<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">63387</article-id><article-id pub-id-type="doi">10.7554/eLife.63387</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Microbiology and Infectious Disease</subject></subj-group></article-categories><title-group><article-title>A conserved cell division protein directly regulates FtsZ dynamics in filamentous and unicellular actinobacteria</article-title></title-group><contrib-group><contrib contrib-type="author" equal-contrib="yes" id="author-209145"><name><surname>Ramos-León</surname><given-names>Félix</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-209146"><name><surname>Bush</surname><given-names>Matthew J</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0001-8216-0152</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="other" rid="fund5"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-209148"><name><surname>Sallmen</surname><given-names>Joseph W</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-76234"><name><surname>Chandra</surname><given-names>Govind</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0002-7882-6676</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-209147"><name><surname>Richardson</surname><given-names>Jake</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-41052"><name><surname>Findlay</surname><given-names>Kim C</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-20411"><name><surname>McCormick</surname><given-names>Joseph R</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0002-9071-7296</contrib-id><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-208410"><name><surname>Schlimpert</surname><given-names>Susan</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-6364-8056</contrib-id><email>susan.schlimpert@jic.ac.uk</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund5"/><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Molecular Microbiology, John Innes Centre</institution><addr-line><named-content content-type="city">Norwich</named-content></addr-line><country>United Kingdom</country></aff><aff id="aff2"><label>2</label><institution>Department of Cell and Developmental Biology, John Innes Centre</institution><addr-line><named-content content-type="city">Norwich</named-content></addr-line><country>United Kingdom</country></aff><aff id="aff3"><label>3</label><institution>Department of Biological Sciences, Duquesne University</institution><addr-line><named-content content-type="city">Pittsburgh</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Kana</surname><given-names>Bavesh D</given-names></name><role>Reviewing Editor</role><aff><institution>University of the Witwatersrand</institution><country>South Africa</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Kana</surname><given-names>Bavesh D</given-names></name><role>Senior Editor</role><aff><institution>University of the Witwatersrand</institution><country>South Africa</country></aff></contrib></contrib-group><author-notes><fn fn-type="con" id="equal-contrib1"><label>†</label><p>These authors contributed equally to this work</p></fn></author-notes><pub-date date-type="publication" publication-format="electronic"><day>17</day><month>03</month><year>2021</year></pub-date><pub-date pub-type="collection"><year>2021</year></pub-date><volume>10</volume><elocation-id>e63387</elocation-id><history><date date-type="received" iso-8601-date="2020-09-23"><day>23</day><month>09</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2021-03-03"><day>03</day><month>03</month><year>2021</year></date></history><permissions><copyright-statement>© 2021, Ramos-León et al</copyright-statement><copyright-year>2021</copyright-year><copyright-holder>Ramos-León et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-63387-v1.pdf"/><abstract><p>Bacterial cell division is driven by the polymerization of the GTPase FtsZ into a contractile structure, the so-called Z-ring. This essential process involves proteins that modulate FtsZ dynamics and hence the overall Z-ring architecture. Actinobacteria like <italic>Streptomyces</italic> and <italic>Mycobacterium</italic> lack known key FtsZ-regulators. Here we report the identification of SepH, a conserved actinobacterial protein that directly regulates FtsZ dynamics. We show that SepH is crucially involved in cell division in <italic>Streptomyces venezuelae</italic> and that it binds FtsZ via a conserved helix-turn-helix motif, stimulating the assembly of FtsZ protofilaments. Comparative <italic>in vitro</italic> studies using the SepH homolog from <italic>Mycobacterium smegmatis</italic> further reveal that SepH can also bundle FtsZ protofilaments, indicating an additional Z-ring stabilizing function <italic>in vivo</italic>. We propose that SepH plays a crucial role at the onset of cytokinesis in actinobacteria by promoting the assembly of FtsZ filaments into division-competent Z-rings that can go on to mediate septum synthesis.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd><italic>Streptomyces venezuelae</italic></kwd><kwd><italic>Mycobacterium smegmatis</italic></kwd><kwd>FtsZ</kwd><kwd>cell division</kwd><kwd>sporulation</kwd><kwd>prokaryotic development</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Other</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000288</institution-id><institution>Royal Society</institution></institution-wrap></funding-source><award-id>URF\R1\180075</award-id><principal-award-recipient><name><surname>Schlimpert</surname><given-names>Susan</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000268</institution-id><institution>Biotechnology and Biological Sciences Research Council</institution></institution-wrap></funding-source><award-id>BB/T015349/1</award-id><principal-award-recipient><name><surname>Schlimpert</surname><given-names>Susan</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>GM096268</award-id><principal-award-recipient><name><surname>McCormick</surname><given-names>Joseph R</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000268</institution-id><institution>Biotechnology and Biological Sciences Research Council</institution></institution-wrap></funding-source><award-id>BBS/E/J/000PR9791</award-id><principal-award-recipient><name><surname>Bush</surname><given-names>Matthew J</given-names></name><name><surname>Schlimpert</surname><given-names>Susan</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Identification of a novel regulator that directly influences the assembly and function of the cell division machinery in industrially and medically important bacteria.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Cell division is an essential process for almost all living organisms. The core component of the bacterial cell division machinery is the bacterial tubulin homolog FtsZ, which forms the so-called Z-ring at the future division site. Like tubulin, FtsZ monomers polymerize in a GTP-dependent manner into cytoplasmic filaments that undergo treadmilling <italic>in vivo</italic>, a process in which FtsZ subunits are selectively added to one end and removed from the other end (<xref ref-type="bibr" rid="bib32">Loose and Mitchison, 2014</xref>; <xref ref-type="bibr" rid="bib59">Yang et al., 2017</xref>). The Z-ring provides a dynamic scaffold for the assembly of a multiprotein division machinery, the divisome. In addition, FtsZ treadmilling also guides the circumferential movement of peptidoglycan synthases at the division site which leads to septum formation and cell membrane constriction (<xref ref-type="bibr" rid="bib5">Bisson-Filho et al., 2017</xref>; <xref ref-type="bibr" rid="bib40">Perez et al., 2019</xref>; <xref ref-type="bibr" rid="bib59">Yang et al., 2017</xref>).</p><p>While the rate of treadmilling is set by the FtsZ GTPase activity, the overall architecture of the Z-ring is modulated by FtsZ-binding proteins that can influence its positioning, membrane interaction or stimulate FtsZ filament formation and bundling (<xref ref-type="bibr" rid="bib10">Caldas et al., 2019</xref>; <xref ref-type="bibr" rid="bib20">García-Soriano et al., 2020</xref>; <xref ref-type="bibr" rid="bib36">McQuillen and Xiao, 2020</xref>). The function of many of these proteins has been well characterized in the classical rod-shaped model organisms <italic>Escherichia coli</italic> and <italic>Bacillus subtilis</italic>. However, members of the actinobacteria, which include industrially and medically important species such as the prolific antibiotic producers of the genus <italic>Streptomyces</italic>, or the human pathogens <italic>Mycobacterium tuberculosis</italic> and <italic>Corynebacterium diphtheriae</italic>, lack most of the key components that are known to regulate the dynamics of Z-ring formation. This raises the fundamental question as to how exactly the assembly and the architecture of the Z-ring is controlled in these bacteria.</p><p><italic>Streptomyces</italic> are Gram-positive soil bacteria that have a fascinating multicellular life cycle involving filamentous growth and sporulation (<xref ref-type="bibr" rid="bib7">Bush et al., 2015</xref>). Unlike most unicellular organisms that assemble one Z-ring and divide by binary division, <italic>Streptomyces</italic> have two functionally distinct modes of cell division: vegetative cross-wall formation and sporulation septation (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Cross-walls divide the growing mycelium occasionally into long multigenomic compartments that remain physically connected. In contrast, during reproductive growth, dozens of sporulation septa are simultaneously deposited in a ladder-like pattern between the segregating chromosomes along the length of sporogenic hyphae. Sporulation septa eventually constrict, leading to cell–cell separation and the release of unigenomic spores. Both these forms of cell division require FtsZ, but unlike in most other bacteria the <italic>ftsZ</italic> gene can be deleted in <italic>Streptomyces</italic>, leading to viable hyphae that lack both cross-walls and sporulation septa (<xref ref-type="bibr" rid="bib34">McCormick et al., 1994</xref>; <xref ref-type="bibr" rid="bib42">Santos-Beneit et al., 2017</xref>). The <italic>Streptomyces</italic> divisome is comprised of several conserved core divisome components including FtsQ, DivIC, FtsL and the cell wall synthesis proteins FtsI and FtsW (<xref ref-type="bibr" rid="bib35">McCormick, 2009</xref>; <xref ref-type="bibr" rid="bib12">Cantlay et al., 2021</xref>). In addition, the <italic>Streptomyces</italic> cell division machinery includes the membrane anchor SepF, two additional SepF-like proteins of unknown function (SepF2 and SepF3), the two dynamin-like proteins DynA and DynB, which ensure the stability of Z-rings during sporulation, and the actinomycete-specific protein SsgB, which has been proposed to recruit FtsZ to future sporulation septation sites (<xref ref-type="bibr" rid="bib46">Schlimpert et al., 2017</xref>; <xref ref-type="bibr" rid="bib57">Willemse et al., 2011</xref>). However, factors that affect the dynamics of Z-ring formation and regulate its architecture have not yet been identified in actinobacteria and the mechanisms that control cell division in <italic>Streptomyces</italic> and related actinobacteria are poorly understood.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title><italic>sepH</italic> is required for sporulation septation in <italic>Streptomyces venezuelae</italic>.</title><p>(<bold>A</bold>) Schematic illustrating the multicellular life style of <italic>Streptomyces</italic> including the two FtsZ-dependent modes of cell division that occur in vegetative and sporogenic hyphae: cross-wall formation and sporulation septation. (<bold>B</bold>) Schematic of the predicted SepH domain organization including the N-terminal DUF3071 domain containing a helix-turn-helix (HTH) motif and the unstructured C-terminal domain. Numbers indicate corresponding amino acid positions. (<bold>C</bold>) Cryo-scanning electron micrographs of sporogenic hyphae from wild-type (WT) <italic>S. venezuelae</italic>, the Δ<italic>sepH</italic> mutant (SV56), and the complemented mutant strain Δ<italic>sepH/sepH<sup>+</sup></italic> (MB747). Scale bars: 2 μm. (<bold>D</bold>) Subcellular co-localization of fluorescently labeled FtsZ (FtsZ-mCherry) and SepH (SepH-YPet) in vegetative and sporulating hyphae. Fluorescent gene fusions were expressed in the WT background (MB751). White arrow heads point at co-localization at cross-walls in vegetative hyphae and the asterisk denotes a sporogenic hypha undergoing sporulation septation. Scale bar: 5 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig1-v1.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title><italic>sepH</italic> is a direct target of the transcriptional regulators WhiA and WhiB.</title><p>ChIP-seq traces showing the enrichment of the FLAG-tagged developmental regulators WhiA and WhiB at binding sites upstream of <italic>sepH (vnz_27360)</italic> or their absence in the untagged wild-type (WT) control sample. Source data: <xref ref-type="bibr" rid="bib6">Bush et al., 2013</xref>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig1-figsupp1-v1.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 2.</label><caption><title>Spore length analysis of wild-type (WT) <italic>S. venezuelae</italic>, the Δ<italic>sepH</italic> mutant (SV56), and the complemented mutant strain Δ<italic>sepH/sepH<sup>+</sup></italic> (MB747).</title><p>A minimum of 347 spores were quantified for each biological replicate (n = 3) and strain. The dashed red lines indicate the median, and black dotted lines the 25/75th percentiles. Statistical comparisons were made using a one-way ANOVA test followed by a Dunnett’s multiple comparison test comparing the means to the WT mean. ****p&lt;0.0001; ns, not significant.</p><p><supplementary-material id="fig1s2sdata1"><label>Figure 1—figure supplement 2—source data 1.</label><caption><title>Spore size measurement data.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63387-fig1-figsupp2-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig1-figsupp2-v1.tif"/></fig><fig id="fig1s3" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 3.</label><caption><title>Localization and corresponding protein abundance of SepH-YPet in the wild-type (WT) and the Δ<italic>ftsZ</italic> mutant.</title><p>(<bold>A</bold>) Localization pattern of constitutively produced SepH-YPet in the WT (MB858) and in an <italic>ΔftsZ</italic> mutant strain (MB859). Scale bar: 5 μm. (<bold>B</bold>) Virtual automated Western blot showing the accumulation of SepH-YPet produced from the constitutive <italic>ermE*</italic> promoter in MB858, MB859, and an untagged WT control carrying the empty vector (e.v., SS4). YPet fusions were detected with an anti-GFP antibody (1:200). Shown are representative results of duplicate experiments.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig1-figsupp3-v1.tif"/></fig></fig-group><p>Here, we report the identification and characterization of SepH, a conserved actinobacterial-specific cell division protein that directly binds FtsZ and regulates the dynamics of Z-ring formation in filamentous <italic>Streptomyces</italic> and in rod-shaped <italic>Mycobacterium</italic> species. We find that SepH co-localizes with FtsZ in <italic>Streptomyces</italic> and is required for regular cross-wall formation and sporulation septation. Biochemical characterization of SepH from <italic>Streptomyces venezuelae</italic> and <italic>Mycobacterium smegmatis</italic> revealed that SepH interacts with FtsZ via a highly conserved helix-turn-helix motif and stimulates the formation of FtsZ protofilaments <italic>in vitro</italic>. In addition, SepH from <italic>M. smegmatis</italic> promotes the lateral interaction of FtsZ filaments. Our data suggest that SepH fulfills a crucial function during the initial stages of cell division by increasing the local concentration of FtsZ, thereby stimulating the assembly of division-competent Z-rings.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>SepH is required for regular sporulation in <italic>Streptomyces venezuelae</italic></title><p>In <italic>Streptomyces</italic>, the initiation of sporulation-specific cell division is controlled by two key transcriptional regulators, WhiA and WhiB. Recent work by Bush et al. determined the regulon of WhiA and WhiB, which co-control the expression of ~240 transcriptional units (<xref ref-type="bibr" rid="bib8">Bush et al., 2016</xref>; <xref ref-type="bibr" rid="bib6">Bush et al., 2013</xref>). To identify novel regulators of Z-ring formation in actinomycetes, we chose to focus on uncharacterized gene products which are conserved across streptomycete genomes and are direct targets of WhiAB (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). This analysis turned our attention to <italic>vnz_27360</italic> (here named <italic>sepH for ‘septation protein H’</italic>), a gene of previously unknown biological function that is conserved across the <italic>Streptomyces</italic> genus. Bioinformatic analysis revealed that SepH consists of an N-terminal domain of unknown function (DUF3071) and an unstructured, less conserved C-terminal half (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). In addition, the DUF3071 domain contains a predicted helix-turn-helix (HTH) motif, suggesting that SepH could function as a DNA-binding protein.</p><p>To investigate if <italic>sepH</italic> plays a role in <italic>Streptomyces</italic> cell division, we first generated a Δ<italic>vnz_27360::apr</italic> null mutant (Δ<italic>sepH</italic>) and imaged sporulating hyphae of wild-type (WT) <italic>S. venezuelae</italic>, Δ<italic>sepH</italic>, and the complemented Δ<italic>sepH</italic> mutant strain (Δ<italic>sepH</italic>/<italic>sepH</italic><sup>+</sup>) by cryo-scanning electron microscopy (cryo-SEM) (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). While aerial hyphae of WT <italic>S. venezuelae</italic> completely differentiated into chains of regularly sized spores, <italic>sepH</italic>-deficient hyphae failed to undergo efficient sporulation septation, leading to chains of spores of irregular size (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). This phenotype could be fully complemented by providing <italic>sepH in trans</italic> (Δ<italic>sepH/sepH</italic><sup>+</sup>), confirming that SepH is indeed required for normal sporulation.</p><p>Next, we set out to determine the subcellular localization of SepH and generated a C-terminal SepH-YPet fusion. The <italic>sepH-ypet</italic> fusion, controlled by its native promoter, was integrated <italic>in trans</italic> at the ΦBT1 phage attachment site in a merodiploid strain that additionally expressed an ectopic copy of <italic>mcherry</italic> labeled <italic>ftsZ,</italic> which was under control of the native promoter. Microscopic analysis of the resulting <italic>S. venezuelae</italic> strain revealed that SepH-YPet co-localized specifically with FtsZ-mCherry at incipient division sites including vegetative cross-walls and sporulation septa (<xref ref-type="fig" rid="fig1">Figure 1D</xref>). Although <italic>sepH</italic> is a direct target of the two sporulation-specific regulators WhiAB, the accumulation of SepH-YPet at vegetative division septa suggests that <italic>sepH</italic> expression is probably driven from an additional, WhiAB-independent promoter and that SepH might also be involved in cell division during vegetative growth.</p><p>Furthermore, we asked whether the specific localization pattern of SepH is dependent on FtsZ and the assembly of a functional divisome. To address this question, we took advantage of an Δ<italic>ftsZ</italic> null mutant (<xref ref-type="bibr" rid="bib42">Santos-Beneit et al., 2017</xref>) and inserted a <italic>sepH-ypet</italic> fusion <italic>in trans</italic>. Fluorescence microscopy of the Δ<italic>ftsZ</italic> strain constitutively producing SepH-YPet revealed that in the absence of FtsZ, SepH-YPet was largely stable and mostly dispersed in the cytoplasm (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3A and B</xref>), indicating that SepH recruitment to future division sites depends upon the assembly of Z-rings.</p></sec><sec id="s2-2"><title>SepH is important for cell division during vegetative growth and sporulation</title><p>To determine the role of SepH in <italic>Streptomyces</italic> cell division, we introduced a <italic>ftsZ-ypet</italic> gene fusion into the Δ<italic>sepH</italic> mutant strain and WT <italic>S. venezuelae</italic> and followed the formation of Z-rings during sporulation using time-lapse fluorescence microscopy. In sporulating WT hyphae, Z-rings are assembled in a characteristic, ‘ladder-like’ pattern in the tip cell compartment of sporogenic hyphae (<xref ref-type="bibr" rid="bib45">Schlimpert et al., 2016</xref>; <xref ref-type="bibr" rid="bib47">Schwedock et al., 1997</xref>). These so-called ‘Z-ladders’ lead to the synthesis of sporulation septa and the formation of chains of exospores of equal size (<xref ref-type="fig" rid="fig2">Figure 2A</xref> and <xref ref-type="video" rid="video1">Video 1</xref>). Interestingly, in the Δ<italic>sepH</italic> mutant Z-ladders were less uniform and frequently displayed an irregular spacing between individual FtsZ-YPet-rings. As observed in cryo-SEM images, spores produced under these conditions were aberrant in size and shape, indicating that regular septation was impaired (<xref ref-type="fig" rid="fig2">Figure 2B</xref> and <xref ref-type="video" rid="video2">Video 2</xref>).</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>SepH is important for cell division leading to sporulation septa and vegetative cross-walls.</title><p>(<bold>A</bold> and <bold>B</bold>) Still images from <xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref> showing the localization of FtsZ-YPet in sporulating (<bold>A</bold>) wild-type (WT; SS12) and (<bold>B</bold>) Δ<italic>sepH</italic> mutant hyphae (MB750). Arrow heads in (<bold>B</bold>) point at aberrant spores or gaps in FtsZ-YPet-ladders (filled arrow head) or indicate lysed hyphae (open arrow heads in DIC image). Note that DIC images correspond to a later time point than fluorescence micrographs to show the terminal sporulation phenotype. Scale bars: 10 µm. (<bold>C</bold>) and (<bold>D</bold>) Kymograph analysis of FtsZ-YPet dynamics during sporulation-specific cell division in WT (<bold>C</bold>) and <italic>ΔsepH</italic> hyphae (<bold>D</bold>), ectopically expressing an additional copy of <italic>ftsZ-ypet</italic> from the native promoter (SS12 and MB750). The DIC image below shows the terminal sporulation phenotype. Yellow and blue boxes indicate magnified regions of the kymograph. Scale bar: 2 µm. Additional examples of kymographs can be found in <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>. (<bold>E</bold>) Fluorescence intensity traces of FtsZ-YPet (Z-rings) over time derived from sporulating WT (SS12) and Δ<italic>sepH</italic> mutant hyphae (MB750). Shown are the mean fluorescence intensity traces (mean ± SEM) collected from Z-rings of five sporulating hyphae for each strain. (<bold>F</bold>) Width of Z-rings in sporulating hyphae of WT (SS12) and <italic>sepH</italic>-deficient hyphae (MB750). The same data set as in (<bold>E</bold>) was used and the mean width for reach replicate (colored dots, n = 5) ±95% CI was plotted. (<bold>G</bold>) HADA labeling of peptidoglycan to visualize cross-walls in WT, Δ<italic>sepH</italic> (SV56), and Δ<italic>sepH/sepH<sup>+</sup></italic> (MB747) hyphae. Spores of each strain were germinated and grown in the presence of 0.25 mM HADA for 5 hr in a microfluidic device before imaging. Scale bar: 20 μm.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Time-lapse fluorescence image series of selected and straightened hyphae (SS12) used to generate kymograph shown in <xref ref-type="fig" rid="fig2">Figure 2C</xref>.</title></caption><media mime-subtype="octet-stream" mimetype="application" xlink:href="elife-63387-fig2-data1-v1.mp4"/></supplementary-material></p><p><supplementary-material id="fig2sdata2"><label>Figure 2—source data 2.</label><caption><title>Time-lapse fluorescence image series of selected and straightened hyphae (MB750) used to generate kymograph shown in <xref ref-type="fig" rid="fig2">Figure 2D</xref>.</title></caption><media mime-subtype="octet-stream" mimetype="application" xlink:href="elife-63387-fig2-data2-v1.mp4"/></supplementary-material></p><p><supplementary-material id="fig2sdata3"><label>Figure 2—source data 3.</label><caption><title>Custom Python and R-scripts and extracted fluorescence intensities of Z-rings used to generate <xref ref-type="fig" rid="fig2">Figure 2E and F</xref>.</title></caption><media mime-subtype="zip" mimetype="application" xlink:href="elife-63387-fig2-data3-v1.zip"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig2-v1.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Additional examples of kymographs showing the localization of FtsZ-YPet over time in (<bold>A</bold>) wild-type (SS12) or (<bold>B</bold>) Δ<italic>sepH</italic> hyphae (MB750).</title><p>Scale bar: 2 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig2-figsupp1-v1.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>FtsZ levels in wild-type and Δ<italic>sepH</italic> cells during sporulation.</title><p>FtsZ levels were determined by automated Western blot analysis using an anti-FtsZ polyclonal antibody (1:200). Lysates were analyzed in triplicate for each strain and FtsZ levels were quantified at the indicated time-points.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig2-figsupp2-v1.tif"/></fig></fig-group><media id="video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-63387-video1.mp4"><label>Video 1.</label><caption><title>Time-lapse fluorescence and DIC microscopy movie showing the localization of FtsZ-YPet in vegetative and sporulating hyphae of wild-type <italic>S. venezuelae</italic> (SS12).</title><p>Scale bar: 10 μm.</p></caption></media><media id="video2" mime-subtype="mp4" mimetype="video" xlink:href="elife-63387-video2.mp4"><label>Video 2.</label><caption><title>Time-lapse fluorescence and DIC microscopy movie showing growth and localization of FtsZ-YPet in vegetative and sporulating hyphae of the <italic>S. venezuelae</italic> Δ<italic>sepH</italic> mutant (MB750).</title><p>Scale bar: 10 μm.