<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">63997</article-id><article-id pub-id-type="doi">10.7554/eLife.63997</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell Biology</subject></subj-group></article-categories><title-group><article-title>Quantitative glycoproteomics reveals cellular substrate selectivity of the ER protein quality control sensors UGGT1 and UGGT2</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-211343"><name><surname>Adams</surname><given-names>Benjamin M</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-9980-5321</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-211344"><name><surname>Canniff</surname><given-names>Nathan P</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-211345"><name><surname>Guay</surname><given-names>Kevin P</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-42441"><name><surname>Larsen</surname><given-names>Ida Signe Bohse</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-30951"><name><surname>Hebert</surname><given-names>Daniel N</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-1537-4446</contrib-id><email>dhebert@biochem.umass.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Biochemistry and Molecular Biology, University of Massachusetts</institution><addr-line><named-content content-type="city">Amherst</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution>Program in Molecular and Cellular Biology, University of Massachusetts</institution><addr-line><named-content content-type="city">Amherst</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution>Department of Cellular and Molecular Medicine, University of Copenhagen</institution><addr-line><named-content content-type="city">Copenhagen</named-content></addr-line><country>Denmark</country></aff><aff id="aff4"><label>4</label><institution>Copenhagen Center for Glycomics, University of Copenhagen</institution><addr-line><named-content content-type="city">Copenhagen</named-content></addr-line><country>Denmark</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Miller</surname><given-names>Elizabeth A</given-names></name><role>Reviewing Editor</role><aff><institution>MRC Laboratory of Molecular Biology</institution><country>United Kingdom</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Ron</surname><given-names>David</given-names></name><role>Senior Editor</role><aff><institution>University of Cambridge</institution><country>United Kingdom</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>15</day><month>12</month><year>2020</year></pub-date><pub-date pub-type="collection"><year>2020</year></pub-date><volume>9</volume><elocation-id>e63997</elocation-id><history><date date-type="received" iso-8601-date="2020-10-13"><day>13</day><month>10</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2020-12-14"><day>14</day><month>12</month><year>2020</year></date></history><permissions><copyright-statement>© 2020, Adams et al</copyright-statement><copyright-year>2020</copyright-year><copyright-holder>Adams et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-63997-v2.pdf"/><abstract><p>UDP-glucose:glycoprotein glucosyltransferase (UGGT) 1 and 2 are central hubs in the chaperone network of the endoplasmic reticulum (ER), acting as gatekeepers to the early secretory pathway, yet little is known about their cellular clients. These two quality control sensors control lectin chaperone binding and glycoprotein egress from the ER. A quantitative glycoproteomics strategy was deployed to identify cellular substrates of the UGGTs at endogenous levels in CRISPR-edited HEK293 cells. The 71 UGGT substrates identified were mainly large multidomain and heavily glycosylated proteins when compared to the general N-glycoproteome. UGGT1 was the dominant glucosyltransferase with a preference toward large plasma membrane proteins whereas UGGT2 favored the modification of smaller, soluble lysosomal proteins. This study sheds light on differential specificities and roles of UGGT1 and UGGT2 and provides insight into the cellular reliance on the carbohydrate-dependent chaperone system to facilitate proper folding and maturation of the cellular N-glycoproteome.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>calnexin</kwd><kwd>calreticulin</kwd><kwd>lectin chaperones</kwd><kwd>protein homeostasis</kwd><kwd>glycoproteomics</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Human</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000057</institution-id><institution>National Institute of General Medical Sciences</institution></institution-wrap></funding-source><award-id>GM086874</award-id><principal-award-recipient><name><surname>Hebert</surname><given-names>Daniel N</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000057</institution-id><institution>National Institute of General Medical Sciences</institution></institution-wrap></funding-source><award-id>T32GM008515</award-id><principal-award-recipient><name><surname>Adams</surname><given-names>Benjamin M</given-names></name><name><surname>Canniff</surname><given-names>Nathan P</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Natural substrates of the central endoplasmic reticulum quality control glycoprotein sensors UDP-glucose:glycoproteinglucosyltransferase (UGGT)1 and UGGT2 were identified using a glycoproteomics approach and the role for their modification was explored.