<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">62449</article-id><article-id pub-id-type="doi">10.7554/eLife.62449</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title><italic>C. elegans</italic> orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-205162"><name><surname>Hsu</surname><given-names>Tsung-Yuan</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-7234-7810</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-205165"><name><surname>Zhang</surname><given-names>Bo</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-76922"><name><surname>L'Etoile</surname><given-names>Noelle D</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="other" rid="fund3"/><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-204034"><name><surname>Juang</surname><given-names>Bi-Tzen</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-1210-0992</contrib-id><email>btjuang@nctu.edu.tw</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund5"/><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Biological Science and Technology, National Yang Ming Chiao Tung University</institution><addr-line><named-content content-type="city">Hsinchu</named-content></addr-line><country>Taiwan</country></aff><aff id="aff2"><label>2</label><institution>Department of Biological Science and Technology, National Chiao Tung University</institution><addr-line><named-content content-type="city">Hsinchu</named-content></addr-line><country>Taiwan</country></aff><aff id="aff3"><label>3</label><institution>Department of Cell and Tissue Biology, University of California, San Francisco</institution><addr-line><named-content content-type="city">San Francisco</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Portman</surname><given-names>Douglas</given-names></name><role>Reviewing Editor</role><aff><institution>University of Rochester</institution><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Sengupta</surname><given-names>Piali</given-names></name><role>Senior Editor</role><aff><institution>Brandeis University</institution><country>United States</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>01</day><month>03</month><year>2021</year></pub-date><pub-date pub-type="collection"><year>2021</year></pub-date><volume>10</volume><elocation-id>e62449</elocation-id><history><date date-type="received" iso-8601-date="2020-08-25"><day>25</day><month>08</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2021-02-26"><day>26</day><month>02</month><year>2021</year></date></history><permissions><copyright-statement>© 2021, Hsu et al</copyright-statement><copyright-year>2021</copyright-year><copyright-holder>Hsu et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-62449-v2.pdf"/><abstract><p> <italic>Caenorhabditis elegans</italic> expresses human Werner syndrome protein (WRN) orthologs as two distinct proteins: MUT-7, with a 3′−5′ exonuclease domain, and CeWRN-1, with helicase domains. How these domains cooperate remains unclear. Here, we demonstrate the different contributions of MUT-7 and CeWRN-1 to 22G small interfering RNA (siRNA) synthesis and the plasticity of neuronal signaling. MUT-7 acts specifically in the cytoplasm to promote siRNA biogenesis and in the nucleus to associate with CeWRN-1. The import of siRNA by the nuclear Argonaute NRDE-3 promotes the loading of the heterochromatin-binding protein HP1 homolog HPL-2 onto specific loci. This heterochromatin complex represses the gene expression of the guanylyl cyclase ODR-1 to direct olfactory plasticity in <italic>C. elegans</italic>. Our findings suggest that the exonuclease and helicase domains of human WRN may act in concert to promote RNA-dependent loading into a heterochromatin complex, and the failure of this entire process reduces plasticity in postmitotic neurons.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>neuronal plasticity</kwd><kwd>22G small RNA</kwd><kwd>werner syndrome protein</kwd><kwd>3'-5' exonuclease</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>C. elegans</italic></kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100004663</institution-id><institution>Ministry of Science and Technology, Taiwan</institution></institution-wrap></funding-source><award-id>103-2311-B-009 -003-MY2</award-id><principal-award-recipient><name><surname>Juang</surname><given-names>Bi-Tzen</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100004663</institution-id><institution>Ministry of Science and Technology, Taiwan</institution></institution-wrap></funding-source><award-id>105-2311-B-009 -002-MY3</award-id><principal-award-recipient><name><surname>Juang</surname><given-names>Bi-Tzen</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>2R01DC005991</award-id><principal-award-recipient><name><surname>L'Etoile</surname><given-names>Noelle D</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01 DC015758</award-id><principal-award-recipient><name><surname>L'Etoile</surname><given-names>Noelle D</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100005799</institution-id><institution>National Chiao Tung University</institution></institution-wrap></funding-source><award-id>The higher education sprout project of the National Chiao Tung University and Ministry of Education, Taiwan</award-id><principal-award-recipient><name><surname>Juang</surname><given-names>Bi-Tzen</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>The olfactory learning of <italic>Caenorhabditis elegans</italic> shows that the exonuclease and helicase domains of human Werner syndrome protein (WRN) coordinately regulate the biogenesis of small interfering RNAs to promote neuronal plasticity.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Werner syndrome (WS) is an adult-onset progeroid disease in which mutations in the gene encoding the Werner syndrome protein (WRN) are thought to cause abnormal cell function (<xref ref-type="bibr" rid="bib33">Shamanna et al., 2017</xref>). Patients with WS have inactivating mutations in either the 3′−5′ exonuclease domain or the helicase domain of WRN (<xref ref-type="bibr" rid="bib40">Yu et al., 1996</xref>; <xref ref-type="bibr" rid="bib15">Huang et al., 2006</xref>). Earlier studies of human WS have focused on the relationship between WRN helicase activity and genome integrity, including functions such as DNA repair and telomere maintenance, but the importance of WRN exonuclease activity was recently emphasized according to molecular genetic tests. First, although sequence analysis of individuals with WS shows that ~95% mutations in <italic>WRN</italic> genes produce frameshift and nonsense mutations that are predicted to result in truncated proteins, people harboring mutations causing a 90% reduction in WRN helicase activity but leaving WRN exonuclease activity intact do not present with the clinical manifestations of WS (<xref ref-type="bibr" rid="bib17">Kamath-Loeb et al., 2017</xref>). Second, in 10–15% of patients diagnosed with WS, no mutation is found within WRN (<xref ref-type="bibr" rid="bib31">Oshima and Hisama, 2014</xref>). In some of these non-classical cases, an arginine-to-cysteine substitution is found at amino acid 507 (R507C) in the 3′−5′ exonuclease domain of POLD, which is a DNA polymerase that associates with the WRN helicase during lagging strand synthesis (<xref ref-type="bibr" rid="bib26">Lessel et al., 2015</xref>). Third, in a <italic>Drosophila melanogaster</italic> model of WS, loss of the Drosophila WRN, which only contains the 3′−5′ exonuclease domain, affects lifespan under NAD<sup>+</sup> supplementation (<xref ref-type="bibr" rid="bib8">Fang et al., 2019</xref>). However, it is unclear how the exonuclease and helicase domains of the WRN differentially contribute to protection against age-related pathologies. In <italic>Caenorhabditis elegans</italic>, these functions are encoded by two separate nematode proteins, MUT-7 and CeWRN-1, providing an excellent platform for analyzing how the exonuclease and helicase activities of WRN collaborate to regulate cellular functions.</p><p>The nematode <italic>C. elegans</italic> has a highly developed olfactory system and exhibits robust behavioral plasticity upon environmental stimulation. The cells within the sensory circuit include amphid wing cells (termed AWC neurons), which respond to attractive volatile cues such as butanone (<xref ref-type="bibr" rid="bib1">Bargmann et al., 1993</xref>). Prolonged odor exposure in the absence of food causes the animals to ignore a previously attractive odor (<xref ref-type="bibr" rid="bib5">Colbert and Bargmann, 1997</xref>; <xref ref-type="bibr" rid="bib20">L'Etoile et al., 2002</xref>). This behavioral plasticity results from changes within an AWC neuron itself driving a cGMP-dependent protein kinase (PKG), EGL-4, into the nucleus (<xref ref-type="bibr" rid="bib24">Lee et al., 2010a</xref>). A feedback mechanism involved in the process of neuronal plasticity requires a reduction in the mRNA expression levels of a membrane-bound guanylyl cyclase, ODR-1 (<xref ref-type="bibr" rid="bib21">L'Etoile and Bargmann, 2000</xref>). Transcriptional silencing is mediated by loading the heterochromatin-binding protein HPL-2 (an HP1 homolog) onto the <italic>odr-1</italic> locus (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). The assembly of heterochromatin complexes is directed by an increase in the <italic>odr-1</italic> small interfering RNA (siRNA), consisting of 22 nucleotides starting with a 5′ guanosine (22G), whose synthesis requires the 3′−5′ exonuclease activity of MUT-7 in butanone-trained animals (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). <italic>C. elegans</italic> MUT-7 shares 29% sequence identity with the 3′−5′ exonuclease domain of human WRN (<xref ref-type="bibr" rid="bib19">Ketting et al., 1999</xref>). In <italic>Arabidopsis thaliana</italic>, loss of the functional <italic>mut-7</italic> ortholog encoding a WS-like exonuclease (WEX) leads to defective post-transcriptional gene silencing (<xref ref-type="bibr" rid="bib9">Glazov et al., 2003</xref>). In <italic>C. elegans</italic>, CeWRN-1 shows 43% sequence identity with the helicase domain of human WRN (<xref ref-type="bibr" rid="bib23">Lee et al., 2004</xref>). Loss of CeWRN-1 seems to cause several progeroid phenotypes, such as decreased lifespan and pharyngeal clogging in the worm head (<xref ref-type="bibr" rid="bib23">Lee et al., 2004</xref>). However, the role of CeWRN-1 in neuronal plasticity has not been investigated. Although the major clinical features of WS do not include significant neurodegenerative disorders, WS patients have recently been observed to show a brain atrophy (<xref ref-type="bibr" rid="bib10">Goto et al., 2013</xref>; <xref ref-type="bibr" rid="bib22">Lebel and Monnat, 2018</xref>). In addition, <xref ref-type="bibr" rid="bib8">Fang et al., 2019</xref> reported WRN-related microarray data in the <italic>C. elegans</italic> brain nervous system, and their findings suggest that WRN may play important roles in neuronal development and neuroplasticity.</p><p>We therefore utilized the neuronal plasticity of the <italic>C. elegans</italic> AWC olfactory neuron to elucidate how MUT-7 and CeWRN-1 work together to shape animal olfactory behavior. We report that prolonged odor stimulation results in the production of <italic>odr-1</italic> siRNAs, mediated by the MUT-7 3′−5′ exonuclease in the cytoplasm. These small RNAs, acting as transmitters, facilitate the phosphorylation of MUT-7 and HPL-2 by EGL-4 in the nucleus. The CeWRN-1 helicase associates with the chromatin-binding protein HPL-2 to promote heterochromatin formation to silence ODR-1 expression.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>MUT-7 and CeWRN-1 mediate behavioral plasticity</title><p>The human <italic>WRN</italic> gene encodes a 1432 amino acid protein that possesses an N-terminal 3′−5′ exonuclease domain and three C-terminal helicase domains (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Two different nematode proteins are orthologous to the functional domains of human WRN: <italic>C. elegans</italic> MUT-7 contains a 3′−5′ exonuclease and CeWRN-1 has three helicase domains (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Our previous studies demonstrated that MUT-7 is also required for generating endogenous 22G siRNAs in response to the prolonged odor stimulation of olfactory AWC neurons (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Olfactory behavior was measured by using a well-established chemotaxis assay (<xref ref-type="fig" rid="fig1">Figure 1B</xref>, upper) in which the animal’s sensory neurons are stimulated by a variety of odors, and the neural response is reflected in its behavior. The animal’s naïve or primary response is to seek out innately attractive odors (chemotaxis). This odor-seeking response is decreased when the animal experiences odor in the absence of food, causing the animal to ignore the previously attractive odor (olfactory learning). Olfactory behavior is quantified by a chemotaxis index (CI): naïve wild-type animals sense an attractive odor with a high CI value (close to 1.0), while prolonged odor stimulation reduces animal odor-seeking behavior, resulting in a decreased CI (close to 0).</p><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>The two <italic>C. elegans</italic> orthologs of human WRN required for olfactory learning behavior.</title><p>(<bold>A</bold>) Alignment of <italic>C. elegans</italic> MUT-7 and CeWRN-1 with human WRN. The 3′−5′ exonuclease domain of nematode MUT-7 has been predicted to show 29% amino acid sequence identity to that of human WRN, as indicated by the dark gray regions. The three helicase domains of human WRN (helicase/ATPase, RecQ C-terminal domain [RQC], and helicase-and-RNaseD C-terminal [HRDC] domains) are conserved in nematode CeWRN-1, as indicated by light gray regions. The helicase/ATPase domain shares 43% identity, and the RQC and HRDC domains share 25% identity (<xref ref-type="bibr" rid="bib23">Lee et al., 2004</xref>). (<bold>B</bold>) MUT-7 and CeWRN-1 function in AWC neurons to promote butanone-related learning at the time of odor exposure. (Upper) Scheme of olfactory learning. Five-day cultured adult animals were washed to remove bacteria, after which half of the population was pre-exposed to buffer alone (top), and the other half was pre-exposed to buffer with a diluted odor, such as butanone (bottom). After 80 min, the animals were placed at the ‘origin’ of a 9 cm assay plate containing a butanone spot (pink circle) and a control ethanol spot (blue circle). The animals allowed roaming around the dish for 2 hr at 20°C, and their olfactory behavior was quantified with the chemotaxis index (CI). (Bottom) The mean CIs are from the number of animals pre-exposed to buffer (−) or diluted odor (+). More than fifty animals were analyzed per assay. We used GraphPad Prism eight software to perform multiple comparisons and p-values from the two-way ANOVA results are presented for the indicated strains. Error bars represent SEM. (<bold>C</bold>) The enzymatic activity of the MUT-7 3′−5′ exonuclease affects olfactory behavior. (Upper) Schematic diagram of <italic>mut-7</italic> alleles. Two alleles (<italic>ne4255</italic> and <italic>pk204</italic>) are indicated by arrows. (Bottom) The <italic>ne4255</italic> allele results in the loss of exonuclease activity and defective chemotaxis, whereas the <italic>pk204</italic> allele results in low exonuclease activity and the loss of butanone-related learning, while chemotaxis remains normal. Bars represent mean CIs, error bars represent SEM, and p-values represent two-way ANOVA results obtained by using GraphPad software.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig1-v2.tif"/></fig><p>Strains that lacked MUT-7 or CeWRN-1 were analyzed in the chemotaxis assay, and we found that their odor-trained CI was not only greater than half of the naïve CI but also significantly differed from the CIs of odor-trained wild-type animals (<xref ref-type="fig" rid="fig1">Figure 1B</xref>, lower figure), suggesting that MUT-7 and CeWRN-1 are required for animals to learn. To examine whether MUT-7 and CeWRN-1 act in the same genetic pathway, we generated <italic>mut-7;Cewrn-1</italic> double mutants and found that the ability of the double-mutant animals to alter their response to butanone was similar to that of single-mutant animals (<xref ref-type="fig" rid="fig1">Figure 1B</xref>, lower). Thus, the data indicate that MUT-7 and CeWRN-1 act in the same pathway in AWC neurons to promote olfactory learning.</p><p>MUT-7 contains a conserved 3′−5′ exonuclease domain, which is predicted to be able to recognize and degrade target mRNAs in the 3′−5′ direction (<xref ref-type="bibr" rid="bib19">Ketting et al., 1999</xref>). Thus, we asked whether an intact 3′−5′ exonuclease domain is required for olfaction. An allele of <italic>mut-7</italic>(<italic>ne4255</italic>) with a missense mutation at E437K has been predicted to reduce the activity of the 3′−5′ exonuclease by interrupting the predicted Mg<sup>2+</sup> binding domain (<xref ref-type="bibr" rid="bib11">Gu et al., 2009</xref>). <italic>mut-7(ne4255)</italic> mutant animals were shown to be defective in butanone chemotaxis (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). A nonsense allele, <italic>mut-7(pk204),</italic> with the W812 Amber mutation has been proposed to produce a truncated MUT-7 protein that blocks RNAi in the germline (<xref ref-type="bibr" rid="bib19">Ketting et al., 1999</xref>). Worms carrying the W812 Amber mutation in MUT-7 showed reduced 22G RNA levels (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>), and although they were able to show chemotaxis toward butanone, they were unable to learn to ignore this odor after it was paired with starvation (<xref ref-type="fig" rid="fig1">Figure 1C</xref>; <xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Although the version of the MUT-7 protein expressed in these animals (<italic>mut-7(pk204)</italic>) contained a complete 3′−5′ exonuclease domain, it failed to silence the transposition of the Tc5 transposon, presumably because of an important role of the intact C-terminus (<xref ref-type="bibr" rid="bib11">Gu et al., 2009</xref>). Thus, we found that the neuroplasticity of AWC neurons requires wild-type MUT-7 activity. Therefore, the <italic>mut-7(pk204)</italic> mutant strain provides an excellent platform for understanding the molecular and cell biological roles of MUT-7 with a 3′-5′ exonuclease domain in promoting learning and memory.</p></sec><sec id="s2-2"><title>Roles of nuclear and cytoplasmic MUT-7 in promoting learning</title><p>In <italic>C. elegans</italic>, functional studies of MUT-7 have thus far focused on its ability to produce siRNAs in the cytoplasm (<xref ref-type="bibr" rid="bib11">Gu et al., 2009</xref>; <xref ref-type="bibr" rid="bib36">Tops et al., 2005</xref>). We previously found that the expression of MUT-7 with GFP appended to its N-terminus (GFP-MUT-7 in <xref ref-type="fig" rid="fig2">Figure 2A</xref>, upper) specifically in AWC cells restored odor learning in <italic>mut-7(pk204)</italic> mutant animals (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, fourth pair). The expression of GFP-MUT-7 in AWC also restored <italic>odr-1</italic> 22G RNA levels in <italic>mut-7(pk204)</italic> odor-trained worms (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, third dataset) (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Indeed, we used quantitative real-time PCR to probe <italic>odr-1</italic> mRNA and found that prolonged odor exposure decreased <italic>odr-1</italic> mRNA levels in wild-type animals, while <italic>odr-1</italic> mRNA levels were insensitive to odor exposure in <italic>mut-7(pk204)</italic> mutant animals (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>). Furthermore, we used a CRISPR-Cas9 system to generate an integrated line expressing ODR-1::GFP under the control of the endogenous <italic>odr-1</italic> promoter. GFP-tagged ODR-1 was concentrated in the flattened ciliated end of the AWC neuron (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). The fluorescence intensity in naïve wild-type animals was significantly brighter than the fluorescence of GFP in odor-trained wild-type animals (<xref ref-type="fig" rid="fig2">Figure 2D</xref>, top). In contrast, no significant difference in GFP expression induced by odor exposure was observed in the <italic>mut-7(pk204)</italic> mutants (<xref ref-type="fig" rid="fig2">Figure 2D</xref>, bottom). These results confirm that MUT-7 is required in the synthesis of <italic>odr-1</italic> 22G RNA after prolonged odor treatment to specifically downregulate the expression of both the <italic>odr-1</italic> mRNA and the ODR-1 protein.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Different intracellular roles of MUT-7 mediate olfactory learning.