</p></caption></media><p>Kymograph analyses of FtsZ-YPet fluorescence in sporulating WT hyphae confirmed the expected regular spacing and dynamics of Z-rings, including Z-ring assembly and constriction, which is accompanied by an increase in fluorescence followed by disassembly and loss of defined FtsZ-YPet fluorescence (<xref ref-type="fig" rid="fig2">Figure 2C and E</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A</xref>). In contrast, establishment of equally spaced Z-rings frequently failed in <italic>sepH</italic>-deficient hyphae leading to the formation of larger, spore-like compartments (<xref ref-type="fig" rid="fig2">Figure 2D</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1B</xref>). Notably, closer inspection of the gaps within Z-ladders in Δ<italic>sepH</italic> mutant hyphae revealed that no discrete FtsZ-YPet signal was visible at these positions, indicating that the formation of individual Z-rings was disturbed very early in the assembly process. However, we found that the dynamics of Z-ring assembly, constriction and disassembly of the remaining Z-rings in <italic>sepH</italic>-deficient hyphae were very similar to the WT (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). We also note that FtsZ protein levels were comparable in sporulating WT and Δ<italic>sepH</italic> cultures (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>), indicating that the absence of SepH does not affect FtsZ protein stability. Moreover, calculation of the average Z-ring width in the two strains did not reveal any marked differences (<xref ref-type="fig" rid="fig2">Figure 2F</xref>), suggesting that the overall dynamics and architecture of Z-rings are WT-like in Δ<italic>sepH</italic> mutant hyphae and that additional mechanisms might be in place that can partially compensate for the lack of SepH activity.</p><p>While analyzing the spatiotemporal localization of FtsZ-YPet in Δ<italic>sepH</italic> hyphae, we noticed occasional lysis of large hyphal segments and the formation of unusual branched sporogenic hyphae (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). Given that FtsZ and SepH also co-localize at cross-walls (<xref ref-type="fig" rid="fig1">Figure 1D</xref>), we reasoned that the absence of SepH might also affect cell division during vegetative growth. To examine the importance of SepH for cross-wall formation, we used the fluorescent D-ala-D-ala analogue HADA to label peptidoglycan and to visualize cross-walls (<xref ref-type="bibr" rid="bib27">Kuru et al., 2015</xref>). Inspection of still images of WT <italic>S. venezuelae</italic> and the complemented Δ<italic>sepH</italic> mutant strain (Δ<italic>sepH/sepH</italic><sup>+</sup>) grown in the presence of HADA showed comparable frequency and distribution of cross-walls within vegetative hyphae. However, we found that <italic>sepH</italic>-deficient hyphae displayed visibly fewer cross-walls compared to the WT (<xref ref-type="fig" rid="fig2">Figure 2G</xref>). The dramatically reduced number of cross-walls in the <italic>sepH</italic> mutant could explain the lysis and branching phenotype we observed in our Δ<italic>sepH</italic> time-lapse microscopy experiments. In WT <italic>Streptomyces</italic>, cross-walls compartmentalize growing hyphae and are often associated with hyphal branch points leading to the physical separation of different hyphal segments. Thus, fewer cross-walls in the Δ<italic>sepH</italic> mutant result in much longer hyphal compartments that are potentially more susceptible to large-scale lytic events. In addition, at the onset of sporulation septation, FtsZ ladders assemble within these unsegmented and branching hyphal compartments which can subsequently result in the formation of the enlarged triangular shaped-like spores at hyphal branch points (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). Collectively, these results demonstrate a crucial role for SepH in cell division during vegetative growth and sporulation.</p></sec><sec id="s2-3"><title>The N-terminal DUF3071 domain is crucial for SepH function</title><p>To identify the protein regions required for the recruitment and function of SepH, we generated fluorescent protein fusions to the N-terminal DUF3071 domain (SepH-NTD, residues 1–186) and the unstructured C-terminal domain (SepH-CTD, residues 187–344) (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). The corresponding mutant alleles were integrated <italic>in trans</italic> at the ΦBT1 phage attachment site in the Δ<italic>sepH</italic> mutant and expressed from the native promoter. The resulting strains were then analyzed by fluorescence microscopy and cryo-SEM to determine the subcellular localization of the fusion proteins and their ability to compensate for the loss of WT SepH activity. Using automated Western blotting, we verified that all proteins were synthesized and stable under the conditions used (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). Control experiments with full-length SepH-YPet demonstrated that this fusion was fully functional and restored WT-like localization and sporulation (compare <xref ref-type="fig" rid="fig3">Figure 3B and F</xref> and <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). Expression of the SepH C-terminal domain (SepH-CTD) gave a diffuse localization pattern and failed to complement any aspect of the Δ<italic>sepH</italic> phenotype, resulting in irregular sporulation and cell lysis (<xref ref-type="fig" rid="fig3">Figure 3C and G</xref>). Interestingly, production of just the N-terminal DUF3071 domain (SepH-NTD) was sufficient to partially restore normal sporulation (<xref ref-type="fig" rid="fig3">Figure 3H</xref>). However, the distinct septal accumulation characteristic of full-length SepH-YPet and WT-like sporulation could only be clearly observed for the truncated gene fusion when it was expressed from a constitutive promoter (<italic>ermE*<sub>p</sub></italic>) in the Δ<italic>sepH</italic> mutant (<xref ref-type="fig" rid="fig3">Figure 3E and I</xref>). By contrast, constitutive expression of <italic>sepH-CTD-ypet</italic> did not improve sporulation in the Δ<italic>sepH</italic> mutant (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>). Taken together, these results imply that the conserved N-terminal region of SepH encoding the DUF3071 domain is vital for SepH function, but WT activity also requires the C-terminal domain.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>The DUF3071 domain is crucial for SepH function <italic>in vivo</italic>.</title><p>(<bold>A</bold>) Schematic showing the SepH domain architecture and constructed truncations. Numbers indicate the relevant amino acid positions. (<bold>B–E</bold>) Fluorescence micrographs showing the localization of the full-length and truncated SepH-YPet variants in the Δ<italic>sepH</italic> mutant expressed from the native promoter (<bold>B–D</bold>, strains MB918, MB827, MB828) or from the constitutive <italic>P<sub>ermE*</sub></italic> promotor (<bold>E</bold>, strain MB852). Scale bar: 5 µm. (<bold>F–I</bold>) Cryo-SEM images of the same strains presented in (<bold>B–E</bold>) showing the ability of (<bold>F</bold>) full-length SepH-YPet or (<bold>G–I</bold>) truncated versions of SepH fused to YPet to complement the sporulation defect of the Δ<italic>sepH</italic> mutant when produced from the native promoter (<bold>F–H</bold>, strains MB918, MB827, MB828) or a constitutive promoter (<bold>I</bold>, strain MB852). Note, expression of <italic>sepH-CTD</italic> (<bold>G</bold>) does not rescue the Δ<italic>sepH</italic> mutant. Scale bars: 5 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig3-v1.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Automated Western blot analysis of the different SepH-YPet constructs shown in <xref ref-type="fig" rid="fig3">Figure 3B–D</xref>.</title><p>Strains (MB918, MB827, MB828, SV56) were grown to mid-exponential phase and SepH-YPet fusions were detected using an anti-GFP antibody (1:200). Red arrow heads indicate expected size for each construct. Asterisks denote non-specific signals that are also present in the negative control (Δ<italic>sepH</italic>) or likely degradation products. Shown are representative results of duplicate experiments.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig3-figsupp1-v1.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>Control image showing the Δ<italic>sepH</italic> phenotype.</title><p>Cryo-SEM image showing sporulating hyphae of Δ<italic>sepH</italic> carrying an empty plasmid (MB749). Scale bar: 5 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig3-figsupp2-v1.tif"/></fig><fig id="fig3s3" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 3.</label><caption><title>Constitutive expression of <italic>sepH-CTD-ypet</italic> does not rescue the Δ<italic>sepH</italic> phenotype.</title><p>Cryo-SEM image showing sporulating hyphae of Δ<italic>sepH</italic> producing SepH-CTD fused to YPet from the constitutive <italic>ermE*</italic> promoter (MB851, <italic>sepH-CTD-ypet</italic><sup>++</sup>). Scale bar: 5 μm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig3-figsupp3-v1.tif"/></fig></fig-group></sec><sec id="s2-4"><title>SepH does not bind to the nucleoid</title><p>The DUF3071 domain of SepH includes a HTH motif, characteristic of DNA binding proteins (<xref ref-type="bibr" rid="bib3">Aravind et al., 2005</xref>). This raised the question as to whether SepH could interact with the nucleoid. Notably, to-date, no functional homologs of the well-described nucleoid occlusion systems present in other bacteria have been identified in <italic>Streptomyces</italic>. To investigate a potential role of SepH in chromosome segregation, we first generated a dual-labeled strain which produced SepH-YPet and a mCherry-labeled version of the bacterial nucleoid-associated protein HupA (<xref ref-type="bibr" rid="bib41">Salerno et al., 2009</xref>). Both fluorescent protein gene fusions were integrated at the ΦBT1 phage attachment site of WT <italic>S. venezuelae</italic> and expression was driven from their native promoters. Fluorescence microscopy of the resulting <italic>S. venezuelae</italic> strain showed that SepH-YPet and HupA-mCherry did not co-localize. Instead, SepH-YPet accumulated at sites where HupA-mCherry was largely absent, indicating that SepH does not associate with the nucleoid (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). Furthermore, we visualized the nucleoid in WT and Δ<italic>sepH</italic> spore chains stained with the fluorescent DNA dye 7-AAD but did not observe anucleate spores in the Δ<italic>sepH</italic> mutant (<xref ref-type="fig" rid="fig4">Figure 4B</xref>), suggesting that chromosome segregation is not impaired in <italic>sepH</italic>-deficient hyphae.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>SepH is not associated with the nucleoid or required for chromosome segregation.</title><p>(<bold>A</bold>) Fluorescence micrographs showing the accumulation of SepH-YPet and the concomitant distribution of chromosomal DNA visualized using the nucleoid-associated protein HupA fused to mCherry (MB807). Boxes I and II indicate an enlarged hyphal segment shown in the left panels. Scale bars: 2 µm. (<bold>B</bold>) Fluorescence images of wild-type (WT) and Δ<italic>sepH</italic> (SV56) spore chains incubated with the fluorescent dyes 7-AAD and WGA Alexa Fluor 488 to visualize DNA and cell wall material, respectively. Scale bar: 5 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig4-v1.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>SepH does not bind DNA.</title><p>(<bold>A</bold>) Relative genome-wide distribution of putative SepH binding sites identified by ChIP-seq analysis using an anti-SepH polyclonal antibody during sporulation in wild-type versus Δ<italic>sepH</italic> (SV56) cells. Arrows point to the three most enriched putative binding sites of SepH upstream of <italic>vnz_07520</italic>, <italic>vnz_30075</italic>, and <italic>vnz_35870,</italic> which were further analyzed in (<bold>B</bold>) and (<bold>C</bold>). (<bold>B</bold>) DNase I footprinting analysis of SepH bound to radiolabeled probes derived from the sequence upstream of <italic>vnz_07520</italic>, <italic>vnz_30075</italic>, and <italic>vnz_35870</italic>. 5’-end-labeled probes were incubated with increasing concentrations of SepH and subjected to DNase I treatment. The footprints are flanked by Maxam and Gilbert sequence ladders (GA). No binding of SepH to the probes could be detected. (<bold>C</bold>) EMSA analysis to test for non-specific binding of SepH to the promoter region of <italic>vnz_35870</italic>, a sequence internal to <italic>vnz_08520</italic> (<italic>ftsZ</italic>) and a low-GC sequence from the kanmycin resistance gene (<italic>kan<sup>r</sup></italic>). No binding activity of SepH to any of the tested DNA probes could be detected. Numbers in brackets indicate GC-content of the DNA probe.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig4-figsupp1-v1.tif"/></fig></fig-group><p>To independently verify our localization studies, we first performed chromatin immunoprecipitation coupled with deep-sequencing (ChIP-seq) using sporulating WT <italic>S. venezuelae</italic>. In parallel, we conducted ChIP-seq experiments with the Δ<italic>sepH</italic> mutant strain as a negative control to eliminate false-positive signals arising from non-specific binding of the α-SepH antibody. Analysis of the ChIP-seq results did not reveal any significant enrichment of SepH on the chromosome (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A</xref>) compared to the Δ<italic>sepH</italic> negative control. Furthermore, DNase I footprinting experiments using purified SepH together with radiolabeled probes derived from three of the most enriched chromosomal regions (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B</xref>) did not reveal protection of the selected DNA fragments, collectively suggesting that SepH does not bind to specific DNA-sequences. Finally, we performed electrophoretic mobility shift assays (EMSAs) to test SepH for non-specific DNA-binding activity <italic>in vitro</italic> (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1C</xref>). For this, we tested binding of SepH to the promoter region of <italic>vnz_35870</italic> (the most enriched region in ChIP-seq), the sequence internal to <italic>vnz_08520</italic> (not enriched in ChIP-seq) and the low GC-sequence of the kanamycin resistance gene from a standard <italic>E. coli</italic> expression vector. Under the conditions used, we did not observe binding of SepH to any of these DNA fragments. Collectively, our results strongly suggest that the HTH motif in the conserved N-terminal region of SepH is not involved in DNA binding and that SepH does not play a direct role in chromosome segregation.</p></sec><sec id="s2-5"><title>The SepH HTH motif is essential for the interaction with FtsZ</title><p>While most HTH motifs mediate DNA binding, exceptions to this rule exist and HTH motifs have also been shown to facilitate protein–protein interaction (<xref ref-type="bibr" rid="bib53">van den Ent et al., 2010</xref>). Thus, we hypothesized that the HTH motif within the NTD of SepH could directly affect the function of a protein binding partner, such as FtsZ or other components of the <italic>Streptomyces</italic> cell division machinery. To investigate this possibility, we performed yeast-two hybrid (Y2H) assays. As previously described, we observed that FtsZ can self-interact and associate with SepF (<xref ref-type="bibr" rid="bib46">Schlimpert et al., 2017</xref>). Furthermore, our Y2H experiments suggested that SepH can oligomerize and, most significantly, SepH binds FtsZ (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). In addition, we tested interactions between SepH and several other <italic>Streptomyces</italic> divisome components including SepF, SepF2, SepF3, DynA, and DynB but only detected a putative interaction with SepF in one orientation (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>).</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>SepH helix-turn-helix (HTH) motif is crucial for the interaction with FtsZ.</title><p>(<bold>A</bold>) Yeast two-hybrid analysis. The indicated proteins were fused to the GAL4 activation domain (AD) and the GAL4 DNA-binding domain (BD). The viability of the yeast strains expressing the respective fusion proteins was confirmed by spotting the individual strains on minimal medium containing leucine and tryptophan (left panel). Interaction between the protein fusion allows growth on minimal medium lacking leucine, tryptophan, histidine, and alanine (right panel). The full set of tested interactions can be found in <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>. Each interaction was tested in triplicate. (<bold>B</bold>) Yeast two-hybrid assay showing the interaction between FtsZ and different SepH variants, including full-length SepH (SepH), the N-terminal domain of SepH (SepH-NTD), the C-terminal SepH domain (SepH-CTD), and the mutated SepH HTH domain (SepH-G79P). Experiments were performed as described above. (<bold>C</bold>) Coomassie-stained SDS gel with purified <italic>S. venezuelae</italic> FtsZ, SepH, SepH-NTD (residues 1–186), SepH-CTD (residues 187–344), and SepH-G79P. (<bold>D</bold>) Mean GTP hydrolysis rate of 3.5 µM FtsZ alone or in the presence of increasing concentrations of SepH. SepH did not show GTPase activity (red graph). Error bars represent SEM (n ≥ 3). (<bold>E</bold>) Mean GTP hydrolysis rate of FtsZ (3.5 µM) in the presence of wild-type SepH and SepH variants at a molar ratio of 1:1. Error bars represent min/max values (n ≥ 3). (<bold>F</bold>) Co-sedimentation of SepH with polymerized FtsZ <italic>in vitro</italic>. 3.5 µM FtsZ was incubated for 15 min in the presence or absence of 2 mM GTP, and 0.6 µM SepH or SepH-G79P as indicated. Polymerized FtsZ was collected by high-speed ultracentrifugation. The presence of proteins in the supernatant (S) and pellet (P) was analyzed by SDS-PAGE and Coomassie staining. Representative images of two independent experiments are shown. The percentage of total FtsZ or SepH/SepHG79P in the pellet fraction is indicated below. Note that due to number of samples, protein fractions were loaded on separate protein gels which resulted in slightly different staining intensity.</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>High-speed co-sedimentation data used in <xref ref-type="fig" rid="fig5">Figure 5F</xref>.</title></caption><media mime-subtype="octet-stream" mimetype="application" xlink:href="elife-63387-fig5-data1-v1.pptx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig5-v1.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Yeast-two hybrid analysis showing the complete set of tested interactions between SepH and different cell division proteins.</title><p>Growth and putative interaction between the different fusion proteins was verified by spotting the individual strains onto minimal media lacking either leucine and tryptophan (growth) or leucine, tryptophan, histidine, and alanine (interaction). The white dashed box indicates the subset of interactions shown in <xref ref-type="fig" rid="fig5">Figure 5A</xref>. Each interaction was tested in triplicate and a representative overview of the results is shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig5-figsupp1-v1.tif"/></fig><fig id="fig5s2" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 2.</label><caption><title>Cryo-SEM micrograph of sporulating Δ<italic>sepH</italic> hyphae expressing <italic>sepH-G79P</italic> ectopically from the native promoter (MB938).</title><p>Scale bar: 10 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig5-figsupp2-v1.tif"/></fig><fig id="fig5s3" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 3.</label><caption><title>Biochemical characterization of SepH, SepH variants, and FtsZ.</title><p>(<bold>A</bold>) CD spectroscopy analysis of wild-type SepH (black) and SepH-G79P (red). Both proteins show a similar spectral pattern indicating that they are not significantly different in their secondary structure. (<bold>B</bold>) Size exclusion chromatograms of purified SepH (gray), SepH-G79P (red), SepH-NTD (yellow), and SepH-CTD (blue). Predicted multimerization states of the purified proteins based on the migration of MW standards is indicated (4×, tetramer; 2×, dimer). Shown are representative results of duplicate experiments. (<bold>C</bold>) Mean GTP hydrolysis rate of increasing concentrations of FtsZ over time. Error bars represent SEM (n ≥ 3).</p><p><supplementary-material id="fig5s3sdata1"><label>Figure 5—figure supplement 3—source data 1.</label><caption><title>Analytical gel filtration data.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63387-fig5-figsupp3-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig5-figsupp3-v1.tif"/></fig><fig id="fig5s4" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 4.</label><caption><title>Quantification of SepH and FtsZ abundance by quantitative (automated) Western blotting.</title><p>(<bold>A</bold>) and (<bold>B</bold>). <italic>Top</italic>, virtual Western blot image showing a dilution series of purified FtsZ (left) and SepH (right) used to generate a standard curve and endogenous FtsZ and SepH amounts in wild-type cell lysates. Proteins were detected using a polyclonal antibody against FtsZ and SepH. Asterisk denotes an unspecific cross-reaction by the α-SepH antibody. Arrow head points at SepH detected in the cell lysate. <italic>Below</italic>, the bands for the FtsZ and SepH standards were quantified and fit by a linear function (black circles). The amount of FtsZ and SepH (red circles) was calculated from the calibration. Quantification of SepH and FtsZ in cell lysates was performed in biological triplicate experiments, and automated WES analysis was performed in technical replicates. (<bold>C</bold>) Calculation of the molar ratio of SepH and FtsZ in <italic>S. venezuelae</italic> hyphae shows that SepH abundance is approximately sixfold lower compared to FtsZ. Circles present the ratio calculated for each replicate, and the line is the mean.</p><p><supplementary-material id="fig5s4sdata1"><label>Figure 5—figure supplement 4—source data 1.</label><caption><title>High-speed co-sedimentation data with GMPCCP.</title></caption><media mime-subtype="octet-stream" mimetype="application" xlink:href="elife-63387-fig5-figsupp4-data1-v1.pptx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig5-figsupp4-v1.tif"/></fig><fig id="fig5s5" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 5.</label><caption><title>High-speed co-sedimentation with GMPCCP.</title><p>3.5 µM FtsZ was incubated with 1 mM GMPCCP and in the presence or absence of 0.6 µM SepH as indicated. Reactions were incubated for 15 min followed by high-speed ultracentrifugation. The presence of proteins in the supernatant (S) and pellet (P) was analyzed by SDS-PAGE and Coomassie staining. A representative image of two independent experiments is shown. The percentage of total FtsZ or SepH in the pellet fraction is indicated below.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig5-figsupp5-v1.tif"/></fig></fig-group><p>To identify the SepH domain involved in binding FtsZ, we performed additional experiments using the SepH-NTD and the SepH-CTD variants (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). We found that the SepH-NTD could bind FtsZ in the Y2H assays but the SepH-CTD could not. We hypothesized that the HTH fold in the N-terminal domain of SepH could be involved in binding FtsZ. Thus, we repeated the Y2H assay with a SepH variant in which we had substituted a highly conserved glycine residue in the HTH motif with a proline residue (SepH-G79P) (<xref ref-type="bibr" rid="bib37">Mercy et al., 2019</xref>). While SepH-G79P was still able to interact with WT SepH (<xref ref-type="fig" rid="fig5">Figure 5B</xref>), this mutant version failed to bind FtsZ. This indicated that the SepH HTH motif is indeed required for the interaction with FtsZ, but not for self-interaction. We also introduced the <italic>sepH</italic>-G79P allele into the Δ<italic>sepH</italic> mutant and found that SepH-G79P was unable to restore WT-like sporulation (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>).</p><p>Encouraged by the Y2H results, we purified recombinant <italic>S. venezuelae</italic> FtsZ, SepH, and the SepH variants to test if SepH can directly influence the behavior of FtsZ <italic>in vitro</italic> (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). Using circular dichroism (CD), we first confirmed that the G79P substitution did not cause any major structural changes (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3A</xref>). We then examined SepH and its variants by size exclusion chromatography and found that WT SepH, SepH-CTD, and SepH-G79P eluted as one peak, corresponding to a predicted size of a tetramer, while SepH-NTD eluted as a dimer (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3B</xref>). We next measured the GTP hydrolysis rate of FtsZ in the presence of SepH (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Initial characterization of the biochemical properties of <italic>S. venezuelae</italic> FtsZ confirmed that the protein was active and robustly hydrolyzed GTP in a time-dependent manner at a rate of 1.12 ± 0.44 GTP per FtsZ per minute, similar to the recently published activity of <italic>Streptomyces</italic> FtsZ (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3C</xref>; <xref ref-type="bibr" rid="bib48">Sen et al., 2019</xref>). While SepH on its own did not hydrolyze GTP, we found that the addition of increasing amounts of SepH led to a moderate increase of FtsZ’s GTP turnover (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Importantly, we measured a similar increase in GTP turnover when we incubated FtsZ with SepH-NTD but not with the SepH-CTD or SepH-G79P variants (<xref ref-type="fig" rid="fig5">Figure 5E</xref>).</p><p>To ensure that our studies on the effect of SepH on FtsZ behavior were performed under physiologically relevant conditions, we used quantitative Western blot analysis and determined that the intracellular levels of SepH are sixfold lower than FtsZ (<xref ref-type="fig" rid="fig5s4">Figure 5—figure supplement 4</xref>). Notably, we found in our initial GTPase assays that using 0.6 μM SepH was already sufficient to stimulate the GTPase activity of 3.5 μM FtsZ (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Based on these results, we performed all subsequent <italic>in vitro</italic> studies using a 1:6 molar ratio of SepH to FtsZ.