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Protein folding in the cell is an error-prone process and protein misfolding is the basis for a large number of disease states (<xref ref-type="bibr" rid="bib35">Hebert and Molinari, 2007</xref>; <xref ref-type="bibr" rid="bib31">Hartl, 2017</xref>). A significant fraction of the proteome in mammalian cells passes through the secretory pathway by first being targeted to the endoplasmic reticulum (ER) where folding occurs (<xref ref-type="bibr" rid="bib79">Uhlén et al., 2015</xref>; <xref ref-type="bibr" rid="bib39">Itzhak et al., 2016</xref>; <xref ref-type="bibr" rid="bib1">Adams et al., 2019a</xref>). Molecular chaperones of the ER help to guide secretory pathway cargo along a productive folding pathway by directing the trajectory of the folding reaction, inhibiting non-productive side reactions such as aggregation or by retaining immature or misfolded proteins in the ER until they can properly fold or be targeted for degradation. Understanding how chaperone binding controls the maturation and flux of proteins through the secretory pathway is of important fundamental biological concern and will impact our knowledge of protein folding diseases and the development of potential therapeutics including the production of biologics that are frequently secretory proteins.</p><p>Proteins that traverse the secretory pathway are commonly modified with N-linked glycans as they enter the ER lumen (<xref ref-type="bibr" rid="bib81">Zielinska et al., 2010</xref>). These carbohydrates serve a variety of roles including acting as quality control tags or attachment sites for the lectin ER chaperones calnexin and calreticulin (<xref ref-type="bibr" rid="bib37">Helenius and Aebi, 2004</xref>; <xref ref-type="bibr" rid="bib34">Hebert et al., 2014</xref>). N-glycosylation commences co-translationally in mammals and the first round of binding to calnexin and calreticulin is initiated shortly thereafter by the rapid trimming of glucoses by glucosidases I and II to reach their monoglucosylated state (<xref ref-type="bibr" rid="bib18">Chen et al., 1995</xref>; <xref ref-type="bibr" rid="bib20">Cherepanova et al., 2019</xref>). Lectin chaperone binding is multifunctional as it has been shown to: (1) direct the folding trajectory of a protein by acting as a holdase that slows folding in a region-specific manner (<xref ref-type="bibr" rid="bib22">Daniels et al., 2003</xref>; <xref ref-type="bibr" rid="bib80">Wang et al., 2008</xref>); (2) act as an adapter or platform to recruit folding factors including oxidoreductases (ERp57 and ERp29) and a peptidyl-prolyl <italic>cis trans</italic> isomerase (CypB) to maturing nascent chains (<xref ref-type="bibr" rid="bib44">Kozlov and Gehring, 2020</xref>); (3) diminish aggregation (<xref ref-type="bibr" rid="bib33">Hebert et al., 1996</xref>); (4) retain immature, misfolded, or unassembled proteins in the ER (<xref ref-type="bibr" rid="bib61">Rajagopalan et al., 1994</xref>); and (5) target aberrant proteins for degradation by ER-associated degradation (ERAD) and ER-phagy (<xref ref-type="bibr" rid="bib52">Molinari et al., 2003</xref>; <xref ref-type="bibr" rid="bib56">Oda et al., 2003</xref>; <xref ref-type="bibr" rid="bib29">Forrester et al., 2019</xref>). For glycoproteins, the lectin chaperones appear to be the dominant chaperone system as once an N-glycan is added to a region on a protein, it has been shown to be rapidly passed from the ER Hsp70 chaperone BiP to the lectin chaperones, further underscoring their central role in controlling protein homeostasis in the secretory pathway (<xref ref-type="bibr" rid="bib30">Hammond and Helenius, 1994</xref>).</p><p>N-glycan trimming to an unglucosylated glycoform by glucosidase II supports substrate release from the lectin chaperones. At this stage, if the protein folds properly, it is packaged into COPII vesicles for anterograde trafficking (<xref ref-type="bibr" rid="bib11">Barlowe and Helenius, 2016</xref>). Alternatively, substrates that are evaluated to be non-native are directed for rebinding to the lectin chaperones by the protein folding sensor UDP-glucose:glycoprotein glucosyltransferase 1 (UGGT1) that reglucosylates immature or misfolded proteins (<xref ref-type="bibr" rid="bib36">Helenius, 1994</xref>; <xref ref-type="bibr" rid="bib74">Sousa and Parodi, 1995</xref>). Since UGGT1 directs the actions of this versatile lectin chaperone system and thereby controls protein trafficking through the ER, it acts as a key gatekeeper of the early secretory pathway. Therefore, it is vital to understand the activity of UGGT1 and the scope of substrates it modifies.