</title><p>(<bold>A</bold>) Different localizations of MUT-7 in AWCs associated with different positions of the GFP tag. MUT-7 with an upstream (<bold>a and b</bold>) or downstream (<bold>c and d</bold>) GFP tag showed localization throughout the soma (<bold>b</bold>) or in the cytoplasm (<bold>d</bold>), respectively. A 4XNLS fragment was added upstream of N-terminal mCherry-tagged MUT-7 to cause nuclear accumulation in AWCs (<bold>e</bold> and <bold>f</bold>; the background green cytoplasmic signal comes from the coinjection marker p<italic>AWC</italic>::GFP). All constructs were expressed under an AWC-specific promoter (p<italic>AWC</italic>). (<bold>B</bold>) MUT-7 localization in AWCs affects olfactory behaviors. The individual constructs from (<bold>A</bold>) were introduced into <italic>mut-7(pk204)</italic> mutants, and the olfactory behavior of the transgenic animals was tested after 80 min of pre-exposure to either buffer alone (−) or diluted butanone (+). All strains analyzed in (<bold>B</bold>) and (<bold>C</bold>) were integrated lines obtained by using UV/TMP methods. The p-values come from two-way ANOVA results obtained by comparing the indicated odor-trained populations. n.s. indicates no significant difference. (<bold>C</bold>) Cytoplasmic MUT-7 is required for the synthesis of <italic>odr-1</italic> 22G RNAs after prolonged odor stimulation. (Upper) Total RNA was extracted from whole animals and <italic>odr-1</italic> 22G RNA was quantified by RT-qPCR with an <italic>odr-1.7</italic> TaqMan probe. (Bottom) The expression of <italic>odr-1</italic> siRNA was normalized to that of odor-insensitive sn2343 RNA, and the fold change between odor-trained and naïve animals of the indicated genotypes was then calculated. The red line indicates no change between odor-trained and naïve populations. The p-values displayed come from the comparison of the fold change between the indicated strains by using one-way ANOVA. (<bold>D</bold>) Prolonged odor exposure decreases endogenous ODR-1 expression. (Left) A gene encoding ODR-1::GFP under the control of an endogenous promoter was integrated into the worm genome by using a CRISPR-based method. GFP was observed in the flattened ciliated end of the AWC neuron indicated by the white arrows. All images were captured using an upright microscope (Leica DM6B) at 63X magnification. In odor-trained wild-type animals, ODR-1 expression decreased the fluorescence intensity by 30% compared to that in naïve wild-type animals. The fluorescence intensity in <italic>mut-7(pk204)</italic> mutant animals was not significantly different between the naïve and odor-trained populations. The fluorescence intensity in the naïve and odor-trained animals was quantified as shown in the right panel. The p-value comes from the comparison of fluorescence intensity between naïve and odor-trained worms by using two-way ANOVA. Error bars represent SEM, and n.s. indicates no significant difference.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Pairwise comparison of <italic>odr-1</italic> 22G RNA levels.</title><p>The expression of <italic>odr-1</italic> 22G RNA in naïve and odor-trained populations was quantified by RT-qPCR by using the <italic>odr-1.7</italic> probe. Each RT-qPCR result was normalized to the endogenous <italic>sn2343</italic> gene, whose levels did not change with odor treatment. A line links the 22G values of each paired population (naïve vs. odor-trained) that was grown at the same time on the same plates. According to the scale on the y-axis, <italic>odr-1</italic> 22G RNA in wild-type and <italic>Cewrn-1(gk99)</italic> mutant animals showed higher expression levels (between 5 × 10<sup>−4</sup> and 2 × 10<sup>−5</sup>) because total RNA was extracted from whole worms and some germ cells expressed <italic>odr-1</italic> siRNAs (<xref ref-type="bibr" rid="bib11">Gu et al., 2009</xref>). By contrast, <italic>odr-1</italic> 22G RNA in <italic>mut-7(pk204)</italic> showed very low expression (between 5 × 10<sup>−6</sup> and 6 × 10<sup>−7</sup>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig2-figsupp1-v2.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Prolonged odor exposure decreases <italic>odr-1</italic> mRNA expression.</title><p>The expression of <italic>odr-1</italic> mRNA in naïve and odor-trained worms was quantified by SYBR Green based quantitative PCR. The fold change is the ratio calculated between the mRNA level in odor-trained worms and the mRNA level in naïve worms. p-values are from t-test results obtained by comparing the indicated strains.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig2-figsupp2-v2.tif"/></fig></fig-group><p>Although the rescuing (active) form of MUT-7 was found in both the nucleus and cytoplasm (<xref ref-type="fig" rid="fig2">Figure 2A</xref>, top) (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>), we were able to restrict MUT-7 to the cytoplasm or nucleus. By appending GFP to the C-terminus of MUT-7 (called CterGFP-MUT-7, <xref ref-type="fig" rid="fig2">Figure 2A</xref>, middle), MUT-7 was restricted to the cytoplasm, and by appending four nuclear localization sequences to mCherry (termed NLS-mCherry-MUT-7, <xref ref-type="fig" rid="fig2">Figure 2A</xref>, bottom), MUT-7 was limited to the nucleus. In addition, we tested whether mCherry-MUT-7 (no NLS) was a rescuing form of MUT-7 and found that the expression of mCherry-MUT-7 rescued the learning defects of <italic>mut-7(pk204)</italic> mutant animals (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, third pair). Furthermore, NLS-mCherry-MUT-7 and NLS-GFP-MUT-7 constructs were generated in parallel, but the NLS-GFP-MUT-7 strain was the only integrated line to be obtained by using a standard UV/trimethylpsoralen (UV/TMP) integration method. Therefore, the NLS-GFP-MUT-7 expression line was used in the following experiments.</p><p>To assess how MUT-7 localization affects siRNA levels and how this in turn impacts odor learning, we asked whether the subcellular localization of MUT-7 affected <italic>odr-1</italic> 22G RNA levels and behavioral plasticity in odor-trained animals. We found that animals in which MUT-7 was restricted to the cytoplasm (CterGFP-MUT-7) showed an increase in the <italic>odr-1.7</italic> 22G RNA levels to the same level found in the wild type when they were odor trained (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, first versus fourth datasets). This was interesting because although they exhibited wild-type levels of <italic>odr-1.7</italic> 22G RNA, these animals were not able to learn as well as the wild types (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, first versus fifth pairs of bars). By contrast, restricting MUT-7 to the nucleus (NLS-GFP-MUT-7) blocked the odor-dependent increases in both 22G RNA (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, first versus fifth dataset) and learning (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, first versus sixth pairs of bars). Importantly, each version of MUT-7 was functional, as expressing both CterGFP-MUT-7 and NLS-GFP-MUT-7 in the <italic>mut-7(pk204)</italic> mutants restored both 22G RNA levels and odor learning (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, seventh pair of bars, and <xref ref-type="fig" rid="fig2">Figure 2C</xref>, sixth dataset). Thus, 22G RNA production is not sufficient to cause odor learning, and MUT-7 must perform an additional role in the nucleus, because when it is restricted from the nucleus, animals do not learn.</p><p>Taken together, our behavioral and RT-qPCR results indicate that cytoplasmic MUT-7 may function in the small RNA synthesis process. These results also provide insight that MUT-7 acts in a different way in the nucleus. Moreover, the two pools of MUT-7 must (indirectly) act in coordination to promote olfactory learning.</p><p>Olfactory learning is assessed in the adult stage, but developmental defects such as an abnormal cell fate could indirectly affect this process. The two AWC neurons are asymmetric with respect to the odors to which they respond. This asymmetry is determined by the expression of STR-2 in either the left or right AWC neuron in wild-type animals (referred to as the AWC<sup>ON</sup> neuron) (<xref ref-type="bibr" rid="bib37">Troemel et al., 1999</xref>). To determine whether the various versions of MUT-7 affect this cell fate, STR-2-driven DsRed fluorescence was expressed in CterGFP-MUT-7 or NLS-GFP-MUT-7 transgenic animals, and asymmetric expression of STR-2 was observed in more than 96% of tested animals (<xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>). This result suggests that the impairment of behavioral plasticity in adult animals carrying CterGFP-MUT-7 or NLS-GFP-MUT-7 is not due to changes in cell fate.</p></sec><sec id="s2-3"><title>MUT-7 and EGL-4 interact in the nucleus of odor-trained animals in a PKG phosphorylation site-dependent manner</title><p>What is the role of nuclear MUT-7 in determining the chromatin changes seen in odor-trained animals? Previous data have shown that MUT-7 is required not only in the cytoplasm of odor-trained animals, to increase <italic>odr-1</italic> 22G RNA levels (<xref ref-type="fig" rid="fig2">Figure 2C</xref>), but also in the nucleus, to promote learning (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). Thus, we wanted to understand the potential function of MUT-7 in the nucleus to promote odor learning. Our prior studies indicated that, for odor learning to occur, PKG EGL-4 needs to enter the nucleus and presumably phosphorylate its targets. Mutations in the PKG consensus sites of MUT-7 caused defects in odor learning (<xref ref-type="fig" rid="fig3">Figure 3A</xref>; <xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Our previous genetic epistasis experiments indicated that MUT-7 acts downstream of nuclear EGL-4 (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Thus, MUT-7 might be phosphorylated by EGL-4 in the AWC nucleus of an odor-trained animal.</p><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>MUT-7 is phosphorylated by EGL-4 in the nucleus after prolonged odor exposure.</title><p>(<bold>A</bold>) Schematic representation of the seven predicted phosphorylation sites of PKG in MUT-7 in the top panel. Different point mutations were introduced by site-directed mutagenesis, and the constructs were transferred to wild-type animals to generate dominant-negative strains for behavioral assays. The p-value comes from the results of two-way ANOVA for the comparison of the indicated strains. n.s. indicates no significant difference between the wild type and the indicated mutant animals. (<bold>B</bold>) The BiFC assay revealed an in vivo interaction between EGL-4 and MUT-7 in the AWC nucleus. (Upper) BiFC florescence signals were observed in odor-trained worms (bottom) but not in naïve worms (top). (Bottom) Schematic representation of the BiFC constructs. (<bold>C</bold>) The BiFC screen showed the critical residues within MUT-7 for the specific interaction with nuclear EGL-4. The BiFC screen revealed that the specific interaction between nuclear MUT-7 and EGL-4 was consistent with the adaptation results shown in (<bold>B</bold>). Since nuclear EGL-4 induced adaptation of the odor-seeking behavioral response in naive worms, the percentage of BiFC signals in naïve worms expressing NLS::EGL-4 with different versions of MUT-7 is similar to that in the odor-trained worms.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig3-v2.tif"/></fig><p>Since the expression of full-length MUT-7 in bacteria for in vitro kinase assays was not successful, we next attempted to detect a physical interaction between EGL-4 and MUT-7 by using in vivo bimolecular fluorescence complementation (BiFC). The basic principle of the BiFC assay is the reconstitution of a fluorescent molecule such as the GFP-derived Venus fluorophore that has been split into two separate halves (<xref ref-type="bibr" rid="bib14">Hu et al., 2006</xref>; <xref ref-type="bibr" rid="bib18">Kerppola, 2006</xref>; <xref ref-type="bibr" rid="bib34">Shyu et al., 2008</xref>). Each half of the molecule is appended to a distinct protein, and if the two proteins physically interact, the N- and C-halves of the split Venus protein will reconstitute the fluorophore.</p><p>We expressed MUT-7 and EGL-4 tagged with the N- and C-terminal fragments of the Venus fluorophore (VN and VC), respectively, in the AWC neurons of a wild-type animal (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). We observed that only 1% of buffer-trained animals showed a reconstituted fluorescent signal in the AWC nucleus and that this percentage rose to 75% after prolonged odor training (<xref ref-type="fig" rid="fig3">Figure 3B and C</xref>, first row). The BiFC signal is binary either on or off. Thus, in a population of naïve worms, few show the signal, while in a population of butanone exposed ones, many showed the signal. This means that individual worms may have complexes between these proteins in the nucleus but the proportion of the population with these complexes changes with butanone treatment. This may reflect the fact that most but not all naive animals are attracted to butanone, but the proportion that is attracted decreases when worms are starved in the presence of butanone. Importantly, the BiFC signal in each butanone-trained animal was seen in only one AWC neuron. This reflects the fact that butanone is sensed by only one AWC (<xref ref-type="bibr" rid="bib39">Wes and Bargmann, 2001</xref>). These results also indicate that our BiFC system can specifically detect protein interactions in the single butanone-sensing neuron of the worm. In addition, we tested constitutively nuclear EGL-4 tagged with the Venus C-terminus (NLS::EGL-4) in naïve animals expressing MUT-7 tagged with the Venus N-terminus, and 86% of odor-trained animals exhibited the BiFC signal (<xref ref-type="fig" rid="fig3">Figure 3C</xref>, third row). These results indicate that EGL-4 associates either directly or in a protein complex with MUT-7 in the AWC nucleus of odor-trained worms.</p><p>We next asked whether the consensus PKG phosphorylation sites in MUT-7 are important for this association between MUT-7 and EGL-4. Thus, we performed a similar BiFC analysis with MUT-7 variants in which all seven of the predicted PKG phosphorylation sites were mutated to nonphosphorylatable alanine residues (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). These nonphosphorylatable forms of MUT-7 failed to reconstitute the BiFC signal (<xref ref-type="fig" rid="fig3">Figure 3C</xref>, second and fourth rows). The single S883A mutation (at a site deleted in the pk204 allele of mut-7) was sufficient to block BiFC fluorescence (<xref ref-type="fig" rid="fig3">Figure 3C</xref>, sixth row). Taken together, these data lead us to propose that the phosphorylated form of MUT-7 is bound by EGL-4 in the AWC nucleus and that EGL-4 kinase may be responsible for phosphorylating MUT-7. As a control, a point mutation in MUT-7 (S516A) that does not affect learning (<xref ref-type="fig" rid="fig3">Figure 3A</xref>, fifth pair for behavior) (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>) was shown to not disrupt BiFC between EGL-4 and MUT-7 (<xref ref-type="fig" rid="fig3">Figure 3C</xref>, fifth row).</p></sec><sec id="s2-4"><title>The import of <italic>odr-1</italic> 22G RNA by NRDE-3 bolsters MUT-7 and EGL-4 association in the nucleus</title><p>We next asked whether 22G RNA production is required for EGL-4 and MUT-7 to associate in the nucleus. The rationale for this question was that small RNA species may direct repressive chromatin marks to specific genes in the AWC nucleus and that EGL-4 creates a repressed chromatin state by phosphorylating HPL-2 (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Thus, we asked whether small RNA levels affect the association between EGL-4 and MUT-7 in the nucleus upon odor exposure. To test this hypothesis, we decided to block 22G RNA production by creating a dominant-negative cytoplasmic MUT-7 and asked if the nuclear pool of MUT-7 would still be able to associate with EGL-4. To test this hypothesis, tryptophan 812 was replaced with a nonsense codon to mimic the sequence variation in <italic>mut-7(pk204).</italic> The expression of this construct in wild-type worms resulted in not only failure to learn (<xref ref-type="fig" rid="fig3">Figure 3A</xref>, seventh pairs) but also failure to produce <italic>odr-1</italic> 22G RNA after odor training (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). We next asked whether MUT-7(W812Amber) would associate with nuclear EGL-4 in this new context without 22G RNA. We found that only 11% of odor-trained transgenic animals showed the BiFC signal (<xref ref-type="fig" rid="fig3">Figure 3C</xref>, seventh row). This result suggests that the production of <italic>odr-1</italic> 22G RNA by processes that involve MUT-7 in the cytoplasm is required for the association between EGL-4 and MUT-7 in the AWC nucleus.</p><p>We have presented evidence that the cytoplasmic and nuclear pools of MUT-7 do not have to move between the compartments to promote odor learning (<xref ref-type="fig" rid="fig2">Figure 2B</xref>; the co-expression of NLS-GFP-MUT-7 and CterGFP-MUT-7 in <italic>mut-7(pk204)</italic> animals rescues <italic>mut-7</italic> learning defects). Therefore, we wondered how the 22G RNA-based signal might travel from the cytoplasm to the nucleus. One candidate potentially mediating this process is the Argonaut NRDE-3, which shuttles 22G siRNA from the cytoplasm to the nucleus in the nuclear RNA silencing pathway (<xref ref-type="bibr" rid="bib12">Guang et al., 2008</xref>). A previous coimmunoprecipitation analysis revealed that <italic>odr-1</italic> 22G RNAs are loaded onto NRDE-3 in butanone odor-trained worms (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>), indicating that this protein is a good candidate for the conduit between the cytoplasm and nucleus. To understand whether the entry of <italic>odr-1</italic> 22G RNAs into the nucleus is required to trigger the association between MUT-7 and EGL-4, we turned to BiFC. We expressed MUT-7 tagged with the Venus N-terminus and EGL-4 tagged with the Venus C-terminus in <italic>nrde-3(gg66)</italic> mutant animals lacking NRDE-3. We found that the BiFC signal was not detected in either naïve or odor-trained transgenic worms (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, first row). Furthermore, we observed that 86% of odor-trained wild-type worms co-expressing NLS::EGL-4 and constitutively nuclear MUT-7 tagged with the Venus N-terminus (NLS::MUT-7) showed a BiFC signal (<xref ref-type="fig" rid="fig3">Figure 3C</xref>, last row) but that only 5% of odor-trained <italic>nrde-3</italic>(<italic>gg66</italic>) mutant worms expressing the same constructs showed a BiFC signal (<xref ref-type="fig" rid="fig4">Figure 4D</xref>, first row). Taken together, these observations indicate that the import of 22G RNAs into the nucleus via NRDE-3 is required for the association between nuclear MUT-7 and EGL-4.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>CeWRN-1 function in the AWC nucleus is required for olfactory learning.</title><p>(<bold>A</bold>) The BiFC screen showed in vivo specific protein interactions in the AWC nucleus after prolonged odor exposure. The BiFC fluorescent signals were scored in naïve and odor-trained worms. Each strain was examined in three separate experiments, and all the data were statistically analyzed by two-way ANOVA. (<bold>B</bold>) (Upper) CeWRN-1 is expressed in the AWC nucleus. Fluorescent images of wild-type animals expressing <italic>Cewrn-1</italic> cDNA with a GFP tag at the C-terminus showed protein accumulation in the nucleus. (Bottom) The expression of CeWRN-1 in AWC rescues the learning defects of <italic>Cewrn-1(gk99)</italic> mutant animals. GFP-tagged CeWRN-1 was introduced into the <italic>Cewrn-1(gk99)</italic> null mutant and restored olfactory learning ability. The p-values come from two-way ANOVAs between the specified groups. (<bold>C</bold>) CeWRN-1 interacts with MUT-7 and HPL-2. An influenza hemagglutinin (HA) peptide was inserted between MUT-7 and GFP, and fluorescent images showed that MUT-7 was distributed throughout the AWC cell body, as shown in <xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3</xref>. Thus, the same strategy was applied to generate the p<italic>AWC</italic>::MUT-7::HA::VC155 construct (top) in the BiFC assay. (<bold>D</bold>) NRDE-3 is required for the MUT-7 and EGL-4 interaction, the CeWRN-1 and HPL-2 interaction, and the MUT-7 and CeWRN-1 interaction in the AWC nucleus. We expressed the indicated BiFC constructs in <italic>nrde-3(gg66)</italic> mutants and scored the BiFC signals in naïve and odor-trained worms.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Images of BiFC screening results.</title><p>All representative fluorescent images related to <xref ref-type="fig" rid="fig4">Figure 4A</xref> from naïve and odor-trained worms are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig4-figsupp1-v2.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Localization of CeWRN-1 in AWC neurons.</title><p>Fluorescent images of wild-type animals expressing GFP under a putative 2.5 kb <italic>Cewrn-1</italic> promoter showed the same localization obtained with the <italic>AWC</italic> promoter-driving mCherry.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig4-figsupp2-v2.tif"/></fig><fig id="fig4s3" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 3.</label><caption><title>Expression of MUT-7::HA::GFP in the whole cell body of the AWC neuron.</title><p>An influenza hemagglutinin (HA) peptide was inserted between MUT-7 and GFP in the CterGFP-MUT-7 construct. This construct was introduced into wild-type animals, and GFP was observed in the whole AWC soma region.