</p><p>To further substantiate our finding that SepH directly binds FtsZ, we performed high-speed sedimentation assays (<xref ref-type="fig" rid="fig5">Figure 5F</xref>). In the absence of GTP, FtsZ was unable to polymerize into filaments and was largely found in the supernatant after ultracentrifugation. In the presence of GTP, approximately 35% of FtsZ was detected in the pellet fraction, indicating that FtsZ had assembled into polymers. When SepH was added to the reaction with FtsZ and GTP prior to ultracentrifugation, 47% of FtsZ and 96% of SepH were robustly pelleted, confirming a direct interaction between SepH and FtsZ. In contrast, incubation of FtsZ with GTP and the SepH HTH mutant variant (SepH-G79P) resulted in a clearly reduced co-sedimentation of SepH-G79P (50%) with polymerized FtsZ (36%). In addition, in the absence of FtsZ both SepH and SepH-G79P were largely soluble.</p><p>Next, we asked whether the hydrolysis of GTP is required for the interaction of SepH with FtsZ. To address this question, we repeated the co-sedimentation assays with FtsZ and SepH using the slow-hydrolysable GTP analogue GMPCCP. Under these conditions, the amount of FtsZ in the pellet fraction nearly doubled (88%) and this was independent of SepH, which co-sedimented almost completely with FtsZ (98%) (<xref ref-type="fig" rid="fig5s5">Figure 5—figure supplement 5</xref>). Taken together, our two-hybrid and <italic>in vitro</italic> experiments demonstrate that SepH directly interacts with FtsZ via the HTH motif in the conserved N-terminal DUF3071 domain and that this interaction is independent of the GTPase activity of FtsZ.</p></sec><sec id="s2-6"><title>SepH stimulates the formation of dynamic FtsZ filaments <italic>in vitro</italic></title><p>The enrichment of SepH and FtsZ in the pellet fraction following high-speed centrifugation suggested that SepH either promotes the formation of macromolecular FtsZ bundles or stimulates the assembly of a high number of individual FtsZ protofilaments. To distinguish between these two possibilities, we first repeated the co-sedimentation assays with GTP at a lower centrifugation speed, which would only allow the pelleting of FtsZ bundles but not FtsZ protofilaments. A similar approach was recently employed to examine the assembly state of FtsZ filaments in complex with the FtsZ-stabilizing protein GpsB (<xref ref-type="bibr" rid="bib18">Eswara et al., 2018</xref>). Using this differential centrifugation method, we detected no meaningful accumulation of SepH (12%) and FtsZ (3%) in the pellet fraction (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>), indicating the absence of large FtsZ assemblies in the presence of SepH.</p><p>To further investigate the assembly state of FtsZ and to visualize the effect of SepH on FtsZ filament morphology, we used negative staining and transmission electron microscopy (TEM). Our control experiments confirmed that purified FtsZ and SepH did not form any visible complexes when imaged on their own (<xref ref-type="fig" rid="fig6">Figure 6A and B</xref>). Upon addition of 2 mM GTP to the polymerization buffer (50 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>), FtsZ (3.5 μM) formed long, gently curved fibers that sparsely covered the EM grid (<xref ref-type="fig" rid="fig6">Figure 6C</xref>). In the presence of GTP and 0.6 μM SepH, FtsZ filaments became readily visible and were similar in morphology but varied more in length compared to FtsZ filaments assembled without SepH (<xref ref-type="fig" rid="fig6">Figure 6D</xref>). We also tested if the addition of a higher concentration of SepH would affect FtsZ filament morphology. At an equimolar ratio of SepH and FtsZ (1:1), FtsZ filaments were highly abundant on EM grids and discernible as largely straight filaments of various lengths (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A</xref>). Occasionally, we did observe some thin filament bundles which were likely a result of the artificial stabilization of FtsZ protofilaments due to the excess of SepH rather than active stabilization of lateral interactions between FtsZ filaments. In addition, we examined FtsZ polymers in the presence of the different SepH variants. As expected, incubation of FtsZ with GTP and SepH-CTD or SepH-G79P did not alter FtsZ filament morphology (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2B-C</xref>). However, FtsZ filaments appeared to be more abundant and longer in the presence of SepH-NTD (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2D</xref>). Likewise, stable FtsZ filaments formed in the presence of slow-hydrolysable GTP analogue GMPCCP either with or without SepH were similar in appearance and did not assemble into large polymer aggregates (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2E and F</xref>). We therefore conclude that SepH does not actively contribute to the bundling of FtsZ protofilaments <italic>in vitro</italic>.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>SepH stimulates the polymerization of dynamic FtsZ protofilaments.</title><p>(<bold>A–D</bold>) Visualization of purified FtsZ and/or SepH using negative staining transmission electron microscopy (TEM). No structures were detected for 3.5 μM FtsZ in the absence of GTP (<bold>A</bold>), or 0.6 μM SepH in the presence of GTP (<bold>B</bold>). Filaments were observed for FtsZ (3.5 μM) when 2 mM GTP was added (<bold>C</bold>), and increased FtsZ polymerization was observed when SepH (0.6 μM) was added to the reaction (<bold>D</bold>). Scale bar: 100 nm. (<bold>E</bold>) Light scatter traces showing the reversible assembly of 3.5 μM FtsZ filaments in the presence of 50 μM GTP and increasing amounts of SepH. Red line denotes DLS trace generated with a molar ratio of FtsZ to SepH at 6:1. (<bold>F</bold>) Light scatter traces showing the polymerization of 3.5 μM FtsZ with 2 mM GTP in the presence (red line) or absence of 0.6 μM SepH (black line). SepH alone did not generate light scattering when incubated with 2 mM GTP (dashed line). Light scatter graphs display representative traces of at least three independent experiments. (<bold>G</bold>) Critical concentration (Cc) of FtsZ from <italic>S. venezuelae</italic> in the presence and absence of 0.6 μM SepH. Cc was determined by extrapolating the linear regression line of the FtsZ GTPase rate backwards to where it intercepts the X-axis. GTPase hydrolysis rates are the result of two independent experiments.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig6-v1.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Low-speed co-sedimentation with GTP.</title><p>Polymerized FtsZ (3.5 µM) was sedimented in the presence or absence of 0.6 µM SepH and 2 mM GTP following a 15 min incubation period. The presence of proteins in the supernatant (S) and pellet (P) was analyzed by SDS-PAGE and Coomassie staining. A representative image of two independent experiments is shown. The percentage of total FtsZ or SepH in the pellet fraction is indicated below.</p><p><supplementary-material id="fig6s1sdata1"><label>Figure 6—figure supplement 1—source data 1.</label><caption><title>Low-speed co-sedimentation data with GTP.</title></caption><media mime-subtype="octet-stream" mimetype="application" xlink:href="elife-63387-fig6-figsupp1-data1-v1.pptx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig6-figsupp1-v1.tif"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 2.</label><caption><title>FtsZ filament morphology in the presence of excess SepH, SepH variants, and with GMPCCP.</title><p>(<bold>A–D</bold>) FtsZ (3.5 μM) filaments formed in the presence of 2 mM GTP and with either an equimolar ratio (1:1) of wild-type SepH (<bold>A</bold>) or at a 6:1 molar ratio with the different SepH variants SepH-G79P (<bold>B</bold>), SepH-CTD (<bold>C</bold>), or SepH-NTD (<bold>D</bold>). (<bold>E</bold> and <bold>F</bold>) FtsZ (3.5 μM) filament morphology with and without 0.6 μM SepH when assembled with the slow-hydrolysable GTP analogue GMPCCP (2 mM). Polymerization reactions were incubated for 15 min and FtsZ filaments were visualized by protein negative stain TEM. Scale bars: 200 nm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig6-figsupp2-v1.tif"/></fig><fig id="fig6s3" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 3.</label><caption><title>Additional FtsZ polymerization results as measured by DLS.</title><p>Light scattering traces of 3.5 μM FtsZ assembly kinetics resulting from incubation with (<bold>A</bold>) SepH (0.6 μM) and 2 mM GDP, (<bold>B</bold>) with 2 mM GTP and 0.6. μM of the different SepH variants, or (<bold>C</bold>) in the presence of the slow-hydrolysable GTP analogue GMPCCP (2 mM) with or without 0.6 μM SepH. Light scatter curves display representative traces of three independent experiments.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig6-figsupp3-v1.tif"/></fig></fig-group><p>To directly follow the assembly kinetics of purified FtsZ into filaments, we used dynamic light scattering (DLS). In the presence of 50 μM GTP, FtsZ monomers assembled into protofilaments, which resulted in a sharp increase in the light scattering signal. The reaction reached a brief steady-state level before GTP became limiting and the intrinsic FtsZ GTPase activity triggered depolymerization and the complete disassembly of FtsZ filaments. Importantly, incubation of 3.5 μM FtsZ with 50 μM GTP and increasing amounts of SepH led to a significantly higher amplitude in light scattering compared to FtsZ with just GTP (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). The initial burst in light scattering was followed by a rapid decrease in the light scatter signal and the complete depolymerization of FtsZ filaments. Control experiments using GDP or SepH with GTP did not generate a light scattering signal, confirming the absence of any polymers or molecular assemblies (<xref ref-type="fig" rid="fig6s3">Figure 6—figure supplement 3A</xref>).</p><p>We repeated the DLS experiments using a higher GTP concentration (2 mM) and a ratio of FtsZ and SepH of 6:1 to test if the detected decrease in light scattering was caused by the depletion of GTP and the accumulation of GDP. When hydrolysable GTP was provided in excess, there was no drop in the light scatter signal (<xref ref-type="fig" rid="fig6">Figure 6F</xref>), suggesting that the observed decline in the scatter signal in <xref ref-type="fig" rid="fig6">Figure 6E</xref> was in fact caused by the depolymerization of FtsZ filaments. Furthermore, we recorded the polymerization dynamics of FtsZ in combination with the different SepH variants. In line with our earlier results, SepH-NTD stimulated FtsZ assembly dynamics although not to the same degree as full-length SepH (<xref ref-type="fig" rid="fig6s3">Figure 6—figure supplement 3B</xref>). In contrast, SepH-CTD and SepH-G79P did not further affect the assembly kinetics of FtsZ and resulted in scatter profiles similar to FtsZ with just GTP. In addition, we monitored FtsZ polymerization using GMPCCP (<xref ref-type="fig" rid="fig6s3">Figure 6—figure supplement 3C</xref>). In agreement with the TEM results, we did not observe any change in the light scattering curves when SepH was added to the polymerization reaction, indicating the absence of higher molecular FtsZ assemblies (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2E and F</xref>).</p><p>The DLS curves of FtsZ filament assembly with and without SepH showed a similar initial rate of polymerization but reached a higher light scatter amplitude when SepH was present (<xref ref-type="fig" rid="fig6">Figure 6F</xref>). We reasoned that SepH has a positive effect on FtsZ polymerization and that the associated increase in FtsZ GTPase activity is a direct consequence of a higher amount of FtsZ protofilament ends that can undergo treadmilling. To support this idea, we determined the critical concentration of FtsZ and found that the addition of SepH, at a molar ratio of 6 FtsZ to 1 SepH, lowers the critical concentration of FtsZ from 1.43 to 1.11 μM (<xref ref-type="fig" rid="fig6">Figure 6G</xref>). Together, these findings demonstrate that SepH directly regulates the behavior of FtsZ by promoting the reversible assembly of FtsZ protofilaments.</p></sec><sec id="s2-7"><title>SepH is conserved in morphologically diverse actinobacteria</title><p>Previous work by <xref ref-type="bibr" rid="bib19">Gao et al., 2006</xref> identified a group of 24 so-called signature proteins that are highly conserved actinobacterial proteins and inculde SepH. To get a better understanding of the phylogenetic distribution and conservation of SepH, we specifically searched for SepH homologs in an expanded set of 3962 representative genomes, including those of 673 actinobacterial species. In total, we identified 626 SepH homologs, which, in agreement with Gao et al., are exclusively found in actinobacteria (<xref ref-type="fig" rid="fig7">Figure 7A</xref>; <xref ref-type="bibr" rid="bib19">Gao et al., 2006</xref>). Furthermore, SepH homologs cluster into distinct groups, suggesting a greater sequence divergence at the family level. Interestingly, in contrast to SepH homologs detected in, for example, the Corynebacteriales or Micrococcales, SepH homologs identified in all analyzed streptomycetes genomes (n = 60) display a very high sequence identity (&gt;80%), which is reflected by the small number of individual leaves within the Streptomycetales branch. Notably, members of the actinobacteria display remarkably diverse cellular morphologies, ranging from cocci and rods to multicellular filaments (<xref ref-type="bibr" rid="bib4">Barka et al., 2016</xref>). Thus, it is conceivable that SepH homologs have further evolved to support cell division in the different actinobacterial species.</p><fig-group><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>SepH<sub>Ms</sub> stimulates FtsZ polymerization and bundling <italic>in vitro</italic>.</title><p>(<bold>A</bold>) Phylogenetic tree showing the distribution of SepH within different actinobacterial orders. Major orders with more than two representative leaves are shown in different colors. Numbers denote bootstrap values. The scale bar represents the average substitutions per site. (<bold>B</bold>) Representative fluorescence and DIC images showing the subcellular localization (I) and wild-type (WT)-like sporulation (II) of the <italic>S. venezuelae</italic> Δ<italic>sepH</italic> mutant producing SepH<sub>Ms</sub>-mCherry (SS380). For comparison spore chains of the WT and the Δ<italic>sepH</italic> mutant (SV56) are shown and the mean ± SD spore length for each strain is denoted below. 350 spores per biological replicate (n = 3) and strain were measured. Scale bars: 5 μm. (<bold>C</bold>) Yeast two-hybrid analysis to test the interaction between SepH<sub>Ms</sub> and FtsZ<sub>Ms</sub> from <italic>M. smegmatis</italic>. Viability of the yeast strains carrying the respective fusion proteins was confirmed by spotting the individual strains on minimal medium lacking leucine and tryptophan (left panel). An interaction between the protein fusions allows growth on minimal medium lacking leucine, tryptophan, histidine, and alanine (right panel). Shown is a representative image. Experiments were performed in triplicate. (<bold>D</bold>) Assembly dynamics of FtsZ<sub>Ms</sub> from <italic>M. smegmatis</italic> using dynamic light scattering. Light scatter traces for 6 µM FtsZ (black) and 6 µM FtsZ<sub>Ms</sub> in the presence of 3 µM SepH<sub>Ms</sub> (red) are shown. 2 mM GTP was added to induce FtsZ polymerization. Light scatter graphs display representative traces of at least three independent experiments. (<bold>E</bold>) FtsZ<sub>Ms</sub> filament morphology visualized by negative stain TEM of 6 µM FtsZ<sub>Ms</sub> alone, with 2 mM GTP and with 3 µM SepH<sub>Ms</sub>. SepH<sub>Ms</sub> (3 μM) does not form visible structures when incubated with GTP. Scale bars: 200 nm. (<bold>F</bold>) High = and low-speed co-sedimentation assay of polymerized FtsZ<sub>Ms</sub> (6 μM) with and without SepH<sub>Ms</sub> (3 μM) in the presence of 2 mM GTP. Presence of FtsZ<sub>Ms</sub> and SepH<sub>Ms</sub> in the supernatant (S) or pellet (P) was analyzed by SDS-PAGE and Coomassie staining. The average percentage of total FtsZ<sub>Ms</sub> or SepH<sub>Ms</sub> in the pellet fraction based on results from two independent experiments is indicated below. Note that due to the number of samples, protein fractions were run on several protein gels which resulted in different staining intensity.</p><p><supplementary-material id="fig7sdata1"><label>Figure 7—source data 1.</label><caption><title>Alignment of SepH proteins used to construct phylogenetic tree and phylogenetic tree file with bootstrap values used to generate <xref ref-type="fig" rid="fig7">Figure 7A</xref>.</title></caption><media mime-subtype="zip" mimetype="application" xlink:href="elife-63387-fig7-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig7sdata2"><label>Figure 7—source data 2.</label><caption><title>Spore measurement data used in <xref ref-type="fig" rid="fig7">Figure 7B</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63387-fig7-data2-v1.xlsx"/></supplementary-material></p><p><supplementary-material id="fig7sdata3"><label>Figure 7—source data 3.</label><caption><title>Co-sedimentation data used in <xref ref-type="fig" rid="fig7">Figure 7F</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63387-fig7-data3-v1.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig7-v1.tif"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 1.</label><caption><title>SepH sequence logo.</title><p>Logo generated from an alignment of 360 representative actinobacterial SepH sequences. Amino acids are colored according to their chemical properties. The SepH N-terminal region contains a highly conserved helix-turn-helix (HTH) motif. The red arrow head denotes the glycine residue that was substituted in the <italic>S. venezuelae</italic> SepH-G79P variant. The C-terminal domain contains two additional conserved sequence motifs of unknown function (dashed boxes).</p><p><supplementary-material id="fig7s1sdata1"><label>Figure 7—figure supplement 1—source data 1.</label><caption><title>Alignment used to generate SepH sequence logo.</title></caption><media mime-subtype="zip" mimetype="application" xlink:href="elife-63387-fig7-figsupp1-data1-v1.zip"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig7-figsupp1-v1.tif"/></fig><fig id="fig7s2" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 2.</label><caption><title>SDS gel showing purified SepH<sub>Ms</sub> and FtsZ<sub>Ms</sub>.</title><p>Coomassie-stained SDS gel with SepH-6xHis (SepH<sub>Ms</sub>) and untagged FtsZ (FtsZ<sub>Ms</sub>) from <italic>M. smegmatis</italic>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig7-figsupp2-v1.tif"/></fig><fig id="fig7s3" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 3.</label><caption><title>Size exclusion chromatogram of purified SepH<sub>Ms</sub>.</title><p>Based on the migration of MW standards, purified SepH<sub>Ms</sub> is predicted to form a tetramer (4×). Experiment was performed in duplicate.</p><p><supplementary-material id="fig7s3sdata1"><label>Figure 7—figure supplement 3—source data 1.</label><caption><title>Size exclusion chromatogram data.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63387-fig7-figsupp3-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig7-figsupp3-v1.tif"/></fig><fig id="fig7s4" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 4.</label><caption><title>GTP hydrolysis rate of FtsZ<sub>Ms</sub> with and without SepH<sub>Ms</sub>.</title><p>Mean GTP hydrolysis rates of 6 µM FtsZ<sub>Ms</sub>, 3 µM SepH<sub>Ms</sub>, and 6 µM FtsZ<sub>Ms</sub> in the presence of 3 µM SepH<sub>Ms</sub> (1:0.5) or 6 μM SepH<sub>Ms</sub> (1:1). Error bars represent SEM (n = 3).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig7-figsupp4-v1.tif"/></fig><fig id="fig7s5" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 5.</label><caption><title>FtsZ<sub>Ms</sub> (6 μM) filament bundles formed in the presence of 6 μM SepH<sub>Ms</sub> and 2 mM GTP.</title><p>Filaments were visualized by negative stain TEM. Scale bar: 200 nm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig7-figsupp5-v1.tif"/></fig></fig-group><p>Despite this apparent divergence of SepH homologs throughout the actinobacteria, a refined alignment of 360 representative SepH sequences clearly showed a strong conservation in the N-terminal DUF3071 domain, including the HTH motif (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). Interestingly, we identified two additional highly conserved sequence motifs at the far C-terminal end of SepH homologs. These two motifs include a four-amino acid lysine and arginine-rich patch, which is particularly enriched in SepH sequences from <italic>Corynebacteria</italic>, and an additional string of 10 amino acids which is present in all analyzed SepH homologs (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). It is conceivable that these residues are involved in a yet unidentified aspect of SepH function.</p><p>To investigate if SepH homologs share a similar biological function, we expressed codon-optimized <italic>sepH</italic> from the non-pathogenic, rod-shaped model organism <italic>Mycobacterium smegmatis</italic> mc<sup>2</sup> 155 (<italic>sepH<sub>Ms</sub>, MSMEG_5685</italic>) in the <italic>S. venezuelae</italic> Δ<italic>sepH</italic> mutant. Both SepH homologs share an overall sequence identity of 34%. The heterologous <italic>sepH<sub>Ms</sub></italic> was fused to <italic>mcherry</italic>, placed under the control of the native <italic>sepH<sub>Sv</sub></italic> promoter and integrated at the <italic>S. venezuelae</italic> ΦBT1 phage attachment site. SepH<sub>Ms</sub>-mCherry was able to fully support WT-like sporulation in the Δ<italic>sepH</italic> mutant (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). Moreover, SepH<sub>Ms</sub>-mCherry also displayed the characteristic septal localization in growing and sporulating hyphae similar to SepH from <italic>S. venezuelae</italic> (<xref ref-type="fig" rid="fig1">Figures 1D</xref> and <xref ref-type="fig" rid="fig7">7B</xref>). In addition, we could detect a direct interaction between SepH<sub>Ms</sub> and FtsZ<sub>Ms</sub> using yeast two-hybrid analyses, supporting the idea that SepH plays a universal role in actinobacterial cell division (<xref ref-type="fig" rid="fig7">Figure 7C</xref>).</p></sec><sec id="s2-8"><title>SepH from <italic>M. smegmatis</italic> stimulates FtsZ polymerization and bundling</title><p>To test if SepH<sub>Ms</sub> can also affect the behavior of FtsZ<sub>Ms</sub> <italic>in vitro</italic>, we purified recombinant SepH<sub>Ms</sub>-6xHis (SepH<sub>Ms</sub>) and untagged FtsZ<sub>Ms</sub> (<xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2</xref>). We first examined SepH<sub>Ms</sub> by size exclusion chromatography and, like SepH from <italic>S. venezuelae</italic>, it eluted as a single peak that corresponds to the predicted size of a tetramer (148 kDa) (<xref ref-type="fig" rid="fig7s3">Figure 7—figure supplement 3</xref>). We also measured the effect of SepH<sub>Ms</sub> on the GTPase activity of FtsZ<sub>Ms</sub> but did not observe a significant effect on the GTP turnover rate when SepH<sub>Ms</sub> was added to the reaction (<xref ref-type="fig" rid="fig7s4">Figure 7—figure supplement 4</xref>). Next, we followed the assembly of FtsZ<sub>Ms</sub> into filaments using DLS. As described previously, mycobacterial FtsZ displayed a low polymerization rate (<xref ref-type="bibr" rid="bib55">White et al., 2000</xref>). However, FtsZ<sub>Ms</sub> filament assembly was dramatically stimulated upon addition of SepH<sub>Ms</sub> at a molar ratio of 1:0.5 (<xref ref-type="fig" rid="fig7">Figure 7D</xref>), as indicated by a sharp and rapid increase in the light scattering signal. Electron microscopy of negatively stained FtsZ<sub>Ms</sub> (6 μM) confirmed that the incubation with GTP led to the assembly of long and thin protofilaments (<xref ref-type="fig" rid="fig7">Figure 7E</xref>). Interestingly, and in contrast to SepH from <italic>S. venezuelae</italic>, the addition of 3 μM SepH<sub>Ms</sub> resulted in the formation of FtsZ<sub>Ms</sub> bundles, which were even more prominent when FtsZ<sub>Ms</sub> and SepH<sub>Ms</sub> were combined at equimolar concentrations (<xref ref-type="fig" rid="fig7s5">Figure 7—figure supplement 5</xref>). Notably, in the background of these bundles, shorter FtsZ filaments were visible, suggesting that SepH<sub>Ms</sub> initially enhanced FtsZ<sub>Ms</sub> protofilament formation which subsequently led to the assembly of long and stable FtsZ<sub>Ms</sub> filaments that could further associate into multifilament bundles. This observation was also supported by differential co-sedimentation epxeriments. Incubation of FtsZ<sub>Ms</sub> with GTP and SepH<sub>MS</sub> followed by either high- or low-speed centrifugation resulted in an enrichment of both proteins in the pellet fraction (<xref ref-type="fig" rid="fig7">Figure 7F</xref>), indicating that SepH<sub>Ms</sub>led to the formation of macromolecular FtsZ assemblies that can be pelleted at lower centrifugation rates. This clearly suggests that SepH<sub>Ms</sub> not only stimulates the rapid polymerization of FtsZ<sub>Ms</sub> but also has the propensity to promote lateral interactions of FtsZ<sub>Ms</sub> filaments.</p><p>Collectively, our results demonstrate that, similar to SepH from <italic>S. venezuelae,</italic> SepH from <italic>M. smegmatis</italic> not only stimulates but also accelerates the assembly of FtsZ<sub>Ms</sub> filaments. In addition, SepH<sub>Ms</sub> further promotes lateral interactions between FtsZ<sub>Ms</sub> protofilaments, leading to the formation of stable macromolecular FtsZ assemblies <italic>in vitro</italic>.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Here we report the identification of SepH as one of the missing actinomycete-specific positive regulators of Z-ring formation. Based on our <italic>in vivo</italic> and <italic>in vitro</italic> characterization of the SepH homologs from the filamentous species <italic>S. venezuelae</italic> and the rod-shaped species <italic>M. smegmatis</italic>, we propose a model in which SepH-mediated FtsZ assembly increases the local concentration of FtsZ. This in turn promotes the spatial ordering of FtsZ filaments, the formation of division-competent Z-ring(s), and efficient FtsZ treadmilling, which is linked to the synthesis of septal peptidoglycan (<xref ref-type="fig" rid="fig8">Figure 8</xref>; <xref ref-type="bibr" rid="bib5">Bisson-Filho et al., 2017</xref>; <xref ref-type="bibr" rid="bib59">Yang et al., 2017</xref>).