</p><p>Our current knowledge of the activity of UGGT1 relies largely on studies using purified components. UGGT1 was found to recognize non-native or near-native glycoproteins with exposed hydrophobic regions using in vitro approaches where the modification of glycopeptides, engineered or model substrates by purified UGGT1 was monitored (<xref ref-type="bibr" rid="bib65">Ritter and Helenius, 2000</xref>; <xref ref-type="bibr" rid="bib77">Taylor et al., 2003</xref>; <xref ref-type="bibr" rid="bib15">Caramelo et al., 2004</xref>). Recent crystal structures of fungal UGGT1 have shown that it possesses a central, hydrophobic cavity in its protein sensing domain, which may support hydrophobic-based interactions for substrate selection (<xref ref-type="bibr" rid="bib67">Roversi et al., 2017</xref>; <xref ref-type="bibr" rid="bib69">Satoh et al., 2017</xref>).</p><p>Cell-based studies of UGGT1 have relied on the overexpression of cellular and viral proteins (<xref ref-type="bibr" rid="bib73">Soldà et al., 2007</xref>; <xref ref-type="bibr" rid="bib58">Pearse et al., 2008</xref>; <xref ref-type="bibr" rid="bib28">Ferris et al., 2013</xref>; <xref ref-type="bibr" rid="bib76">Tannous et al., 2015</xref>). <italic>Uggt1</italic> knockout studies have found that the roles of UGGT1 appear to be substrate specific as UGGT1 can promote, decrease, or not affect the interaction between substrates and calnexin (<xref ref-type="bibr" rid="bib73">Soldà et al., 2007</xref>). Prosaposin, the only known cellular substrate of UGGT1 when expressed at endogenous levels, grossly misfolds in the absence of <italic>Uggt1</italic> and accumulates in aggresome-like structures (<xref ref-type="bibr" rid="bib59">Pearse et al., 2010</xref>). Work in animals has further emphasized the importance of UGGT1 as the deletion of <italic>Uggt1</italic> in mice is embryonically lethal (<xref ref-type="bibr" rid="bib53">Molinari et al., 2005</xref>).</p><p>UGGT1 has a paralogue, UGGT2, but it has not demonstrated cellular activity (<xref ref-type="bibr" rid="bib5">Arnold et al., 2000</xref>). Domain swapping experiments have demonstrated that UGGT2 possesses a catalytically active glucosyltransferase domain when appended to the folding sensor domain of UGGT1 (<xref ref-type="bibr" rid="bib6">Arnold and Kaufman, 2003</xref>). In vitro experiments using purified, chemically glycosylated interleukin-8 (IL-8), which is not glycosylated in cells, have found that UGGT2 can glucosylate IL-8 (<xref ref-type="bibr" rid="bib75">Takeda et al., 2014</xref>). This suggests that UGGT2 may be an additional reglucosylation enzyme or protein folding sensor of the ER.</p><p>Unlike the classical ATP-dependent chaperones that directly query the conformation of their substrates (<xref ref-type="bibr" rid="bib9">Balchin et al., 2016</xref>), binding to the lectin chaperones is dictated by enzymes that covalently modify the substrate (<xref ref-type="bibr" rid="bib37">Helenius and Aebi, 2004</xref>; <xref ref-type="bibr" rid="bib34">Hebert et al., 2014</xref>). Rebinding to the carbohydrate-dependent chaperones is initiated by the UGGTs that interrogate the integrity of the structure of the protein. Therefore, the proteome-wide detection of cellular UGGT substrates provides the unprecedented opportunity to identify clients that require multiple rounds of chaperone binding and are more reliant on lectin chaperone binding for proper maturation and sorting. Therefore, we designed a cell-based quantitative glycoproteomics approach to identify high-confidence endogenous substrates of UGGT1 and UGGT2 by the affinity purification of monoglucosylated substrates in CRISPR/Cas9-edited cells. UGGT1 and UGGT2 substrates were found to display multiple features of complex proteins including extended lengths plus large numbers of Cys residues and N-glycans. Specific substrates of either UGGT1 or UGGT2 were also discovered, therefore determining that UGGT2 possessed glucosyltransferase activity and identifying its first natural substrates. UGGT1 demonstrated a slight preference for transmembrane proteins, especially those targeted to the plasma membrane, while UGGT2 modification favored soluble lysosomal proteins. The identification of reglucosylated substrates improves our understanding of their folding and maturation pathways and has implications regarding how folding trajectories may be altered in disease states.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Experimental design</title><p>To identify the substrates that are most dependent upon persistent calnexin/calreticulin binding, we isolated and identified endogenous substrates of the ER protein folding sensors UGGT1 and UGGT2. As the product of a reglucosylation by the UGGTs is a monoglucosylated N-glycan, the presence of the monoglucosylated glycoform was used as a readout for substrate reglucosylation. N-glycans are originally transferred to nascent glycoproteins containing three glucoses, therefore a monoglucosylated glycan can be generated either through trimming of two glucoses from the nascent N-linked glycan or through reglucosylation by the UGGTs. In order to isolate the reglucosylation step from the trimming process, a gene edited