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig4-figsupp3-v2.tif"/></fig></fig-group></sec><sec id="s2-5"><title>MUT-7 associates with CeWRN-1 in the nucleus to promote olfactory learning</title><p>WS patients accelerate aging after puberty; thus, mutations in the helicase domains of the human WRN protein have been studied as a possible way to understand the aging process. The WS helicase is orthologous to <italic>C. elegans</italic> CeWRN-1 (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). CeWRN-1 is involved in multiple cellular events, including DNA replication and repair (<xref ref-type="bibr" rid="bib25">Lee et al., 2010b</xref>).</p><p>Olfactory behavioral analysis revealed that strains lacking CeWRN-1 were unable to learn to ignore butanone after training (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). The expression pattern of CeWRN-1 has not been characterized in vivo, so we placed GFP expression under the control of the <italic>Cewrn-1</italic> promoter and observed a GFP signal in many cells, including the pair of AWC neurons (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>). To determine whether CeWRN-1 acts in AWC neurons to regulate odor sensing and learning, the CeWRN-1 protein was expressed in AWCs and rescued the learning defects of the <italic>Cewrn-1(gk99)</italic> mutant (<xref ref-type="fig" rid="fig4">Figure 4B</xref>, bottom). Furthermore, GFP-tagged CeWRN-1 stained the AWC nucleus (<xref ref-type="fig" rid="fig4">Figure 4B</xref>, top). These data indicate that CeWRN-1 acts within AWC neurons to promote olfactory plasticity. This is unlikely to be due to a change in AWC cell fate because the wild-type pattern of asymmetric STR-2 expression was observed in all tested animals (<xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>).</p><p>The nuclear accumulation of EGL-4 in odor-trained wild-type animals is required for olfactory learning and adaptation (<xref ref-type="bibr" rid="bib20">L'Etoile et al., 2002</xref>; <xref ref-type="bibr" rid="bib28">O'Halloran et al., 2009</xref>; <xref ref-type="bibr" rid="bib29">O'Halloran et al., 2012</xref>; <xref ref-type="bibr" rid="bib2">Cho et al., 2016</xref>); therefore, we asked whether CeWRN-1 is required for EGL-4 nuclear entry. We found that GFP-tagged EGL-4 entered the nucleus of AWC neurons in <italic>Cewrn-1(gk99)</italic> animals that had been trained with butanone (<xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>). Thus, CeWRN-1 does not regulate EGL-4 nuclear entry. We next asked whether CeWRN-1 might interact with EGL-4 in the nucleus. To test this hypothesis, we appended the N-terminal half of Venus to CeWRN-1 and expressed this construct in a strain-expressing EGL-4 tagged with the C-terminal half of Venus. Less than 2% of transgenic animals under either naïve or trained conditions showed a fluorescent signal (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, second row), suggesting that the CeWRN-1 and EGL-4 do not interact directly.</p><p>MUT-7 and CeWRN-1 are predicted to be <italic>C. elegans</italic> orthologs of the 3′−5′ exonuclease and helicase domains of human WRN, respectively. To explore whether nematode MUT-7 and CeWRN-1 could interact, the BiFC constructs for CeWRN-1 and MUT-7 were co-expressed in wild-type animals, and 46% of odor-trained worms showed the BiFC signal, in contrast to &lt;4% of buffer-trained control worms (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, third row; <xref ref-type="fig" rid="fig4">Figure 4C</xref>, top). In addition, the same BiFC constructs were expressed in <italic>nrde-3(gg99)</italic> mutants, and only 3% of naïve and odor-rained worms exhibited the BiFC signal (<xref ref-type="fig" rid="fig4">Figure 4D</xref>, second row). These results indicate that CeWRN-1 may associate with nuclear MUT-7 in the presence of NRDE-3 and that they may mediate olfactory learning together.</p></sec><sec id="s2-6"><title>Odor-activated MUT-7 directs HPL-2 loading on histone H3</title><p>Our previous survey of genes required for olfactory plasticity assumed that MUT-7 may interact with HPL-2 at the time of odor exposure to promote butanone-related learning (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Moreover, chromatin immunoprecipitation studies showed that odor adaptation resulted in the loading of HPL-2 onto the <italic>odr-1</italic> locus within AWC neurons (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). However, it remained unclear whether MUT-7 and HPL-2 act together in a complex or in series in a process promoting HPL-2 loading onto target genes. To distinguish between these possibilities, we first asked whether MUT-7 and HPL-2 are in close enough association in the nucleus to reconstitute fluorescence (BiFC). We found that very few naïve or odor-trained animals showed BiFC (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, fourth row). Thus, MUT-7 and HPL-2 are unlikely to be associated even after odor training.</p><p>Second, we asked if the EGL-4-MUT-7 association requires HPL-2. We found that, in <italic>hpl-2</italic> null animals, 67% of odor-trained animals showed BiFC, in contrast to only 1% of naïve animals (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, fifth row). Thus, neither does HPL-2 exist in a complex with MUT-7 nor is it required to promote the association between MUT-7 and EGL-4.</p><p>Next, we asked whether the association of HPL-2 and the histone H3.3 variant HIS-71, which is incorporated into the nuclei of almost all somatic cells of <italic>C. elegans</italic> throughout its lifespan (<xref ref-type="bibr" rid="bib30">Ooi et al., 2006</xref>), increases during odor training, as predicted by the chromatin IP (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). When we expressed HIS-71 tagged with the Venus N-terminus and HPL-2 tagged with the Venus C-terminus in wild-type animals, we found that 91.5% of odor-trained worms showed BiFC, in contrast to a background rate of 11.6% in naïve worms (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, sixth row). Thus, odor training increases the association between HPL-2 and H3.3. To determine whether MUT-7 is required for the increased association, the same set of BiFC constructs was expressed in the <italic>mut-7(pk204)</italic> mutant background, and less than 4% of either naïve or odor-trained animals exhibited the BiFC signal (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, seventh row). This suggests that MUT-7 is required for the formation of the HPL-2-H3 complex in odor-trained animals but that it does not directly associate with either HPL-2 or histone H3.3. This led us to hypothesize that phosphorylated MUT-7 directs the heterochromatin complex to genetic loci, possibly using 22G RNA as a guide.</p></sec><sec id="s2-7"><title>CeWRN-1 guides the HPL-2 and histone H3 association</title><p>To better understand whether <italic>C. elegans</italic> CeWRN-1 is involved in heterochromatin formation by binding to HPL-2, we first asked whether CeWRN-1 and HPL-2 act in the same genetic pathway. We generated <italic>hpl-2;Cewrn-1</italic> double mutants and found that the odor learning ability of the double mutants was similar to the odor learning ability of <italic>Cewrn-1</italic> or <italic>hpl-2</italic> single-mutant animals (<xref ref-type="fig" rid="fig1">Figure 1B</xref>, lower). The results indicate that CeWRN-1 and HPL-2 act in the same pathway to promote learning. Next, we asked whether CeWRN-1 associates with HPL-2 to regulate signaling. We co-expressed CeWRN-1 tagged with the N-terminal half of Venus and HPL-2 tagged with the C-terminal half of Venus in wild-type worms. We found that 80% of odor-trained worms but less than 4% of naïve worms showed reconstituted fluorescence in the AWC nucleus (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, eighth row; <xref ref-type="fig" rid="fig4">Figure 4C</xref>, bottom). The same BiFC constructs were expressed in <italic>nrde-3(gg66)</italic>, and less than 4% of naïve or odor-trained worms exhibited the BiFC signal (<xref ref-type="fig" rid="fig4">Figure 4D</xref>, third row). Therefore, these results indicate that the association between HPL-2 and CeWRN-1 in odor-trained animals depends on NRDE-3. To determine whether CeWRN-1 affects HPL-2 binding to histone H3, we examined the BiFC of HIS-71 and HPL-2 in <italic>Cewrn-1(gk99)</italic> null mutants. We found that loss of CeWRN-1 reduced the BiFC signal, as &lt;7% of naïve and odor-trained worms showed fluorescence (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, ninth row). These results showed that CeWRN-1 is required for HPL-2 to associate with histone H3 in odor-trained animals. Our data were also consistent with the observation that the human WRN protein associates with the heterochromatin-binding protein HP1 and histone H3K9me3 in a human WS mesenchymal stem cell model (<xref ref-type="bibr" rid="bib41">Zhang et al., 2015</xref>).</p><p>If CeWRN-1 is required for heterochromatin formation, then it is possible that <italic>odr-1</italic> 22G RNA production could be affected by loss of CeWRN-1. Specifically, since odor learning requires the downregulation of ODR-1 by <italic>odr-1</italic> 22G RNAs, we asked whether <italic>odr-1</italic> 22G RNA production is interrupted by loss of CeWRN-1. To test the hypothesis that CeWRN-1 drives 22G RNA function, we asked whether the increase in the expression of <italic>odr-1</italic> 22G RNAs during odor training requires CeWRN-1. We found that in <italic>Cewrn-1</italic> loss-of-function mutants, <italic>odr-1</italic> 22G RNA levels did not change (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, seventh data set). Importantly, <italic>odr-1</italic> 22G RNA expression at baseline was the same in wild-type worms and <italic>Cewrn-1</italic> mutants (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>, left and right). By contrast, in <italic>mut-7(pk204)</italic> mutants, the <italic>odr-1</italic> 22G RNA level was significantly decreased in odor-trained animals (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>, middle). These results suggest that endogenous MUT-7 functions normally in the <italic>Cewrn-1</italic> mutant background. Taken together, the data imply that CeWRN-1 is required for HPL-2 to load onto histone H3 and thus fine tune gene expression via the small RNA-mediated silencing pathway in AWCs during the butanone-related learning process.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>We report that the exonuclease and helicase domains of the <italic>C. elegans</italic> orthologs of the WS protein play different roles in siRNA synthesis (mediated by cytoplasmic MUT-7) and heterochromatin formation (mediated by nuclear CeWRN-1) to promote neuronal plasticity. Although there is no obvious clinical outcome of human WS associated with brain diseases, the brain atrophy observed in WS patients (<xref ref-type="bibr" rid="bib10">Goto et al., 2013</xref>; <xref ref-type="bibr" rid="bib22">Lebel and Monnat, 2018</xref>) and the abnormal neuronal gene expression indicated by microarray data from the <italic>C. elegans</italic> WS model (<xref ref-type="bibr" rid="bib8">Fang et al., 2019</xref>) suggest the possibility of neurodegeneration. Moreover, patients with WS may exhibit hypogonadism of the testes in males and ovaries in females and, thus, reduced fertility (<xref ref-type="bibr" rid="bib15">Huang et al., 2006</xref>). To assess whether either nematode ortholog (CeWRN-1 or MUT-7) is required for fertility, the number of eggs produced during the first 3 days of adulthood was counted. We found that loss of CeWRN-1 reduced the total brood size from an average of 213 in the wild type to 185 eggs in the <italic>Cewrn-1(gk99)</italic> mutant (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). Loss of MUT-7 exonuclease activity greatly reduced brood size to an average of 96 eggs, and <italic>mut-7;Cewrn-1</italic> double-mutant animals showed an average of only 68 eggs per brood. We also asked whether the reduced brood size was the result of germline cell death. The wild-type and <italic>Cewrn-1</italic> mutant animals showed similar numbers of cell corpses per gonad arm, while the <italic>mut-7</italic> mutants showed a larger number of cell corpses (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplements 2</xref>–<xref ref-type="fig" rid="fig5s3">3</xref>). Thus, the MUT-7 exonuclease is required for germ cell viability, but the CeWRN-1 helicase may not be sufficient. The findings obtained in <italic>C. elegans</italic> may provide an opportunity to study how the exonuclease domain of the human WRN protein is involved in reproductive health in the future.</p><p>The obtained molecular evidence of the WRN homolog’s 3′−5′ exonuclease function indicates that the residues critical for 3'−5′ exonuclease catalytic activity are conserved between MUT-7 and the exonuclease domain of mammalian WRN (<xref ref-type="bibr" rid="bib19">Ketting et al., 1999</xref>). The human WRN protein exhibits both DNase and RNase activities (<xref ref-type="bibr" rid="bib35">Suzuki et al., 1999</xref>). The analysis of the crystal structures of the WRN exonuclease and helicase domains indicated that they are likely to cooperate in repairing DNA (<xref ref-type="bibr" rid="bib32">Perry et al., 2006</xref>). Nematode MUT-7 is involved in germline transposon silencing via the RNA interference pathway (<xref ref-type="bibr" rid="bib19">Ketting et al., 1999</xref>). Loss of MUT-7 results in the loss of transposon silencing and increased activity of the DNA repair machinery in response to transposon-mediated DNA double-strand breaks in germ cells (<xref ref-type="bibr" rid="bib38">Wallis et al., 2019</xref>). The location in the germline where this transposition occurs (<xref ref-type="bibr" rid="bib38">Wallis et al., 2019</xref>) is consistent with the gonad area in which we observed cell corpses in <italic>mut-7</italic> mutants (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3</xref>). Furthermore, the RNAi pathway silences transposon activity by producing abundant 22G RNAs in the nematode germline that serve to repress transposase expression (<xref ref-type="bibr" rid="bib11">Gu et al., 2009</xref>; <xref ref-type="bibr" rid="bib13">Halic and Moazed, 2009</xref>). Our work indicates that the prolonged external stimulation of <italic>C. elegans</italic> activates 22G RNA synthesis via the function of MUT-7 in the cytoplasm. Moreover, the entry of 22G RNA into the nucleus guides the interaction between CeWRN-1 and HPL-2 to form repressive chromatin. Small RNAs involved in WS process have also been observed in WS mouse models, in which some microRNAs, such as miR124, show differential expression compared to that in wild-type mice (<xref ref-type="bibr" rid="bib6">Dallaire et al., 2012</xref>). Although evidence of the importance of siRNA in WS is currently lacking, we systematically demonstrated in the present study that the synthesis and shuttling of siRNA into the AWC nucleus are required for CeWRN-1-dependent olfactory learning. The identity of all siRNAs involved in plasticity is unknown, as is the full catalog of histone modifications that dynamically regulate neuronal plasticity. Indeed, a few recent reports indicate that human WS may result not from the loss of genome integrity but from changes in epigenetic marks such as DNA methylation patterns (<xref ref-type="bibr" rid="bib27">Maierhofer et al., 2019</xref>). Thus, the identification of molecular mechanisms that link environmental challenges to epigenetic changes in well-defined models may provide an opportunity to elucidate the pathogenesis of segmental progeroid syndromes. For example, this work sets up the testable hypothesis that the exonuclease domain of human WRN may be involved in the regulation of small RNAs to protect the genome from changes that promote aging.</p><p>Overall, our study reveals two different cellular roles of the MUT-7 3′−5′ exonuclease: amplification of endogenous <italic>odr-1</italic> 22G RNAs in the cytoplasm and mediation of the association between MUT-7 and EGL-4 in the nucleus. We present evidence that the NRDE-3-mediated shuttling of small RNA into the nucleus is required for MUT-7 to associate with EGL-4. Our olfactory behavioral analysis shows that the MUT-7 exonuclease and CeWRN-1 helicase not only function in the same pathway to promote learning but also associate with each other in the nucleus after odor training. Finally, we show that the CeWRN-1 helicase interacts with the heterochromatin-binding protein HPL-2 to mediate the introduction of repressive chromatin marks on histone H3, which are required to downregulate ODR-1 expression (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Further studies on the different roles of WRN exonuclease and helicase in regulating behavioral plasticity may not only reveal the pathogenic mechanism of WS but also contribute to the development of new molecular therapeutic strategies.</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Models of the involvement of MUT-7 and CeWRN-1 in long-term olfactory learning in AWC.</title><p>(<bold>A</bold>) In wild-type AWC neurons, prolonged odor exposure causes EGL-4 to enter the nucleus. <italic>odr-1</italic> 22G RNAs are generated by cytoplasmic MUT-7 and shuttled into the nucleus by NRDE-3. Once the small RNA enters the nucleus, EGL-4 phosphorylates nuclear MUT-7, which directs the association between CeWRN-1 and HPL-2. HPL-2 then associates with methylated H3.3, thereby downregulating <italic>odr-1</italic> transcription. Lower levels of the ODR-1 protein are predicted to promote olfactory learning. (<bold>B</bold>) Loss of MUT-7 from the cytoplasm inhibits <italic>odr-1</italic> 22G RNA production. Although EGL-4 accumulates in the nucleus, the lack of induced small RNA import leads to the disruption of the MUT-7 and EGL-4 interaction, the MUT-7 and CeWRN-1 interaction, and the CeWRN-1 and HPL-2 interaction. The lack of these associations affects the <italic>odr-1</italic> mRNA-downregulating signal because of the failure of HPL-2 loading on histones. The continued expression of ODR-1 results in defects in olfactory learning. Supplemental Information titles and legends.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig5-v2.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Loss of MUT-7 significantly decreases brood size.</title><p>Animals were synchronized in the larva one stage and seeded on NGM culture plates. The number of eggs was scored from the young adult stage onward every 24 hr for 3 days. A t-test was used to compare total eggs between the indicated strains. Error bars represent SEM.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig5-figsupp1-v2.tif"/></fig><fig id="fig5s2" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 2.</label><caption><title>Loss of MUT-7 significantly affects germline cell death.</title><p>Oocyte development was visualized from the young adult stage onward at 12, 24, 48, and 96 hr. The t-test was used to compare the total numbers of cell corpses per gonad arm between the indicated strains. Error bars represent SEM.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig5-figsupp2-v2.tif"/></fig><fig id="fig5s3" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 3.</label><caption><title>Images of cell corpses in wild-type and <italic>mut-7(pk204)</italic> animals.</title><p>Cell corpses in each strain are indicated by red arrows.