</p><fig id="fig8" position="float"><label>Figure 8.</label><caption><title>Model of SepH-mediated FtsZ remodeling in <italic>Streptomyces</italic> and <italic>Mycobacterium</italic>.</title><p>SepH (green) directly binds FtsZ (yellow) and stimulates the robust assembly of FtsZ protofilaments. Filament-associated SepH from <italic>M. smegmatis</italic> can further mediate lateral interactions between FtsZ filaments while SepH from <italic>S. venezuelae</italic> is likely to only transiently stabilize FtsZ protofilaments. The GTP hydrolysis rate of FtsZ is likely not directly affected by SepH but will eventually lead to the disassembly of FtsZ filaments. Importantly, SepH functions by increasing the local concentration of FtsZ which promotes the condensation of filaments into a Z-ring and aids FtsZ treadmilling during the early stages of cell division. This process is linked to septal peptidoglycan synthesis and the formation of division septa.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-fig8-v1.tif"/></fig><p>Our model is supported by several lines of evidence. First, we report that SepH plays a crucial role during the early stages of Z-ring formation. Kymograph analysis of fluorescently tagged FtsZ revealed that individual Z-rings fail to assemble in sporulating <italic>S. venezuelae</italic> hyphae lacking SepH (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). Notably, this contrasts with earlier results from a <italic>Streptomyces</italic> Δ<italic>dynAB</italic> mutant in which already assembled Z-rings become destabilized and disassemble, leading to failed septation or partially constricted hyphae (<xref ref-type="bibr" rid="bib46">Schlimpert et al., 2017</xref>). Thus, SepH is clearly important for the establishment of Z-rings. We further found that apart from the irregular spacing, Z-rings assembled in the absence of SepH displayed similar dynamics and architecture to Z-rings in sporulating WT hyphae (<xref ref-type="fig" rid="fig2">Figure 2E and F</xref>). One possible explanation could be that FtsZ molecules that fail to establish a Z-ring are free to diffuse and to interact with neighboring Z-rings, thereby allowing the WT-like assembly of the remaining Z-rings and compensating for the lack of SepH. In addition, <italic>Streptomyces</italic> undergo a second, distinct mode of division during vegetative growth which leads to the synthesis of cross-walls. Our live-cell imaging studies revealed that SepH is required not only for sporulation-specific cell division but also for vegetative cross-wall formation (<xref ref-type="fig" rid="fig2">Figure 2G</xref>). The formation of cross-walls is poorly understood and although the synthesis of cross-walls depends on FtsZ, other core cell division proteins such as DivIC, FtsI, FtsL, and FtsW are not absolutely required (<xref ref-type="bibr" rid="bib35">McCormick, 2009</xref>; <xref ref-type="bibr" rid="bib12">Cantlay et al., 2021</xref>). We found that deleting <italic>sepH</italic> significantly reduced the number of cross-walls in vegetative hyphae. The importance of SepH for FtsZ-mediated cell division during vegetative growth was further supported by the observation that <italic>sepH</italic>-deficient hyphae were prone to extensive cell lysis due to reduced hyphal compartmentalization. This is in line with work by Santos-Beneit et al. demonstrating that cross-walls protect the mycelium from large scale cell rupture caused by mechanical or enzymatical stress (<xref ref-type="bibr" rid="bib42">Santos-Beneit et al., 2017</xref>). Thus, despite the different morphological outcomes of the two types of cell division that occur during the <italic>Streptomyces</italic> life cycle, both require SepH for efficient and regular Z-ring formation.</p><p>Second, we show that SepH directly interacts with FtsZ <italic>in vitro</italic> and determined the protein domains that are critical for SepH function. Our cytological and biochemical analyses have revealed that the N-terminal DUF3071 domain is crucial for SepH activity during cell division (<xref ref-type="fig" rid="fig3">Figures 3</xref> and <xref ref-type="fig" rid="fig5">5</xref>). Importantly, our data support the idea that SepH function depends on a highly conserved HTH motif located within the DUF3071 domain (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). Mutational analysis confirmed that this motif is essential for SepH activity in <italic>S. venezuelae</italic> cell division and required for interaction with FtsZ (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Although the SepH C-terminus is less conserved among SepH homologs and largely dispensable for SepH function, we found that the C-terminal domain (CTD) is required for SepH tetramer formation <italic>in vitro</italic> and efficient subcellular localization <italic>in vivo</italic> (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3B</xref> and <xref ref-type="fig" rid="fig3">Figure 3</xref>). Furthermore, in the absence of the SepH C-terminal domain, FtsZ filaments assembled together with SepH-NTD appeared to be longer (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2D</xref>), indicating that the CTD influences overall SepH activity. In support of the importance of the C-terminal half for SepH function, we identified two additional short sequence motifs of unknown function within the CTD that are widely conserved among SepH homologs (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>).</p><p>Third, we demonstrate that SepH from <italic>S. venezuelae</italic> and SepH<sub>Ms</sub> from <italic>M. smegmatis</italic> stimulate FtsZ nucleation and affect FtsZ filament stability which ultimately may aid the formation of division-competent Z-rings <italic>in vivo</italic> (<xref ref-type="fig" rid="fig6">Figures 6</xref> and <xref ref-type="fig" rid="fig7">7</xref>). Recent work in <italic>B. subtilis</italic> and <italic>S. aureus</italic> suggest that at the onset of cytokinesis, loose FtsZ filaments are actively condensed into a Z-ring. This process depends on FtsZ treadmilling and the activity of FtsZ-binding proteins, such as SepF, FtsA, ZapA, or GpsB, which support filament formation, bundling, stabilization, or membrane-anchoring (<xref ref-type="bibr" rid="bib18">Eswara et al., 2018</xref>; <xref ref-type="bibr" rid="bib38">Monteiro et al., 2018</xref>; <xref ref-type="bibr" rid="bib49">Silber et al., 2021</xref>; <xref ref-type="bibr" rid="bib50">Squyres et al., 2020</xref>; <xref ref-type="bibr" rid="bib56">Whitley et al., 2020</xref>; <xref ref-type="bibr" rid="bib58">Woldemeskel et al., 2017</xref>). Interestingly, our <italic>in vitro</italic> studies suggest that the SepH homologs from <italic>S. venezuelae</italic> and <italic>M. smegmatis</italic> display biochemical properties that are partially similar to the activities described for ZapA and GspB (<xref ref-type="bibr" rid="bib10">Caldas et al., 2019</xref>; <xref ref-type="bibr" rid="bib18">Eswara et al., 2018</xref>; <xref ref-type="bibr" rid="bib50">Squyres et al., 2020</xref>; <xref ref-type="bibr" rid="bib58">Woldemeskel et al., 2017</xref>). For example, similar to the effect described for GpsB, we found that SepH and SepH<sub>Ms</sub> promote FtsZ assembly (<xref ref-type="bibr" rid="bib18">Eswara et al., 2018</xref>). In addition, like ZapA, <italic>M. smegmatis</italic> SepH<sub>Ms</sub> also supports lateral association of FtsZ filaments (<xref ref-type="bibr" rid="bib10">Caldas et al., 2019</xref>) and, under the conditions used, could also induce the formation of FtsZ bundles (<xref ref-type="fig" rid="fig7">Figure 7e</xref> and <xref ref-type="fig" rid="fig7s5">Figure 7—figure supplement 5</xref>). This observation is in line with our comparative GTPase activity assays which suggested that SepH<sub>Ms</sub> does not affect the GTP turnover rate of FtsZ<sub>Ms</sub>, (<xref ref-type="fig" rid="fig7s4">Figure 7—figure supplement 4</xref>). These results are in slight contrast to the observed activity of SepH from <italic>S. venezuelae</italic>, which led to an increase in the GTPase activity of FtsZ.We believe that the effect on the higher GTP hydrolysis rate of FtsZ is a direct consequence of the more abundant and reversible assembly of FtsZ filaments in the presence of SepH (<xref ref-type="fig" rid="fig6">Figure 6E and G</xref>). Further structural studies will be required to identify the critical residues at the interface of the SepH-FtsZ complex and to determine whether SepH or SepH<sub>Ms</sub> association induces a conformational change in the FtsZ structure that could promote the nucleation and/or bundling observed in our <italic>in vitro</italic> experiments. However, the net effect of both SepH homologs leads to a local increase in FtsZ concentration which is likely to also influence FtsZ GTPase activity, thereby mediating efficient FtsZ-treadmilling and Z-ring remodeling. Moreover, as reported for GpsB and ZapA (<xref ref-type="bibr" rid="bib18">Eswara et al., 2018</xref>; <xref ref-type="bibr" rid="bib33">Low et al., 2004</xref>), both characterized SepH homologs form oligomers in solution which could further aid the interaction with FtsZ and the assembly of FtsZ filaments into a condensed Z-ring to drive cytokinesis.</p><p>Finally, our combined cytological, biochemical, and phylogenetic analyses support our hypothesis that SepH plays a conserved and crucial role in actinobacterial cell division. Actinobacteria display a range of complex life styles and include human pathogens such as <italic>C. diphtheriae</italic> or <italic>M. tuberculosis</italic>, in which <italic>sepH</italic> is essential (<xref ref-type="bibr" rid="bib4">Barka et al., 2016</xref>; <xref ref-type="bibr" rid="bib21">Griffin et al., 2011</xref>; <xref ref-type="bibr" rid="bib43">Sassetti et al., 2003</xref>). Although SepH is not essential in <italic>S. venezuelae</italic>, <italic>sepH</italic>-deficient hyphae are subject to frequent cell lysis during vegetative growth and sporulate less efficiently (<xref ref-type="video" rid="video2">Video 2</xref>), supporting the notion that SepH plays a critical role in streptomycetes development.</p><p>In summary, we propose that SepH functions to promote FtsZ polymerization and in this way orchestrates the assembly, stabilization, and activity of FtsZ at the onset of cell division in actinobacteria.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type <break/>(species) or resource</th><th valign="top">Designation</th><th valign="top">Source or reference</th><th valign="top">Identifiers</th><th valign="top">Additional information</th></tr></thead><tbody><tr><td>Gene (<italic>Streptomyces venezuelae</italic>)</td><td><italic>sepH</italic></td><td>StrepDB</td><td><italic>vnz_27360</italic></td><td><ext-link ext-link-type="uri" xlink:href="http://strepdb.streptomyces.org.uk/">http://strepdb.streptomyces.org.uk/</ext-link></td></tr><tr><td>Gene (<italic>S. venezuelae</italic>)</td><td><italic>ftsZ</italic></td><td>StrepDB</td><td><italic>vnz_08520</italic></td><td><ext-link ext-link-type="uri" xlink:href="http://strepdb.streptomyces.org.uk/">http://strepdb.streptomyces.org.uk/</ext-link></td></tr><tr><td>Gene (<italic>Mycobacterium smegmatis mc<sup>2</sup> 155</italic>)</td><td><italic>sepH<sub>Ms</sub></italic></td><td>Mycobrowser</td><td><italic>msmeg_5685</italic></td><td><ext-link ext-link-type="uri" xlink:href="https://mycobrowser.epfl.ch/">https://mycobrowser.epfl.ch/</ext-link></td></tr><tr><td>Gene (<italic>M. smegmatis mc<sup>2</sup> 155</italic>)</td><td><italic>ftsZ<sub>Ms</sub></italic></td><td>Mycobrowser</td><td><italic>msmeg_4222</italic></td><td><ext-link ext-link-type="uri" xlink:href="https://mycobrowser.epfl.ch/">https://mycobrowser.epfl.ch/</ext-link></td></tr><tr><td>Strain, strain background (<italic>S. venezuelae</italic>)</td><td>WT</td><td>NZ_CP018074.1</td><td>NRRL B-65442</td><td>Wild type</td></tr><tr><td>Genetic reagent (<italic>S. venezuelae</italic>)</td><td>Δ<italic>sepH</italic>::<italic>apr</italic></td><td>This paper</td><td>SV56</td><td>Chromosomal <italic>sepH</italic> locus was replaced by <italic>apr-oriT cassette amplified with</italic> primers mb118/mb119 and then transduced into WT using ΦSV1</td></tr><tr><td>Antibody</td><td>Anti-SepH (Rabbit polyclonal)</td><td>This paper</td><td>Cambridge Research Biochemicals</td><td>Automated Western blot (1:200)</td></tr><tr><td>Antibody</td><td>Anti-FtsZ (Rabbit polyclonal)</td><td>This paper</td><td>Cambridge Research Biochemicals</td><td>Automated Western blot (1:200)</td></tr><tr><td>Antibody</td><td>Anti-GFP <break/>(Rabbit polyclonal)</td><td>Sigma Aldrich</td><td>SAB4301138-100UL</td><td>Automated Western blot (1:200)</td></tr><tr><td>Recombinant DNA reagent</td><td>pTB146 <break/>(plasmid)</td><td>doi:<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1038/emboj.2008.264">10.1038/emboj.2008.264</ext-link></td><td/><td>Plasmid for heterologous protein production</td></tr><tr><td>Recombinant DNA reagent</td><td>pET-21b <break/>(plasmid)</td><td>Novagen</td><td>69741</td><td>Plasmid for heterologous protein production</td></tr><tr><td>Recombinant DNA reagent</td><td>SepH <break/>(pFRL39, plasmid)</td><td>This paper</td><td><italic>sepH</italic> in pTB146</td><td>Purification of SepH</td></tr><tr><td>Recombinant DNA reagent</td><td>FtsZ, (pSS287, plasmid)</td><td>This paper</td><td><italic>ftsZ</italic> in pTB146</td><td>Purification of FtsZ</td></tr><tr><td>Recombinant DNA reagent</td><td>FtsZ<sub>Ms</sub>(pSS560, plasmid)</td><td>This paper</td><td><italic>ftsZ<sub>Ms</sub></italic> in pTB146</td><td>Purification of FtsZ<sub>Ms</sub></td></tr><tr><td>Recombinant DNA reagent</td><td>SepH<sub>Ms</sub>(pSS561, plasmid)</td><td>This paper</td><td><italic>sepH<sub>Ms</sub></italic> in pET21b</td><td>Purification of SepH<sub>Ms</sub></td></tr><tr><td>Sequence-based reagent</td><td>mb118</td><td>This paper</td><td>Redirect PCR primer</td><td>CACGTGACGTCGGCAGGCACCACCCGGGAGGTCCCCATGATTCCGGGGATCCGTCGACC</td></tr><tr><td>Sequence-based reagent</td><td>mb119</td><td>This paper</td><td>Redirect PCR primer</td><td>AGCCGCGGAACCGGCGGACCGCCACGGCTCCTGCCGTCATGTAGGCTGGAGCTGCTTC</td></tr><tr><td>Commercial assay or kit</td><td>12–230 KDa Wes separation module</td><td>Bio-Techne</td><td>SM-W004</td><td>Plate and capillaries for Automated Western blot</td></tr><tr><td>Commercial assay or kit</td><td>WES anti-rabbit detection module</td><td>Bio-Techne</td><td>DM-001</td><td>Secondary antibody, luminol and reagents for Automated Western blot</td></tr><tr><td>Commercial assay or kit</td><td>Frozen-EZ Yeast Transformation II Kit</td><td>Cambridge Bioscience</td><td>T2001</td><td>Yeast two-hybrid analysis</td></tr><tr><td>Commercial assay or kit</td><td>Pi ColorLock Kit</td><td>Expedeon</td><td>303–0030</td><td/></tr><tr><td>Commercial assay or kit</td><td>CellASIC ONIX B04A-03 Microfluidic Bacteria Plate</td><td>Millipore</td><td>B04A-03-5PK</td><td>Time-lapse microscopy</td></tr><tr><td>Chemical compound, drug</td><td>GTP</td><td>Jena Bioscience</td><td>NU-1012</td><td>GTPase assay, DLS, TEM, Co- sedimentation</td></tr><tr><td>Chemical compound, drug</td><td>GDP</td><td>Sigma Aldrich</td><td>G7127-10MG</td><td>DLS, TEM, Co- sedimentation</td></tr><tr><td>Chemical compound, drug</td><td>GMPCPP (GpCpp)</td><td>Jena Bioscience</td><td>NU-405S</td><td>DLS, TEM, Co- sedimentation</td></tr><tr><td>Chemical compound, drug</td><td>WGA (Wheat Germ Agglutinin), Alexa Fluor 488 Conjugate</td><td>Molecular Probes</td><td>W11261</td><td>Cell wall staining</td></tr><tr><td>Chemical compound, drug</td><td>7-AAD (7-Aminoactinomycin D)</td><td>Molecular Probes</td><td>A1310</td><td>DNA staining</td></tr><tr><td>Chemical compound, drug</td><td>HADA (3-[[(7-Hydroxy-2-oxo-2<italic>H</italic>-1-benzopyran-3-yl) carbonyl]amino]-D-alanine hydrochloride)</td><td>Other</td><td/><td>Cell wall staining; Gift from M. Thanbichler: synthesized after doi:<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1038/nprot.2014.197">10.1038/nprot.2014.197</ext-link></td></tr><tr><td>Software, algorithm</td><td>Fiji</td><td>Open-source software package</td><td/><td>Image analysis</td></tr><tr><td>Software, algorithm</td><td>ZenBlue 2012</td><td>Zeiss</td><td>Version 1.120</td><td>Image analysis</td></tr><tr><td>Software, algorithm</td><td>Compass for SW</td><td>Bio-Techne</td><td>Version 4.0</td><td>WES</td></tr><tr><td>Software, algorithm</td><td>Prism</td><td>GraphPad</td><td>Version 9.0</td><td>Data analysis</td></tr><tr><td>Software, algorithm</td><td>CLUSTALX</td><td><ext-link ext-link-type="uri" xlink:href="http://www.clustal.org/clustal2/">http://www.clustal.org/clustal2/</ext-link></td><td/><td>Phylogenetic analysis</td></tr><tr><td>Software, algorithm</td><td>MAFFT</td><td><ext-link ext-link-type="uri" xlink:href="https://mafft.cbrc.jp/alignment/software/">https://mafft.cbrc.jp/alignment/software/</ext-link></td><td/><td>Phylogenetic analysis</td></tr><tr><td>Software, algorithm</td><td>MUSCLE</td><td><ext-link ext-link-type="uri" xlink:href="https://www.ebi.ac.uk/Tools/msa/muscle/">https://www.ebi.ac.uk/Tools/msa/muscle/</ext-link></td><td/><td>Phylogenetic analysis</td></tr><tr><td>Software, algorithm</td><td>CD-HIT</td><td><ext-link ext-link-type="uri" xlink:href="http://weizhongli-lab.org/cd-hit/">http://weizhongli-lab.org/cd-hit/</ext-link></td><td/><td>Phylogenetic analysis</td></tr><tr><td>Software, algorithm</td><td>TRIM-AL</td><td><ext-link ext-link-type="uri" xlink:href="http://trimal.cgenomics.org/">http://trimal.cgenomics.org/</ext-link></td><td/><td>Phylogenetic analysis</td></tr><tr><td>Software, algorithm</td><td>PHYML</td><td><ext-link ext-link-type="uri" xlink:href="http://www.atgc-montpellier.fr/phyml/">http://www.atgc-montpellier.fr/phyml/</ext-link></td><td/><td>Phylogenetic analysis</td></tr><tr><td>Software, algorithm</td><td>iTOL</td><td><ext-link ext-link-type="uri" xlink:href="https://itol.embl.de/">https://itol.embl.de/</ext-link></td><td/><td>Phylogenetic analysis</td></tr><tr><td>Software, algorithm</td><td>WebLogo3</td><td><ext-link ext-link-type="uri" xlink:href="http://weblogo.threeplusone.com/">http://weblogo.threeplusone.com/</ext-link></td><td/><td>Sequence logo</td></tr></tbody></table></table-wrap><sec id="s4-1"><title>Bacterial strains and growth conditions</title><p>Bacterial strains are listed in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref> (Table 1). <italic>E. coli</italic> strains were grown in LB or on LB agar at 37°C supplemented with the following antibiotics when necessary: 100 µg mL<sup>−1</sup> carbenicillin, 50 µg mL<sup>−1</sup> kanamycin, 25 µg mL<sup>−1</sup> hygromycin, 50 µg mL<sup>−1</sup> apramycin, or 25 µg mL<sup>−1</sup> chloramphenicol.</p><p><italic>Streptomyces venezuelae</italic> was grown in maltose-yeast extract-malt extract medium (MYM) prepared with 50% tap water and 50% reverse osmosis water and supplemented with R2 trace element solution at 1:500 (<xref ref-type="bibr" rid="bib26">Kieser et al., 2000</xref>). Liquid cultures were grown under aeration at 30°C at 250 rpm. MYM agar was supplemented with the following antibiotics when required: 5 µg mL<sup>−1</sup> kanamycin, 25 µg mL<sup>−1</sup> hygromycin, or 50 µg mL<sup>−1</sup> apramycin.</p><p>Plasmids and oligonucleotides used to generate or to verify strains and plasmids are listed in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>, Tables 2 and 3, respectively.</p></sec><sec id="s4-2"><title>Construction and complementation of a <italic>sepH</italic> mutant in <italic>S. venezuelae</italic></title><p>Using ‘Redirect’ PCR targeting (<xref ref-type="bibr" rid="bib24">Gust et al., 2004</xref>; <xref ref-type="bibr" rid="bib23">Gust et al., 2003</xref>), the <italic>sepH</italic> mutant was generated in which the central (1029 bp) coding region was replaced with a single apramycin resistance cassette. A cosmid library that covers &gt;98% of the <italic>S. venezuelae</italic> genome (M.J. Bibb and M.J. Buttner, unpublished) is fully documented at <ext-link ext-link-type="uri" xlink:href="http://strepdb.streptomyces.org.uk/">http://strepdb.streptomyces.org.uk/</ext-link>. Cosmid Sv-3-B02 was introduced into <italic>E. coli</italic> BW25113 containing pIJ790 and the <italic>sepH</italic> gene (<italic>vnz_27360</italic>) was replaced with the <italic>apr-oriT</italic> cassette amplified from pIJ773 using the primer pair mb118 and mb119. The resulting disrupted cosmid was confirmed by PCR analysis using the flanking primers mb144 and mb145 and introduced into <italic>S. venezuelae</italic> by conjugation via <italic>E. coli</italic> ET12567/pUZ8002 (<xref ref-type="bibr" rid="bib39">Paget et al., 1999</xref>). Double cross-over strains (Apr<sup>R</sup>, Kan<sup>S</sup>) were confirmed by PCR using primer mb144 and mb145. To avoid any unwanted genetic changes following PCR-targeting and homologous recombination, the Δ<italic>sepH::apr</italic> locus was transduced back into WT <italic>S. venezuelae</italic> using the transducing phage SV1 (<xref ref-type="bibr" rid="bib51">Stuttard, 1982</xref>) as described by <xref ref-type="bibr" rid="bib52">Tschowri et al., 2014</xref>. A representative transductant (Apr<sup>R</sup>) was designated SV56. For complementation, pMB557 was introduced into the <italic>sepH</italic> mutant by conjugation.</p></sec><sec id="s4-3"><title>Light microscopy and kymograph analysis</title><p>For imaging protein localization in <italic>S. venezuelae</italic>, cells were grown in MYM medium for 14–18 hr and a 2 µL sample of the culture was spotted onto a 1% agarose pad. <italic>Streptomyces</italic> hyphae were visualized using a Zeiss Axio Observer Z.1 inverted epifluorescence microscope fitted with a Zeiss Colibri 7 LED light source and a Zeiss Alpha Plan-Apo 100×/1.46 Oil DIC M27 objective. Still images and time-lapse images series were collected using Zen Blue (Zeiss) and analyzed using Fiji (<xref ref-type="bibr" rid="bib44">Schindelin et al., 2012</xref>).</p><p>Time-lapse fluorescence imaging <italic>with S. venezuelae</italic> was performed as previously described (<xref ref-type="bibr" rid="bib45">Schlimpert et al., 2016</xref>). Briefly, <italic>S. venezuelae</italic> strains were grown in MYM medium for about 36 hr at 30°C and 250 rpm to reach complete sporulation. To isolate spores, mycelium was pelleted at 400× g for 1 min. Supernatants enriched in spores were diluted in MYM medium to a final concentration of 0.5–5 × 10<sup>7</sup> spores/mL. Spores were loaded into B04A microfluidic plates (ONIX, CellASIC), allowed to germinate and grown by perfusing MYM for 3 hr before medium was switched to spent-MYM medium. Spent-MYM was prepared from the 36 hr sporulation culture by filtering the growth medium to remove spores and mycelial fragments. The media flow rate and temperature were maintained at 2 psi and 30°C. Time-lapse imaging was started approximately 8 hr after spores had germinated and images were acquired every 10 min until sporulation was completed.</p><p>Kymographs were generated from registered time-lapse image series of strain SS12 (WT/<italic>ftsZ-ypet</italic>) and MB750 (Δ<italic>sepH</italic>/<italic>ftsZ-ypet</italic>) using Fiji (<xref ref-type="bibr" rid="bib44">Schindelin et al., 2012</xref>). Hyphae undergoing sporulation septation were first identified based on the characteristic FtsZ-YPet localization pattern following the cessation of tip extension. 24 frames (10 min/frame) including one frame immediately before and 22 frames after the cessation of hyphal growth were isolated. Selected hyphae were ‘straightened’ in Fiji and a segmented line (five pt) was manually drawn along the center of the straightened hyphae. FtsZ-YPet fluorescence intensity was plotted along this line as a function of time (240 min) using the ‘Reslice’ command. Kymographs were further annotated in Adobe Illustrator.</p><p>To visualize fluorescence intensities of Z-rings over time, time-lapse series were first corrected for background fluorescence by applying a custom Python script with a multi-Otsu thresholding algorithm. The following steps were performed in Fiji (<xref ref-type="bibr" rid="bib44">Schindelin et al., 2012</xref>): Z-rings were identified manually in time-lapse series and an ROI of 10 × 20 pixels was drawn around each Z-ring. The average fluorescence intensity values within each ROI were then collected and the mean fluorescence intensity trace of all Z-rings isolated from either WT or <italic>sepH</italic>-deficient hyphae was plotted using Graphpad Prism.</p><p>To determine the width of Z-rings, an average fluorescence intensity projection for each of the time-series was first generated in Fiji. The corresponding fluorescence intensity trace along a segmented line (five pt) manually drawn along the hyphal midline was then extracted, and the obtained data was further processed in R. For each strain, five independent time-lapse series were analyzed. Peaks (which correspond to potential Z-rings) were identified using a custom R script and further filtered to remove false-positive peaks with a fluorescence intensity below 100. Z-ring width was calculated by measuring the full width at half maximum of the Z-ring peak in the fluorescence intensity profiles. Z-rings widths were further analyzed and plotted using Graphpad Prism.</p></sec><sec id="s4-4"><title>Spore length measurements</title><p>Lawns of the respective <italic>S. venezuelae</italic> strains were generated by spreading a single colony onto MYM agar. The plates were incubated for 3–4 days at 30°C until sporulation was completed. Spores were washed off the agar using 20% glycerol and a sterile cotton pad through which spores were harvested using a sterile syringe. A small aliquot of the spore suspension was mounted on a microscope slide on top of a thin agarose pad (1% agarose dissolved in water) and imaged by phase-contrast microscopy using a Zeiss Axio Observer Z.1 inverted microscope and a Zeiss Alpha Plan-Apo 100×/1.46 Oil DIC M27 objective. Spore lengths were determined using the software Fiji (<xref ref-type="bibr" rid="bib44">Schindelin et al., 2012</xref>) except for spore length measurements in <xref ref-type="fig" rid="fig7">Figure 7B</xref> in which case the MicrobeJ plug-in for Fiji was used (<xref ref-type="bibr" rid="bib15">Ducret et al., 2016</xref>).