cell line was created that transfers abbreviated unglucosylated N-linked glycans to nascent chains. The N-linked glycosylation pathway in mammalian cells is initiated through the sequential addition of monosaccharides, mediated by the <italic>ALG</italic> (Asn-linked glycosylation) gene products, to a cytosolically exposed dolichol-P-phosphate embedded in the ER membrane (<xref ref-type="bibr" rid="bib3">Aebi, 2013</xref>; <xref ref-type="bibr" rid="bib19">Cherepanova et al., 2016</xref>; <xref ref-type="fig" rid="fig1">Figure 1A</xref>). The immature dolichol-P-phosphate precursor is then flipped into the ER lumen and sequential carbohydrate addition is continued by additional ALG proteins. The completed N-glycan (Glc<sub>3</sub>Man<sub>9</sub>GlcNAc<sub>2</sub>) is then appended to an acceptor Asn residue in the sequon Asn-Xxx-Ser/Thr/Cys (where Xxx is not a Pro) by the oligosaccharyl transferase (OST) complex (<xref ref-type="bibr" rid="bib19">Cherepanova et al., 2016</xref>). Initially, a Chinese Hamster Ovary (CHO) cell line with a defect in <italic>Alg6</italic> was employed to establish the utility of this approach to follow (re)glucosylation (<xref ref-type="bibr" rid="bib60">Quellhorst et al., 1999</xref>; <xref ref-type="bibr" rid="bib14">Cacan et al., 2001</xref>; <xref ref-type="bibr" rid="bib58">Pearse et al., 2008</xref>; <xref ref-type="bibr" rid="bib59">Pearse et al., 2010</xref>; <xref ref-type="bibr" rid="bib76">Tannous et al., 2015</xref>). As the CHO proteome is poorly curated compared to the human proteome, CRISPR/Cas9 was used to knock out the <italic>ALG6</italic> gene in HEK293-EBNA1-6E cells to provide a cellular system that transferred non-glucosylated glycans (Man<sub>9</sub>GlcNAc<sub>2</sub>) to substrates. In these <italic>ALG6<sup>-/-</sup></italic>cells, a monoglucosylated glycan is solely created by the glucosylation by the UGGTs providing a suitable system to follow the glucosylation process (<xref ref-type="fig" rid="fig1">Figure 1B</xref>).</p><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>The identification of UDP-glucose:glycoprotein glucosyltransferase (UGGT) 1/2 substrates.</title><p>(<bold>A</bold>) The pathway of N-glycosylation in eukaryotic cells is depicted. N-glycan synthesis is initiated in the outer endoplasmic reticulum (ER) membrane leaflet on a dolichol-P-phosphate facing the cytoplasm. Flipping of the precursor N-glycan to the ER luminal leaflet and further synthesis steps mediated by ALG proteins leads to eventual transfer of a Glc<sub>3</sub>Man<sub>9</sub>GlcNAc<sub>2</sub> N-glycan to a substrate by the oligosaccharyl transferase complex. ALG6 (red lettering) catalyzes the transfer of the initial glucose onto the Man<sub>9</sub> precursor N-glycan. (<bold>B</bold>) In wild-type (WT) cells, a Glc<sub>3</sub>Man<sub>9</sub>GlcNAc<sub>2</sub> N-glycan is transferred to substrates. Monoglucosylated substrates may therefore occur via trimming by glucosidases I/II (GlsI/II) or reglucosylation by UGGT1/2. In <italic>ALG6<sup>-/-</sup></italic> cells, a Man<sub>9</sub>GlcNAc<sub>2</sub> N-glycan is transferred to substrates. Therefore, monoglucosylated substrates may only occur through reglucosylation by UGGT1/2. Deoxynojirimycin (500 μM) was added to block the trimming of monoglucosylated substrates by GlsII. <italic>ALG6<sup>-/-</sup></italic> cells were then lysed and split equally between affinity purifications with either GST-CRT or GST-CRT-Y109A bound to glutathione beads. Affinity-purified samples were then reduced, alkylated, trypsinized, and labeled with tandem mass tag (TMT) labels. Samples were then deglycosylated with PNGaseF, pooled, and analyzed by mass spectrometry. (<bold>C</bold>) Substrates were identified by dividing the quantification of the TMT label in the GST-CRT condition for each protein by that of the associated GST-CRT-Y109A condition, yielding the fold increase. Localization as predicted by UniprotKB annotation is depicted. A cutoff of threefold increase was applied. Data is representative of two independent experiments. Error bars represent standard error of the mean (SEM). (<bold>D</bold>) The N-glycoproteome (N-glycopro) was computationally determined by collecting all proteins annotated to contain N-glycans by UniprotKB. Annotated localization information was then used to computationally determine the localization distribution of the N-glycoproteome as well as the identified UGGT substrates.