Draxin mutation was performed by PCR using the following primers: wildtype forward AGACGGTCCCTGCGTCTC, mutant forward GTCGCAGACGGTCCCTTG, and common reverse AGGCTTCCCAGATGACACTC. Sanger sequencing was performed at the Australian Genome Research Facility.

Participants were enrolled in an ongoing study at The University of Queensland from October 2014 with approval from The University of Queensland Research Ethics committee. 10 individuals with partial CCD aged 21–72 (mean age = 40 years, standard deviation = 17.73) and 9 neurotypical individuals (mean age = 34.89, standard deviation = 16.77) provided written informed consent. MRI scans of all participants were reviewed by a neuroradiologist (SM), who has extensive experience in human brain malformations. The groups did not differ significantly in either age or gender. Genetic information to determine cause of CCD was not collected for this study.

MRI scanning was performed using the same parameters and cohort of BTBR × C57 N2 adult mice as described in Edwards et al., 2020. Briefly, skulls were post-fixed in 4% paraformaldehyde for at least 48 hr after perfusion. Following this, each BTBR × C57 N2 adult mouse skull (with brain in situ) was washed in phosphate buffered saline (PBS) with 0.2% sodium azide. Skulls were immersed in Fomblin Y-LVAC fluid (Solvay Solexis, Bollate, Italy), and air was actively removed from each sample via vacuum pumping prior to MRI scanning. All skulls (n = 112) initially underwent two-dimensional scans measuring diffusion in the mediolateral direction to identify the commissural phenotype. From this analysis, a subset of brains of each of complete CCD (n = 10), partial CCD (n = 11), and full CC (n = 10) phenotypes were dissected from skulls, incubated for 4 days in 0.2% gadopentetate dimeglumine (Magnevist, Berlex Imaging, Wayne, NJ, USA), and scanned with a 16.4 Tesla Bruker Avance MRI scanner using a FLASH sequence that was described previously (Schanze et al., 2018): FLASH sequence (voxel size = 0.03 × 0.03 × 0.03 mm, MTX 654 × 380 × 280, FOV 19.6 × 11.4 × 8.4 mm, TR = 50 ms, TE = 12 ms, flip angle of 30°). Three adult BTBR inbred mouse brains were scanned using identical processing steps. C57 mouse brain scans were acquired previously for Ullmann et al., 2013 and were kindly provided by Dr. Nyoman Kurniawan (Centre for Advanced Imaging, The University of Queensland, Australia).

Human participants underwent MRI at the Centre for Advanced Imaging (The University of Queensland) using a 7 Tesla Siemens Magnetom whole-body MRI scanner. Structural MRI data was acquired as described previously (Hearne et al., 2019): at 7 T, MP2RAGE sequence (voxel size = 0.75 × 0.75 × 0.75 mm, MTX 256 × 300 × 320, FOV 192 × 225 × 240 mm, TR = 4300 ms, TE = 3.44 ms, TI = 840/2370 ms, flip angle of 5°, FOV 192 × 225 × 240 mm).

Commissure and brain sizes were measured in OsiriX (v 5.8.5; Rosset et al., 2004), blind to animal genotype. All commissure lengths and areas were measured in the midsagittal plane on single-direction diffusion scans. Anteroposterior CC length was measured using the straight length tool from the most anterior point to the most posterior point of the CC. HC length was measured using the straight length tool from the dorsal-most aspect of the HC (inferior to the CC) to the ventral-most aspect of the HC. HC area was measured using the closed polygon tool using the same superior and inferior boundaries for HC length. Anterior commissure area was measured using the closed polygon tool. Brain length was measured using the straight length tool, from the anterior aspect of the frontal pole to the posterior-most aspect of the cerebellum. IHF and CC measurements from human MRI were measured from representative images displayed within figures using ITK-SNAP v3.8.0 (Yushkevich et al., 2006).

Immunohistochemistry was performed on 50 μm tissue sections as previously described (Moldrich et al., 2010). Primary antibodies used: sheep anti-DRAXIN (1:250; AF6149, R&D Systems), mouse anti-human KI67 (1:500; 550609, BD Pharmingen), mouse anti-GAP43 (1:500; MAB347, Millipore), rabbit anti-GFAP (1:500; Z0334, Dako), mouse anti-GLAST (or EAAT1; 1:500; ab49643, Abcam), rabbit anti-GLAST (or EAAT1; 1:250; ab416, Abcam), chicken anti-LAMININ (1:250; LS-C96142, LSBio), rabbit anti-LAMININ (1:250; L9393, Sigma), rat anti-NESTIN (AB 2235915, DSHB), and rabbit anti-SOX9 (1:500, AB553, Merck). Secondary antibodies were Alexa Fluor IgG antibodies (1:500, Invitrogen) or biotinylated IgG antibodies (1:500 or 1:1000, Jackson Laboratories) used in conjunction with Alexa Fluor 647-conjugated streptavidin (1:500, Invitrogen) amplification. EdU labelling was performed using the Click-iT EdU Alexa Fluor 488 or Alexa Fluor 555 Imaging kits (Invitrogen) according to the manufacturer’s instructions. Cell nuclei were labelled using 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen) as mounting media.