</p></sec><sec id="s4-5"><title>Staining of DNA and peptidoglycan</title><p><italic>S. venezuelae</italic> WT and SV56 cells were grown in confluent patches on MYM agar for 1–2 days. Glass coverslips were gently pressed onto the cell material and removed. Coverslips were fixed with 100% methanol for 1 min. Sterile H<sub>2</sub>O was used to wash the coverslips. Spore chains attached to the coverslips were incubated with the DNA-stain 7-AAD (7-aminoactinomycin D, 10 μg mL<sup>−1</sup>) and with Wheat Germ Agglutinin (WGA), Alexa Fluor 488 Conjugate (50 μg mL<sup>−1</sup>) to visualize cell wall material. The samples were incubated for 30 min in the dark, after which the dyes were removed with sterile H<sub>2</sub>O. The coverslips were then mounted onto agarose pads and visualized by fluorescence microscopy.</p><p>For HADA (7-hydroxycoumarin 3-carboxylic acid-amino-D-alanine) labeling (<xref ref-type="bibr" rid="bib27">Kuru et al., 2015</xref>), spores were loaded into BA04 microfluidic plates (CellASIC ONIX). Trapped spores were continuously supplied with MYM containing 0.25 mM HADA at 2 psi and 30°C. Following spore germination, hyphae were allowed to grow by perfusing MYM-HADA at 2 psi for 4–5 hr. Prior to image acquisition MYM-HADA was replaced with MYM and hyphae were visualized using fluorescence microscopy as described above. Images were collected using Zen Blue (Zeiss) and analyzed using Fiji (<xref ref-type="bibr" rid="bib44">Schindelin et al., 2012</xref>).</p></sec><sec id="s4-6"><title>Cryo-scanning electron microscopy</title><p><italic>S. venezuelae</italic> colonies were mounted on the surface of an aluminum stub with Tissue Tek OCT (optimal cutting temperature compound) (Agar Scientific Ltd, Essex, UK), plunged into liquid nitrogen slush at approximately −210°C to cryo-preserve the material, and transferred to the cryo-stage of an Alto 2500 cryotransfer system (Gatan, Oxford, England) attached to either a FEI NanoSEM 450 field emission gun scanning electron microscope (FEI Ltd, Eindhoven, The Netherlands) or a Zeiss Supra 55 field emission gun scanning electron microscope (Zeiss UK Ltd, Cambridge). The surface frost was sublimated at −95°C for 3½ min before the sample was sputter coated with platinum for 2 min at 10 mA at below −110°C. Finally, the sample was moved onto the cryo-stage in the main chamber of the microscope, held at approximately −130°C, and viewed at 3 kV.</p></sec><sec id="s4-7"><title>Transmission electron microscopy</title><p>FtsZ filament morphology was visualized by negative staining and TEM. For FtsZ from <italic>S. venezuelae</italic>, 3.5 µM FtsZ and/or 0.6 µM SepH was prepared in buffer P (50 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>). All the solutions were previously filtered using 0.1 µm centrifugal filter units (Millipore). Reactions were pre-warmed at 30°C for 10 min, started by adding 2 mM GTP, and incubated at 30°C for an additional 15 min. 1 or 3.5 μL of each reaction was placed on a carbon-filmed, 400 mesh copper grid (EM Resolutions, Sheffield, UK) which had been glow discharged for 20 s at 10 mA in an Ace 200 (Leica Microsystems (UK) Ltd, Milton Keynes, UK). After 60 s, excess sample was wicked away using Whatman No. 1 filter paper and grids were negatively stained using 2% (w/v) uranyl acetate in water. Grids were imaged using a Talos F200C transmission electron microscope (ThermoFisher Scientific, Eindhoven, The Netherlands) operated at 200 kV, equipped with a 4 k OneView CMOS detector (Gatan UK, Abingdon, Oxfordshire, UK).</p><p>For <italic>M. smegmatis</italic> proteins, 6 µM FtsZ<sub>Ms</sub> was prepared in modified buffer P (50 mM HEPES pH 6.8, 100 mM KCl, 5 mM MgCl<sub>2</sub>) in the absence or presence of SepH<sub>Ms</sub> at 3 µM or 6 µM. Reactions were pre-warmed to 37°C for 10 min, and then started by adding 2 mM GTP and incubated for further 20 min. Samples were stained and imaged as described above.</p></sec><sec id="s4-8"><title>Automated Western blot analysis</title><p>For analysis of protein levels, we used the automated capillary-based immunoassay platform WES (ProteinSimple, San Jose, CA). To prepare proteins samples, 2 mL aliquots of liquid MYM cultures were sampled at the desired time points. Mycelium was pelleted by centrifugation and washed with PBS. Pellets were snap-frozen in liquid nitrogen and stored at −80°C until use. Mycelial pellets were thawed on ice and resuspended in 0.4 mL ice-cold lysis buffer (20 mM Tris pH 8.0, 5 mM EDTA, 1× EDTA-free protease inhibitors [Roche]) and sonicated (5 × 15 s on/15 s off at 5-micron amplitude). Cell lysates were then cleared by centrifugation at 16,000× g for 20 min at 4°C. Total protein concentration was determined using Bradford reagent (Biorad) and 1 µg of total protein was then loaded in technical triplicate into a microplate (ProteinSimple). For the detection of SepH, FtsZ or YPet-fusion proteins anti-SepH antibody (1:200), anti-FtsZ antibody (1:200) or anti-GFP antibody (1:200) was used. Data analysis and the generation of virtual Western blots were done using the Compass Software (Protein Simple, Version XZ).</p></sec><sec id="s4-9"><title>Quantification of the cellular molar ratio of FtsZ to SepH</title><p>Serial dilutions of purified SepH (1 × 10<sup>−3</sup> to 7.8 × 10<sup>−6</sup> mg mL<sup>−1</sup>) and FtsZ (5 × 10<sup>−4</sup> to 3.9 × 10<sup>−6</sup> mg mL<sup>−1</sup>) were made using 1× polymerization buffer (50 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>) and loaded in technical replicates onto the WES automated blotting system, according to the manufacturer’s instructions (ProteinSimple, San Jose, CA). Lysates from sporulating cultures of WT <italic>S. venezuelae</italic> were processed as described above. One microgram of total protein of biological triplicates was loaded into a microplate (ProteinSimple) and FtsZ and SepH were detected with anti-FtsZ anti-SepH antibodies (diluted to 1:200). From the output of the WES, standards for recombinant FtsZ and SepH were quantified and fit with a linear function to create a calibration curve. Using these calibration curves, the signals generated by FtsZ and SepH from the cell lysates were used to calculate the FtsZ:SepH molar ratio.</p></sec><sec id="s4-10"><title>Yeast two-hybrid analysis</title><p>The yeast two-hybrid assays were performed in strain <italic>Saccharomyces cerevisiae</italic> Y2HGold (Takara Bio USA). Combination of the two plasmids encoding the desired fusion proteins were transformed into Y2HGold cells using Frozen-EZ Yeast Transformation II Kit (Zymo Research). Selection for growth was carried out on selective drop-out plates lacking leucine and tryptophan (SD<sup>-Leu-Trp</sup>) and single colonies were inoculated into liquid SD<sup>-Leu -Trp</sup> medium and grown overnight at 30°C. Saturated cultures were diluted 1:4 in water and 5 µL of each dilution was then spotted on SD<sup>-Leu-Trp</sup> and SD<sup>-Leu -Trp -Ade -His</sup> (additionally lacking adenine and histidine) in order to test for growth and interaction, respectively. Plates were incubated for 4–5 days at 30°C and scanned. Each interaction was tested in biological triplicate experiments.</p></sec><sec id="s4-11"><title>Protein expression and purification</title><p>To purify untagged SepH, SepH variants and FtsZ from <italic>S. venezuelae</italic> and FtsZ<sub>MS</sub> from <italic>M. smegmatis</italic>, <italic>E. coli</italic> Rossetta (DE3) was transformed with derivatives of the plasmid pTB146 to produce His<sub>6</sub>-SUMO-tagged protein fusions. Cells were grown at 37°C in LB medium containing 50 µg mL<sup>−1</sup> carbenicillin, 25 µg mL<sup>−1</sup> chloramphenicol, and 1% glucose overnight and then diluted 1/100 in fresh LB medium containing carbenicillin and chloramphenicol. To induce protein production, 0.5 mM IPTG was added to the culture once cells reached an OD<sub>600</sub> of 0.5. Cultures were incubated shaking at 30°C for 4 hr and then harvested by centrifugation. Cell pellets were resuspended in Tris-FtsZ buffer (50 mM Tris-HCl pH 8.0, 50 mM KCl, and 10% glycerol) and lysed by sonication for 10 cycles at 15-micron amplitude, 15 s ON, and 30 s OFF. Lysates were centrifuged at 26,000× g for 30 min at 4°C to remove cell debris. His<sub>6</sub>-SUMO-FtsZ, His<sub>6</sub>-SUMO-SepH, or His<sub>6</sub>-SUMO-FtsZ<sub>Ms</sub> were purified using an HisTrap column in ÄKTA pure (GE Healthcare) and eluted using an increasing concentration of imidazole. Fractions containing protein were pooled and dialyzed overnight at 4°C against Tris-FtsZ buffer containing 1 mM DTT and His<sub>6</sub>-Upl1 protease at a molar ration of 100:1. The cleaved His<sub>6</sub>-SUMO tag and His<sub>6</sub>-Upl1 protease were then removed by incubation with Ni-NTA affinity agarose beads. The flow-through containing untagged FtsZ, SepH, or FtsZ<sub>Ms</sub> was then concentrated and subjected to size exclusion chromatography on a HiLoad 16/600 Superdex 200 pg column (GE Healthcare) in Tris-FtsZ buffer. Peak protein fractions were pooled and dialyzed overnight against HEPES-FtsZ buffer (50 mM HEPES pH 7.2, 50 mM KCl, and 10% glycerol) and subsequently stored at −80°C until further use.</p><p>To purify <italic>M. smegmatis</italic> SepH<sub>Ms</sub>-His<sub>6</sub> (SepH<sub>Ms</sub>), <italic>E. coli</italic> Rossetta (DE3) carrying the plasmid pSS561 was induced for protein overexpression and cell lysis was carried out as described above. SepH<sub>Ms</sub>-His<sub>6</sub> was purified from lysates using an HisTrap column in ÄKTA pure (GE Healthcare) and eluted using an increasing concentration of imidazole. Fractions containing the protein were pooled and dialyzed overnight against HEPES-FtsZ buffer (50 mM HEPES pH 7.2, 50 mM KCl, and 10% glycerol) and stored at −80°C until use.</p></sec><sec id="s4-12"><title>Antibody production</title><p>To produce antibodies against FtsZ and SepH from <italic>Streptomyces</italic>, untagged FtsZ and SepH-His<sub>6</sub> were overexpressed and purified as described above, and a total amount of 2 mg of purified protein was sent to Cambridge Research Biochemicals (UK) to be used to raise antibodies in rabbits.</p></sec><sec id="s4-13"><title>Analytical gel filtration chromatography</title><p>Purified SepH, SepH-NTD, SepH-CTD, or SepHG79P was prepared at 30 µM in buffer P (50 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>). A 500 µL sample was subjected to size exclusion chromatography on a Superose 12 10/300 GL column (GE Healthcare) in buffer P using an ÄKTA pure (GE Healthcare) at 0.25 mL min<sup>−1</sup> constant flow. Gel filtration standards (Bio-Rad) included thyroglobulin (MW 670,000), γ-globuline (MW 158,000), ovalbumin (MW 44,000), myoglobin (MW 17,000), and vitamin B12 (MW 1,350). Standards were separated using the same conditions described above, and the retention volume of each of the proteins was plotted against Log MW. The standard curve was used to calculate the molecular weight of SepH using the retention volume previously obtained. The same procedure described above was carried out for SepH<sub>Ms</sub> but using a modified buffer P (50 mM HEPES pH 6.8, 100 mM KCl, 5 mM MgCl<sub>2</sub>).</p></sec><sec id="s4-14"><title>GTPase activity assay</title><p>FtsZ GTPase activity was monitored using the PiColorLock Gold kit (Expedeon), a malachite-green-based assay. SepH and FtsZ were diluted to the desired concentration in buffer P (50 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>). The protein solution was incubated for 10 min at 30°C and the reaction was started by adding 50 µM GTP. Samples were taken at 0, 2.5, 5, 7.5, and 10 min. Reactions were stopped by adding an equal volume of 0.6 M perchloric acid. Absorbance at 620 nm was measured and plotted using Microsoft Excel. GTPase activity was determined from the linear range of the curves (<xref ref-type="bibr" rid="bib54">Wasserstrom et al., 2013</xref>). GTPase activity assays for <italic>M. smegmatis</italic> FtsZ<sub>Ms</sub> and SepH<sub>Ms</sub> were performed as described above but using a modified buffer P (50 mM HEPES pH 6.8, 100 mM KCl, 5 mM MgCl<sub>2</sub>) and incubating the protein solutions at 37°C. Samples were taken at 0, 5, 10, 15, and 20 min and data was analyzed as described above.</p><p>To determine the critical concentration, the GTPase activity was determined for several FtsZ concentrations (4.5, 3.5, 2.5, and 2 µM) in the absence or presence of 0.6 µM SepH. To accommodate for the number of samples and higher FtsZ concentrations, reactions volumes were reduced to accommodate measurements using 96-well plates and samples were taken every 1.5 min instead of 2.5 min as described above. Each reaction was performed in duplicate. A linear regression was calculated for the GTPase rate with and without SepH to determine the value of the X-intercept (the critical concentration).</p></sec><sec id="s4-15"><title>Dynamic light scattering</title><p>FtsZ assembly was monitored using a Wyatt Dynapro Titan Dynamic Light Scattering (DLS) instrument. All components of the reaction buffer were filtered using 0.1 µm centrifugal filter units (Millipore). <italic>S. venezuelae</italic> FtsZ (3.5 µM) was prepared in buffer P (50 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>) and SepH was added at the desired concentrations when required. 15 µL of the resulting protein solution was transferred to a quartz cuvette and equilibrated to 30°C for 5 min in the DLS instrument and the laser intensity adjusted until readings reached ~20,000 counts. Baseline readings were taken for 5 min, GTP (50 µM or 2 mM) was added, and light scatter readings were recorded for up to 25 min. The same protocol was followed in the case of GDP or GMPCCP. Data were visualized using Dynamics software (v6), transferred to an Excel file, and plotted using GraphPad Prism. <italic>M. smegmatis</italic> FtsZ<sub>Ms</sub> (6 µM) was prepared in modified buffer P (50 mM HEPES pH 6.8, 100 mM KCl, 5 mM MgCl<sub>2</sub>) in the presence or absence of SepH<sub>Ms</sub> (3 µM). All DLS measurements with <italic>M. smegmatis</italic> proteins were performed at 37°C, baseline readings were first monitored for 5 min, followed by the addition of 2 mM GTP and the recording of the scatter profile for up to 35 min. Data was analyzed as described above.</p></sec><sec id="s4-16"><title>CD spectroscopy</title><p>SepH or SepHG79P (3.5 µM) were dialyzed overnight against phosphate buffer pH 7.2 to dilute the sodium ions in preparation for CD analysis. Spectra were recorded in 1 nm steps on a Chirascan Plus spectrophotometer (Applied Photophysics) at 20°C in a 0.5 mm quartz cuvette (Hellma). Measurements were collected in triplicate, averaged, and background subtracted with matched buffer using the Chirascan software package. Data were exported to an Excel file and plotted using GraphPad Prism.</p></sec><sec id="s4-17"><title>Sedimentation assay</title><p>FtsZ (3.5 µM) and/or SepH (0.6 µM) were prepared in buffer P (50 mM HEPES pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>). Reactions were incubated at 30°C for 10 min and polymerization was started by adding GTP (2 mM) or GMPCCP (1 mM). Samples were incubated for an additional 15 min at 30°C and then pelleted by ultracentrifugation at 350,000× g for 15 min (high-speed), or at 25,000× g for 30 min (low-speed). Supernatant and pellet fractions were mixed with equivalent volumes of SDS sample buffer. Proteins were visualized by SDS-PAGE and Coomassie staining and protein bands were quantified using Fiji (<xref ref-type="bibr" rid="bib44">Schindelin et al., 2012</xref>).</p><p>For <italic>M. smegmatis</italic> proteins, FtsZ<sub>Ms</sub> (6 µM) and/or SepH<sub>Ms</sub> (3 µM) were prepared in modified buffer P (50 mM HEPES pH 6.8, 100 mM KCl, 5 mM MgCl<sub>2</sub>). Reactions were incubated at 37°C for 10 min, started by adding 2 mM GTP final concentration, incubated for an additional 20 min followed by ultracentrifugation and SDS-PAGE analysis as described above.</p></sec><sec id="s4-18"><title>Chromatin immunoprecipitation and deep-sequencing</title><p>WT <italic>S. venezuelae</italic> and the <italic>ΔsepH</italic> mutant (SV56) were grown in four 30 mL volumes of MYM medium for 18 hr (sporulation). Cross-linking and immunoprecipitation were conducted as described by <xref ref-type="bibr" rid="bib9">Bush et al., 2019</xref> using the anti-SepH polyclonal antibody. Library construction and sequencing were performed by Genewiz (NJ, USA), using Illumina Hiseq (2 × 150 bp configuration, trimmed to 100 bp).</p><p>Reads in the fastq files received from the sequencing contractor were aligned to the <italic>S. venezuelae</italic> genome (GenBank accession number CP018074) using the bowtie2 (2) software (version 2.2.9), which resulted in one SAM (.sam) file for each pair of fastq files (paired-end sequencing). For each SAM file, the depth command of samtools (version 1.8) was used to arrive at the depth of sequencing at each nucleotide position of the <italic>S. venezuelae</italic> chromosome (<ext-link ext-link-type="uri" xlink:href="https://www.sanger.ac.uk/">https://www.sanger.ac.uk/</ext-link>science/tools/samtools-bcftools-htslib). From the sequencing depths at each nucleotide position determined in 2, a local enrichment was calculated in a moving window of 30 nucleotides moving in steps of 15 nucleotides as (the mean depth at each nucleotide position in the 30-nt window) divided by (the mean depth at each nucleotide position in a 3000-nucleotide window cantered around the 30-nucleotide window). This results in an enrichment ratio value for every 15 nucleotides along the genome. The enrichment ratios thus calculated were stored in files in the bedgraph format and were used for viewing in IGB. After ensuring good correlation between the replicates (Spearman correlation coefficient &gt;0.95) the mean of the replicates was calculated and used in further calculations. Enrichment in the control was subtracted from the enrichment in the WT files. Significance of enrichment was calculated assuming normal distribution of the control-subtracted enrichment values. The SepH ChIP-seq data has been deposited at the MIAME-compliant ArrayExpress database (<ext-link ext-link-type="uri" xlink:href="https://www.ebi.ac.uk/arrayexpress/">https://www.ebi.ac.uk/arrayexpress/</ext-link>) under accession number E-MTAB-9064.</p></sec><sec id="s4-19"><title>DNase I footprinting</title><p>DNase I footprinting experiments were carried out essentially as previously described (<xref ref-type="bibr" rid="bib6">Bush et al., 2013</xref>) and according to the manufacturer’s instructions (Sure Track footprinting kit, Amersham Pharmacia Biotech). DNA fragments from the promoter regions of <italic>vnz35870, vnz30075</italic>, and <italic>vnz07520</italic> were amplified by PCR from the PL1_M15, PL1_G3 and PL1_E16 cosmids, using the primer pairs mb1136/mb1129, mb1138/mb1139, and mb1140/mb1133, respectively. Oligonucleotides were first end-labeled with T4 polynucleotide kinase (Amersham Pharmacia Biotech) and [γ-<sup>32</sup>P]-ATP as described by the manufacturer. Binding reactions were carried out at room temperature for 30 min in 1× Polymerization Buffer (50 mM HEPES/KOH pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>) in a total volume of 40 µL, and in the presence of approximately 50,000–75,000 cpm of the DNA probe. Following incubation, 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl<sub>2</sub> was added, mixed, and incubated for 1 min. The reaction was stopped by addition of 140 μL stop solution [192 mM NaAc, 32 mM EDTA, 0.14% SDS, 70 μg yeast-tRNA (Invitrogen)]. Samples were then phenol–chloroform extracted prior to ethanol (96%) precipitation. The pellet was vacuum-dried and resuspended in 5 μL of formamide loading dye (95% formamide, 20 mM EDTA pH 8.0, 0.1% bromophenol blue, 0.1% xylene cyanol FF). 2.5 μL of each sample was loaded on a 6% sequencing gel, next to a G+A ladder, prepared according to the Sure Track footprinting kit (Amersham Pharmacia Biotech). The gel was then vacuum-dried before imaging using image plates, visualized using the FUJIFILM FLA-7000.</p></sec><sec id="s4-20"><title>Electrophoretic mobility shift assay</title><p>DNA sequences were amplified by PCR using the primer pairs mb1136/mb1129, mb1124/mb1125, and mb1126/mb1127 and the templates PL1_M15, SV-4-G01, and pCOLADuet-1 respectively. This generated probes to test for potential binding of SepH to the promoter region of <italic>vnz35870</italic>, a sequence internal to <italic>vnz08520</italic> (<italic>ftsZ</italic>) and a low-GC sequence from the vector <italic>kan<sup>R</sup>-</italic>gene (<italic>aphII</italic>). Binding reactions were carried out at room temperature for 30 min in 1× polymerization buffer (50 mM HEPES/KOH pH 7.2, 50 mM KCl, 5 mM MgCl<sub>2</sub>) in a total volume of 20 µL, and in the presence of 50 ng of the DNA probe. Following the incubation step, samples were run on pre-cast Mini-PROTEAN TBE gels (Bio-Rad 456–5014) in 0.5× TBE for 60–90 min alongside 100 bp ladder (NEB). Gels were stained for 30 min in ethidium bromide solution before imaging under UV-light.</p></sec><sec id="s4-21"><title>Phylogenetics analysis</title><p>The SepH sequence from <italic>Streptomyces venezuelae</italic> (<italic>vnz_27360</italic>) was used to BLAST against 3962 representative bacterial species (<xref ref-type="bibr" rid="bib2">Altschul et al., 1997</xref>; <xref ref-type="bibr" rid="bib1">Altschul et al., 1990</xref>; <xref ref-type="bibr" rid="bib11">Camacho et al., 2009</xref>). After reciprocal BLAST analysis and quality filtering, 626 actinobacterial SepH homologs were identified. The 626 sequences were clustered to remove redundancies using CD-HIT at 90% similarity and then clustered again at 75% similarity to reduce the likelihood of misclustering (<xref ref-type="bibr" rid="bib31">Li and Godzik, 2006</xref>). These representative homologs (360 sequences) were used to create three separate sequence alignments using CLUSTALX (<xref ref-type="bibr" rid="bib28">Larkin et al., 2007</xref>), MUSCLE (<xref ref-type="bibr" rid="bib16">Edgar, 2004a</xref>; <xref ref-type="bibr" rid="bib17">Edgar, 2004b</xref>), and MAFFT, using the l-ins-I option (<xref ref-type="bibr" rid="bib25">Katoh and Standley, 2014</xref>). TrimAl was used to compare the alignments for consistency, at which point the most consistent (CLUSTAL) was used and gaps that were present in 80% or more of sequences were trimmed out (<xref ref-type="bibr" rid="bib13">Capella-Gutiérrez et al., 2009</xref>). This alignment was used to generate a tree in PHYML (<xref ref-type="bibr" rid="bib22">Guindon et al., 2010</xref>) using the model, LG +G, as selected by SMS (<xref ref-type="bibr" rid="bib29">Lefort et al., 2017</xref>). The tree was visualized using iTOL, the Interactive Tree of Life (<xref ref-type="bibr" rid="bib30">Letunic and Bork, 2019</xref>). Additionally, the alignment was used to generate a logo using WebLogo3 (<xref ref-type="bibr" rid="bib14">Crooks et al., 2004</xref>).</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We would like to thank Kelley Gallagher for helpful discussions on the phylogenetic analysis and Clare Stevenson and Julia Mundy for excellent technical assistance. We thank the JIC Bioimaging facility and staff for technical support and in particular Sergio Lopez for help with image analysis. Work in the lab of JRM was supported by the National Institutes of Health grant GM096268. We gratefully acknowledge funding by the Royal Society (URF\R1\180075) and the BBSRC (BB/T015349/1) to SS and for support by the BBSRC Institute Strategic Program grant BBS/E/J000PR9791 to the John Innes Centre.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Data curation, Formal analysis, Validation, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con4"><p>Data curation, Software, Formal analysis</p></fn><fn fn-type="con" id="con5"><p>Methodology</p></fn><fn fn-type="con" id="con6"><p>Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con7"><p>Conceptualization, Writing - review and editing</p></fn><fn fn-type="con" id="con8"><p>Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>Tables listing bacterial strains, plasmids, and oligonucleotides used in this study.</title></caption><media mime-subtype="docx" mimetype="application" xlink:href="elife-63387-supp1-v1.docx"/></supplementary-material><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="docx" mimetype="application" xlink:href="elife-63387-transrepform-v1.docx"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>ChIP-seq data generated in this study has has been depositited to ArrayExpress database under accession number E-MTAB-9064. All other data genearted or analyzed during this study is included in the manuscript and supporting files. Where considered appropiate, soure data has been uploaded to eLife.