</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>TMT quantification results for <xref ref-type="fig" rid="fig1">Figure 1C</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-fig1-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig1-v2.tif"/></fig><p>To aid in substrate identification, an inhibitor of glucosidases I and II, deoxynojirimycin (DNJ), was added 1 hr prior to cell lysis to block glucose trimming and trap monoglucosylated products. Monoglucosylated substrates were then isolated by affinity purification using recombinant glutathione S-transferase-calreticulin (GST-CRT), as calreticulin binds monoglucosylated proteins. To account for nonspecific binding, a lectin-deficient construct (GST-CRT-Y109A) was used as an affinity purification control (<xref ref-type="bibr" rid="bib40">Kapoor et al., 2004</xref>). Affinity purified substrates were reduced, alkylated, and trypsin digested. The resulting peptides were labeled with tandem mass tags (TMTs) (<xref ref-type="bibr" rid="bib63">Rauniyar and Yates, 2014</xref>), deglycosylated using PNGaseF, and analyzed by mass spectrometry to identify substrates of the UGGTs. The use of TMT, as well as the control GST-CRT-Y109A affinity purification, allows for robust, quantitative identification of substrates of the UGGTs. The resulting data was analyzed by calculating the fold change in abundance of the TMT associated with proteins identified through affinity purification using wild-type (WT) GST-CRT over affinity purification using GST-CRT-Y109A. To be considered a UGGT substrate, a cutoff of threefold (WT GST-CRT/GST-CRT-Y109A) was applied. This conservative cutoff was set to give a high level of confidence in the identified substrates, as below this cutoff, increasing fractions of non-secretory pathway proteins were found.</p></sec><sec id="s2-2"><title>Substrate identification of the UGGTs</title><p>In order to determine the cellular substrates of the UGGTs, the above glycoproteomics protocol was followed using <italic>ALG6<sup>-/-</sup></italic> cells. A restricted pool of 37 N-linked glycosylated proteins was identified as substrates of the UGGTs (<xref ref-type="fig" rid="fig1">Figure 1C</xref> and <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>). Prosaposin, the only previously known endogenous substrate of the UGGTs, was included in this group, supporting the utility of the approach (<xref ref-type="bibr" rid="bib59">Pearse et al., 2010</xref>). Integrin β−1 showed the most significant fold change (WT GST-CRT/GST-CRT-Y109A) of ~26-fold, indicating there is a large dynamic range of reglucosylation levels.</p><p>The cell localizations of UGGT substrates were then determined by using their UniprotKB classification. Approximately two-thirds of the UGGT substrates are destined for the plasma membrane or lysosomes (<xref ref-type="fig" rid="fig1">Figure 1C and D</xref>). Additional substrates are secreted or are resident to the ER or nuclear membrane. Nuclear pore membrane glycoprotein 210 (NUP210) was the only nuclear membrane protein found to be reglucosylated and it is the sole subunit of the nuclear pore that is N-glycosylated (<xref ref-type="bibr" rid="bib12">Beck and Hurt, 2017</xref>). The nucleus and ER share a contiguous membrane. Proteins targeted to the nuclear membrane are first inserted into the ER membrane, then move laterally to the nuclear membrane (<xref ref-type="bibr" rid="bib41">Katta et al., 2014</xref>). Four proteins were designated as ‘multiple localizations’ including cation-independent mannose-6-phosphate receptor (CI-M6PR), which traffics between the Golgi, lysosome, and plasma membrane (<xref ref-type="bibr" rid="bib23">Dell'Angelica and Payne, 2001</xref>).</p><p>To distinguish the general pool of substrates that the UGGTs are expected to be exposed to, N-glycosylated proteins of the secretory pathway proteome (N-glycoproteome) were computationally defined (<xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>). The N-glycoproteome is comprised of proteins that are targeted to the ER either for residency in the secretory/endocytic pathways or for trafficking to the plasma membrane or for secretion. The reviewed UniprotKB <italic>H. sapiens</italic> proteome (20,353 total proteins) was queried to identify all proteins annotated as N-glycosylated, resulting in a set of 4520 proteins. This set was then curated to remove proteins predicted to be mitochondrial, contain less than 50 amino acids or redundant isoforms. The resulting N-glycoproteome contained 4361 proteins, predicting ~21% of the proteome is N-glycosylated. Comparing UGGT substrates to the N-glycoproteome allows for the characterization of feature preferences of substrates for the UGGTs.</p><p>The majority of the N-glycoproteome was either localized to the plasma membrane (37%) or secreted (20%) according to their UniprotKB designations. Smaller fractions of the N-glycoproteome reside in the ER (5%), Golgi (4%), or lysosomes (2%). UGGT substrates are therefore significantly enriched for lysosomal proteins compared to the N-glycoproteome, while all other localizations display a similar distribution to their availability. In total, these results demonstrate the ability to identify substrates of the UGGTs proteomically and suggest that the UGGTs display substrate preferences.</p></sec><sec id="s2-3"><title>Determination of UGGT1- and UGGT2-specific substrates</title><p>There are two ER glucosyltransferase paralogues, UGGT1 and UGGT2, though currently there is no evidence that UGGT2 acts as a protein sensor or a glucosyltransferase in the cell. Therefore, we sought to determine if UGGT2 has glucosyltransferase activity in the cell, and if so, do these two paralogues have different substrate specificities. To address this concern, GST-CRT affinity purification and TMT mass spectrometry were used to identify substrates of UGGT1 in <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells and potential UGGT2 substrates in <italic>ALG6</italic>/<italic>UGGT1<sup>-/-</sup></italic> cells.