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-fig5-figsupp3-v2.tif"/></fig></fig-group></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type (species) or resource</th><th valign="top">Designation</th><th valign="top">Source or reference</th><th valign="top">Identifiers</th><th valign="top">Additional information</th></tr></thead><tbody><tr><td valign="top">Strain, strain background (<italic>Caenorhabditis elegans</italic>)</td><td valign="top">N2</td><td valign="top">Caenorhabditis Genetics Center</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:WB-STRAIN:WBStrain00000001">WB-STRAIN:WBStrain00000001</ext-link></td><td valign="top">Genotype: wild type</td></tr><tr><td valign="top">Strain, strain background (<italic>C. elegans</italic>)</td><td valign="top"><italic>Cewrn-1(gk99)</italic></td><td valign="top">Caenorhabditis Genetics Center</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:WB-STRAIN:WBStrain">WB-STRAIN:WBStrain</ext-link> 00035559</td><td valign="top">Genotype: <italic>wrn-1(gk99)</italic> II</td></tr><tr><td valign="top">Strain, strain background (<italic>C. elegans</italic>)</td><td valign="top"><italic>hpl-2(tm1489)</italic></td><td valign="top">Caenorhabditis Genetics Center</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:WB-STRAIN:WBStrain00030670">WB-STRAIN:WBStrain00030670</ext-link></td><td valign="top">Genotype: <italic>hpl-2(tm1489)</italic> III</td></tr><tr><td valign="top">Strain, strain background (<italic>C. elegans</italic>)</td><td valign="top"><italic>mut-7(ne4255)</italic></td><td valign="top">Caenorhabditis Genetics Center</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:WB-STRAIN:WBStrain00040468">WB-STRAIN:WBStrain00040468</ext-link></td><td valign="top">Genotype: <italic>mut-7(ne4255)</italic> III</td></tr><tr><td valign="top">Strain, strain background (<italic>C. elegans</italic>)</td><td valign="top"><italic>mut-7(pk204)</italic></td><td valign="top">Caenorhabditis Genetics Center</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:WB-STRAIN:WBStrain00028942">WB-STRAIN:WBStrain00028942</ext-link></td><td valign="top">Genotype: <italic>mut-7(pk204)</italic> III</td></tr><tr><td valign="top">Strain, strain background (<italic>C. elegans</italic>)</td><td valign="top"><italic>nrde-3(gg66)</italic></td><td valign="top">Caenorhabditis Genetics Center</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:WB-STRAIN:WBStrain00040756">WB-STRAIN:WBStrain00040756</ext-link></td><td valign="top">Genotype: <italic>nrde-3(gg66) X</italic></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>ceh-36<sup>prom3</sup></italic>-pPD95.75 vector</td><td valign="top">Oliver Hobert Lab</td><td valign="top"/><td valign="top">AWC-specific promoter <italic>ceh-36<sup>prom3</sup></italic></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>Cewrn-1::GFP</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">2.5 kb upstream of the <italic>Cewrn-1</italic> start site of translation</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::GFP::MUT-7</italic></td><td valign="top">Noelle D. L'Etoile Lab <break/><xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref></td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::4XNLS::mCherry::MUT-7</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">4XNLS::mCherry obtained from pGC302 (Addgene)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::4XNLS::GFP::MUT-7</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">4XNLS::GFP obtained from pGC240 (Addgene)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::MUT-7::GFP</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">MUT-7 was amplified from <italic>yk443</italic> plasmid</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::CeWRN-1::GFP</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top"><italic>Cewrn-1</italic> cDNA from <italic>yk1276</italic> plasmid</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top"><italic>ODR-1::GFP</italic></td><td valign="top">This study</td><td valign="top">Noelle D. L'Etoile Lab</td><td valign="top">AID::3xFLAG, 1 kb downstream of <italic>odr-1.b</italic> stop codon</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC</italic>::GFP::MUT-7(W812Amber)</td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">Site-directed mutagenesis reaction Technologies</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>odr-3::NLS::VC155::EGL-4</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">Add NLS sequence and BiFC analysis</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>odr-3::VC155::EGL-4</italic>.</td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">BiFC analysis</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::VN173::MUT-7</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">BiFC analysis</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::NLS::VN173::MUT-7</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">Add NLS sequence and BiFC analysis</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC</italic>::VN173::MUT-7</td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">BiFC analysis</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::MUT-7::HA::VC155</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">Add HA taq</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::MUT-7::c-Myc::VN173</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">Add c-Myc taq</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::HPL-2::VC155</italic></td><td valign="top">Noelle D. L'Etoile Lab</td><td valign="top"/><td valign="top"><xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top"><italic>pAWC::HIS-71::VN173</italic></td><td valign="top">Noelle D. L'Etoile Lab</td><td valign="top"/><td valign="top"><xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">p<italic>AWC::CeWRN-1::VN173</italic></td><td valign="top">This study</td><td valign="top">Bi-Tzen Juang Lab</td><td valign="top">BiFC analysis</td></tr><tr><td valign="top">Commercial kit</td><td valign="top">QuikChange Lightning Site-Directed Mutagenesis Kit</td><td valign="top">Agilent Technologies</td><td valign="top">Agilent:210518</td><td valign="top"/></tr><tr><td valign="top">Commercial kit</td><td valign="top">TURBO DNA-free Kit</td><td valign="top">Thermo Fisher: Invitrogen</td><td valign="top">Catalog number::AM1907</td><td valign="top"/></tr><tr><td valign="top">Commercial kit</td><td valign="top">Multiscribe Reverse Transcriptase</td><td valign="top">Thermo Fisher: Applied Biosystems</td><td valign="top">Catalog number: 4311235</td><td valign="top"/></tr><tr><td valign="top">Commercial kit</td><td valign="top">TaqMan Universal PCR Master Mix</td><td valign="top">Thermo Fisher: Applied Biosystems</td><td valign="top">Catalog number: 4326708</td><td valign="top"/></tr><tr><td valign="top">Commercial kit</td><td valign="top">iScrpt cDNA Synthesis Kit</td><td valign="top">Bio-Rad</td><td valign="top">Catalog number: 1708890</td><td valign="top"/></tr><tr><td valign="top">Commercial kit</td><td valign="top">iTaq Universal SYBR Green Supermix</td><td valign="top">Bio-Rad</td><td valign="top">Catalog number: 1725120</td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">GraphPad</td><td valign="top">Prism</td><td valign="top">GraphPad Prism 8.0.1</td><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">MetaMorph</td><td valign="top">Molecular Devices</td><td valign="top">Version 7.8.13.0</td><td valign="top"/></tr></tbody></table></table-wrap><sec id="s4-1"><title>Worm strains</title><p>Bristol N2 was used as the wild-type strain: <italic>Cewrn-1(gk99)</italic>; <italic>hpl-2(tm1489)</italic>; <italic>mut-7(ne4255)</italic> and <italic>mut-7(pk204)</italic>; <italic>nrde-3(gg66)</italic>. Nematode strains used in this work were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). Strains were maintained at 20°C on NGM plates seeded with <italic>Escherichia coli</italic> OP50.</p></sec><sec id="s4-2"><title>Plasmid construction and transgenic strains</title><p>Almost constructs were created based on the original plasmid p<italic>ceh-36<sup>prom3</sup></italic>-pPD95.75 (a kind gift from Oliver Hobert [<xref ref-type="bibr" rid="bib7">Etchberger et al., 2007</xref>]), containing an AWC-specific promoter <italic>ceh-36<sup>prom3</sup></italic>, referred to as p<italic>AWC</italic>. Transgenic lines were generated by injecting 20–25 ng/µl of plasmids except BiFC constructs injected 5 ng/μl. Twenty-five nanograms per microliter of <italic>ofm-1</italic>::GFP and p<italic>AWC</italic>::mcherry was used as coinjection markers.</p><sec id="s4-2-1"><title>Cell expression analysis of CeWRN-1</title><sec id="s4-2-1-1"><title><italic>p</italic>Cewrn-1::GFP</title><p>2.5 kb upstream of the <italic>Cewrn-1</italic> start site of translation was amplified and placed into pPD95.75 containing a GFP on the plasmid backbone. This plasmid was used in <xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>.</p></sec></sec><sec id="s4-2-2"><title>AWC-specific expression of MUT-7 and CeWRN-1</title><sec id="s4-2-2-1"><title>p<italic>AWC::GFP::MUT-7</italic></title><p>This construct was created in <xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>. After microinjection into N2 animals, the transgenic line was exposed to TMP and UV for integration purpose. The integrants were selected in the F2 generation by observing 100% transmission of the coinjection markers. To clean the genome of TMP-induced mutations, this strain was outcrossed to N2 through at least three generations. This strain was then crossed to <italic>mut-7(pk204)</italic> background. This plasmid was used in <xref ref-type="fig" rid="fig2">Figure 2</xref>.</p></sec><sec id="s4-2-2-2"><title>p<italic>AWC::4XNLS::mCherry::MUT-7</italic></title><p>4XNLS::mCherry obtained from pGC302 (Addgene) was PCR amplified with primers that contained <italic>BamHI</italic> and <italic>XmaI</italic> sites and inserted into p<italic>ceh-36<sup>prom3</sup></italic>-pPD95.75 pre-cut with the same restriction enzymes. The <italic>mut-7</italic> cDNA was amplified from p<italic>AWC</italic>::GFP::MUT-7 containing a <italic>XmaI</italic> and a <italic>KpnI</italic> restriction enzyme site. The PCR product and the previous p<italic>AWC</italic>::4XNLS::mCherry plasmid were digested with <italic>XmaI</italic> and <italic>KpnI</italic> and ligated together. This plasmid was used in <xref ref-type="fig" rid="fig2">Figure 2A</xref>.</p></sec><sec id="s4-2-2-3"><title>p<italic>AWC::4XNLS::GFP::MUT-7</italic></title><p>4XNLS::GFP obtained from pGC240 (Addgene) was PCR amplified and contained XmaI at the 5′ end. The product was digested with <italic>XmaI</italic> and <italic>XhoI</italic> within the GFP and inserted into p<italic>AWC</italic>::GFP::MUT-7 pre-cut with the same restriction enzymes. This plasmid was used in <xref ref-type="fig" rid="fig2">Figure 2B,C</xref>.</p></sec><sec id="s4-2-2-4"><title>p<italic>AWC::MUT-7::GFP</italic></title><p>The full-length cDNA encoding MUT-7 was amplified from <italic>yk443</italic> containing <italic>KpnI</italic> restriction enzyme site at both ends and in-frame inserted into the p<italic>ceh-36<sup>prom3</sup></italic>-pPD95.75. This plasmid was used in <xref ref-type="fig" rid="fig2">Figure 2</xref>.</p></sec><sec id="s4-2-2-5"><title>p<italic>AWC::CeWRN-1::GFP</italic></title><p>The <italic>Cewrn-1</italic> full-length cDNA from <italic>yk1276</italic> kindly provided by Yuji Kohara was amplified by PCR and contained <italic>KpnI</italic> at the 3′ end. The product was digested with <italic>KpnI</italic> and ligated into the p<italic>ceh-36<sup>prom3</sup></italic>-pPD95.75 cut with <italic>SmaI</italic> and <italic>KpnI</italic>. This plasmid was used in <xref ref-type="fig" rid="fig4">Figure 4B</xref>.</p></sec><sec id="s4-2-2-6"><title><italic>ODR-1::GFP</italic></title><p>To tag <italic>odr-1</italic> locus using CRISPR/Cas9, the repair template construct (pNLZ21) was made by Gibson assembly combining the following components: 1.1 kb upstream of <italic>odr-1.b</italic> stop codon, N-terminal mEGFP added with Intron-embedded LoxP-flanked (Myc, let-858 Terminator, Cbr-unc-119, and reverse p<italic>hsp16-41</italic>::CRE:tbb-2 3’UTR) with C-terminal mEGFP, AID::3xFLAG, 1 kb downstream of <italic>odr-1.b</italic> stop codon, and pUC-118. mEGFP was derived from pMB66 (Addgene plasmid #19329). Cbr-unc-119 was derived from pCFJ150 vector (Addgene plasmid #19329). let-858 Terminator, p<italic>hsp16-41</italic>::CRE::tbb-2 3′UTR, and AID::3xFLAG were derived from pJW1584 (Addgene plasmid #121055). pU6:sgRNA (F+E) (pNLZ22) targeting <italic>odr-1</italic> with guide sequence 5′-<named-content content-type="sequence">ggcgtcataggcggtaacgg</named-content> was derived from pDD162 (Addgene plasmid #46149). To generate JZ2147:<italic>odr-1(py7)</italic> (<italic>odr-1</italic>::mEGFP::AID::3xFLAG), pJW1259 (p<italic>eft-3:</italic>:Cas9::tbb-2 3’UTR) (Addgene plasmid #61251), the repair template, and pU6::sgRNA targeting <italic>odr-1</italic> were injected into <italic>unc-119(ed3)</italic> worms with coinjection markers. Progeny that moved like wild type but without fluorescent coinjection markers were PCR examined and singled out. To excise LoxP-flanked cassette, pDD104 (p<italic>eft-3</italic>::CRE::tbb-2 3′UTR) (Addgene plasmid #47551) was injected into verified <italic>odr-1-</italic>tagged worms. Unc progeny was singled out and verified by PCR. Then, <italic>unc-119</italic> worms carrying the <italic>odr-1</italic>::mEGFP fragment were crossed with wild type to remove <italic>unc-119(ed3)</italic> allele. This plasmid and strain were used in <xref ref-type="fig" rid="fig2">Figure 2D</xref>.</p></sec></sec><sec id="s4-2-3"><title>Site-directed mutagenesis in phosphorylation sites of MUT-7</title><p>All constructs created by site-directed mutagenesis were from our previous work (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>) except p<italic>AWC</italic>::GFP::MUT-7(W812Amber). The primers used for creating W812 Amber substitution were 5′-<named-content content-type="sequence">CCACTGGAAGAATGGTAGAATCGTATGCTTCATATC</named-content> and 5′-<named-content content-type="sequence">GATATGAAGCATACGATTCTACCATTCTTCCAGTGG</named-content>, and the site-directed mutagenesis reaction was performed by the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). These plasmids were used in <xref ref-type="fig" rid="fig3">Figure 3A</xref>.</p></sec><sec id="s4-2-4"><title>BiFC analysis</title><p>Two <italic>C. elegans</italic> BiFC plasmids, pCE-BiFC-VN173 and pCE-BiFC-VC155, were obtained from AddGene. All site-directed mutagenesis reactions were performed by QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, 210518). These plasmids were used in <xref ref-type="fig" rid="fig3">Figures 3C</xref> and <xref ref-type="fig" rid="fig4">4A</xref>.</p><list list-type="alpha-lower"><list-item><p>p<italic>odr-3::NLS::VC155::EGL-4</italic>. This construct used was made by replacing the GFP fragment of p<italic>odr-3</italic>::NLS::GFP::EGL-4 (<xref ref-type="bibr" rid="bib25">Lee et al., 2010b</xref>) with a VC155 fragment that was amplified from pCE-BiFC-VC155 with two primers containing a <italic>BamHI</italic> site at the 5′ end of the forward and reverse primers (5′-<named-content content-type="sequence">GGATCCGACAAGCAGAAGAACGGCAT</named-content> and 5′-<named-content content-type="sequence">GGATCCCTTGTACAGCTCGTCCATG</named-content>). The resulting plasmid was sequenced to confirm the correct orientation.</p></list-item> <list-item><p>p<italic>odr-3::VC155::EGL-4</italic>. This construct was created by two rounds of site-directed mutagenesis on p<italic>odr-3</italic>::NLS::VC155::EGL-4. First, a start codon ATG was in frame inserted into upstream of the VC155 with two primers designed by primerX software (<ext-link ext-link-type="uri" xlink:href="http://www.bioinformatics.org/primerx/cgi-bin/DNA_1.cgi">http://www.bioinformatics.org/primerx/cgi-bin/DNA_1.cgi</ext-link>) (5′-<named-content content-type="sequence">CGTAAGGTAGGATCCATGGACAAGCAGAAGAAC</named-content> and 5′-<named-content content-type="sequence">GTTCTTCTGCTTGTCCATGGATCCTACCTTACG</named-content>). Next, the start codon ATG of NLS was disrupted with two primers (5′- <named-content content-type="sequence">GAAAATCAACTGGAAATAAGCCCAAAGAAGAAGCG</named-content> and 5′-<named-content content-type="sequence">CGCTTCTTCTTTGGGCTTATTTCCAGTTGATTTTC</named-content>).</p></list-item> <list-item><p>p<italic>AWC::VN173::MUT-7</italic>. A VN173 fragment was PCR amplified using pCE-BiFC-VN173 as template with primers that contained <italic>BamHI</italic> at the both ends and cloned into the p<italic>ceh-36<sup>prom3</sup></italic>-pPD95.75 plasmid. The <italic>mut-7</italic> cDNA was PCR amplified with two primers that contained <italic>KpnI</italic> and <italic>EcoRI</italic> (5′-<named-content content-type="sequence">tttgcgGGTACCATGGAAGAAGAACCGTACAAAAGA</named-content> and 5′-<named-content content-type="sequence">CAGTTGGAATTCTCAACATTCCTGGCTGGTG</named-content>) and cloned into the previous plasmid pre-cut with the same enzymes.</p></list-item> <list-item><p>p<italic>AWC::NLS::VN173::MUT-7</italic>. A 4XNLS fragment was PCR amplified from pGC240 (AddGene) and contained <italic>BamHI</italic> at both ends and inserted into the p<italic>AWC</italic>::VN173::MUT-7 with the same restriction enzyme.</p></list-item> <list-item><p>p<italic>AWC::MUT-7::HA::VC155</italic>. The AWC-specific promoter, <italic>ceh-36<sup>prom3</sup></italic>, was fused upstream of the <italic>mut-7</italic> cDNA and cloned into pCE-BiFC-VC155 using the restriction enzymes <italic>XmaI</italic> and <italic>SacII</italic>. To analyze whether this version of MUT-7 functions normally, p<italic>AWC</italic>::MUT-7::HA::GFP was made by replacing the VC155 fragment with GFP using the restriction enzymes <italic>KpnI</italic> and <italic>NotI</italic>. This plasmid was used in <xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3</xref>.</p> </list-item> <list-item><p>p<italic>AWC::MUT-7::c-Myc::VN173</italic>. The AWC-specific <italic>ceh-36<sup>prom3</sup></italic> promoter was fused upstream of the <italic>mut-7</italic> cDNA and cloned into pCE-BiFC-VN173 using the restriction enzymes <italic>SphI</italic> and <italic>SacII</italic>.</p></list-item> <list-item><p>p<italic>AWC::HPL-2::VC155</italic> and <italic>pAWC::HIS-71::VN173</italic>. These constructs were created in <xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>.</p></list-item> <list-item><p>p<italic>AWC::CeWRN-1::VN173</italic>. This construct was made by replacing the <italic>his-71</italic> genomic DNA of p<italic>AWC</italic>::HIS-71::VN173 with the <italic>Cewrn-1</italic> cDNA which was amplified with two primers containing <italic>NheI</italic> and <italic>KpnI</italic> (5′-<named-content content-type="sequence">cttgGCTAGCATGATAAGTGATGATGACGATCTACC</named-content> and 5′-ctttGGTACC <named-content content-type="sequence">AAGTTTGAATTTCTTCAATGGAGG</named-content>).</p></list-item></list></sec></sec><sec id="s4-3"><title>Behavioral assay</title><p>Olfactory behavioral assay was performed as described previously (<xref ref-type="bibr" rid="bib4">Colbert and Bargmann, 1995</xref>). Briefly, ~200 adult worms that were grown on HB101-seeded plates for 5 days at 20°C were collected and split into two 1.5 ml microcentrifuge tubes. To remove bacterial contamination, animals were washed three times with S-basal buffer. For odor training, animals were pre-exposed to 1.5 ml of diluted buffer (10 μl of butanone per 100 ml S-basal buffer), while a control population was pre-exposed to S-basal buffer only. After 80 min, animals were washed twice with S-basal buffer and once with water to get rid of butanone. Animals were then placed on 10 ml of chemotaxis agar (1.6% agar in 5 mM potassium phosphate [pH 6.0], 1 mM CaCl<sub>2</sub>, and 1 mM MgSO<sub>4</sub>) in a 9 cm diameter Petri dish. One microliter drop of butanone source diluted 1:1000 in ethanol and 1 µl drop of ethanol source were spotted on each side of the plate with 1 μl of 1 M sodium azide at the same spots at the beginning of the assay. After 2 hr, worms were scored for CI index calculation: the number of animals roaming near the attractive odor source minus the number of animals roaming near the control ethanol source and then the difference was divided by the total animals on the assay plate. Animals were kept at 20°C through all the assay steps.</p></sec><sec id="s4-4"><title>BiFC assay</title><p>Transgenic worms expressing a pair of BiFC constructs were picked at L4 stage and incubated on HB101-seeded plate for 5 days at 20°C. Young adult animals were washed with S-basal buffer for three times and then spilt into two tubes: one incubates in S-basal buffer (naïve worm); another pre-exposes to butanone-diluted buffer (odor-trained worms). The tubes were rotated for 80 min at 20°C. Twenty to 30 worms were mounted on an agarose pad with adding 1 μM of NaN<sub>3</sub>, and then took pictures at the same illumination and exposure using an Upright Microscope (Leica DM6 B) at 63× magnification. All tested worms are analyzed by taking continuous Z-section fluorescence images at 0.3 μm intervals throughout the thickness of the pharynx. We analyze carefully all the images to decide whether BiFC signals are observed or not. The quantitation of BiFC is determined by dividing the number of worms showing BiFC signals by the total number of worms tested.</p></sec><sec id="s4-5"><title>Brood size assay</title><p>To measure the brood size of worms, single L4 worm was picked and grown on a NGM plate seeded with <italic>E. coli</italic> OP50 at 20°C. Once reached adulthood, the animal was gently transferred to a new plate, and its eggs laid on the original plate were scored. This step was repeated every 24 hr until Day 3.</p></sec><sec id="s4-6"><title>Gonad cell death assay</title><p>Five L4 worms were placed on an OP50-seeded plate and incubated at 20°C. Once animals had grown to adulthood, cell corpses in the gonad were counted at 12, 24, 48, and 96 hr in DIC microscopy.</p></sec><sec id="s4-7"><title>Quantitative real-time PCR</title><p>Quantitative real-time PCR was performed as described previously (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Briefly, adult animals from three bacterial seeded plates were collected and washed with S-basal buffer. One hundred to 200 animals were applied for a behavioral assay, and the remaining animals were isolated total RNA by using TRIZOL extraction (<xref ref-type="bibr" rid="bib3">Chomczynski and Sacchi, 1987</xref>). RNA was purified by 1-bromo-3-chloropropane, precipitated by isopropanol, and resuspended in RNAase-free water. The genomic DNA in the RNA samples was removed by using TURBO DNA-free Kit (Invitrogen).