</p><p>The following dataset was generated:</p><p><element-citation id="dataset1" publication-type="data" specific-use="isSupplementedBy"><person-group person-group-type="author"><name><surname>Ramos-Leon</surname><given-names>F</given-names></name><name><surname>Bush</surname><given-names>MJ</given-names></name><name><surname>Sallmen</surname><given-names>JW</given-names></name><name><surname>Chandra</surname><given-names>G</given-names></name><name><surname>Richards</surname><given-names>J</given-names></name><name><surname>Findlay</surname><given-names>KC</given-names></name><name><surname>McCormick</surname><given-names>JR</given-names></name><name><surname>Schlimpert</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2020">2020</year><data-title>A conserved cell division protein directly regulates FtsZ dynamics in filamentous and unicellular actinobacteria</data-title><source>ArrayExpress</source><pub-id assigning-authority="EBI" pub-id-type="accession" xlink:href="https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-9064/">E-MTAB-9064</pub-id></element-citation></p><p>The following previously published dataset was used:</p><p><element-citation id="dataset2" publication-type="data" specific-use="references"><person-group person-group-type="author"><name><surname>Bush</surname><given-names>MJ</given-names></name><name><surname>Bibb</surname><given-names>MJ</given-names></name><name><surname>Chandra</surname><given-names>G</given-names></name><name><surname>Findlay</surname><given-names>KC</given-names></name><name><surname>Buttner</surname><given-names>MJ</given-names></name></person-group><year iso-8601-date="2013">2013</year><data-title>Genes required for aerial growth, cell division, and chromosome segregation are targets of WhiA before sporulation in Streptomyces venezuelae</data-title><source>ArrayExpress</source><pub-id assigning-authority="EBI" pub-id-type="accession" xlink:href="https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-4673/">E-MTAB-4673</pub-id></element-citation></p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Altschul</surname> <given-names>SF</given-names></name><name><surname>Gish</surname> <given-names>W</given-names></name><name><surname>Miller</surname> <given-names>W</given-names></name><name><surname>Myers</surname> <given-names>EW</given-names></name><name><surname>Lipman</surname> <given-names>DJ</given-names></name></person-group><year iso-8601-date="1990">1990</year><article-title>Basic local alignment search tool</article-title><source>Journal of Molecular Biology</source><volume>215</volume><fpage>403</fpage><lpage>410</lpage><pub-id pub-id-type="doi">10.1016/S0022-2836(05)80360-2</pub-id><pub-id pub-id-type="pmid">2231712</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Altschul</surname> <given-names>SF</given-names></name><name><surname>Madden</surname> <given-names>TL</given-names></name><name><surname>Schäffer</surname> <given-names>AA</given-names></name><name><surname>Zhang</surname> <given-names>J</given-names></name><name><surname>Zhang</surname> <given-names>Z</given-names></name><name><surname>Miller</surname> <given-names>W</given-names></name><name><surname>Lipman</surname> <given-names>DJ</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>Gapped BLAST and PSI-BLAST: a new generation of protein database search programs</article-title><source>Nucleic Acids Research</source><volume>25</volume><fpage>3389</fpage><lpage>3402</lpage><pub-id pub-id-type="doi">10.1093/nar/25.17.3389</pub-id><pub-id pub-id-type="pmid">9254694</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aravind</surname> <given-names>L</given-names></name><name><surname>Anantharaman</surname> <given-names>V</given-names></name><name><surname>Balaji</surname> <given-names>S</given-names></name><name><surname>Babu</surname> <given-names>MM</given-names></name><name><surname>Iyer</surname> <given-names>LM</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>The many faces of the helix-turn-helix domain: transcription regulation and beyond</article-title><source>FEMS Microbiology Reviews</source><volume>29</volume><fpage>231</fpage><lpage>262</lpage><pub-id pub-id-type="doi">10.1016/j.femsre.2004.12.008</pub-id><pub-id pub-id-type="pmid">15808743</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barka</surname> <given-names>EA</given-names></name><name><surname>Vatsa</surname> <given-names>P</given-names></name><name><surname>Sanchez</surname> <given-names>L</given-names></name><name><surname>Gaveau-Vaillant</surname> <given-names>N</given-names></name><name><surname>Jacquard</surname> <given-names>C</given-names></name><name><surname>Meier-Kolthoff</surname> <given-names>JP</given-names></name><name><surname>Klenk</surname> <given-names>HP</given-names></name><name><surname>Clément</surname> <given-names>C</given-names></name><name><surname>Ouhdouch</surname> <given-names>Y</given-names></name><name><surname>van Wezel</surname> <given-names>GP</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Taxonomy, physiology, and natural products of actinobacteria</article-title><source>Microbiology and Molecular Biology Reviews</source><volume>80</volume><fpage>1</fpage><lpage>43</lpage><pub-id pub-id-type="doi">10.1128/MMBR.00019-15</pub-id><pub-id pub-id-type="pmid">26609051</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bisson-Filho</surname> <given-names>AW</given-names></name><name><surname>Hsu</surname> <given-names>YP</given-names></name><name><surname>Squyres</surname> <given-names>GR</given-names></name><name><surname>Kuru</surname> <given-names>E</given-names></name><name><surname>Wu</surname> <given-names>F</given-names></name><name><surname>Jukes</surname> <given-names>C</given-names></name><name><surname>Sun</surname> <given-names>Y</given-names></name><name><surname>Dekker</surname> <given-names>C</given-names></name><name><surname>Holden</surname> <given-names>S</given-names></name><name><surname>Van Nieuwenhze</surname> <given-names>MS</given-names></name><name><surname>Brun</surname> <given-names>YV</given-names></name><name><surname>Garner</surname> <given-names>EC</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Treadmilling by FtsZ filaments drives peptidoglycan synthesis and bacterial cell division</article-title><source>Science</source><volume>355</volume><fpage>739</fpage><lpage>743</lpage><pub-id pub-id-type="doi">10.1126/science.aak9973</pub-id><pub-id pub-id-type="pmid">28209898</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bush</surname> <given-names>MJ</given-names></name><name><surname>Bibb</surname> <given-names>MJ</given-names></name><name><surname>Chandra</surname> <given-names>G</given-names></name><name><surname>Findlay</surname> <given-names>KC</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Genes required for aerial growth, cell division, and chromosome segregation are targets of WhiA before sporulation in <italic>Streptomyces venezuelae</italic></article-title><source>mBio</source><volume>4</volume><elocation-id>e00684-13</elocation-id><pub-id pub-id-type="doi">10.1128/mBio.00684-13</pub-id><pub-id pub-id-type="pmid">24065632</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bush</surname> <given-names>MJ</given-names></name><name><surname>Tschowri</surname> <given-names>N</given-names></name><name><surname>Schlimpert</surname> <given-names>S</given-names></name><name><surname>Flärdh</surname> <given-names>K</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>c-di-GMP signalling and the regulation of developmental transitions in streptomycetes</article-title><source>Nature Reviews Microbiology</source><volume>13</volume><fpage>749</fpage><lpage>760</lpage><pub-id pub-id-type="doi">10.1038/nrmicro3546</pub-id><pub-id pub-id-type="pmid">26499894</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bush</surname> <given-names>MJ</given-names></name><name><surname>Chandra</surname> <given-names>G</given-names></name><name><surname>Bibb</surname> <given-names>MJ</given-names></name><name><surname>Findlay</surname> <given-names>KC</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Genome-Wide chromatin immunoprecipitation sequencing analysis shows that WhiB is a transcription factor that cocontrols its regulon with WhiA to initiate developmental cell division in <italic>Streptomyces</italic></article-title><source>mBio</source><volume>7</volume><elocation-id>e00523</elocation-id><pub-id pub-id-type="doi">10.1128/mBio.00523-16</pub-id><pub-id pub-id-type="pmid">27094333</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bush</surname> <given-names>MJ</given-names></name><name><surname>Chandra</surname> <given-names>G</given-names></name><name><surname>Al-Bassam</surname> <given-names>MM</given-names></name><name><surname>Findlay</surname> <given-names>KC</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>BldC delays entry into development to produce a sustained period of vegetative growth in <italic>Streptomyces venezuelae</italic></article-title><source>mBio</source><volume>10</volume><elocation-id>e02812-18</elocation-id><pub-id pub-id-type="doi">10.1128/mBio.02812-18</pub-id><pub-id pub-id-type="pmid">30723132</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Caldas</surname> <given-names>P</given-names></name><name><surname>López-Pelegrín</surname> <given-names>M</given-names></name><name><surname>Pearce</surname> <given-names>DJG</given-names></name><name><surname>Budanur</surname> <given-names>NB</given-names></name><name><surname>Brugués</surname> <given-names>J</given-names></name><name><surname>Loose</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Cooperative ordering of treadmilling filaments in cytoskeletal networks of FtsZ and its crosslinker ZapA</article-title><source>Nature Communications</source><volume>10</volume><elocation-id>5744</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-019-13702-4</pub-id><pub-id pub-id-type="pmid">31848350</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Camacho</surname> <given-names>C</given-names></name><name><surname>Coulouris</surname> <given-names>G</given-names></name><name><surname>Avagyan</surname> <given-names>V</given-names></name><name><surname>Ma</surname> <given-names>N</given-names></name><name><surname>Papadopoulos</surname> <given-names>J</given-names></name><name><surname>Bealer</surname> <given-names>K</given-names></name><name><surname>Madden</surname> <given-names>TL</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>BLAST+: architecture and applications</article-title><source>BMC Bioinformatics</source><volume>10</volume><elocation-id>421</elocation-id><pub-id pub-id-type="doi">10.1186/1471-2105-10-421</pub-id><pub-id pub-id-type="pmid">20003500</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cantlay</surname> <given-names>S</given-names></name><name><surname>Sen</surname> <given-names>BC</given-names></name><name><surname>Flärdh</surname> <given-names>K</given-names></name><name><surname>McCormick</surname> <given-names>JR</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Influence of core divisome proteins on cell division in <italic>Streptomyces venezuelae</italic> ATCC 10712</article-title><source>Microbiology</source><volume>167</volume><elocation-id>e001015</elocation-id><pub-id pub-id-type="doi">10.1099/mic.0.001015</pub-id><pub-id pub-id-type="pmid">33400639</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Capella-Gutiérrez</surname> <given-names>S</given-names></name><name><surname>Silla-Martínez</surname> <given-names>JM</given-names></name><name><surname>Gabaldón</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses</article-title><source>Bioinformatics</source><volume>25</volume><fpage>1972</fpage><lpage>1973</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btp348</pub-id><pub-id pub-id-type="pmid">19505945</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Crooks</surname> <given-names>GE</given-names></name><name><surname>Hon</surname> <given-names>G</given-names></name><name><surname>Chandonia</surname> <given-names>JM</given-names></name><name><surname>Brenner</surname> <given-names>SE</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>WebLogo: a sequence logo generator</article-title><source>Genome Research</source><volume>14</volume><fpage>1188</fpage><lpage>1190</lpage><pub-id pub-id-type="doi">10.1101/gr.849004</pub-id><pub-id pub-id-type="pmid">15173120</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ducret</surname> <given-names>A</given-names></name><name><surname>Quardokus</surname> <given-names>EM</given-names></name><name><surname>Brun</surname> <given-names>YV</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>MicrobeJ, a tool for high throughput bacterial cell detection and quantitative analysis</article-title><source>Nature Microbiology</source><volume>1</volume><elocation-id>16077</elocation-id><pub-id pub-id-type="doi">10.1038/nmicrobiol.2016.77</pub-id><pub-id pub-id-type="pmid">27572972</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edgar</surname> <given-names>RC</given-names></name></person-group><year iso-8601-date="2004">2004a</year><article-title>MUSCLE: multiple sequence alignment with high accuracy and high throughput</article-title><source>Nucleic Acids Research</source><volume>32</volume><fpage>1792</fpage><lpage>1797</lpage><pub-id pub-id-type="doi">10.1093/nar/gkh340</pub-id><pub-id pub-id-type="pmid">15034147</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edgar</surname> <given-names>RC</given-names></name></person-group><year iso-8601-date="2004">2004b</year><article-title>MUSCLE: a multiple sequence alignment method with reduced time and space complexity</article-title><source>BMC Bioinformatics</source><volume>5</volume><elocation-id>113</elocation-id><pub-id pub-id-type="doi">10.1186/1471-2105-5-113</pub-id><pub-id pub-id-type="pmid">15318951</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Eswara</surname> <given-names>PJ</given-names></name><name><surname>Brzozowski</surname> <given-names>RS</given-names></name><name><surname>Viola</surname> <given-names>MG</given-names></name><name><surname>Graham</surname> <given-names>G</given-names></name><name><surname>Spanoudis</surname> <given-names>C</given-names></name><name><surname>Trebino</surname> <given-names>C</given-names></name><name><surname>Jha</surname> <given-names>J</given-names></name><name><surname>Aubee</surname> <given-names>JI</given-names></name><name><surname>Thompson</surname> <given-names>KM</given-names></name><name><surname>Camberg</surname> <given-names>JL</given-names></name><name><surname>Ramamurthi</surname> <given-names>KS</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>An essential <italic>Staphylococcus aureus</italic> cell division protein directly regulates FtsZ dynamics</article-title><source>eLife</source><volume>7</volume><elocation-id>e38856</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.38856</pub-id><pub-id pub-id-type="pmid">30277210</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gao</surname> <given-names>B</given-names></name><name><surname>Paramanathan</surname> <given-names>R</given-names></name><name><surname>Gupta</surname> <given-names>RS</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Signature proteins that are distinctive characteristics of actinobacteria and their subgroups</article-title><source>Antonie Van Leeuwenhoek</source><volume>90</volume><fpage>69</fpage><lpage>91</lpage><pub-id pub-id-type="doi">10.1007/s10482-006-9061-2</pub-id><pub-id pub-id-type="pmid">16670965</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>García-Soriano</surname> <given-names>DA</given-names></name><name><surname>Heermann</surname> <given-names>T</given-names></name><name><surname>Raso</surname> <given-names>A</given-names></name><name><surname>Rivas</surname> <given-names>G</given-names></name><name><surname>Schwille</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>The speed of FtsZ treadmilling is tightly regulated by membrane binding</article-title><source>Scientific Reports</source><volume>10</volume><elocation-id>10447</elocation-id><pub-id pub-id-type="doi">10.1038/s41598-020-67224-x</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Griffin</surname> <given-names>JE</given-names></name><name><surname>Gawronski</surname> <given-names>JD</given-names></name><name><surname>Dejesus</surname> <given-names>MA</given-names></name><name><surname>Ioerger</surname> <given-names>TR</given-names></name><name><surname>Akerley</surname> <given-names>BJ</given-names></name><name><surname>Sassetti</surname> <given-names>CM</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism</article-title><source>PLOS Pathogens</source><volume>7</volume><elocation-id>e1002251</elocation-id><pub-id pub-id-type="doi">10.1371/journal.ppat.1002251</pub-id><pub-id pub-id-type="pmid">21980284</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guindon</surname> <given-names>S</given-names></name><name><surname>Dufayard</surname> <given-names>JF</given-names></name><name><surname>Lefort</surname> <given-names>V</given-names></name><name><surname>Anisimova</surname> <given-names>M</given-names></name><name><surname>Hordijk</surname> <given-names>W</given-names></name><name><surname>Gascuel</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0</article-title><source>Systematic Biology</source><volume>59</volume><fpage>307</fpage><lpage>321</lpage><pub-id pub-id-type="doi">10.1093/sysbio/syq010</pub-id><pub-id pub-id-type="pmid">20525638</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gust</surname> <given-names>B</given-names></name><name><surname>Challis</surname> <given-names>GL</given-names></name><name><surname>Fowler</surname> <given-names>K</given-names></name><name><surname>Kieser</surname> <given-names>T</given-names></name><name><surname>Chater</surname> <given-names>KF</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>PCR-targeted <italic>Streptomyces</italic> gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin</article-title><source>PNAS</source><volume>100</volume><fpage>1541</fpage><lpage>1546</lpage><pub-id pub-id-type="doi">10.1073/pnas.0337542100</pub-id><pub-id pub-id-type="pmid">12563033</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gust</surname> <given-names>B</given-names></name><name><surname>Chandra</surname> <given-names>G</given-names></name><name><surname>Jakimowicz</surname> <given-names>D</given-names></name><name><surname>Yuqing</surname> <given-names>T</given-names></name><name><surname>Bruton</surname> <given-names>CJ</given-names></name><name><surname>Chater</surname> <given-names>KF</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Lambda red-mediated genetic manipulation of antibiotic-producing <italic>Streptomyces</italic></article-title><source>Advances in Applied Microbiology</source><volume>54</volume><fpage>107</fpage><lpage>128</lpage><pub-id pub-id-type="doi">10.1016/S0065-2164(04)54004-2</pub-id><pub-id pub-id-type="pmid">15251278</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Katoh</surname> <given-names>K</given-names></name><name><surname>Standley</surname> <given-names>DM</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>MAFFT: iterative refinement and additional methods</article-title><source>Methods in Molecular Biology</source><volume>1079</volume><fpage>131</fpage><lpage>146</lpage><pub-id pub-id-type="doi">10.1007/978-1-62703-646-7_8</pub-id><pub-id pub-id-type="pmid">24170399</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Kieser</surname> <given-names>T</given-names></name><name><surname>Bibb</surname> <given-names>MJ</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name><name><surname>Chater</surname> <given-names>KF</given-names></name><name><surname>Hopwood</surname> <given-names>DA</given-names></name></person-group><year iso-8601-date="2000">2000</year><source>Practical Streptomyces Genetics</source><publisher-name>John Innes Foundation</publisher-name></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kuru</surname> <given-names>E</given-names></name><name><surname>Tekkam</surname> <given-names>S</given-names></name><name><surname>Hall</surname> <given-names>E</given-names></name><name><surname>Brun</surname> <given-names>YV</given-names></name><name><surname>Van Nieuwenhze</surname> <given-names>MS</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Synthesis of fluorescent D-amino acids and their use for probing peptidoglycan synthesis and bacterial growth in situ</article-title><source>Nature Protocols</source><volume>10</volume><fpage>33</fpage><lpage>52</lpage><pub-id pub-id-type="doi">10.1038/nprot.2014.197</pub-id><pub-id pub-id-type="pmid">25474031</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Larkin</surname> <given-names>MA</given-names></name><name><surname>Blackshields</surname> <given-names>G</given-names></name><name><surname>Brown</surname> <given-names>NP</given-names></name><name><surname>Chenna</surname> <given-names>R</given-names></name><name><surname>McGettigan</surname> <given-names>PA</given-names></name><name><surname>McWilliam</surname> <given-names>H</given-names></name><name><surname>Valentin</surname> <given-names>F</given-names></name><name><surname>Wallace</surname> <given-names>IM</given-names></name><name><surname>Wilm</surname> <given-names>A</given-names></name><name><surname>Lopez</surname> <given-names>R</given-names></name><name><surname>Thompson</surname> <given-names>JD</given-names></name><name><surname>Gibson</surname> <given-names>TJ</given-names></name><name><surname>Higgins</surname> <given-names>DG</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Clustal W and clustal X version 2.0</article-title><source>Bioinformatics</source><volume>23</volume><fpage>2947</fpage><lpage>2948</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btm404</pub-id><pub-id pub-id-type="pmid">17846036</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lefort</surname> <given-names>V</given-names></name><name><surname>Longueville</surname> <given-names>JE</given-names></name><name><surname>Gascuel</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>SMS: smart model selection in PhyML</article-title><source>Molecular Biology and Evolution</source><volume>34</volume><fpage>2422</fpage><lpage>2424</lpage><pub-id pub-id-type="doi">10.1093/molbev/msx149</pub-id><pub-id pub-id-type="pmid">28472384</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Letunic</surname> <given-names>I</given-names></name><name><surname>Bork</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Interactive tree of life (iTOL) v4: recent updates and new developments</article-title><source>Nucleic Acids Research</source><volume>47</volume><fpage>W256</fpage><lpage>W259</lpage><pub-id pub-id-type="doi">10.1093/nar/gkz239</pub-id><pub-id pub-id-type="pmid">30931475</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>W</given-names></name><name><surname>Godzik</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences</article-title><source>Bioinformatics</source><volume>22</volume><fpage>1658</fpage><lpage>1659</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btl158</pub-id><pub-id pub-id-type="pmid">16731699</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Loose</surname> <given-names>M</given-names></name><name><surname>Mitchison</surname> <given-names>TJ</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>The bacterial cell division proteins FtsA and FtsZ self-organize into dynamic cytoskeletal patterns</article-title><source>Nature Cell Biology</source><volume>16</volume><fpage>38</fpage><lpage>46</lpage><pub-id pub-id-type="doi">10.1038/ncb2885</pub-id><pub-id pub-id-type="pmid">24316672</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Low</surname> <given-names>HH</given-names></name><name><surname>Moncrieffe</surname> <given-names>MC</given-names></name><name><surname>Löwe</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>The crystal structure of ZapA and its modulation of FtsZ polymerisation</article-title><source>Journal of Molecular Biology</source><volume>341</volume><fpage>839</fpage><lpage>852</lpage><pub-id pub-id-type="doi">10.1016/j.jmb.2004.05.031</pub-id><pub-id pub-id-type="pmid">15288790</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McCormick</surname> <given-names>JR</given-names></name><name><surname>Su</surname> <given-names>EP</given-names></name><name><surname>Driks</surname> <given-names>A</given-names></name><name><surname>Losick</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>Growth and viability of <italic>Streptomyces coelicolor</italic> mutant for the cell division gene <italic>ftsZ</italic></article-title><source>Molecular Microbiology</source><volume>14</volume><fpage>243</fpage><lpage>254</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.1994.tb01285.x</pub-id><pub-id pub-id-type="pmid">7830569</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McCormick</surname> <given-names>JR</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Cell division is dispensable but not irrelevant in <italic>Streptomyces</italic></article-title><source>Current Opinion in Microbiology</source><volume>12</volume><fpage>689</fpage><lpage>698</lpage><pub-id pub-id-type="doi">10.1016/j.mib.2009.10.004</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McQuillen</surname> <given-names>R</given-names></name><name><surname>Xiao</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Insights into the structure, function, and dynamics of the bacterial cytokinetic FtsZ-Ring</article-title><source>Annual Review of Biophysics</source><volume>49</volume><fpage>309</fpage><lpage>341</lpage><pub-id pub-id-type="doi">10.1146/annurev-biophys-121219-081703</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mercy</surname> <given-names>C</given-names></name><name><surname>Ducret</surname> <given-names>A</given-names></name><name><surname>Slager</surname> <given-names>J</given-names></name><name><surname>Lavergne</surname> <given-names>JP</given-names></name><name><surname>Freton</surname> <given-names>C</given-names></name><name><surname>Nagarajan</surname> <given-names>SN</given-names></name><name><surname>Garcia</surname> <given-names>PS</given-names></name><name><surname>Noirot-Gros</surname> <given-names>MF</given-names></name><name><surname>Dubarry</surname> <given-names>N</given-names></name><name><surname>Nourikyan</surname> <given-names>J</given-names></name><name><surname>Veening</surname> <given-names>JW</given-names></name><name><surname>Grangeasse</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>RocS drives chromosome segregation and nucleoid protection in <italic>Streptococcus pneumoniae</italic></article-title><source>Nature Microbiology</source><volume>4</volume><fpage>1661</fpage><lpage>1670</lpage><pub-id pub-id-type="doi">10.1038/s41564-019-0472-z</pub-id><pub-id pub-id-type="pmid">31182798</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Monteiro</surname> <given-names>JM</given-names></name><name><surname>Pereira</surname> <given-names>AR</given-names></name><name><surname>Reichmann</surname> <given-names>NT</given-names></name><name><surname>Saraiva</surname> <given-names>BM</given-names></name><name><surname>Fernandes</surname> <given-names>PB</given-names></name><name><surname>Veiga</surname> <given-names>H</given-names></name><name><surname>Tavares</surname> <given-names>AC</given-names></name><name><surname>Santos</surname> <given-names>M</given-names></name><name><surname>Ferreira</surname> <given-names>MT</given-names></name><name><surname>Macário</surname> <given-names>V</given-names></name><name><surname>Van Nieuwenhze</surname> <given-names>MS</given-names></name><name><surname>Filipe</surname> <given-names>SR</given-names></name><name><surname>Pinho</surname> <given-names>MG</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Peptidoglycan synthesis drives an FtsZ-treadmilling-independent step of cytokinesis</article-title><source>Nature</source><volume>554</volume><fpage>528</fpage><lpage>532</lpage><pub-id pub-id-type="doi">10.1038/nature25506</pub-id><pub-id pub-id-type="pmid">29443967</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Paget</surname> <given-names>MS</given-names></name><name><surname>Chamberlin</surname> <given-names>L</given-names></name><name><surname>Atrih</surname> <given-names>A</given-names></name><name><surname>Foster</surname> <given-names>SJ</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Evidence