In situ hybridisation was performed as previously described (Moldrich et al., 2010), with the following minor modifications: Fast red (Roche) was applied to detect probes with fluorescence. For fluorescent in situ hybridisation against Draxin mRNA in wildtype CD1 mice, the Draxin CDS was amplified by PCR using the following primer pairs from the Allen Brain Atlas (Lein et al., 2007): CAGGGAGGTTTAGGACAAACAG and TGTAGGAGCTGAGGGAAAGAAG. The Draxin CDS was subsequently cloned into the pGEM-T Vector (Promega USA) and sequences were verified. Digoxygenin-labelled (DIG RNA labelling mix; Roche) antisense riboprobes were also generated in a similar manner from the Draxin CDS amplified from BTBR and C57 E15 telencephalic midline tissue using the following primer pairs: CGACAGGGAGAGCCAATG and GTACTGGGCGTACACCTGCT.

The Draxin CDS was amplified from BTBR and C57 E15 telencephalic midline tissue using the following primer pairs containing added EcoRI and NotI restriction sites: GAATTCGACAGGGAGAGCCAATG and GCGGCCGCGTACTGGGCGTACACCTGCT. The amplified sequence was digested with EcoRI and NotI and subsequently inserted into the pPBCAG-IRES-GFP (pPBCAGIG) expression plasmid (Chen et al., 2020) via the corresponding restriction sites. Successful cloning of the Draxin CDS into the pPBCAGIG plasmid was verified by Sanger sequencing.

Whole-cell protein extracts were prepared from transfected HEK293T cells and dissected midline tissue as described previously (Bunt et al., 2010). Protein extracts were cleared by centrifugation and used for western blotting as described previously (Bunt et al., 2017). Primary antibodies used for immunoblotting were sheep anti-DRAXIN (AF6149, R&D Systems, 1 µg/mL), goat anti-β-ACTIN (AB0145-200, SICGEN, 1:1000 or 3 µg/mL), and rabbit anti-GFP (A-6455, Thermo Fisher Scientific, 1:1000). The secondary antibodies used were sheep IgG (H and L) antibody DyLight 800 conjugated (Rockland Immunochemicals Inc, 1:15000), IRDye 680LT donkey anti-rabbit (LI-COR, 1:15000), and IRDye 800CW donkey anti-goat (LI-COR, 1:15000). Immunoblotted membranes were imaged using the Odyssey Classic (LI-COR) and Image Studio 5 software (LI-COR).

Microscopy for fluorescence immunohistochemistry or in situ hybridisation was performed using either an inverted Zeiss Axio-Observer fitted with a W1 Yokogawa spinning disk module, Hamamatsu Flash4.0 sCMOS camera, and Slidebook 6 software or an inverted Nikon TiE fitted with a Spectral Applied Research Diskovery spinning disk module, Hamamatsu Flash4.0 sCMOS camera, and Nikon NIS software. Pseudocoloured image projections of ~10–20 μm thick z-stacks were acquired. Images of chromogenic in situ hybridisation samples were acquired on a Zeiss upright Axio-Imager Z1 microscope with Axio- Cam HRm camera and Zen software (Carl Zeiss). Images were cropped, sized, and contrast-brightness enhanced for presentation with ImageJ and Photoshop software (Adobe).

The ratio of IHF length to total telencephalic midline length was quantified in ImageJ freeware (National Institutes of Health, Bethesda, USA) as previously described (Gobius et al., 2016). The IHF width was measured from LAMININ and GLAST stained tissue sections in two different regions: (1) ~5 μm from the base of the IHF and (2) at the most rostral region where GLAST-positive MZG fibres attach to the IHF surface which coincided with the corticoseptal boundary. The IHF width at the base (region 1) was then expressed as a ratio over the IHF width at the corticoseptal boundary (region 2) in order to reflect changes in the compression of the IHF at the base prior to IHF remodelling. Fluorescence intensity of GLAST-positive and NESTIN-positive MZG fibres in a region of interest ~100 × 200 μm (medial-lateral × rostral-caudal) along the IHF surface was measured in ImageJ v1.52i freeware from multiple intensity projection 2D images generated from 3D z-stacks. The number of SOX9-positive MZG cell bodies was counted manually using the Cell Counter plugin in ImageJ v1.51s freeware from a region of interest at the surface of the IHF measuring ~10 × 200 μm (medial-lateral × rostral-caudal). For cell proliferation assays, the telencephalic hinge was outlined as a region of interest in Imaris from 3D z-stacks. The number of DAPI-positive, EdU-positive, KI67-positive cells was automatically counted using the Imaris spots function as previously described (Faridar et al., 2014). The colocalisation function was used to determine co-labelled spots within 4 μm (MZG) or 5 μm (leptomeninges) of each other. All counts were performed blind to the experimental conditions and normalised to the number of DAPI-positive cells or the volume of the region of interest.

Statistical tests were performed in GraphPad Prism (v.7 and v.8), and p<0.05 was considered significant. Statistical testing was performed for all quantitative analyses – the relevant statistical test performed, number of biological replicates, and level of significance are described for all quantitative results in figures or their legends, and in Supplementary file 1. Data sets were first checked for normality using a D’Agostino–Pearson omnibus normality test. If the data was not normally distributed, then the non-parametric equivalent test was performed. For qualitative comparisons (Figures 4 and 8), a minimum of 3 animals were used for each experiment.