</p><sec id="s4-7-1"><title>Quantitation of odr-1 22G RNA</title><p>The total RNA from entire worms was used in measuring 22G RNA quantitation in <xref ref-type="fig" rid="fig2">Figure 2C</xref>. All <italic>odr-1</italic> 22G RNAs were originally provided from <xref ref-type="bibr" rid="bib11">Gu et al., 2009</xref>, and the most abundant species termed <italic>odr-1.7</italic> (<named-content content-type="sequence">GCAAACATATTGAGGGTAAGT</named-content>) was used to design Taqman probe and primers for quantization of 22G RNA (<xref ref-type="bibr" rid="bib16">Juang et al., 2013</xref>). Forty-eight nanogram of total RNA was applied for cDNA synthesis by Multiscribe Reverse Transcriptase (Applied Biosystems). Quantitative real-time PCR was prepared by mixing cDNA, fluorogenic probe, and TaqMan Universal PCR Master Mix (Applied Biosystems) in triplicate for each sample. Thermocycling conditions carried out on a Roche LC-480 II instrument were denaturation at 95°C for 10 min, followed by 50 cycles of 15 s at 95°C and 1 min at 60°C. The threshold cycle number of log-based fluorescence (Ct) was obtained, and the relative expression level (dCt) of <italic>odr-1</italic> 22G RNA was normalized to a mature small nuclear RNA control (sn2343, Applied Biosystems). The fold change of 22G RNA expression was calculated by the ratio of odor-trained over naive populations.</p></sec><sec id="s4-7-2"><title>Quantitation of <italic>odr-1</italic> mRNA</title><p>One milligram of total RNA was applied for cDNA synthesis by using iScrpt cDNA Synthesis Kit (Bio-Rad). Twenty microliters of dye-based quantitative PCR was prepared by adding 500 nM of forward and reverse primers, 2 μl of cDNA, and 10 μl of 2× iTaq Universal SYBR Green Supermix (Bio-Rad). The cycling program was run 50 cycles and each cycle included 95°C for 15 s and 60°C for 1 min. The primers for <italic>odr-1</italic> were 5′-<named-content content-type="sequence">gcgaagacccctaccattta</named-content> and 5′-<named-content content-type="sequence">cgctggcaacatttcattta</named-content>, and the primers for internal control <italic>act-3</italic> were 5′-<named-content content-type="sequence">cggtatgggacagaaggac</named-content> and 5′-<named-content content-type="sequence">ggaagcgtagagggagagga</named-content>. The mRNA expression level of <italic>odr-1</italic> was determined by the Ct value and then normalized to <italic>act-3</italic>. The fold change of odr-1 mRNA by prolonged odor exposure was measured by the ratio of odor-trained over naïve worms and shown in <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>.</p></sec></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Paul J Hagerman for critical reading and helpful discussion. We thank Jung-Hsiang Chen, Chin-Fu Wang, and Jay Shieh (Department of Materials Science and Engineering, National Taiwan University); Yan-Hwa Wu Lee, Chih-Sheng Lin, and Yun-Ming Wang (National Chiao Tung University); and Yuh-Jyh Jong (Kaohsiung Medical University) for their help in the early development of the B-TJ laboratory. We thank Chan-Hsien Yeh, Chiao-Hui Chuang, Chun-Yen Teng, Yi-Yin Chen, and Huang-Chin Lin for figure editing and software teaching. We thank the Caenorhabditis Genetics Center and the National Bioresource Project for worm strains and Yuji Kohara for yk cDNA clones. We thank the assistance from the Taiwan <italic>C. elegans</italic> core facility (CECF). B-TJ acknowledges support from the Ministry of Science and Technology, Taiwan (103–2311-B-009–003-MY2 and 105–2311-B-009–002-MY3) and the higher education sprout project of the National Chiao Tung University and Ministry of Education, Taiwan. NDL acknowledges support from the National Institutes of Health (2R01DC005991 and R01DC015758).</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Data curation, Validation, Methodology</p></fn><fn fn-type="con" id="con3"><p>Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con4"><p>Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>Asymmetric expression of <italic>str-2</italic> in AWC neurons.</title><p>The cell fate of the AWC neuron was examined by quantifying the asymmetric expression of p<italic>str-2</italic>::DsRed. Animals were scored in three categories according to p<italic>str-2</italic>::DsRed expression either in AWC (0AWCp<italic>str-2</italic> ON), in only one AWC (1AWCp<italic>str-2</italic> ON), or in both AWCs (2AWCp<italic>str-2</italic> ON).</p></caption><media mime-subtype="docx" mimetype="application" xlink:href="elife-62449-supp1-v2.docx"/></supplementary-material><supplementary-material id="supp2"><label>Supplementary file 2.</label><caption><title>Nuclear accumulation of EGL-4 after prolonged butanone exposure.</title><p>Integrated GFP-tagged EGL-4 (termed pyIs500) was expressed in wild-type, <italic>hpl-2(tm1489)</italic>, and <italic>Cewrn-1(gk99)</italic> animals. The nuclear expression of EGL-4 was scored in naïve and odor-trained animals.</p></caption><media mime-subtype="docx" mimetype="application" xlink:href="elife-62449-supp2-v2.docx"/></supplementary-material><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="docx" mimetype="application" xlink:href="elife-62449-transrepform-v2.docx"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>All data generated or analysed during this study are included in the manuscript and supporting files.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bargmann</surname> <given-names>CI</given-names></name><name><surname>Hartwieg</surname> <given-names>E</given-names></name><name><surname>Horvitz</surname> <given-names>HR</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Odorant-selective genes and neurons mediate olfaction in <italic>C. elegans</italic></article-title><source>Cell</source><volume>74</volume><fpage>515</fpage><lpage>527</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(93)80053-H</pub-id><pub-id pub-id-type="pmid">8348618</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cho</surname> <given-names>CE</given-names></name><name><surname>Brueggemann</surname> <given-names>C</given-names></name><name><surname>L'Etoile</surname> <given-names>ND</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Parallel encoding of sensory history and behavioral preference during <italic>Caenorhabditis elegans</italic> olfactory learning</article-title><source>eLife</source><volume>5</volume><elocation-id>e14000</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.14000</pub-id><pub-id pub-id-type="pmid">27383131</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chomczynski</surname> <given-names>P</given-names></name><name><surname>Sacchi</surname> <given-names>N</given-names></name></person-group><year iso-8601-date="1987">1987</year><article-title>Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction</article-title><source>Analytical Biochemistry</source><volume>162</volume><fpage>156</fpage><lpage>159</lpage><pub-id pub-id-type="doi">10.1016/0003-2697(87)90021-2</pub-id><pub-id pub-id-type="pmid">2440339</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Colbert</surname> <given-names>HA</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Odorant-specific adaptation pathways generate olfactory plasticity in <italic>C. elegans</italic></article-title><source>Neuron</source><volume>14</volume><fpage>803</fpage><lpage>812</lpage><pub-id pub-id-type="doi">10.1016/0896-6273(95)90224-4</pub-id><pub-id pub-id-type="pmid">7718242</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Colbert</surname> <given-names>HA</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>Environmental signals modulate olfactory acuity, discrimination, and memory in <italic>Caenorhabditis elegans</italic></article-title><source>Learning &amp; Memory</source><volume>4</volume><fpage>179</fpage><lpage>191</lpage><pub-id pub-id-type="doi">10.1101/lm.4.2.179</pub-id><pub-id pub-id-type="pmid">10456062</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dallaire</surname> <given-names>A</given-names></name><name><surname>Garand</surname> <given-names>C</given-names></name><name><surname>Paquel</surname> <given-names>ER</given-names></name><name><surname>Mitchell</surname> <given-names>SJ</given-names></name><name><surname>de Cabo</surname> <given-names>R</given-names></name><name><surname>Simard</surname> <given-names>MJ</given-names></name><name><surname>Lebel</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Down regulation of miR-124 in both werner syndrome DNA helicase mutant mice and mutant <italic>Caenorhabditis elegans</italic> wrn-1 reveals the importance of this microRNA in accelerated aging</article-title><source>Aging</source><volume>4</volume><fpage>636</fpage><lpage>647</lpage><pub-id pub-id-type="doi">10.18632/aging.100489</pub-id><pub-id pub-id-type="pmid">23075628</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Etchberger</surname> <given-names>JF</given-names></name><name><surname>Lorch</surname> <given-names>A</given-names></name><name><surname>Sleumer</surname> <given-names>MC</given-names></name><name><surname>Zapf</surname> <given-names>R</given-names></name><name><surname>Jones</surname> <given-names>SJ</given-names></name><name><surname>Marra</surname> <given-names>MA</given-names></name><name><surname>Holt</surname> <given-names>RA</given-names></name><name><surname>Moerman</surname> <given-names>DG</given-names></name><name><surname>Hobert</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>The molecular signature and cis-regulatory architecture of <italic>a C. elegans</italic> gustatory neuron</article-title><source>Genes &amp; Development</source><volume>21</volume><fpage>1653</fpage><lpage>1674</lpage><pub-id pub-id-type="doi">10.1101/gad.1560107</pub-id><pub-id pub-id-type="pmid">17606643</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fang</surname> <given-names>EF</given-names></name><name><surname>Hou</surname> <given-names>Y</given-names></name><name><surname>Lautrup</surname> <given-names>S</given-names></name><name><surname>Jensen</surname> <given-names>MB</given-names></name><name><surname>Yang</surname> <given-names>B</given-names></name><name><surname>SenGupta</surname> <given-names>T</given-names></name><name><surname>Caponio</surname> <given-names>D</given-names></name><name><surname>Khezri</surname> <given-names>R</given-names></name><name><surname>Demarest</surname> <given-names>TG</given-names></name><name><surname>Aman</surname> <given-names>Y</given-names></name><name><surname>Figueroa</surname> <given-names>D</given-names></name><name><surname>Morevati</surname> <given-names>M</given-names></name><name><surname>Lee</surname> <given-names>HJ</given-names></name><name><surname>Kato</surname> <given-names>H</given-names></name><name><surname>Kassahun</surname> <given-names>H</given-names></name><name><surname>Lee</surname> <given-names>JH</given-names></name><name><surname>Filippelli</surname> <given-names>D</given-names></name><name><surname>Okur</surname> <given-names>MN</given-names></name><name><surname>Mangerich</surname> <given-names>A</given-names></name><name><surname>Croteau</surname> <given-names>DL</given-names></name><name><surname>Maezawa</surname> <given-names>Y</given-names></name><name><surname>Lyssiotis</surname> <given-names>CA</given-names></name><name><surname>Tao</surname> <given-names>J</given-names></name><name><surname>Yokote</surname> <given-names>K</given-names></name><name><surname>Rusten</surname> <given-names>TE</given-names></name><name><surname>Mattson</surname> <given-names>MP</given-names></name><name><surname>Jasper</surname> <given-names>H</given-names></name><name><surname>Nilsen</surname> <given-names>H</given-names></name><name><surname>Bohr</surname> <given-names>VA</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>NAD<sup>+</sup> augmentation restores mitophagy and limits accelerated aging in werner syndrome</article-title><source>Nature Communications</source><volume>10</volume><elocation-id>5284</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-019-13172-8</pub-id><pub-id pub-id-type="pmid">31754102</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Glazov</surname> <given-names>E</given-names></name><name><surname>Phillips</surname> <given-names>K</given-names></name><name><surname>Budziszewski</surname> <given-names>GJ</given-names></name><name><surname>Schöb</surname> <given-names>H</given-names></name><name><surname>Meins</surname> <given-names>F</given-names></name><name><surname>Levin</surname> <given-names>JZ</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>A gene encoding an RNase D exonuclease-like protein is required for post-transcriptional silencing in Arabidopsis</article-title><source>The Plant Journal</source><volume>35</volume><fpage>342</fpage><lpage>349</lpage><pub-id pub-id-type="doi">10.1046/j.1365-313X.2003.01810.x</pub-id><pub-id pub-id-type="pmid">12887585</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Goto</surname> <given-names>M</given-names></name><name><surname>Ishikawa</surname> <given-names>Y</given-names></name><name><surname>Sugimoto</surname> <given-names>M</given-names></name><name><surname>Furuichi</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Werner Syndrome: a changing pattern of clinical manifestations in Japan (1917~2008)</article-title><source>BioScience Trends</source><volume>7</volume><fpage>13</fpage><lpage>22</lpage><pub-id pub-id-type="doi">10.5582/bst.2013.v7.1.13</pub-id><pub-id pub-id-type="pmid">23524889</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gu</surname> <given-names>W</given-names></name><name><surname>Shirayama</surname> <given-names>M</given-names></name><name><surname>Conte</surname> <given-names>D</given-names></name><name><surname>Vasale</surname> <given-names>J</given-names></name><name><surname>Batista</surname> <given-names>PJ</given-names></name><name><surname>Claycomb</surname> <given-names>JM</given-names></name><name><surname>Moresco</surname> <given-names>JJ</given-names></name><name><surname>Youngman</surname> <given-names>EM</given-names></name><name><surname>Keys</surname> <given-names>J</given-names></name><name><surname>Stoltz</surname> <given-names>MJ</given-names></name><name><surname>Chen</surname> <given-names>CC</given-names></name><name><surname>Chaves</surname> <given-names>DA</given-names></name><name><surname>Duan</surname> <given-names>S</given-names></name><name><surname>Kasschau</surname> <given-names>KD</given-names></name><name><surname>Fahlgren</surname> <given-names>N</given-names></name><name><surname>Yates</surname> <given-names>JR</given-names></name><name><surname>Mitani</surname> <given-names>S</given-names></name><name><surname>Carrington</surname> <given-names>JC</given-names></name><name><surname>Mello</surname> <given-names>CC</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the <italic>C. elegans</italic> germline</article-title><source>Molecular Cell</source><volume>36</volume><fpage>231</fpage><lpage>244</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2009.09.020</pub-id><pub-id pub-id-type="pmid">19800275</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guang</surname> <given-names>S</given-names></name><name><surname>Bochner</surname> <given-names>AF</given-names></name><name><surname>Pavelec</surname> <given-names>DM</given-names></name><name><surname>Burkhart</surname> <given-names>KB</given-names></name><name><surname>Harding</surname> <given-names>S</given-names></name><name><surname>Lachowiec</surname> <given-names>J</given-names></name><name><surname>Kennedy</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>An argonaute transports siRNAs from the cytoplasm to the nucleus</article-title><source>Science</source><volume>321</volume><fpage>537</fpage><lpage>541</lpage><pub-id pub-id-type="doi">10.1126/science.1157647</pub-id><pub-id pub-id-type="pmid">18653886</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Halic</surname> <given-names>M</given-names></name><name><surname>Moazed</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>22G-RNAs in transposon silencing and centromere function</article-title><source>Molecular Cell</source><volume>36</volume><fpage>170</fpage><lpage>171</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2009.10.010</pub-id><pub-id pub-id-type="pmid">19854125</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hu</surname> <given-names>CD</given-names></name><name><surname>Grinberg</surname> <given-names>A</given-names></name><name><surname>Kerppola</surname> <given-names>TK</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Visualization of protein interactions in living cells using bimolecular fluorescence complementation (BiFC) analysis</article-title><source>Current Protocols in Cell Biology</source><volume>21</volume><elocation-id>23</elocation-id><pub-id pub-id-type="doi">10.1002/0471143030.cb2103s29</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huang</surname> <given-names>S</given-names></name><name><surname>Lee</surname> <given-names>L</given-names></name><name><surname>Hanson</surname> <given-names>NB</given-names></name><name><surname>Lenaerts</surname> <given-names>C</given-names></name><name><surname>Hoehn</surname> <given-names>H</given-names></name><name><surname>Poot</surname> <given-names>M</given-names></name><name><surname>Rubin</surname> <given-names>CD</given-names></name><name><surname>Chen</surname> <given-names>DF</given-names></name><name><surname>Yang</surname> <given-names>CC</given-names></name><name><surname>Juch</surname> <given-names>H</given-names></name><name><surname>Dorn</surname> <given-names>T</given-names></name><name><surname>Spiegel</surname> <given-names>R</given-names></name><name><surname>Oral</surname> <given-names>EA</given-names></name><name><surname>Abid</surname> <given-names>M</given-names></name><name><surname>Battisti</surname> <given-names>C</given-names></name><name><surname>Lucci-Cordisco</surname> <given-names>E</given-names></name><name><surname>Neri</surname> <given-names>G</given-names></name><name><surname>Steed</surname> <given-names>EH</given-names></name><name><surname>Kidd</surname> <given-names>A</given-names></name><name><surname>Isley</surname> <given-names>W</given-names></name><name><surname>Showalter</surname> <given-names>D</given-names></name><name><surname>Vittone</surname> <given-names>JL</given-names></name><name><surname>Konstantinow</surname> <given-names>A</given-names></name><name><surname>Ring</surname> <given-names>J</given-names></name><name><surname>Meyer</surname> <given-names>P</given-names></name><name><surname>Wenger</surname> <given-names>SL</given-names></name><name><surname>von Herbay</surname> <given-names>A</given-names></name><name><surname>Wollina</surname> <given-names>U</given-names></name><name><surname>Schuelke</surname> <given-names>M</given-names></name><name><surname>Huizenga</surname> <given-names>CR</given-names></name><name><surname>Leistritz</surname> <given-names>DF</given-names></name><name><surname>Martin</surname> <given-names>GM</given-names></name><name><surname>Mian</surname> <given-names>IS</given-names></name><name><surname>Oshima</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>The spectrum of WRN mutations in werner syndrome patients</article-title><source>Human Mutation</source><volume>27</volume><fpage>558</fpage><lpage>567</lpage><pub-id pub-id-type="doi">10.1002/humu.20337</pub-id><pub-id pub-id-type="pmid">16673358</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Juang</surname> <given-names>BT</given-names></name><name><surname>Gu</surname> <given-names>C</given-names></name><name><surname>Starnes</surname> <given-names>L</given-names></name><name><surname>Palladino</surname> <given-names>F</given-names></name><name><surname>Goga</surname> <given-names>A</given-names></name><name><surname>Kennedy</surname> <given-names>S</given-names></name><name><surname>L'Etoile</surname> <given-names>ND</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Endogenous nuclear RNAi mediates behavioral adaptation to odor</article-title><source>Cell</source><volume>154</volume><fpage>1010</fpage><lpage>1022</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2013.08.006</pub-id><pub-id pub-id-type="pmid">23993094</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kamath-Loeb</surname> <given-names>AS</given-names></name><name><surname>Zavala-van Rankin</surname> <given-names>DG</given-names></name><name><surname>Flores-Morales</surname> <given-names>J</given-names></name><name><surname>Emond</surname> <given-names>MJ</given-names></name><name><surname>Sidorova</surname> <given-names>JM</given-names></name><name><surname>Carnevale</surname> <given-names>A</given-names></name><name><surname>Cárdenas-Cortés</surname> <given-names>MD</given-names></name><name><surname>Norwood</surname> <given-names>TH</given-names></name><name><surname>Monnat</surname> <given-names>RJ</given-names></name><name><surname>Loeb</surname> <given-names>LA</given-names></name><name><surname>Mercado-Celis</surname> <given-names>GE</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Homozygosity for the WRN Helicase-Inactivating variant, R834C, does not confer a werner syndrome clinical phenotype</article-title><source>Scientific Reports</source><volume>7</volume><elocation-id>44081</elocation-id><pub-id pub-id-type="doi">10.1038/srep44081</pub-id><pub-id pub-id-type="pmid">28276523</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kerppola</surname> <given-names>TK</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Design and implementation of bimolecular fluorescence complementation (BiFC) assays for the visualization of protein interactions in living cells</article-title><source>Nature Protocols</source><volume>1</volume><fpage>1278</fpage><lpage>1286</lpage><pub-id pub-id-type="doi">10.1038/nprot.2006.201</pub-id><pub-id pub-id-type="pmid">17406412</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ketting</surname> <given-names>RF</given-names></name><name><surname>Haverkamp</surname> <given-names>THA</given-names></name><name><surname>van