</p><p>With the <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells, 66 N-glycosylated proteins were identified as reglucosylation substrates using the three-fold cutoff (GST-CRT/CST-CRT-Y109A) (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). Nearly double the number of UGGT1 substrates were identified through this approach compared to using <italic>ALG6<sup>-/-</sup></italic> cells where both UGGT1 and UGGT2 were present. This expansion in substrate number is likely due to the ~50% increase in expression of UGGT1 in <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). The substrate demonstrating the most significant fold change (23.5-fold) was CD164, creating a similar dynamic range for reglucosylation to that observed in <italic>ALG6<sup>-/-</sup></italic> cells.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Identification of UDP-glucose:glycoprotein glucosyltransferase (UGGT)1- and UGGT2-specific substrates.</title><p>(<bold>A</bold>) Reglucosylation substrates in <italic>ALG6/UGGT2<sup>-/-</sup></italic> cells were identified and quantified as previously described in <xref ref-type="fig" rid="fig1">Figure 1</xref>. Localizations as annotated by UniprotKB are depicted. Data are representative of two independent experiments. Error bars represent SEM. (<bold>B</bold>) Reglucosylated substrates in <italic>ALG6/UGGT1<sup>-/-</sup></italic> cells were identified and quantified as previously above. (<bold>C</bold>) The distribution of localizations as annotated by UniprotKB for reglucosylation substrates identified in both <italic>ALG6/UGGT2<sup>-/-</sup></italic> and <italic>ALG6/UGGT1<sup>-/-</sup></italic> cells is depicted. (<bold>D</bold>) The overlap of reglucosylated substrates identified in both <italic>ALG6/UGGT2<sup>-/-</sup></italic> cells (purple) and <italic>ALG6/UGGT1<sup>-/-</sup></italic> cells (gray) is visualized by a Venn diagram. (<bold>E</bold>) Reglucosylated substrate enrichment in either <italic>ALG6/UGGT1<sup>-/-</sup></italic> or <italic>ALG6/UGGT2<sup>-/-</sup></italic> cells is depicted by dividing the tandem mass tag quantification for each protein in <italic>ALG6/UGGT1<sup>-/-</sup></italic> cells by the associated value in <italic>ALG6/UGGT2<sup>-/-</sup></italic> cells on a log<sub>10</sub> scale. Positive and negative values represent enrichment in <italic>ALG6/UGGT1<sup>-/-</sup></italic> and <italic>ALG6/UGGT2<sup>-/-</sup></italic> cells, respectively. Localization (coloring) and topology (soluble [circles] or transmembrane [squares]) are depicted based on UniprotKB annotation.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>TMT quantification results for <xref ref-type="fig" rid="fig2">Figure 2A</xref> and <xref ref-type="fig" rid="fig2">Figure 2B</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-fig2-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>UDP-glucose:glycoprotein glucosyltransferase (UGGT)1 and UGGT2 expression.</title><p>(<bold>A</bold>) The indicated cells were lysed and whole cell lysates were resolved by SDS-PAGE and imaged by immunoblotting against UGGT1 and GAPDH. Asterisk denotes background band. Data are representative of three independent experiments with quantification shown in (<bold>B</bold>). UGGT1 expression was normalized to that of <italic>ALG6<sup>-/-</sup></italic> cells. Error bars represent standard deviation. Asterisk denotes a p-value of less than 0.05. (<bold>C</bold>) Counts per million of UGGT2 mRNA generated by RNAseq from <xref ref-type="supplementary-material" rid="supp4">Supplementary file 4</xref> was analyzed for the level of <italic>UGGT2</italic> mRNA expression in the indicated cell lines. Counts per million of all genes were averaged and the standard deviation from the average for <italic>UGGT2</italic> mRNA was determined. Error bars represent the standard deviation. Data are representative of three independent experiments.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig2-figsupp1-v2.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>mRNA expression analysis of UDP-glucose:glycoprotein glucosyltransferase (UGGT)1 and UGGT2 substrates.</title><p>(<bold>A</bold>) Reglucosylated substrates identified in <italic>ALG6<sup>-/-</sup></italic> (<bold>A</bold>), <italic>ALG6/UGGT1<sup>-/-</sup></italic> (<bold>B</bold>), and <italic>ALG6/UGGT2<sup>-/-</sup></italic> (<bold>C</bold>) cells were compared to the average expression for the N-glycoproteome in counts per million. The standard deviation from the average is plotted, with the error bars representing the standard deviation. Blue dots above each gene represent the level of fold increase (GST-CRT/GST-CRT-Y109A) found by tandem mass tag (TMT) mass spectrometry. The Pearson’s correlation coefficient (<bold>R</bold>) between the mRNA expression and TMT mass spectrometry fold increase is shown. Data is representative of three independent experiments.