that the extracytoplasmic function sigma factor sigmaE is required for normal cell wall structure in <italic>Streptomyces coelicolor</italic> A3(2)</article-title><source>Journal of Bacteriology</source><volume>181</volume><fpage>204</fpage><lpage>211</lpage><pub-id pub-id-type="doi">10.1128/JB.181.1.204-211.1999</pub-id><pub-id pub-id-type="pmid">9864331</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Perez</surname> <given-names>AJ</given-names></name><name><surname>Cesbron</surname> <given-names>Y</given-names></name><name><surname>Shaw</surname> <given-names>SL</given-names></name><name><surname>Bazan Villicana</surname> <given-names>J</given-names></name><name><surname>Tsui</surname> <given-names>HT</given-names></name><name><surname>Boersma</surname> <given-names>MJ</given-names></name><name><surname>Ye</surname> <given-names>ZA</given-names></name><name><surname>Tovpeko</surname> <given-names>Y</given-names></name><name><surname>Dekker</surname> <given-names>C</given-names></name><name><surname>Holden</surname> <given-names>S</given-names></name><name><surname>Winkler</surname> <given-names>ME</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Movement dynamics of divisome proteins and PBP2x:ftsw in cells of <italic>Streptococcus pneumoniae</italic></article-title><source>PNAS</source><volume>116</volume><fpage>3211</fpage><lpage>3220</lpage><pub-id pub-id-type="doi">10.1073/pnas.1816018116</pub-id><pub-id pub-id-type="pmid">30718427</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Salerno</surname> <given-names>P</given-names></name><name><surname>Larsson</surname> <given-names>J</given-names></name><name><surname>Bucca</surname> <given-names>G</given-names></name><name><surname>Laing</surname> <given-names>E</given-names></name><name><surname>Smith</surname> <given-names>CP</given-names></name><name><surname>Flärdh</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>One of the two genes encoding nucleoid-associated HU proteins in <italic>Streptomyces coelicolor</italic> is developmentally regulated and specifically involved in spore maturation</article-title><source>Journal of Bacteriology</source><volume>191</volume><fpage>6489</fpage><lpage>6500</lpage><pub-id pub-id-type="doi">10.1128/JB.00709-09</pub-id><pub-id pub-id-type="pmid">19717607</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Santos-Beneit</surname> <given-names>F</given-names></name><name><surname>Roberts</surname> <given-names>DM</given-names></name><name><surname>Cantlay</surname> <given-names>S</given-names></name><name><surname>McCormick</surname> <given-names>JR</given-names></name><name><surname>Errington</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A mechanism for FtsZ-independent proliferation in <italic>Streptomyces</italic></article-title><source>Nature Communications</source><volume>8</volume><elocation-id>1378</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-017-01596-z</pub-id><pub-id pub-id-type="pmid">29123127</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sassetti</surname> <given-names>CM</given-names></name><name><surname>Boyd</surname> <given-names>DH</given-names></name><name><surname>Rubin</surname> <given-names>EJ</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Genes required for mycobacterial growth defined by high density mutagenesis</article-title><source>Molecular Microbiology</source><volume>48</volume><fpage>77</fpage><lpage>84</lpage><pub-id pub-id-type="doi">10.1046/j.1365-2958.2003.03425.x</pub-id><pub-id pub-id-type="pmid">12657046</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schindelin</surname> <given-names>J</given-names></name><name><surname>Arganda-Carreras</surname> <given-names>I</given-names></name><name><surname>Frise</surname> <given-names>E</given-names></name><name><surname>Kaynig</surname> <given-names>V</given-names></name><name><surname>Longair</surname> <given-names>M</given-names></name><name><surname>Pietzsch</surname> <given-names>T</given-names></name><name><surname>Preibisch</surname> <given-names>S</given-names></name><name><surname>Rueden</surname> <given-names>C</given-names></name><name><surname>Saalfeld</surname> <given-names>S</given-names></name><name><surname>Schmid</surname> <given-names>B</given-names></name><name><surname>Tinevez</surname> <given-names>JY</given-names></name><name><surname>White</surname> <given-names>DJ</given-names></name><name><surname>Hartenstein</surname> <given-names>V</given-names></name><name><surname>Eliceiri</surname> <given-names>K</given-names></name><name><surname>Tomancak</surname> <given-names>P</given-names></name><name><surname>Cardona</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Fiji: an open-source platform for biological-image analysis</article-title><source>Nature Methods</source><volume>9</volume><fpage>676</fpage><lpage>682</lpage><pub-id pub-id-type="doi">10.1038/nmeth.2019</pub-id><pub-id pub-id-type="pmid">22743772</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schlimpert</surname> <given-names>S</given-names></name><name><surname>Flärdh</surname> <given-names>K</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Fluorescence Time-lapse imaging of the complete <italic>S. venezuelae</italic> life cycle using a microfluidic device</article-title><source>Journal of Visualized Experiments</source><volume>108</volume><elocation-id>53863</elocation-id><pub-id pub-id-type="doi">10.3791/53863</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schlimpert</surname> <given-names>S</given-names></name><name><surname>Wasserstrom</surname> <given-names>S</given-names></name><name><surname>Chandra</surname> <given-names>G</given-names></name><name><surname>Bibb</surname> <given-names>MJ</given-names></name><name><surname>Findlay</surname> <given-names>KC</given-names></name><name><surname>Flärdh</surname> <given-names>K</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Two dynamin-like proteins stabilize FtsZ rings during <italic>Streptomyces</italic> sporulation</article-title><source>PNAS</source><volume>114</volume><fpage>E6176</fpage><lpage>E6183</lpage><pub-id pub-id-type="doi">10.1073/pnas.1704612114</pub-id><pub-id pub-id-type="pmid">28687675</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schwedock</surname> <given-names>J</given-names></name><name><surname>McCormick</surname> <given-names>JR</given-names></name><name><surname>Angert</surname> <given-names>ER</given-names></name><name><surname>Nodwell</surname> <given-names>JR</given-names></name><name><surname>Losick</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>Assembly of the cell division protein FtsZ into ladder-like structures in the aerial hyphae of <italic>Streptomyces coelicolor</italic></article-title><source>Molecular Microbiology</source><volume>25</volume><fpage>847</fpage><lpage>858</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.1997.mmi507.x</pub-id><pub-id pub-id-type="pmid">9364911</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sen</surname> <given-names>BC</given-names></name><name><surname>Wasserstrom</surname> <given-names>S</given-names></name><name><surname>Findlay</surname> <given-names>K</given-names></name><name><surname>Söderholm</surname> <given-names>N</given-names></name><name><surname>Sandblad</surname> <given-names>L</given-names></name><name><surname>von Wachenfeldt</surname> <given-names>C</given-names></name><name><surname>Flärdh</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Specific amino acid substitutions in β strand S2 of FtsZ cause spiraling septation and impair assembly cooperativity in <italic>Streptomyces</italic> spp</article-title><source>Molecular Microbiology</source><volume>112</volume><fpage>184</fpage><lpage>198</lpage><pub-id pub-id-type="doi">10.1111/mmi.14262</pub-id><pub-id pub-id-type="pmid">31002418</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Silber</surname> <given-names>N</given-names></name><name><surname>Mayer</surname> <given-names>C</given-names></name><name><surname>Matos de Opitz</surname> <given-names>CL</given-names></name><name><surname>Sass</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Progression of the late-stage divisome is unaffected by the depletion of the cytoplasmic FtsZ pool</article-title><source>Communications Biology</source><volume>4</volume><elocation-id>270</elocation-id><pub-id pub-id-type="doi">10.1038/s42003-021-01789-9</pub-id><pub-id pub-id-type="pmid">33649500</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="preprint"><person-group person-group-type="author"><name><surname>Squyres</surname> <given-names>GR</given-names></name><name><surname>Holmes</surname> <given-names>MJ</given-names></name><name><surname>Barger</surname> <given-names>SR</given-names></name><name><surname>Pennycook</surname> <given-names>BR</given-names></name><name><surname>Ryan</surname> <given-names>J</given-names></name><name><surname>Yan</surname> <given-names>VT</given-names></name><name><surname>Garner</surname> <given-names>EC</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Dynamics of bacterial cell division: z ring condensation is essential for cytokinesis</article-title><source>bioRxiv</source><pub-id pub-id-type="doi">10.1101/2020.06.30.180737</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stuttard</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="1982">1982</year><article-title>Temperate phages of <italic>Streptomyces venezuelae</italic>: Lysogeny and Host Specificity Shown by Phages SV1 and SV2</article-title><source>Microbiology</source><volume>128</volume><fpage>115</fpage><lpage>121</lpage><pub-id pub-id-type="doi">10.1099/00221287-128-1-115</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tschowri</surname> <given-names>N</given-names></name><name><surname>Schumacher</surname> <given-names>MA</given-names></name><name><surname>Schlimpert</surname> <given-names>S</given-names></name><name><surname>Chinnam</surname> <given-names>NB</given-names></name><name><surname>Findlay</surname> <given-names>KC</given-names></name><name><surname>Brennan</surname> <given-names>RG</given-names></name><name><surname>Buttner</surname> <given-names>MJ</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Tetrameric c-di-GMP mediates effective transcription factor dimerization to control <italic>Streptomyces</italic> development</article-title><source>Cell</source><volume>158</volume><fpage>1136</fpage><lpage>1147</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2014.07.022</pub-id><pub-id pub-id-type="pmid">25171413</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van den Ent</surname> <given-names>F</given-names></name><name><surname>Johnson</surname> <given-names>CM</given-names></name><name><surname>Persons</surname> <given-names>L</given-names></name><name><surname>de Boer</surname> <given-names>P</given-names></name><name><surname>Löwe</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Bacterial actin MreB assembles in complex with cell shape protein RodZ</article-title><source>The EMBO Journal</source><volume>29</volume><fpage>1081</fpage><lpage>1090</lpage><pub-id pub-id-type="doi">10.1038/emboj.2010.9</pub-id><pub-id pub-id-type="pmid">20168300</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wasserstrom</surname> <given-names>S</given-names></name><name><surname>Grantcharova</surname> <given-names>N</given-names></name><name><surname>Ubhayasekera</surname> <given-names>W</given-names></name><name><surname>Ausmees</surname> <given-names>N</given-names></name><name><surname>Sandblad</surname> <given-names>L</given-names></name><name><surname>Flärdh</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Non-sporulating ftsZ mutants in <italic>Streptomyces coelicolor</italic> reveal amino acid residues critical for FtsZ polymerization dynamics</article-title><source>Microbiology</source><volume>159</volume><fpage>890</fpage><lpage>901</lpage><pub-id pub-id-type="doi">10.1099/mic.0.066480-0</pub-id><pub-id pub-id-type="pmid">23475952</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>White</surname> <given-names>EL</given-names></name><name><surname>Ross</surname> <given-names>LJ</given-names></name><name><surname>Reynolds</surname> <given-names>RC</given-names></name><name><surname>Seitz</surname> <given-names>LE</given-names></name><name><surname>Moore</surname> <given-names>GD</given-names></name><name><surname>Borhani</surname> <given-names>DW</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Slow polymerization of <italic>Mycobacterium tuberculosis</italic> FtsZ</article-title><source>Journal of Bacteriology</source><volume>182</volume><fpage>4028</fpage><lpage>4034</lpage><pub-id pub-id-type="doi">10.1128/JB.182.14.4028-4034.2000</pub-id><pub-id pub-id-type="pmid">10869082</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="preprint"><person-group person-group-type="author"><name><surname>Whitley</surname> <given-names>KD</given-names></name><name><surname>Jukes</surname> <given-names>C</given-names></name><name><surname>Tregidgo</surname> <given-names>N</given-names></name><name><surname>Karinou</surname> <given-names>E</given-names></name><name><surname>Almada</surname> <given-names>P</given-names></name><name><surname>Henriques</surname> <given-names>R</given-names></name><name><surname>Dekker</surname> <given-names>C</given-names></name><name><surname>Holden</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>FtsZ treadmilling is essential for Z-ring condensation and septal constriction initiation in bacterial cell division</article-title><source>bioRxiv</source><pub-id pub-id-type="doi">10.1101/2020.07.01.182006</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Willemse</surname> <given-names>J</given-names></name><name><surname>Borst</surname> <given-names>JW</given-names></name><name><surname>de Waal</surname> <given-names>E</given-names></name><name><surname>Bisseling</surname> <given-names>T</given-names></name><name><surname>van Wezel</surname> <given-names>GP</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Positive control of cell division: ftsz is recruited by SsgB during sporulation of <italic>Streptomyces</italic></article-title><source>Genes &amp; Development</source><volume>25</volume><fpage>89</fpage><lpage>99</lpage><pub-id pub-id-type="doi">10.1101/gad.600211</pub-id><pub-id pub-id-type="pmid">21205868</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Woldemeskel</surname> <given-names>SA</given-names></name><name><surname>McQuillen</surname> <given-names>R</given-names></name><name><surname>Hessel</surname> <given-names>AM</given-names></name><name><surname>Xiao</surname> <given-names>J</given-names></name><name><surname>Goley</surname> <given-names>ED</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A conserved coiled-coil protein pair focuses the cytokinetic Z-ring in <italic>Caulobacter crescentus</italic></article-title><source>Molecular Microbiology</source><volume>105</volume><fpage>721</fpage><lpage>740</lpage><pub-id pub-id-type="doi">10.1111/mmi.13731</pub-id><pub-id pub-id-type="pmid">28613431</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname> <given-names>X</given-names></name><name><surname>Lyu</surname> <given-names>Z</given-names></name><name><surname>Miguel</surname> <given-names>A</given-names></name><name><surname>McQuillen</surname> <given-names>R</given-names></name><name><surname>Huang</surname> <given-names>KC</given-names></name><name><surname>Xiao</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>GTPase activity-coupled treadmilling of the bacterial tubulin FtsZ organizes septal cell wall synthesis</article-title><source>Science</source><volume>355</volume><fpage>744</fpage><lpage>747</lpage><pub-id pub-id-type="doi">10.1126/science.aak9995</pub-id><pub-id pub-id-type="pmid">28209899</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.63387.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Kana</surname><given-names>Bavesh D</given-names></name><role>Reviewing Editor</role><aff><institution>University of the Witwatersrand</institution><country>South Africa</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Garner</surname><given-names>Ethan C</given-names></name><role>Reviewer</role><aff><institution/></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>Bacterial cell division is an intensely studied process as inhibition thereof has potential to form the basis of new antibiotic therapies. However, in actinobacteria, a group of organisms comprising several clinically important bacterial pathogens, this process still requires further investigation. This paper reports the function of SepH in <italic>Streptomycesvenezuelae</italic>, demonstrating that it regulates the assembly of the division machinery responsible for cell constriction and ultimate separation of daughter cells. The study will be of interest to microbiologists and bacterial cell biologists who work on cell cycle and division.</p><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;A conserved cell division protein directly regulates FtsZ dynamics in filamentous and unicellular actinobacteria&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Bavesh Kana as the Senior and Reviewing Editor. The following individual involved in review of your submission has agreed to reveal their identity: Ethan C Garner (Reviewer #2).</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is &quot;in revision at <italic>eLife</italic>&quot;. Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)</p><p>Summary:</p><p>Herein, Ramos-Leon and co-workers describe the function of SepH, a highly conserved protein among the actinobacteria that is important for cell division. The model system used is <italic>Streptomycesvenezuelae</italic> (Sven). Like all <italic>Streptomyces</italic>, Sven grows as a filamentous network of cells in a mycelium and undergoes a developmental cycle in which it transitions to growth in aerial hyphae that differentiate into an array of spores. Division is not essential for the vegetative growth of Sven and other <italic>Streptomyces</italic>, but it is essential for spore formation. SepH was originally identified because it is part of the WhiA/WhiB regulon that controls sporulation.</p><p>Key findings:</p><p>1) Inactivation of SepH results in aberrant spore formation, with the spores being irregularly sized when compared to the WT.</p><p>2) SepH was found to localize to the division site in an FtsZ-dependent manner to promote normal Z-ring formation.</p><p>3) SepH was also found to interact with FtsZ and to stimulate its polymerization.</p><p>4) Importantly, many of these activities were found to be conserved in a mycobacterial homolog of SepH.</p><p>Conclusion:</p><p>SepH is a key division protein in actinobacteria that functions via its interaction with FtsZ to promote polymerization.</p><p>Advance to the field:</p><p>As actinobacterial cell division remains poorly characterized relative to the proteobacteria and firmicutes, these results significantly advance the understanding of an essential biological process in this important class of bacteria, which includes major pathogens like <italic>Mycobacterium tuberculosis</italic>.</p><p>Essential revisions</p><p>Reviewers of your manuscript commented that your paper was clearly articulated and overall, the data presentation style was commendable, resulting in a study of notable scholastic excellence. That said, one part of the paper needs improvement and this relates to the effect of SepH on FtsZ, which is summarized as: SepH accelerates and stimulates FtsZ assembly. Currently, this mechanism is confusing and unclear. The two points of data that evidence an increase in FtsZ polymer are: (1) the observation of SepH increasing GTPase activity, and (2) an increase in light scattering signal. Additional controls in these assays are needed to give some clarity. Both are good measurements but have to be validated with secondary measures to ensure the conclusions are correct, as well as determine the contribution of other complicating factors of each assay. Please address the following</p><p>1) With regards to the high amounts of SepH used in the assays relative to FtsZ, for most experiments the authors use equimolar amounts of protein. However, no filament associating protein, save sequesters (profilin, thymosin) exist at or exceed the molar ratio of the monomer. This is important to note, as many filament interacting proteins are seen have different effects at different concentrations – at low levels they may cap, sever, or bundle, but higher levels can artificially stabilize filaments or sequester monomers. Thus, the authors should determine the cellular levels of SepH by Western blot (for which they seem to have antibodies, and maybe already this data).</p><p>2) Once SepH levels are known, the authors should redo some of the <italic>in vitro</italic> experiments at the cellular concentration of SepH. At the least, redo the key biochemical experiments (detailed below) at a lower concentration of SepH – such as 0.6 um, which appears to be already an amount needed for the maximal increase in their GTPase assay.</p><p>3) If and how SepH accelerates and stimulates assembly should be clarified, as how this would occur is currently contradictory and unclear. There are a few different ways SepH could increase FtsZ dynamics, but clarity between increasing the initial assembly rate (nucleation) and turnover (polymer dynamics at equilibrium) have to be separated for the proposed mechanism to be clear. It should be noted that it appears highly unlikely that SepH accelerates FtsZ filament nucleation: if this were the case, SepH would have to increase FtsZ nucleation rate. However, FtsZ is known to rapidly nucleate, making this an unfavourable step for kinetic regulation, and moreover, the data in Figure 6—figure supplement 2 panel C speaks against this hypothesis. This figure shows that FtsZ rapidly nucleates and that SepH has no effect on this first nucleating phase of polymerization. Therefore, the phrases &quot;promotes assembly&quot; and &quot;accelerates&quot; should be modified or removed, as these imply an increase in the rate of polymer formation from pure monomer, which at this stage, is not supported by the data. If the authors wish to test the &quot;accelerates&quot; claim, they should measure the initial phase of FtsZ polymerization by light scattering in a rapid mixer (preferably near FtsZ's critical concentration, for the most dynamic range) whilst slowly increasing the amount of SepH in solution, starting from low nanomolar upward.</p><p>4) It must also be noted that measurements of the initial phase of polymerization should be assayed with hydrolyzable GTP, as nucleotide analogs are known to cause kinetic oddities in a wide number of polymers. Due to these effects, for the longer traces – it is preferred if the authors showed the effects of saturating GTP in the main text</p><p>5) It is obvious that SepH increases FtsZ GTPase activity, but this assay alone makes it hard to conclude any mechanism, as GTPase activity is not a direct readout of polymer dynamics. This is because FtsZ only hydrolyzes GTP in the polymer form. Thus, GTPase rates are a convolution of the amount of polymer and the associated polymer dynamics. However, from the current data, it is not clear how much of this increase comes from SepH causing an increase in FtsZ polymer dynamics or a change in the total amount of FtsZ polymer (critical concentration). Therefore, to strengthen the conclusions, the authors should determine if SepH changes the critical concentration of FtsZ. This could be done by incrementally diluting the total amount of FtsZ within the reaction, as they monitor the GTPase activity. Plotting the GTPase rate (or the plateau value of the light scattering signals) vs total FtsZ concentration will make a line where the X intercept is the critical concentration. Doing this FtsZ titration in the presence of a small amount of SepH (enough to see an effect in the GTPase assay), compared to the same titration without SepH, will give clarity into the underlying cause of the difference in GTPase rates. If there is no change to the critical concentration, SepH must be somehow changing turnover. If SepH lowers the critical concentration, then a mechanism for &quot;promoting assembly&quot; can be concluded.</p><p>6) The experiments with low speed pelleting and EM are not adequate to claim that SepH does not bundle filaments in one species, while it does indeed bundle FtsZ using proteins from another species. This concern arises from the relative timescales of when the low speed pelleting and EM bundling assays were conducted relative to the kinetics observed in the light scattering curves. Critically, light scattering reads filament formation and filament bundling. Work with both FtsZ and other polymers has shown that while filament formation may be fast, most often filament bundling (and the resultant large increase in light scattering) is a slower process, occurring after the initial burst. Thus, the question of SepH promoting bundling of FtsZ becomes highly dependent on the time when the bundling is assayed by EM or slow speed pelleting. The relative difference in the timing of these 2 processes, depending on when they were assayed, could lead to this organismal discrepancy. For the EM assays, the Materials and methods indicate samples were combined and incubated for 10 minutes before spotting onto a grid. For pelleting, it states samples were incubated for 15 minutes. When both of these timescales are placed into the context of the polymerization curves, a possible discrepancy arises:</p><p>For <italic>M. smegmatis</italic> SepH and FtsZ: looking at the polymerization curve in Figure 7D, it is clear there is a huge jump (and divergence between curves) in the light scattering in the FtsZ + SepH curves around ~6 minutes, a time before the EM and pelleting timepoints were taken (10 and 15 minutes). As the EM and the pelleting indicate filaments are bundled at this time point, the difference in the curves would suggest the increase in light scattering is, in some part, due to an increase in filament bundling. However, if the same comparison is drawn looking at the <italic>S. venezuelae</italic> polymerization curve (Figure 6—figure supplement 2 panel C), the conclusion that SepH does not bundle FtsZ becomes questionable. The light scattering curve shows that FtsZ alone and FtsZ + SepH both show an initial burst and small overshoot in the 2 minutes, most likely the initial burst of nucleation and equilibration of the polymer. However, the longer phase of the light scattering increase (most likely bundling) takes far longer compared to M. smegmatis, only beginning to take off around 20 minutes, and not beginning to plateau until 40 minutes. Critically, the assays of bundling by pelleting and EM were conducted at 10 and 15 minutes into the reaction, far before the light scattering curve indicates filament bundling might be occurring.