Luenen</surname> <given-names>HGAM</given-names></name><name><surname>Plasterk</surname> <given-names>RHA</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>mut-7 of <italic>C. elegans</italic>, required for transposon silencing and RNA interference, is a homolog of werner syndrome helicase and RNaseD</article-title><source>Cell</source><volume>99</volume><fpage>133</fpage><lpage>141</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)81645-1</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>L'Etoile</surname> <given-names>ND</given-names></name><name><surname>Coburn</surname> <given-names>CM</given-names></name><name><surname>Eastham</surname> <given-names>J</given-names></name><name><surname>Kistler</surname> <given-names>A</given-names></name><name><surname>Gallegos</surname> <given-names>G</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>The cyclic GMP-dependent protein kinase EGL-4 regulates olfactory adaptation in <italic>C. elegans</italic></article-title><source>Neuron</source><volume>36</volume><fpage>1079</fpage><lpage>1089</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(02)01066-8</pub-id><pub-id pub-id-type="pmid">12495623</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>L'Etoile</surname> <given-names>ND</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Olfaction and odor discrimination are mediated by <italic>the C. elegans</italic> guanylyl cyclase ODR-1</article-title><source>Neuron</source><volume>25</volume><fpage>575</fpage><lpage>586</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(00)81061-2</pub-id><pub-id pub-id-type="pmid">10774726</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lebel</surname> <given-names>M</given-names></name><name><surname>Monnat</surname> <given-names>RJ</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Werner syndrome (WRN) gene variants and their association with altered function and age-associated diseases</article-title><source>Ageing Research Reviews</source><volume>41</volume><fpage>82</fpage><lpage>97</lpage><pub-id pub-id-type="doi">10.1016/j.arr.2017.11.003</pub-id><pub-id pub-id-type="pmid">29146545</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname> <given-names>SJ</given-names></name><name><surname>Yook</surname> <given-names>JS</given-names></name><name><surname>Han</surname> <given-names>SM</given-names></name><name><surname>Koo</surname> <given-names>HS</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>A werner syndrome protein homolog <italic>affects C. elegans</italic> development, growth rate, life span and sensitivity to DNA damage by acting at a DNA damage checkpoint</article-title><source>Development</source><volume>131</volume><fpage>2565</fpage><lpage>2575</lpage><pub-id pub-id-type="doi">10.1242/dev.01136</pub-id><pub-id pub-id-type="pmid">15115755</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname> <given-names>JI</given-names></name><name><surname>O'Halloran</surname> <given-names>DM</given-names></name><name><surname>Eastham-Anderson</surname> <given-names>J</given-names></name><name><surname>Juang</surname> <given-names>BT</given-names></name><name><surname>Kaye</surname> <given-names>JA</given-names></name><name><surname>Scott Hamilton</surname> <given-names>O</given-names></name><name><surname>Lesch</surname> <given-names>B</given-names></name><name><surname>Goga</surname> <given-names>A</given-names></name><name><surname>L'Etoile</surname> <given-names>ND</given-names></name></person-group><year iso-8601-date="2010">2010a</year><article-title>Nuclear entry of a cGMP-dependent kinase converts transient into long-lasting olfactory adaptation</article-title><source>PNAS</source><volume>107</volume><fpage>6016</fpage><lpage>6021</lpage><pub-id pub-id-type="doi">10.1073/pnas.1000866107</pub-id><pub-id pub-id-type="pmid">20220099</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname> <given-names>SJ</given-names></name><name><surname>Gartner</surname> <given-names>A</given-names></name><name><surname>Hyun</surname> <given-names>M</given-names></name><name><surname>Ahn</surname> <given-names>B</given-names></name><name><surname>Koo</surname> <given-names>HS</given-names></name></person-group><year iso-8601-date="2010">2010b</year><article-title>The <italic>Caenorhabditis elegans</italic> werner syndrome protein functions upstream of ATR and ATM in response to DNA replication inhibition and double-strand DNA breaks</article-title><source>PLOS Genetics</source><volume>6</volume><elocation-id>e1000801</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.1000801</pub-id><pub-id pub-id-type="pmid">20062519</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lessel</surname> <given-names>D</given-names></name><name><surname>Hisama</surname> <given-names>FM</given-names></name><name><surname>Szakszon</surname> <given-names>K</given-names></name><name><surname>Saha</surname> <given-names>B</given-names></name><name><surname>Sanjuanelo</surname> <given-names>AB</given-names></name><name><surname>Salbert</surname> <given-names>BA</given-names></name><name><surname>Steele</surname> <given-names>PD</given-names></name><name><surname>Baldwin</surname> <given-names>J</given-names></name><name><surname>Brown</surname> <given-names>WT</given-names></name><name><surname>Piussan</surname> <given-names>C</given-names></name><name><surname>Plauchu</surname> <given-names>H</given-names></name><name><surname>Szilvássy</surname> <given-names>J</given-names></name><name><surname>Horkay</surname> <given-names>E</given-names></name><name><surname>Högel</surname> <given-names>J</given-names></name><name><surname>Martin</surname> <given-names>GM</given-names></name><name><surname>Herr</surname> <given-names>AJ</given-names></name><name><surname>Oshima</surname> <given-names>J</given-names></name><name><surname>Kubisch</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>POLD1 germline mutations in patients initially diagnosed with werner syndrome</article-title><source>Human Mutation</source><volume>36</volume><fpage>1070</fpage><lpage>1079</lpage><pub-id pub-id-type="doi">10.1002/humu.22833</pub-id><pub-id pub-id-type="pmid">26172944</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maierhofer</surname> <given-names>A</given-names></name><name><surname>Flunkert</surname> <given-names>J</given-names></name><name><surname>Oshima</surname> <given-names>J</given-names></name><name><surname>Martin</surname> <given-names>GM</given-names></name><name><surname>Poot</surname> <given-names>M</given-names></name><name><surname>Nanda</surname> <given-names>I</given-names></name><name><surname>Dittrich</surname> <given-names>M</given-names></name><name><surname>Müller</surname> <given-names>T</given-names></name><name><surname>Haaf</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Epigenetic signatures of werner syndrome occur early in life and are distinct from normal epigenetic aging processes</article-title><source>Aging Cell</source><volume>18</volume><elocation-id>e12995</elocation-id><pub-id pub-id-type="doi">10.1111/acel.12995</pub-id><pub-id pub-id-type="pmid">31259468</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>O'Halloran</surname> <given-names>DM</given-names></name><name><surname>Altshuler-Keylin</surname> <given-names>S</given-names></name><name><surname>Lee</surname> <given-names>JI</given-names></name><name><surname>L'Etoile</surname> <given-names>ND</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Regulators of AWC-mediated olfactory plasticity in <italic>Caenorhabditis elegans</italic></article-title><source>PLOS Genetics</source><volume>5</volume><elocation-id>e1000761</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.1000761</pub-id><pub-id pub-id-type="pmid">20011101</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>O'Halloran</surname> <given-names>DM</given-names></name><name><surname>Hamilton</surname> <given-names>OS</given-names></name><name><surname>Lee</surname> <given-names>JI</given-names></name><name><surname>Gallegos</surname> <given-names>M</given-names></name><name><surname>L'Etoile</surname> <given-names>ND</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Changes in cGMP levels affect the localization of EGL-4 in AWC in <italic>Caenorhabditis elegans</italic></article-title><source>PLOS ONE</source><volume>7</volume><elocation-id>e31614</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0031614</pub-id><pub-id pub-id-type="pmid">22319638</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ooi</surname> <given-names>SL</given-names></name><name><surname>Priess</surname> <given-names>JR</given-names></name><name><surname>Henikoff</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Histone H3.3 variant dynamics in the germline of <italic>Caenorhabditis elegans</italic></article-title><source>PLOS Genetics</source><volume>2</volume><elocation-id>e97</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.0020097</pub-id><pub-id pub-id-type="pmid">16846252</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oshima</surname> <given-names>J</given-names></name><name><surname>Hisama</surname> <given-names>FM</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Search and insights into novel genetic alterations leading to classical and atypical werner syndrome</article-title><source>Gerontology</source><volume>60</volume><fpage>239</fpage><lpage>246</lpage><pub-id pub-id-type="doi">10.1159/000356030</pub-id><pub-id pub-id-type="pmid">24401204</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Perry</surname> <given-names>JJ</given-names></name><name><surname>Yannone</surname> <given-names>SM</given-names></name><name><surname>Holden</surname> <given-names>LG</given-names></name><name><surname>Hitomi</surname> <given-names>C</given-names></name><name><surname>Asaithamby</surname> <given-names>A</given-names></name><name><surname>Han</surname> <given-names>S</given-names></name><name><surname>Cooper</surname> <given-names>PK</given-names></name><name><surname>Chen</surname> <given-names>DJ</given-names></name><name><surname>Tainer</surname> <given-names>JA</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>WRN exonuclease structure and molecular mechanism imply an editing role in DNA end processing</article-title><source>Nature Structural &amp; Molecular Biology</source><volume>13</volume><fpage>414</fpage><lpage>422</lpage><pub-id pub-id-type="doi">10.1038/nsmb1088</pub-id><pub-id pub-id-type="pmid">16622405</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shamanna</surname> <given-names>RA</given-names></name><name><surname>Croteau</surname> <given-names>DL</given-names></name><name><surname>Lee</surname> <given-names>JH</given-names></name><name><surname>Bohr</surname> <given-names>VA</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Recent advances in understanding werner syndrome</article-title><source>F1000Research</source><volume>6</volume><elocation-id>1779</elocation-id><pub-id pub-id-type="doi">10.12688/f1000research.12110.1</pub-id><pub-id pub-id-type="pmid">29043077</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shyu</surname> <given-names>YJ</given-names></name><name><surname>Hiatt</surname> <given-names>SM</given-names></name><name><surname>Duren</surname> <given-names>HM</given-names></name><name><surname>Ellis</surname> <given-names>RE</given-names></name><name><surname>Kerppola</surname> <given-names>TK</given-names></name><name><surname>Hu</surname> <given-names>CD</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Visualization of protein interactions in living <italic>Caenorhabditis elegans</italic> using bimolecular fluorescence complementation analysis</article-title><source>Nature Protocols</source><volume>3</volume><fpage>588</fpage><lpage>596</lpage><pub-id pub-id-type="doi">10.1038/nprot.2008.16</pub-id><pub-id pub-id-type="pmid">18388940</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Suzuki</surname> <given-names>N</given-names></name><name><surname>Shiratori</surname> <given-names>M</given-names></name><name><surname>Goto</surname> <given-names>M</given-names></name><name><surname>Furuichi</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Werner syndrome helicase contains a 5'--&gt;3' exonuclease activity that digests DNA and RNA strands in DNA/DNA and RNA/DNA duplexes dependent on unwinding</article-title><source>Nucleic Acids Research</source><volume>27</volume><fpage>2361</fpage><lpage>2368</lpage><pub-id pub-id-type="doi">10.1093/nar/27.11.2361</pub-id><pub-id pub-id-type="pmid">10325426</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tops</surname> <given-names>BB</given-names></name><name><surname>Tabara</surname> <given-names>H</given-names></name><name><surname>Sijen</surname> <given-names>T</given-names></name><name><surname>Simmer</surname> <given-names>F</given-names></name><name><surname>Mello</surname> <given-names>CC</given-names></name><name><surname>Plasterk</surname> <given-names>RH</given-names></name><name><surname>Ketting</surname> <given-names>RF</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>RDE-2 interacts with MUT-7 to mediate RNA interference in <italic>Caenorhabditis elegans</italic></article-title><source>Nucleic Acids Research</source><volume>33</volume><fpage>347</fpage><lpage>355</lpage><pub-id pub-id-type="doi">10.1093/nar/gki183</pub-id><pub-id pub-id-type="pmid">15653635</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Troemel</surname> <given-names>ER</given-names></name><name><surname>Sagasti</surname> <given-names>A</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Lateral signaling mediated by axon contact and calcium entry regulates asymmetric odorant receptor expression in <italic>C. elegans</italic></article-title><source>Cell</source><volume>99</volume><fpage>387</fpage><lpage>398</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)81525-1</pub-id><pub-id pub-id-type="pmid">10571181</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wallis</surname> <given-names>DC</given-names></name><name><surname>Nguyen</surname> <given-names>DAH</given-names></name><name><surname>Uebel</surname> <given-names>CJ</given-names></name><name><surname>Phillips</surname> <given-names>CM</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Visualization and quantification of transposon activity in <italic>Caenorhabditis elegans</italic> RNAi Pathway Mutants</article-title><source>G3: Genes, Genomes, Genetics</source><volume>9</volume><fpage>3825</fpage><lpage>3832</lpage><pub-id pub-id-type="doi">10.1534/g3.119.400639</pub-id><pub-id pub-id-type="pmid">31533956</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wes</surname> <given-names>PD</given-names></name><name><surname>Bargmann</surname> <given-names>CI</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title><italic>C. elegans</italic> odour discrimination requires asymmetric diversity in olfactory neurons</article-title><source>Nature</source><volume>410</volume><fpage>698</fpage><lpage>701</lpage><pub-id pub-id-type="doi">10.1038/35070581</pub-id><pub-id pub-id-type="pmid">11287957</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yu</surname> <given-names>CE</given-names></name><name><surname>Oshima</surname> <given-names>J</given-names></name><name><surname>Fu</surname> <given-names>YH</given-names></name><name><surname>Wijsman</surname> <given-names>EM</given-names></name><name><surname>Hisama</surname> <given-names>F</given-names></name><name><surname>Alisch</surname> <given-names>R</given-names></name><name><surname>Matthews</surname> <given-names>S</given-names></name><name><surname>Nakura</surname> <given-names>J</given-names></name><name><surname>Miki</surname> <given-names>T</given-names></name><name><surname>Ouais</surname> <given-names>S</given-names></name><name><surname>Martin</surname> <given-names>GM</given-names></name><name><surname>Mulligan</surname> <given-names>J</given-names></name><name><surname>Schellenberg</surname> <given-names>GD</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Positional cloning of the Werner's syndrome gene</article-title><source>Science</source><volume>272</volume><fpage>258</fpage><lpage>262</lpage><pub-id pub-id-type="doi">10.1126/science.272.5259.258</pub-id><pub-id pub-id-type="pmid">8602509</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>W</given-names></name><name><surname>Li</surname> <given-names>J</given-names></name><name><surname>Suzuki</surname> <given-names>K</given-names></name><name><surname>Qu</surname> <given-names>J</given-names></name><name><surname>Wang</surname> <given-names>P</given-names></name><name><surname>Zhou</surname> <given-names>J</given-names></name><name><surname>Liu</surname> <given-names>X</given-names></name><name><surname>Ren</surname> <given-names>R</given-names></name><name><surname>Xu</surname> <given-names>X</given-names></name><name><surname>Ocampo</surname> <given-names>A</given-names></name><name><surname>Yuan</surname> <given-names>T</given-names></name><name><surname>Yang</surname> <given-names>J</given-names></name><name><surname>Li</surname> <given-names>Y</given-names></name><name><surname>Shi</surname> <given-names>L</given-names></name><name><surname>Guan</surname> <given-names>D</given-names></name><name><surname>Pan</surname> <given-names>H</given-names></name><name><surname>Duan</surname> <given-names>S</given-names></name><name><surname>Ding</surname> <given-names>Z</given-names></name><name><surname>Li</surname> <given-names>M</given-names></name><name><surname>Yi</surname> <given-names>F</given-names></name><name><surname>Bai</surname> <given-names>R</given-names></name><name><surname>Wang</surname> <given-names>Y</given-names></name><name><surname>Chen</surname> <given-names>C</given-names></name><name><surname>Yang</surname> <given-names>F</given-names></name><name><surname>Li</surname> <given-names>X</given-names></name><name><surname>Wang</surname> <given-names>Z</given-names></name><name><surname>Aizawa</surname> <given-names>E</given-names></name><name><surname>Goebl</surname> <given-names>A</given-names></name><name><surname>Soligalla</surname> <given-names>RD</given-names></name><name><surname>Reddy</surname> <given-names>P</given-names></name><name><surname>Esteban</surname> <given-names>CR</given-names></name><name><surname>Tang</surname> <given-names>F</given-names></name><name><surname>Liu</surname> <given-names>GH</given-names></name><name><surname>Belmonte</surname> <given-names>JC</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Aging stem cells. A werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging</article-title><source>Science</source><volume>348</volume><fpage>1160</fpage><lpage>1163</lpage><pub-id pub-id-type="doi">10.1126/science.aaa1356</pub-id><pub-id pub-id-type="pmid">25931448</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.62449.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Portman</surname><given-names>Douglas</given-names></name><role>Reviewing Editor</role><aff><institution>University of Rochester</institution><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Arey</surname><given-names>Rachel</given-names> </name><role>Reviewer</role><aff><institution>Baylor College of Medicine</institution></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>Using a powerful combination of approaches including in vivo detection of protein-protein interaction, this paper examines the functions of the two domains of the human Werner syndrome protein WRN in <italic>C. elegans</italic> behavioral plasticity. This work shows that these two domains, encoded separately by the <italic>C. elegans</italic> genes mut-7 and wrn-1, have key but distinct roles in a pathway by which the nuclear import of small, non-coding 22G RNAs leads to changes in neuronal gene expression that mediate olfactory adaptation. These findings shed important light on the roles of small RNAs in neuronal plasticity as well as the functions of the two domains of WSP in regulating chromatin state and gene expression.</p><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;<italic>C. elegans</italic> orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Piali Sengupta as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Rachel Arey (Reviewer #1).</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>The editors have judged that your manuscript is of interest, but, as described below, extensive revisions are required before it can be published. We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is &quot;in revision at <italic>eLife</italic>&quot;. Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)</p><p>Summary:</p><p>This paper investigates the roles of MUT-7 and CeWRN-1, two domains of the human Werner Syndrome Protein, in in experience-dependent neuronal plasticity in <italic>C. elegans</italic>. In previous work, the authors showed that small RNA-mediated downregulation of odr-1 in the AWC neuron is important for olfactory adaptation to butanone. Here, the authors present evidence, including studies using an innovative and exciting BiFC approach, that suggest that (1) MUT-7 is required in the cytoplasm for siRNA synthesis, (2) MUT-7 interacts with CeWRN-1 in the nucleus, (3) NRDE-3 translocation into nucleus promotes HPL-2 binding to chromatin at specific loci. Based on these findings, the authors present an interesting model that would contribute significantly to our understanding of how small RNA pathways target endogenous genes to regulate neuronal function. However, as presented, there are significant concerns about several aspects of the model. These need to be addressed with additional experiments (including some important missing controls) as outlined below, as well as more rigorous statistical analysis. Further, for the model to significantly advance the understanding of mechanisms underlying olfactory adaptation, additional studies need to be carried out to address the role of NRDE-3 in this process.