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig2-figsupp2-v2.tif"/></fig><fig id="fig2s3" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 3.</label><caption><title>β-hexosaminidase subunit β trafficking and hypoglycosylation and CI-M6PR hypoglycosylation.</title><p>(<bold>A</bold>) Cells treated without or with deoxynojirimycin for 12 hr, lysed and whole cell lysate samples were resolved and imaged by immunoblotting against β-hexosaminidase subunit β. Data is representative of three independent experiments and quantification is shown in (<bold>B</bold>). (<bold>C</bold>) The indicated cell lines were lysed and samples were split evenly between non-treated and PNGaseF treated. Asterisks denote deglycosylated protein (<bold>D</bold>). As described for panel <bold>C</bold>, except immunoblotting was against CI M6PR.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig2-figsupp3-v2.tif"/></fig></fig-group><p>To identify possible UGGT2-specific substrates, <italic>ALG6/UGGT1<sup>-/-</sup></italic> cells were used to isolate UGGT2 modified substrates. Thirty-four proteins passed the threefold GST-CRT/GST-CRT-Y109A cutoff, with 33 of these proteins predicted to be N-glycosylated and localized to the secretory pathway (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). Importantly, this demonstrated for the first time that UGGT2 was a functional glycosyltransferase capable of reglucosylating a range of cellular substrates. The glycoprotein with the most significant fold change was arylsulfatase A (10.4-fold). Notably, eight of the nine strongest UGGT2 substrates, or 15 of 33 substrates overall, are lysosomal proteins (<xref ref-type="fig" rid="fig2">Figure 2B and C</xref>). While UGGT1 was also observed to engage a significant percentage of lysosomal proteins (27%), 45% of UGGT2 substrates are lysosomal. Both of these percentages are significantly enriched when compared to the N-glycoproteome for which only 2% is comprised of resident lysosome proteins (<xref ref-type="fig" rid="fig1">Figure 1D</xref>).</p><p>UGGT1 substrates were enriched for plasma membrane localized proteins (35%) when compared to UGGT2 substrates (18%), while plasma membrane proteins were found to compose a similar percent of the N-glycoproteome (37%) compared to UGGT1 substrates. Similar percentages of UGGT1 and UGGT2 substrates localize to the ER (18%), are secreted (12%), or are found in multiple localizations (6%) (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). Even though 4% of the N-glycoproteome is composed of Golgi proteins (<xref ref-type="fig" rid="fig1">Figure 1D</xref>), neither UGGT1 nor UGGT2 appeared to modify Golgi localized proteins.</p><p>The number of UGGT1 substrates was double that of UGGT2 suggesting that UGGT1 carried the main quality control load. Only 3 out of 33 UGGT2 substrates were specific to UGGT2. These three UGGT2-specific substrates included arylsulfatase A, α-N-acetylgalactosaminidase, and β-hexosaminidase subunit β (HexB), three soluble lysosomal enzymes (<xref ref-type="fig" rid="fig2">Figure 2D and E</xref>). Thirty substrates overlapped between UGGT1 and UGGT2, while 36 substrates were found to be specific to UGGT1 (<xref ref-type="fig" rid="fig2">Figure 2D</xref> and <xref ref-type="supplementary-material" rid="supp3">Supplementary file 3</xref>). The preference for the shared substrates was explored by plotting all proteins identified as a substrate of either glucosyltransferase on a log<sub>10</sub> scale of the associated TMT value in <italic>ALG6/UGGT1<sup>-/-</sup></italic> cells divided by the values in <italic>ALG6/UGGT2<sup>-/-</sup></italic> cells (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). Proteins enriched as UGGT2 substrates therefore possess positive values while UGGT1 enriched substrates have negative values.</p><p>The three substrates found to be specific to UGGT2 clustered away from all other proteins (<xref ref-type="fig" rid="fig2">Figure 2E</xref> at the top left). The remaining UGGT2 enriched substrates, except for one ER localized protein, localized to the lysosome. All the UGGT2 favored substrates were soluble proteins. In contrast, UGGT1 favored proteins were greater in number and displayed a diversity of localizations with a preference for plasma membrane proteins. These results indicate that UGGT2 is a functional glucosyltransferase, which preferentially engages soluble lysosomal proteins while UGGT1 modifies a wider variety of proteins with a preference for plasma membrane and transmembrane domain-containing proteins in general.