</p><p>Thus, in order to test (or verify) the conclusion that <italic>S. venezuelae</italic> SepH does not bundle FtsZ, the authors should repeat the EM and slow speed pelleting assays at a later timepoint, one matching a timescale of a large signal increase in the light scattering data (30 or 40 minutes), using identical concentrations of proteins and stating hydrolyzable GTP in all assays.</p><p>7) The observation that SepH inhibits ring formation is well noted. However, is there an effect on the dynamics (ring construction) in the rest of the septa? This should be easily quantifiable from the existing data.</p><p>8) Figure 2 and related text, the authors show some interesting kymographs +/- SepH and relate them to dynamics. It is not clear what these mean with regards to dynamics. Clearly the spacing is affected by the absence of SepH; however, the temporal related claims are not very convincing. It would be preferable if they could quantify these claims of gaps-ladders.</p><p>9) Figure 6—figure supplement 2 panel A – There appears to be some problem (perhaps air bubbles) in the GDP polymerization curve of FtsZ alone in Figure 6—figure supplement 2 panel A. This experiment should be redone.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.63387.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential revisions</p><p>Reviewers of your manuscript commented that your paper was clearly articulated and overall, the data presentation style was commendable, resulting in a study of notable scholastic excellence. That said, one part of the paper needs improvement and this relates to the effect of SepH on FtsZ, which is summarized as: SepH accelerates and stimulates FtsZ assembly. Currently, this mechanism is confusing and unclear. The two points of data that evidence an increase in FtsZ polymer are: (1) the observation of SepH increasing GTPase activity, and (2) an increase in light scattering signal. Additional controls in these assays are needed to give some clarity. Both are good measurements but have to be validated with secondary measures to ensure the conclusions are correct, as well as determine the contribution of other complicating factors of each assay. Please address the following</p><p>1) With regards to the high amounts of SepH used in the assays relative to FtsZ, for most experiments the authors use equimolar amounts of protein. However, no filament associating protein, save sequesters (profilin, thymosin) exist at or exceed the molar ratio of the monomer. This is important to note, as many filament interacting proteins are seen have different effects at different concentrations – at low levels they may cap, sever, or bundle, but higher levels can artificially stabilize filaments or sequester monomers. Thus, the authors should determine the cellular levels of SepH by Western blot (for which they seem to have antibodies, and maybe already this data).</p></disp-quote><p>We thank the reviewers for raising this critical point and fully agree with the concerns raised. As suggested, we performed quantitative Western blotting to determine the cellular levels of FtsZ and SepH. Due to the multicellular growth mode of <italic>Streptomyces</italic> filaments, which consist of compartments of variable lengths (e.g. see fluorescence micrographs in Figure 2E for the WT), it is difficult to definitively calculate the cellular concentration of SepH and FtsZ. However, this analysis revealed that the intracellular molar ratio of SepH to FtsZ is 1:6. We have added this new information in the revised manuscript (L288-L293 and Figure 5—figure supplement 4).</p><p>Notably, we reported in our original manuscript that using a 1:6 ratio of SepH (0.6 μM) to FtsZ (3.5 μM) was sufficient to stimulate GTPase activity and filament assembly of FtsZ, suggesting that the observed effects on FtsZ behavior are physiologically relevant. We have now repeated multiple key <italic>in vitro</italic> experiments using SepH and FtsZ at a molar ratio of 1:6 (see below).</p><disp-quote content-type="editor-comment"><p>2) Once SepH levels are known, the authors should redo some of the in vitro experiments at the cellular concentration of SepH. At the least, redo the key biochemical experiments (detailed below) at a lower concentration of SepH – such as 0.6 um, which appears to be already an amount needed for the maximal increase in their GTPase assay.</p></disp-quote><p>In light of the results obtained to address comment 1, we have repeated the following biochemical experiments: (1) dynamic light scattering, (2) co-sedimentation and (3) TEM imaging using protein concentrations that reflect the determined molar ratio of both proteins <italic>in vivo</italic>. Specifically, we used 3.5 μM FtsZ and 0.6 μM SepH in our revised <italic>in vitro</italic> reactions. In summary, and in agreement with our original results, we were able to confirm that SepH from <italic>S. venezuelae</italic> has a positive effect on FtsZ polymerization.</p><p>1) Dynamic light scattering experiments</p><p>We confirmed that SepH affects FtsZ polymerization and led to an increase in light scattering in the presence of 2 mM GTP even when present at a 6-fold lower molar ratio. Furthermore, using the revised reaction conditions, we found that the FtsZ polymerization reactions already reached a plateau after 10 min following the incubation with GTP and SepH. Therefore, we decided to use a 15-minute incubation period of FtsZ with GTP and SepH prior to co-sedimentation and protein negative stain TEM analyses.</p><p>In addition, using the 1:6 molar ratio, we recorded light scattering traces of FtsZ polymerization using different nucleotides (2 mM GDP and 2 mM GMPCCP) and in the presence of the different SepH variants (SepH-NTD, SepH-CTD, SepH-G79P). In summary, we only observed a moderate increase in light scattering when the FtsZ polymerization reactions contained SepH-NTD, which is consistent with our earlier results. In contrast to our previous DLS results using SepH and FtsZ at equimolar amounts, incubating FtsZ with a 6-fold lower concentration of SepH and the slow-hydrolysable GTP analogue GMPCCP did not markedly affect the assembly kinetics of FtsZ. To confirm that SepH can interact with FtsZ filaments in the absence of GTP hydrolysis, we performed additional co-sedimentation experiments (point (2)).</p><p>In line with the new data, we have modified the manuscript accordingly and replaced the respective panel in Figure 6 with new DLS graphs using the revised reaction conditions.</p><p>2) Co-sedimentation experiments</p><p>We repeated all high-speed co-sedimentation experiments presented in the original manuscript using 3.5 μM FtsZ (with or without 2 mM GTP) and in the presence or absence of 0.6 μM SepH or SepH-G79P from <italic>S. venezuelae</italic>. Based on our new DLS results (see above), each reaction was incubated for 15 min at 30°C prior to ultracentrifugation. In agreement with our original sedimentation results, we found that the addition of SepH led to a consistent increase of polymerized FtsZ in the pellet fraction from 35% (no SepH) to 47% (with SepH). Incubation of FtsZ with GTP and the SepH helix-turn-helix mutant variant SepH-G79P resulted in FtsZ levels in the pellet fraction (36%) similar to reactions in which SepH was omitted (35 %). The amount of pelleted FtsZ doubled when polymerization was induced with the slow-hydrolysable GTP analogue GMPCCP (84%), which was also independent of SepH. Additionally, while wild-type SepH almost completely co-sedimented with FtsZ in the presence of both GTP (97%) and GMPCCP (98%), it was largely soluble in the absence of FtsZ. Taken together, these new sedimentation patterns are consistent with our previous results, showing that SepH directly interacts with FtsZ (at 1:6 molar ratio) and that this interaction does not require FtsZ to hydrolyze GTP.</p><p>We have updated the manuscript and the corresponding figure panels (e.g. Figure 5F and Figure 5—figure supplement 5).</p><p>3) Protein negative stain TEM</p><p>We have repeated the visualization of FtsZ filaments assembled using GTP or GMPCCP and in the presence of either wild-type SepH or the SepH variants (SepH-NTD, SepH-CTD, SepH-G79P). Each reaction mix was incubated for 15 min at 30C prior to negative staining and imaging. Using these conditions, we confirmed that FtsZ filaments appeared to be more abundant but similar in morphology when SepH was present. These findings are consistent with the results obtained in the DLS experiments and co-sedimentation assays, showing that SepH stimulates the assembly of FtsZ filaments but does not appear to actively promote FtsZ bundling.</p><p>We have modified the main text where necessary and replaced the original TEM images in Figure 6A-D and Figure 6—figure supplement 2 with images collected using less SepH (0.6 uM) and consistent reaction conditions. We have removed Figure 6E showing the width distribution of FtsZ filaments assembled with and without SepH because this analysis was based on data obtained using the original (higher) molar ratio of FtsZ and SepH at 1:1.</p><disp-quote content-type="editor-comment"><p>3) If and how SepH accelerates and stimulates assembly should be clarified, as how this would occur is currently contradictory and unclear. There are a few different ways SepH could increase FtsZ dynamics, but clarity between increasing the initial assembly rate (nucleation) and turnover (polymer dynamics at equilibrium) have to be separated for the proposed mechanism to be clear. It should be noted that it appears highly unlikely that SepH accelerates FtsZ filament nucleation: if this were the case, SepH would have to increase FtsZ nucleation rate. However, FtsZ is known to rapidly nucleate, making this an unfavourable step for kinetic regulation, and moreover, the data in Figure 6—figure supplement 2 panel C speaks against this hypothesis. This figure shows that FtsZ rapidly nucleates and that SepH has no effect on this first nucleating phase of polymerization. Therefore, the phrases &quot;promotes assembly&quot; and &quot;accelerates&quot; should be modified or removed, as these imply an increase in the rate of polymer formation from pure monomer, which at this stage, is not supported by the data. If the authors wish to test the &quot;accelerates&quot; claim, they should measure the initial phase of FtsZ polymerization by light scattering in a rapid mixer (preferably near FtsZ's critical concentration, for the most dynamic range) whilst slowly increasing the amount of SepH in solution, starting from low nanomolar upward.</p></disp-quote><p>We agree with the reviewer’s that the data in the original manuscript do not provide sufficient evidence that SepH affects the nucleation step of FtsZ filament formation However, in response to reviewer comment 5 (see below), we found that in the presence of 0.6 μM SepH, the critical concentration of FtsZ is clearly reduced from 1.43 to 1.11 μM. This supports our claim that SepH positively influences FtsZ filament formation and thus, we believe that stating “SepH promotes the assembly of FtsZ filaments” is appropriate. Since we did not have the capacity to probe the effect of SepH on FtsZ polymer dynamics, we have removed any phrases implying that SepH from <italic>S. venezuelae</italic> affects the speed of FtsZ filament formation.</p><disp-quote content-type="editor-comment"><p>4) It must also be noted that measurements of the initial phase of polymerization should be assayed with hydrolyzable GTP, as nucleotide analogs are known to cause kinetic oddities in a wide number of polymers. Due to these effects, for the longer traces – it is preferred if the authors showed the effects of saturating GTP in the main text</p></disp-quote><p>Agreed. We now show the results of our revised DLS experiments using excess amounts of GTP (2 mM) in the main text in Figure 6F and DLS traces obtained from experiments with the GTP analogue GMPCCP in the figure supplement (Figure 6 —figure supplement 3).</p><disp-quote content-type="editor-comment"><p>5) It is obvious that SepH increases FtsZ GTPase activity, but this assay alone makes it hard to conclude any mechanism, as GTPase activity is not a direct readout of polymer dynamics. This is because FtsZ only hydrolyzes GTP in the polymer form. Thus, GTPase rates are a convolution of the amount of polymer and the associated polymer dynamics. However, from the current data, it is not clear how much of this increase comes from SepH causing an increase in FtsZ polymer dynamics or a change in the total amount of FtsZ polymer (critical concentration). Therefore, to strengthen the conclusions, the authors should determine if SepH changes the critical concentration of FtsZ. This could be done by incrementally diluting the total amount of FtsZ within the reaction, as they monitor the GTPase activity. Plotting the GTPase rate (or the plateau value of the light scattering signals) vs total FtsZ concentration will make a line where the X intercept is the critical concentration. Doing this FtsZ titration in the presence of a small amount of SepH (enough to see an effect in the GTPase assay), compared to the same titration without SepH, will give clarity into the underlying cause of the difference in GTPase rates. If there is no change to the critical concentration, SepH must be somehow changing turnover. If SepH lowers the critical concentration, then a mechanism for &quot;promoting assembly&quot; can be concluded.</p></disp-quote><p>This is a good point and we thank the reviewers for their detailed suggestions. To strengthen our conclusion that SepH positively influences FtsZ polymer formation, we have determined the critical concentration for GTPase activity of FtsZ alone and in the presence of 0.6 μM SepH. We previously showed that this SepH concentration is sufficient to increase the GTP hydrolysis rate of FtsZ (see also detailed response to comment 2). In our hands, FtsZ displayed a critical concentration of 1.43 μM. Importantly, addition of SepH reduced the critical concentration of FtsZ to 1.11 μM, supporting the idea that SepH from <italic>S. venezuelae</italic> promotes FtsZ filament assembly <italic>in vitro</italic>.</p><p>We have added the new data to the revised manuscript (L369-375 and Figure 6G).</p><disp-quote content-type="editor-comment"><p>6) The experiments with low speed pelleting and EM are not adequate to claim that SepH does not bundle filaments in one species, while it does indeed bundle FtsZ using proteins from another species. This concern arises from the relative timescales of when the low speed pelleting and EM bundling assays were conducted relative to the kinetics observed in the light scattering curves. Critically, light scattering reads filament formation and filament bundling. Work with both FtsZ and other polymers has shown that while filament formation may be fast, most often filament bundling (and the resultant large increase in light scattering) is a slower process, occurring after the initial burst. Thus, the question of SepH promoting bundling of FtsZ becomes highly dependent on the time when the bundling is assayed by EM or slow speed pelleting. The relative difference in the timing of these 2 processes, depending on when they were assayed, could lead to this organismal discrepancy. For the EM assays, the Materials and methods indicate samples were combined and incubated for 10 minutes before spotting onto a grid. For pelleting, it states samples were incubated for 15 minutes. When both of these timescales are placed into the context of the polymerization curves, a possible discrepancy arises:</p><p>For M. smegmatis SepH and FtsZ: looking at the polymerization curve in Figure 7D, it is clear there is a huge jump (and divergence between curves) in the light scattering in the FtsZ + SepH curves around ~6 minutes, a time before the EM and pelleting timepoints were taken (10 and 15 minutes). As the EM and the pelleting indicate filaments are bundled at this time point, the difference in the curves would suggest the increase in light scattering is, in some part, due to an increase in filament bundling. However, if the same comparison is drawn looking at the S. venezuelae polymerization curve (Figure 6—figure supplement 2 panel C), the conclusion that SepH does not bundle FtsZ becomes questionable. The light scattering curve shows that FtsZ alone and FtsZ + SepH both show an initial burst and small overshoot in the 2 minutes, most likely the initial burst of nucleation and equilibration of the polymer. However, the longer phase of the light scattering increase (most likely bundling) takes far longer compared to M. smegmatis, only beginning to take off around 20 minutes, and not beginning to plateau until 40 minutes. Critically, the assays of bundling by pelleting and EM were conducted at 10 and 15 minutes into the reaction, far before the light scattering curve indicates filament bundling might be occurring.</p><p>Thus, in order to test (or verify) the conclusion that S. venezuelae SepH does not bundle FtsZ, the authors should repeat the EM and slow speed pelleting assays at a later timepoint, one matching a timescale of a large signal increase in the light scattering data (30 or 40 minutes), using identical concentrations of proteins and stating hydrolyzable GTP in all assays.</p></disp-quote><p>We thank the reviewers for pointing out the possible discrepancy associated with our experimental design. To resolve this, we have performed additional experiments to clarify if SepH from <italic>S. venezuelae</italic> can bundle FtsZ protofilaments. We now present results obtained using identical protein concentrations and consistent timescales for TEM experiments and sedimentation assays. Specifically, we used 3.5 μM FtsZ, 2 mM GTP and 0.6 μM SepH. Because of using a lower, physiologically more relevant, SepH concentration, our revised DLS studies revealed that FtsZ polymerization reached a steady-state level much quicker (&lt;10 min) compared to the conditions used in our original DLS experiments (see Figure 6E revised manuscript). Consequently, we have repeated the low-speed co-sedimentation studies and TEM analyses of FtsZ filament morphology with and without SepH following a 15 min incubation time.</p><p>1) Low speed co-sedimentation</p><p>With or without SepH, we consistently found the majority of polymerized in the supernatant fraction, indicating the absence of large molecular FtsZ assemblies.</p><p>2) TEM of FtsZ filaments</p><p>In line with the low-speed sedimentation assays, inspection of the electron micrographs showed that in the presence of SepH, FtsZ assembled into curved protofilaments that were randomly distributed across the EM grid. We did not observe FtsZ bundles following an incubation time of 15 min. As pointed out by the reviewers earlier, we note that the effect of SepH on FtsZ filament morphology is concentration-dependent and that when using a higher SepH concentration (e.g. an equimolar ratio of FtsZ and SepH), FtsZ filaments became much better discernible on EM grids and were occasionally organized into thin bundles (Figure 6—figure supplement 2). We also took images following a 30 min incubation period but did not observed a significant increase of these aggregates (<xref ref-type="fig" rid="sa2fig1">Author response image 1</xref>). Given the frequency of these FtsZ filament assemblies and the fact that the cellular concentration of SepH is likely closer to being 6-fold lower than FtsZ (see also response to comment 1), we believe that any possible bundling activity of <italic>S. venezuelae</italic> SepH should be considered with caution and the thin bundles observed in these images are likely a by-product of the artificial stabilization of FtsZ filaments by SepH.</p><fig id="sa2fig1"><label>Author response image 1.</label><caption><title>Representative TEM images of negative stained FtsZ polymers after 30 min of incubation with 2 mM GTP and in the absence or presence of either 0.</title><p>6 μM SepH (6:1) or 3.5 μM SepH (1:1). Scale bar: 200 nm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-resp-fig1-v1.tif"/></fig><p>We have updated the respective panels in Figure 6 and the corresponding figure supplements and discussed the new results in the revised manuscripts.</p><disp-quote content-type="editor-comment"><p>7) The observation that SepH inhibits ring formation is well noted. However, is there an effect on the dynamics (ring construction) in the rest of the septa? This should be easily quantifiable from the existing data.</p></disp-quote><p>We would like to emphasize that SepH does not inhibit Z-ring formation. Our results support the idea that SepH is required for the efficient and regular assembly of division-competent Z-rings during sporulation septation. However, the reviewer raised an interesting point that we had not investigated.</p><p>To determine if the absence of SepH affects the formation of the remaining Z-rings in sporogenic hyphae, we first extracted the fluorescence intensity of Z-rings detected in wild-type and ∆<italic>sepH</italic> mutant hyphae from the same time-lapse imaging series that were used to generate the kymographs shown in Figure 3 and the corresponding figure supplements. These intensity traces were averaged to create a mean intensity trace for Z-rings assembled in wild-type and ∆<italic>sepH</italic> hyphae. Analysis of the resulting graph indicates that Z-rings seem to appear slightly earlier in <italic>sepH</italic>-deficient hyphae. However, the overall dynamics of Z-ring assembly, constriction and disassembly, which are reflected by a steady increase of fluorescence intensity and subsequent decrease in fluorescence as Z-rings disassemble, is highly similar between both strains.</p><p>In addition, we determined the average width of Z-rings assembled in wild-type and ∆<italic>sepH</italic> mutant hyphae. For this we first generated an average intensity profile of FtsZ-YPet fluorescence for each of the available time-lapse imaging series. Intensity peaks in these profiles, which correspond to Z-rings, were detected automatically and the full width of identified Z-rings was calculated at the half maximum intensity of each peak. Subsequently, we plotted the total distribution of peak widths for each strain and replicate (n=5). This analysis revealed that there is no marked difference between widths of Z-rings assembled in ∆<italic>sepH</italic> mutant hyphae compared to wildtype. It is conceivable that in the absence of SepH, FtsZ molecules that fail to polymerize into a Z-ring are free to interact with neighboring Z-rings, thereby supporting the wildtype-like assembly of the remaining Z-rings.</p><p>Taken together, under the employed conditions we did not detect any severe defects in the assembly dynamics and the overall architecture of Z-rings in the absence of SepH.</p><p>We have included this new data in the revised manuscript (L158-162), added two new panels to Figure 3 and provided details about the image analysis in the Materials and methods section.</p><disp-quote content-type="editor-comment"><p>8) Figure 2 and related text, the authors show some interesting kymographs +/- SepH and relate them to dynamics. It is not clear what these mean with regards to dynamics. Clearly the spacing is affected by the absence of SepH; however, the temporal related claims are not very convincing. It would be preferable if they could quantify these claims of gaps-ladders.</p></disp-quote><p>To strengthen the conclusions drawn from these kymographs, we have extracted and plotted the average fluorescence intensity of Z-rings over time (please see also detailed response to comment 7 above). The resulting intensity graphs, now presented in the revised manuscript in Figure 3E, clearly show an increase and decrease of FtsZ-YPet fluorescence intensity over time. Comparing the average intensity traces of Z-rings detected in wild-type and <italic>sepH</italic>-deficient hyphae revealed that the overall temporal pattern of FtsZ-YPet fluorescence is similar in both strains and does not indicate any major defects in the dynamics of Z-ring formation associated with the absence of SepH in the remaining Z-rings.</p><p>In addition, we quantified the importance of SepH for the regular spacing of Z-rings. In line with our spore-size measurements (Figure 1—figure supplement 2), this analysis confirmed that the absence of SepH led to a higher variability in the spacing of Z-rings (<xref ref-type="fig" rid="sa2fig2">Author response image 2</xref>), with Z-rings being assembled every 1.21±0.1 μm in the wildtype (spore size: 1.2±0.23 μm) compared to 1.51±0.2 μm in the ∆<italic>sepH</italic> mutant strain (spore size: 1.4±0.45 μm). We agree with the reviewer that the different spacing between Z-rings in <italic>sepH</italic>-deficient hyphae is obvious in the kymographs. Since the analysis of the distance between Z-rings in sporogenic hyphae did not provide any further information, we opted not to add a separate panel to the Figure 2 supplement.</p><fig id="sa2fig2"><label>Author response image 2.</label><caption><title>Average distance between Z-rings in wild-type and ∆sepH mutant hyphae.</title><p>Results are based on data extracted from 5 independent time-lapse series of sporulating wild-type and sepH-deficient hyphae, respectively, which were also used to generate kymographs shown in Figure 2 and the corresponding figure supplements (main manuscript). Grey dots present entire data set, colored dots are the mean distance for each experimental replicate, line and bars show total mean distance with 95% CI.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63387-resp-fig2-v1.tif"/></fig><disp-quote content-type="editor-comment"><p>9) Figure 6—figure supplement 2 panel A – There appears to be some problem (perhaps air bubbles) in the GDP polymerization curve of FtsZ alone in Figure 6—figure supplement 2 panel A. This experiment should be redone.</p></disp-quote><p>Agreed. We have repeated this experiment and replaced the original DLS traces with new light scattering traces, confirming the clear absence of FtsZ polymerization in the presence of 2 mM GDP (Figure 6—figure supplement 3A).</p></body></sub-article></article>