</p><p>Essential revisions:</p><p>1) The manuscript requires extensive editing for clarity and grammar. The results should be reorganized to follow the flow of the figures. For example, the Cewrn-1 qPCR data in Figure 2C is not referred to until the end of the Results section. Further, the data presented in Figure 4 do not flow with the logic of the text, making it very difficult to follow the authors' results and conclusions. (Here, it might be useful to consider making two separate figures, one that focuses on BifC and the other on CeWRN.) There are numerous grammar issues, and the wording is sometimes awkward, making several sections of the paper very difficult to follow.</p><p>2) Statistical analyses need to be improved. There seems to be a general lack of information as to what statistical tests were applied in the figure legends. In the figure legend for 1B, the authors state &quot;P values show T-test results by comparing the indicated odor-trained population.&quot; This suggests that multiple individual t-tests are being performed between groups, in which case it is necessary to account for multiple comparisons.</p><p>3) There are concerns about the experimental design of the BiFC experiments. In Figure 3B, the naïve and pre-exposure animals appear to be different ages. It also seems unusual that the BiFC image for the naïve animals is completely black and does not show any background fluorescence as seen in the pre-exposure image. The BiFC signals of the naïve worms should be reported as controls, since the NLS::EGL-4 is not equivalent to untagged EGL-4. The experiment to test whether MUT-7 associates with EGL-4 in the nucleus in the absence of 22Gs is not well designed – it would be better to have a wild type nuclear MUT-7 expressed in AWC in a genetic background that prohibits 22G production (mut-7 allele or otherwise). Using W812Amber only indicates that this version of the protein does not associate with EGL-4. Further, Figure 2A uses NLS-mCherry-MUT-7, but the Results section and Figure 2B use NLS-GFP-MUT-7. Why are different fluorescent proteins used here? The mCherry-NUT-7 (no NLS) needs to be tested for its ability to rescue mut-7(-). Otherwise, the defect of NLS-mCherry-MUT-7 can also be contributed by mCherry tagging, in addition to NLS.</p><p>4) BiFC data interpretation. The analyses here use a binary classification (+ or – BiFC signal). Please describe the sensitivity of the assay and how such classification is determined. For example, what is the cut off? Also, if there is no detectable signal in naïve worms and strong signal in adapted worms, does that mean the observed BiFC signal is entirely contributed by olfactory adaptation and the interactions of MUT-7-EGL-4, H3-HPL-2, CeWRN-1-MUT-7 are extremely rare in the AWC cells of naïve worms? In a revised manuscript, please address these issues in the relevant section(s).</p><p>5) Further studies are needed to strengthen the model and provide a sufficient level of new mechanistic insight. In the Results section, it is stated that &quot;phosphorylated MUT-7 directs the heterochromatin complex to genetic loci perhaps using 22G RNA as a guide.&quot; However, since MUT-7 has not been shown to have Argonaute activity, it seems more likely that NRDE-3 would be directing a complex that contains MUT-7, CeWRN-1, and HPL-2 to target loci. Experiments to address this can be carried out using the BiFC strains already on hand. Specific questions that should be addressed are: Are 22Gs required for MUT-7 phosphorylation? How is NRDE-3 involved? The paper currently shows that NRDE-3 is required for MUT-7 and EGL-4 interaction, but what about CeWRN-1 and HPL-2 interaction, or MUT-7 and CeWRN-1 interaction? Are MUT-7, CeWRN-1, and HPL-2 in a complex together? Does NRDE-3 direct their localization? Is it possible to IP HPL-2 and probe for MUT-7 association by Western blot (or vice versa)?</p><p>6) CeWRN-1 and 22G synthesis. The reported involvement of CeWRN-1 in 22G synthesis is quite interesting. However, how CeWRN-1 may be involved in this process while localizing to the nucleus is not resolved. Because only one 22G RNA (odr-1.7) is measured, it is not clear how representative it is for the overall change of odr-1 22G RNAs. The biological significance for 22G RNA difference b/t WT transgene(-) and mut-7 transgene (-) is questionable. There are two large outliers for WT and two small outliers for mut-7. If these outliers are removed from analysis, the difference is likely to disappear. To address these concerns, we ask you to consider sRNA-seq, which is much more sensitive and comprehensive in measuring sRNA levels. If that isn't feasible, please measure the levels of at least two other odr-1 22G RNAs. Further, your paper states that &quot;CeWRN-1 associates with the chromatin binding protein HPL-2 to promote the heterochromatin formation for silencing ODR-1 expression,&quot; but this hypothesis is not directly tested. CeWRN also binds to MUT-7, and acts in the same pathway to regulate olfactory adaptation, so what is the mechanism? This isn't tied together well. Your paper also states that the CeWRN-1 expression pattern has not been characterized, but protein localization of CeWRN-1 using immunofluorescence was performed by Lee et al., 2004. Perhaps you are referring here to particular neurons? While additional experiments are not necessary here, these issues should be addressed by revising the text.</p><p>7) Issues concerning the two mut-7 alleles used. Your paper reports that two different alleles of mut-7 differ in the butanone chemotaxis phenotype. Your subsequent experiments use the pk204 allele, which has normal butanone chemotaxis but fail to ignore the butanone after it is paired with starvation (adaptation defective). The other allele, ne4255, is defective in butanone chemotaxis to begin with. While we understand your focus on adaptation aspect, the phenotype of butanone chemotaxis is also highly relevant. Therefore, some additional experiments are needed for ne4255. At a minimum, please measure the mRNA and sRNA levels of odr-1 in ne4255, which could provide important insight necessary to build a more complete model.</p><p>8) The section is titled: &quot;Phosphorylated MUT-7 associates with EGL-4 in the nucleus of odor-trained animals.&quot; For this to be valid, evidence needs to be presented that MUT-7 is indeed phosphorylated. Otherwise, the conclusion as currently shown in the section title needs to be revised.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;<italic>C. elegans</italic> orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Piali Sengupta (Senior Editor) and a Reviewing Editor.</p><p>The manuscript has been significantly improved but, as noted by both reviewers 1 and 2, several of the required revisions from the initial review were not adequately addressed. Before the paper can be accepted, all of these points must be addressed. Specifically, please respond to the two issues raised by reviewer 1 and the five points raised by reviewer 2. To some extent, the concerns of these two reviewers overlap. Most of these can be addressed by modifying the text of paper to tone down conclusions, provide more context, or mention alternative explanations. However, before the paper can be accepted, please also add the missing controls mentioned in reviewer 2's point #2 (which is also relevant to reviewer 1's point #1).</p><p><italic>Reviewer #1:</italic></p><p>In this study by Hsu et al., the authors use <italic>C. elegans</italic> to investigate the roles of two different domains of the human Werner Syndrome Protein (WSP) in neuronal plasticity, by taking advantage of the fact that there are 2 worm orthologs (MUT-7 and CeWRN-1) of WSP that each only contain one of the domains of interest. This paper cleverly uses these two proteins to investigate the role of different WSP domains in the regulation of neuronal plasticity, as measured by molecular and behavioral responses to olfactory conditioning.</p><p>They find that both MUT-7 (which contains a 3'-5' exonuclease domain) and CeWRN-1 (which contains helicase domains) are necessary for normal olfactory adaptation, and function in the same genetic pathway. The also find that MUT-7 is required in both the nucleus and cytoplasm of the AWC sensory neurons for proper olfactory adaptation, while CeWRN-1 is localized to the AWC nucleus. Cytoplasmic MUT-7 appears to regulate the generation of odr-1 22G RNAs, which regulate levels of the ODR-1 guanylyl cyclase, which has been previously shown to be important for olfactory adaptation.</p><p>To further study nuclear MUT-7 and CeWRN-1, the authors used BiFC, a split fluorescent protein method that uses fluorescence as an indirect measure of in vivo protein-protein interactions. They first examine interactions between MUT-7 and the PKG EGL-4, which was previously shown to act in the nucleus to regulate olfactory adaptation and genetically interacts with MUT-7. Protein-protein interactions between MUT-7 and EGL-4 were detected and appeared to be PKG phosphorylation site-dependent, and mutating putative EGL-4 phosphorylation sites on MUT-7 also disrupted behavior.</p><p>In a series of BiFC experiments carried out in a systematic manner, the authors determine that MUT-7 interacts with both EGL-4 and CeWRN-1 in the nucleus, and CeWRN-1 and EGL-4 do not directly interact. CeWRN-1 interacts with the heterchromatin promoting protein HPL-2 and is necessary for odor-training increases in HPL-2 association with histones, suggesting that it promotes heterochromatin formation and gene silencing, which was previously shown to be important for olfactory adaptation. Lastly, the interactions between MUT-7 and CeWRN-1, MUT-7 and CeWRN-1,and CeWRN-1 and HPL-2 all appear to depend on the argonaute protein NRDE-3. These data provide new insight into mechanisms regulation behavioral plasticity, and suggest that the regulation of small RNAs and chromatin by human WSP may be underappreciated causes of disease.</p><p>The conclusions of this paper are mostly well supported by the data, but there are some weaknesses.</p><p>1) The BiFC method is deployed cleverly here, but can only tell if two things are interacting at a time. The authors mitigate this disadvantage by systematically testing different interactors (give examples) and also testing how BiFC signals change in the context of mutation. However, this method cannot determine whether multiple proteins are actually in a complex. Moreover, it appears that BiFC is an all-or-none phenomenon, thus more nuanced changes in protein interactions that may subtly affect protein complex formation cannot be resolved with this method.</p><p>2) Due to the difficulty of performing biochemical analyses on proteins expressed in a single neuron, the authors are unable to directly demonstrate that MUT-7 is directly phosphorylated by the PKG EGL-4, or determine if there are changes in MUT-7 phosphorylation in response to odor training. The authors attempt to overcome these limitations by examining the behavior and protein association by BiFC of animals expressing a mutant form of MUT-7 where putative PKG/EGL-4 phosphorylation sites are mutated. These findings suggest that phosphorylation of the protein is important, but there is no direct or concrete evidence that phosphorylation is indeed occurring, as claimed in the article.</p><p>The authors addressed almost all of the previous concerns, but should still consider re-wording the sections title &quot;EGL-4 phosphorylates MUT-7 at predicted PKG sites in the nucleus of odor-trained animals&quot; as there is still a lack of direct evidence. Maybe something like &quot;MUT-7 and EGL-4 interact in the nucleus of odor-trained animals in a PKG phosphorylation site-dependent manner?&quot;</p><p>The addition of the NRDE-3 data strengthened the paper greatly, and the reorganization made the story much clearer.</p><p><italic>Reviewer #2:</italic></p><p>In this manuscript, Hsu et al. investigate the role of MUT-7 and CeWRN-1 in regulating neuronal plasticity in <italic>C. elegans</italic>. MUT-7 and CeWRN-1 are orthologs of the human Werner Syndrome protein, which has 3'-5' exonuclease and helicase domains. In previous work, the authors showed that MUT-7, HP1 homolog HPL-2, and the nuclear Argonaute NRDE-3 are required for olfactory adaptation to butanone. Naïve <italic>C. elegans</italic> adults typically exhibit attractive behavior towards butanone. However, adults that were pre-exposed to butanone in the absence of food no longer exhibit attractive chemotaxis towards the odorant. The authors showed previously that pre-exposure to butanone results in the small RNA-mediated downregulation of the membrane bound guanylyl cyclase gene, odr-1, in the AWC sensory neuron. In this current manuscript, Hsu et al. state the conclusions that (1) MUT-7 is required in the cytoplasm for siRNA synthesis, (2) MUT-7 interacts with CeWRN-1 in the nucleus, (3) NRDE-3 translocation into nucleus promotes HPL-2 binding to chromatin 'at specific loci'. I found that there are some intriguing observations presented in the results that warrant further investigation and could contribute to our understanding of how small RNA pathways target endogenous genes to regulate neuronal function based on environmental cues. However, there are some issues with controls for experiments performed, and, as is, the data does not significantly increase of knowledge of the mechanisms of olfactory adaptation beyond what has been shown previously.</p><p>In the revised manuscript entitled &quot;<italic>C. elegans</italic> orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity&quot;, Hsu et al. address most of the concerns of the reviewers. They have added additional data to Figures 2B and 3C, included new supplemental figures, and have clarified multiple points within the text. In my opinion, these changes are satisfactory and strengthen the conclusions of the manuscript.</p><p>However, there are a few points in the decision letter that were not addressed, or were addressed in an unsatisfactory manner, that should be considered before a final decision.</p><p>1) The manuscript still contains numerous problems with grammar and clarity and needs additional editing. In addition, the flow of &quot;Roles of nuclear and cytoplasmic MUT-7 in promoting learning&quot; is difficult to follow and could be rewritten instead of just adding a paragraph.</p><p>2) The authors did not add the BiFC signals of naïve, control worms to Figure 3C. NLS::EGL-4 is not equivalent to EGL-4 without the nuclear localization signal, and controls should be included.</p><p>3) The reviewers' response regarding the details of the BiPAC analysis was not adequately addressed. The reviewers would like details of how quantitation was performed for determining the percentage of animals with signal. The authors say this assay exhibited &quot;on&quot; or &quot;off&quot; signal, but how was &quot;on&quot; determined? Was it a cutoff of pixels above background, or determined to be &quot;on&quot; by eye?</p><p>4) The new NRDE-3 data was not added to Figure 4 but was instead put in Supplementary file 2. This new data was also not incorporated into the model figure (Figure 5). In my opinion, the NRDE-3 data is significant for the mechanism of how MUT-7, CeWRN-1, and HPL-2 function to silence odr-1 in olfactory adaptation and should be incorporated into the main figures.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for submitting your article &quot;<italic>C. elegans</italic> orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity&quot; for consideration by <italic>eLife</italic>.</p><p>The revised version of your paper has addressed nearly all of the issues raised during the previous rounds of review. However, your paper still does not provide details on the analysis and quantitation of the BiFC results. This was specifically noted by multiple reviewers in both previous rounds of review and was included in the list of required revisions. Please revise the section titled &quot;Bimolecular fluorescence complementation (BiFC) assay&quot; in your Materials and methods section to address this issue. Specifically, we ask that you explicitly mention that the BiFC signal is scored as an all-or-none signal by manual visual examination of multiple Z-section images. Further, please explain that the values you provide in the text and figures represent the fraction of BiFC-positive animals among the total number of animals examined.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.62449.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential revisions:</p><p>1) The manuscript requires extensive editing for clarity and grammar. The results should be reorganized to follow the flow of the figures. For example, the Cewrn-1 qPCR data in Figure 2C is not referred to until the end of the Results section. Further, the data presented in Figure 4 do not flow with the logic of the text, making it very difficult to follow the authors' results and conclusions. (Here, it might be useful to consider making two separate figures, one that focuses on BifC and the other on CeWRN.) There are numerous grammar issues, and the wording is sometimes awkward, making several sections of the paper very difficult to follow.</p></disp-quote><p>We agree the reviewer’s comments. Specifically, we rearranged Figure 4A to flow with the logic of the text. Regarding the arrangement of Figure 2C, although <italic>Cewrn-1</italic> qPCR was described near the end of the Results section, these data should be compared with other qPCR data sets such as <italic>wildtype</italic>, <italic>mut-7</italic>, and <italic>mut-7</italic> worms with different GFP tagged MUT-7 versions. Thus, for the flow of the manuscript, we feel that it is important to present <italic>Cewrn-1</italic> qPCR data in Figure 2C.</p><disp-quote content-type="editor-comment"><p>2) Statistical analyses need to be improved. There seems to be a general lack of information as to what statistical tests were applied in the figure legends. In the figure legend for 1B, the authors state &quot;P values show T-test results by comparing the indicated odor-trained population.&quot; This suggests that multiple individual t-tests are being performed between groups, in which case it is necessary to account for multiple comparisons.</p></disp-quote><p>We use GraphPad Prism eight software to re-do the multiple comparisons in all our statistical analyses. In our figures, we indicate the p value by using two-way ANOVA analysis between the specified groups. This statistical method is now written in the figure legends.</p><disp-quote content-type="editor-comment"><p>3) There are concerns about the experimental design of the BiFC experiments. In Figure 3B, the naïve and pre-exposure animals appear to be different ages. It also seems unusual that the BiFC image for the naïve animals is completely black and does not show any background fluorescence as seen in the pre-exposure image. The BiFC signals of the naïve worms should be reported as controls, since the NLS::EGL-4 is not equivalent to untagged EGL-4.</p></disp-quote><p>All our BiFC experiments were performed with the same protocol as the behavioral assay except for the last step, where worms were placed on plates for chemotaxis assays. The populations were synchronized by picking L4 stage worms and examining the next generation. The animals that are imaged from young adults are as the same as age in behavioral assays. We use the same exposure time and illumination conditions in taking each image. In imaging, we focused on the regions of the worms that often had different autofluorescence. Therefore, we replace the original images with ones in which there is similar autofluorescence in both the naive and odor-trained worms in Figure 3B. We also provide all the original BiFC images from naïve and odor-trained worms in Figure 4A as Figure 4—figure supplement 3 (new Figure).</p><disp-quote content-type="editor-comment"><p>The experiment to test whether MUT-7 associates with EGL-4 in the nucleus in the absence of 22Gs is not well designed – it would be better to have a wild type nuclear MUT-7 expressed in AWC in a genetic background that prohibits 22G production (mut-7 allele or otherwise). Using W812Amber only indicates that this version of the protein does not associate with EGL-4.</p></disp-quote><p>To address this point, we co-expressed the N-terminal Venus tagged MUT-7 and the C-terminal Venus tagged EGL-4 in the <italic>nrde-3</italic>(<italic>gg66</italic>) mutant background which blocks <italic>odr-1</italic> 22Gs to shuttle into the nucleus. We did not see the BiFC signal in this case (as in Figure 4A, first low), while there are 75% odor-trained wild-type worms showing BiFC signals in Figures 3B and 3C, first row. We could not express such BiFC constructs in <italic>mut-7</italic>(<italic>pk204</italic>) mutants because the Venus tagged wild-type MUT-7 would rescue the defects of <italic>mut-7</italic> mutants. Further, we observed 86% wild-type worms showing BiFC signals in co-expression of NLS-EGL-4 and NLS-MUT-7 in Figure 3C last row, but only 5% of <italic>nrde-3</italic>(<italic>gg66</italic>) mutants expressing the same constructs showed BiFC signals (We added the new data to Supplementary file 2, first row, and modified the text to clarify this point). Indeed, these results indicate that the association between MUT-7 and EGL-4 in the nucleus is required in the present of 22Gs.</p><disp-quote content-type="editor-comment"><p>Further, Figure 2A uses NLS-mCherry-MUT-7, but the Results section and Figure 2B use NLS-GFP-MUT-7. Why are different fluorescent proteins used here? The mCherry-NUT-7 (no NLS) needs to be tested for its ability to rescue mut-7(-). Otherwise, the defect of NLS-mCherry-MUT-7 can also be contributed by mCherry tagging, in addition to NLS.</p></disp-quote><p>To address this point, we confirmed that the mCherry-MUT-7 (no NLS) rescued <italic>mut-7(pk204)</italic> odor learning defects (We added the new data to Figure 2B, third pair, and modified the text to clarify this point). We created in parallel the NLS-GFP-MUT-7 and NLS-mCherry-MUT-7 constructs, but the NLS-GFP-MUT-7 strain was the only one for which we were able to obtain using a standard UV/trimethylpsoralen (UV/TMP) integration method (We modified the text to clarify this point).</p><disp-quote content-type="editor-comment"><p>4) BiFC data interpretation. The analyses here use a binary classification (+ or – BiFC signal). Please describe the sensitivity of the assay and how such classification is determined. For example, what is the cut off?</p></disp-quote><p>The sensitivity of the BiFC assay is determined by two important controls. First, the BiFC signals are detected in butanone-trained worms rather than naïve worms in analyzing the interactions of MUT-7-EGL-4, H3-HPL-2, and CeWRN-1-MUT-7. The worms for subsequent BiFC analysis were raised in the same HB101-seeded plate as described in the Materials and methods section of the revised manuscript. Adult animals were then spilt into two tubes: one incubated in buffer (Naïve worm) and the other pre-exposed to butanone-diluted buffer (odor-trained worms). Twenty-to-thirty worms were mounted on an agarose pad with the addition of 1 μM of NaN<sub>3</sub>; pictures were then taken using the same illumination and exposure. A large number of odor-trained worms were observed BiFC signals compared to few naïve worms has BiFC signals (Figures 3C and 4A). Thus, we can rule out the problem of non-specific protein aggregation in the assay. The second control is that only one AWC neuron is seen the BiFC signal in each butanone-trained animal (Figures 3B, 4C and Figure 4—figure supplement 3). This reflects the fact that butanone is sensed by only one AWC (Wes and Bargmann, 2001). Indeed, we only observed BiFC signals between MUT-7-EGL-4, H3-HPL-2, and CeWRN-1-MUT-7 in one AWC neuron after butanone exposure. These results indicate that our BiFC system specifically detects protein interactions in the one butanone-sensing neuron of the worm (We modified the text to clarify this point).</p><disp-quote content-type="editor-comment"><p>Also, if there is no detectable signal in naïve worms and strong signal in adapted worms, does that mean the observed BiFC signal is entirely contributed by olfactory adaptation and the interactions of MUT-7-EGL-4, H3-HPL-2, CeWRN-1-MUT-7 are extremely rare in the AWC cells of naïve worms? In a revised manuscript, please address these issues in the relevant section(s).</p></disp-quote><p>The BiFC signal is binary either on or off. Thus, in a population of naïve worms few show the signal while in a population of butanone exposed ones, many showed the signal. This means that individual worms may have complexes between these proteins in the nucleus but the proportion of the population with these complexes changes with butanone treatment. This may reflect the fact that most but not all naive animals are attracted to butanone but the proportion that is attracted decreases when worms are starved in the presence of butanone.</p><disp-quote content-type="editor-comment"><p>5) Further studies are needed to strengthen the model and provide a sufficient level of new mechanistic insight. In the Results section, it is stated that &quot;phosphorylated MUT-7 directs the heterochromatin complex to genetic loci perhaps using 22G RNA as a guide.&quot; However, since MUT-7 has not been shown to have Argonaute activity, it seems more likely that NRDE-3 would be directing a complex that contains MUT-7, CeWRN-1, and HPL-2 to target loci. Experiments to address this can be carried out using the BiFC strains already on hand. Specific questions that should be addressed are: Are 22Gs required for MUT-7 phosphorylation?</p></disp-quote><p>We are unable to probe directly for in vivo MUT-7 phosphorylation status as we are unable to perform immunoprecipitations and western blots for single butanone-sensing AWC neuron. We also have not been successful in isolating the full-length bacterial MUT-7 for in vitro kinase assay. Instead, since EGL-4 is a cGMP-dependent protein kinase (PKG), we predicted MUT-7’s PKG phosphorylation sites, changed these sites to alanine, and we show that the association between MUT-7 and EGL-4 depends on phosphorylation of MUT-7 (Figure 3C, third row, and <xref ref-type="table" rid="resptable1">Author response table 1</xref>) and also on NRDE-3 (Figure 4A first row). Thus, the 22Gs that are provided by NRDE-3 shuttling them into the nucleus are likely required for phosphorylation of MUT-7.</p><table-wrap id="resptable1" position="anchor"><label>Author response table 1.</label><table frame="hsides" rules="groups"><thead><tr><th>Strains (worms with transgenes)</th><th>BiFC signals in the nucleus of the AWC neuron (%)</th><th/></tr></thead><tbody><tr><td/><td>naïve worms</td><td>odor trained worms</td></tr><tr><td>Wildtype ex[CeWRN-1 and MUT-7(all S/T to A)]*</td><td>3% (n=68)</td><td>4% (n=81)</td></tr></tbody></table></table-wrap><p>* indicates wild-type worms carrying pAWC::CeWRN-1::VN173 and pAWC::VC155::MUT-7 (all S/T to A)</p><disp-quote content-type="editor-comment"><p>How is NRDE-3 involved? The paper currently shows that NRDE-3 is required for MUT-7 and EGL-4 interaction, but what about CeWRN-1 and HPL-2 interaction, or MUT-7 and CeWRN-1 interaction?</p></disp-quote><p>We performed the requested BiFC analysis of CeWRN-1 and MUT-7 in <italic>nrde-3(gg99)</italic> mutants and found that no BiFC signal was seen (We added the new data to Supplementary file 2, second row, and modified the text to clarify this point). Similarly, we found that BiFC between HPL-2 and CeWRN-1 depends on NRDE-3 (We added the new data to Supplementary file 2, third row, and modified the text to clarify this point). These new results indicate that NRDE -3 is required for both CeWRN-1 and HPL-2 interaction, and MUT-7 and CeWRN-1 interaction. This is new insight that extends the model and strengthens this paper and we are thankful for this insight by the reviewer.</p><disp-quote content-type="editor-comment"><p>Are MUT-7, CeWRN-1, and HPL-2 in a complex together?</p></disp-quote><p>The reviewer asks whether MUT-7, CeWRN-1, and HPL-2 form a tripartite complex. We cannot determine if MUT-7, CeWRN-1 and HPL-2 form a tripartite complex due to the following technical limitations: (1) We are unable to perform immunoprecipitations or western blots perhaps due to the fact that we are collecting material from one cell (AWC neuron) from the whole worm and we have too high background when we try; (2). BiFC reports the interaction between two candidate proteins and we have not been able to adapt it to report an interaction between three proteins. Thus, at the current stage we are limited to use BiFC to look at complexes between MUT-7, CeWRN-1, and HPL-2 and asking if NRDE-3 is required for the possibility of a tripartite complex.</p><disp-quote content-type="editor-comment"><p>Does NRDE-3 direct their localization?</p></disp-quote><p>Data from previous publication and this manuscript indicate that both HPL-2 and CeWRN-1 are localized within the AWC nucleus of naïve and odor adapted worms (Juang et al., 2013 and Figure 4B) and this expression is not altered in <italic>nrde-3(gg99)</italic> mutants (Please see <xref ref-type="fig" rid="sa2fig1">Author response image 1</xref>, middle and bottom panels). Likewise, the localization of MUT-7 in both cytoplasm and nucleus does not change in <italic>nrde-3(gg66)</italic> mutants (please see <xref ref-type="fig" rid="sa2fig1">Author response image 1</xref>, upper panel). Thus, the results suggest that NRDE-3 does not direct MUT-7, CeWRN-1 or HPL-2 localization.</p><fig id="sa2fig1"><label>Author response image 1.</label><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-62449-resp-fig1-v2.tif"/></fig><disp-quote content-type="editor-comment"><p>Is it possible to IP HPL-2 and probe for MUT-7 association by Western blot (or vice versa)?</p></disp-quote><p>Unfortunately, neither immunoprecipitation nor western blot work when we examine proteins expressed in the single AWC (ON) cells.</p><disp-quote content-type="editor-comment"><p>6) CeWRN-1 and 22G synthesis. The reported involvement of CeWRN-1 in 22G synthesis is quite interesting. However, how CeWRN-1 may be involved in this process while localizing to the nucleus is not resolved. Because only one 22G RNA (odr-1.7) is measured, it is not clear how representative it is for the overall change of odr-1 22G RNAs.</p></disp-quote><p>Our previous publication has tested different <italic>odr-1</italic>-derived 22G RNAs and <italic>odr-1.7</italic> gave the most robust signals in RT-qPCR analysis for the single butanone-sensing AWC neuron (Juang et al., 2013). We found that loss of CeWRN-1 does not affect <italic>odr-1</italic> 22G RNA synthesis (Figure 2—figure supplement 1), but affect the increase of <italic>odr-1</italic> 22G RNA after prolonged butanone exposure (Figure 2C). The possibility about how CeWRN-1 may affect 22G RNA synthesis is to change histone modification via its associated protein HPL-2 and the findings will be reported in the next publication.</p><disp-quote content-type="editor-comment"><p>The biological significance for 22G RNA difference b/t WT transgene(-) and mut-7 transgene (-) is questionable. There are two large outliers for WT and two small outliers for mut-7. If these outliers are removed from analysis, the difference is likely to disappear. To address these concerns, we ask you to consider sRNA-seq, which is much more sensitive and comprehensive in measuring sRNA levels. If that isn't feasible, please measure the levels of at least two other odr-1 22G RNAs.</p></disp-quote><p>To address the reviewer’s concerns, we removed the two extreme outliers from the 22G RNA dataset of wild-type worms and two moderate outliers from the 22G RNA dataset of <italic>mut-7(pk204)</italic> mutant backgrounds. The remaining datasets are applied to GraphPad Prism software and the statistical results still show a significant difference between the two groups by using (1) two-tailed t-test (p=0.0056) and one-way ANOVA (p&lt;0.0001).</p><disp-quote content-type="editor-comment"><p>Further, your paper states that &quot;CeWRN-1 associates with the chromatin binding protein HPL-2 to promote the heterochromatin formation for silencing ODR-1 expression,&quot; but this hypothesis is not directly tested. CeWRN also binds to MUT-7, and acts in the same pathway to regulate olfactory adaptation, so what is the mechanism? This isn't tied together well.</p></disp-quote><p>This manuscript is follow-up research results to our previous publication in the journal, <italic>Cell</italic>, in 2013. We previously demonstrated that HPL-2 associated with <italic>odr-1</italic> 22G RNA in odor-trained worms by using chromatin immunoprecipitation (Juang et al., 2013). Also, <italic>odr-1</italic> 22G RNA associate NRDE-3 in odor-trained wild-type worms to mediate downregulation of the <italic>odr-1</italic> mRNA expression by using co-immunoprecipitation and RT-qPCR (Juang et al., 2013). Next, in this manuscript, we further created GFP tagged ODR-1 integrated worms by using CRISPR system to direct monitor that GFP expression is silenced in odor-trained wild-type worms (Figure 2D). Finally, we found that CeWRN-1 associated with HPL-2 in the nucleus of wild-type odor-trained worms (Figure 4C), but loss of CeWRN-1 fails to load HPL-2 on histone H3 (HIS-71) (Figure 4A, last row). Thus, our results are able to support that CeWRN-1 associates with HPL-2 to promote the heterochromatin formation for silencing ODR-1 expression. Further, the reviewer asks how CeWRN binds to MUT-7 to regulate olfactory adaptation. We provide a possibility that the nuclear MUT-7 phosphorylation is required for associate with CeWRN-1 (please see <xref ref-type="table" rid="resptable1">Author response table 1</xref>). This result suggests that MUT-7 phosphorylation may be an important linker to associate with CeWRN-1 in olfactory signaling.</p><disp-quote content-type="editor-comment"><p>Your paper also states that the CeWRN-1 expression pattern has not been characterized, but protein localization of CeWRN-1 using immunofluorescence was performed by Lee et al., 2004. Perhaps you are referring here to particular neurons? While additional experiments are not necessary here, these issues should be addressed by revising the text.</p></disp-quote><p>We agree with the reviewer that protein localization of CeWRN-1 has been shown by using in vitro immunostaining in the nuclei of germ cells, intestine cells and embryonic cells (Lee et al., 2004). In this manuscript, we performed in vivo GFP-tagged CeWRN-1 and found that CeWRN-1 expressed in the nucleus of the AWC neurons in Figure 4B.</p><disp-quote content-type="editor-comment"><p>7) Issues concerning the two mut-7 alleles used. Your paper reports that two different alleles of mut-7 differ in the butanone chemotaxis phenotype. Your subsequent experiments use the pk204 allele, which has normal butanone chemotaxis but fail to ignore the butanone after it is paired with starvation (adaptation defective). The other allele, ne4255, is defective in butanone chemotaxis to begin with. While we understand your focus on adaptation aspect, the phenotype of butanone chemotaxis is also highly relevant. Therefore, some additional experiments are needed for ne4255. At a minimum, please measure the mRNA and sRNA levels of odr-1 in ne4255, which could provide important insight necessary to build a more complete model.</p></disp-quote><p>Thank you for the reviewer’s comments. When we measured the level of <italic>odr-1</italic> 22G from <italic>mut-7(ne4255)</italic> mutants, we found that the <italic>odr-1</italic> Taqman probe failed to detect any signal in our protocol. We also tested mRNA levels in parallel and found that <italic>odr-1</italic> mRNA expression level was similar to <italic>mut-7(pk204)</italic> (T.-Y.H. and B.-T.J., unpublished data). Thus, <italic>odr-1</italic> transcription and mRNA accumulation are not affected by loss of MUT-7 in the <italic>ne4255</italic> allele and there must be another as yet discovered explanation for the defect but this is beyond the scope of this study.</p><disp-quote content-type="editor-comment"><p>8) The section is titled: &quot;Phosphorylated MUT-7 associates with EGL-4 in the nucleus of odor-trained animals.&quot; For this to be valid, evidence needs to be presented that MUT-7 is indeed phosphorylated. Otherwise, the conclusion as currently shown in the section title needs to be revised.</p></disp-quote><p>As response above for comment 5, we are unable to detect directly MUT-7 phosphorylation status due to technical limitations. Instead, we found that the association between MUT-7 and EGL-4 by seeing BiFC signals (Figure 3B) is disrupted when MUT-7 PKG sites are replaced with alanine (please see <xref ref-type="table" rid="resptable1">Author response table 1</xref>). Therefore, as the reviewer’s suggestion, we change the title to “EGL-4 phosphorylates MUT-7 at predicted PKG sites in the nucleus of odor-trained animals”.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>[…]</p><p>In the revised manuscript entitled &quot;<italic>C. elegans</italic> orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity&quot;, Hsu et al. address most of the concerns of the reviewers. They have added additional data to Figures 2B and 3C, included new supplemental figures, and have clarified multiple points within the text. In my opinion, these changes are satisfactory and strengthen the conclusions of the manuscript.</p><p>However, there are a few points in the decision letter that were not addressed, or were addressed in an unsatisfactory manner, that should be considered before a final decision.</p><p>1) The manuscript still contains numerous problems with grammar and clarity and needs additional editing. In addition, the flow of &quot;Roles of nuclear and cytoplasmic MUT-7 in promoting learning&quot; is difficult to follow and could be rewritten instead of just adding a paragraph.</p></disp-quote><p>Thank you for the reviewer’s comment. The revised manuscript now is edited by professional editing service American Journal Experts (AJE).</p><disp-quote content-type="editor-comment"><p>2) The authors did not add the BiFC signals of naïve, control worms to Figure 3C. NLS::EGL-4 is not equivalent to EGL-4 without the nuclear localization signal, and controls should be included.</p></disp-quote><p>Thank you for the reviewer’s comment. The missing controls of naïve worms expressing NLS::EGL-4 with different versions of MUT-7 mutations are added in Figure 3C, from third row to last row, and Figure 4D, first row. Prolonged odor exposure to butanone causes nuclear accumulation of EGL-4 and expression of constitutively nuclear NLS::EGL-4 in the wild-type worms decreases chemotaxis toward the AWC-sensed odor, butanone, even in naïve worms (O’Halloran et al., 2009; Lee et al., 2010, Juang et al., 2013). Our previous reports indicate that nuclear EGL-4 induces adaptation of the odor-seeking behavioral response in naive worms. Indeed, the percentage of BiFC signals in naïve worms expressing NLS::EGL-4 and MUT-7 is similar to that in the odor-trained worms. We have modified the figure legends of Figures 3C and 4D to clarify this point.</p><disp-quote content-type="editor-comment"><p>3) The reviewers' response regarding the details of the BiPAC analysis was not adequately addressed. The reviewers would like details of how quantitation was performed for determining the percentage of animals with signal. The authors say this assay exhibited &quot;on&quot; or &quot;off&quot; signal, but how was &quot;on&quot; determined? Was it a cutoff of pixels above background, or determined to be &quot;on&quot; by eye?</p></disp-quote><p>Thank you for the reviewer’s comment. We screen the BiFC signal by using an upright microscope (Leica DM6B) at 63X magnification. All tested worms are analyzed by taking continuous Z-section fluorescence images at 0.3μm intervals throughout the thickness of the pharynx. We analyze carefully all the images to decide whether BiFC signals are observed or not. The quantitation of BiFC is determined by dividing the number of worms showing BiFC signals by the total number of worms tested.</p><disp-quote content-type="editor-comment"><p>4) The new NRDE-3 data was not added to Figure 4 but was instead put in Supplementary file 2. This new data was also not incorporated into the model figure (Figure 5). In my opinion, the NRDE-3 data is significant for the mechanism of how MUT-7, CeWRN-1, and HPL-2 function to silence odr-1 in olfactory adaptation and should be incorporated into the main figures.</p></disp-quote><p>We agree with the reviewer’s suggestion and the Supplementary file 2 is incorporated into the Figure 4D (new table). The NRDE-3 data was added to the figure legends of Figures 4D and 5 to clarify the mechanism of how MUT-7, CeWRN-1, and HPL-2 function to silence <italic>odr-1</italic> mRNA expression in olfactory adaptation.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><disp-quote content-type="editor-comment"><p>The revised version of your paper has addressed nearly all of the issues raised during the previous rounds of review. However, your paper still does not provide details on the analysis and quantitation of the BiFC results. This was specifically noted by multiple reviewers in both previous rounds of review and was included in the list of required revisions. Please revise the section titled &quot;Bimolecular fluorescence complementation (BiFC) assay&quot; in your Materials and methods section to address this issue. Specifically, we ask that you explicitly mention that the BiFC signal is scored as an all-or-none signal by manual visual examination of multiple Z-section images. Further, please explain that the values you provide in the text and figures represent the fraction of BiFC-positive animals among the total number of animals examined.</p></disp-quote><p>The editorial suggestions about the analysis and quantitation of the BiFC results are added to the Materials and methods section. We also explain in the text about the fraction of BiFC-positive animals among the total number of animals examined.</p></body></sub-article></article>