</p></sec><sec id="s2-4"><title>Validation of UGGT substrates</title><p>Having identified numerous novel substrates of the UGGTs, a select number of these substrates was tested for reglucosylation to validate the identification approach. Substrates were chosen based on a diversity of topologies, lengths, differences in propensities as UGGT1 or UGGT2 substrates, and reagent availability. Monoglucosylated substrates were affinity isolated from <italic>ALG6<sup>-/-</sup></italic>, <italic>ALG6</italic>/<italic>UGGT1<sup>-/-</sup></italic>, <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic>, and <italic>ALG6</italic>/<italic>UGGT1</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells using GST-CRT compared to GST-CRT-Y109A. Substrates were then identified by immunoblotting with the percent reglucosylation determined by subtracting the amount of protein bound by GST-CRT-Y109A from that of GST-CRT, divided by the total amount of substrate present in the whole cell lysate (WCL), and multiplying by 100.</p><p>CI-M6PR and insulin-like growth factor type one receptor (IGF-1R) are both large type I membrane proteins that possess multiple N-glycosylation sites (<xref ref-type="fig" rid="fig3">Figure 3D and H</xref>). Overall, 10% of CI-M6PR was reglucosylated in <italic>ALG6<sup>-/-</sup></italic> cells (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). The modification level of CI-M6PR was significantly reduced in <italic>ALG6</italic>/<italic>UGGT1<sup>-/-</sup></italic>, but not <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells. As a control, reglucosylation was not observed in <italic>ALG6</italic>/<italic>UGGT1</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells. A similar profile was observed for IGF-1R where reglucosylation levels reached 12% in <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells (<xref ref-type="fig" rid="fig3">Figure 3E–G</xref>). Altogether, these findings were consistent with the quantitative glycoproteomics isobaric labeling results (<xref ref-type="fig" rid="fig3">Figure 3C and G</xref>), confirming that CI-M6PR and IGF-1R are efficient substrates of UGGT1.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Validation of select reglucosylation substrates.</title><p>(<bold>A</bold>) The designated cell lines were lysed and split into whole cell lysate (WCL, 10%) or affinity purification by GST-CRT-WT or GST-CRT-Y109A and imaged by immunoblotting against the CI Man-6-Phosphate receptor. Data is representative of three independent experiments with quantification shown in panel (<bold>B</bold>). Quantifications were calculated by subtracting the value of protein in the Y109A lane from the value of protein in the associated wild-type (WT) lane, divided by the value of protein in the associated WCL lane and multiplied by 100. Error bars represent the standard deviation. Asterisks denote a p-value of less than 0.05. (<bold>C</bold>) Tandem mass tag (TMT) mass spectrometry quantification of CI Man-6-Phosphate receptor reglucosylation from <italic>ALG6/UGGT1<sup>-/-</sup></italic> cells (<xref ref-type="fig" rid="fig2">Figure 2B</xref>) and <italic>ALG6/UGGT2<sup>-/-</sup></italic> cells (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). (<bold>D</bold>) Cartoon representation of CI Man-6-Phosphate receptor with N-glycans (branched structures), the signal sequence (gray), luminal/extracellular domain (blue), transmembrane domain (black), and intracellular domain (green) depicted. Number of amino acids and Cys residues are indicated. (<bold>E</bold>) Reglucosylation of IGF-1R, conducted as previously described above. Pro IGF-1R and mature IGF-1R are both observed due to proteolytic processing. Data are representative of three independent experiments with quantification displayed in (<bold>F</bold>). (<bold>G</bold>) TMT mass spectrometry quantification of IGF-1R from <xref ref-type="fig" rid="fig2">Figure 2A and B</xref>, as previously described. (<bold>H</bold>) Cartoon depiction of IGF-1R. (<bold>I</bold>) The reglucosylation of ENPP1 shown with quantification displayed in J. (<bold>K</bold>) TMT mass spectrometry quantification of ENPP1 from <xref ref-type="fig" rid="fig2">Figure 2A and B</xref> with cartoon depiction of ENPP1 in L. (<bold>M</bold>) Reglucosylation of β-hexosaminidase subunit β, conducted as previously described with quantifications displayed in N and TMT mass spectrometry quantification of β-hexosaminidase subunit β from <xref ref-type="fig" rid="fig2">Figure 2A and B</xref> in O with a cartoon depicting β-hexosaminidase subunit β in P.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Quantifications for reglucosylation validations.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-fig3-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>mRNA expression of lysosomal preferential UDP-glucose:glycoprotein glucosyltransferase (UGGT)2 substrates.</title><p>(<bold>A</bold>) The expression of <italic>HEXB</italic> (<bold>A</bold>), <italic>ARSA</italic> (<bold>B</bold>), <italic>NAGA</italic> (<bold>C</bold>), <italic>GLA</italic> (<bold>D</bold>), <italic>TPP1</italic> (<bold>E</bold>), <italic>FUCA1</italic> (<bold>F</bold>), <italic>HEXA</italic> (<bold>G</bold>), and <italic>NAGLU</italic> (<bold>H</bold>) in the indicated cell lines was analyzed by mRNA expression level in the denoted cell lines from RNAseq data presented in <xref ref-type="supplementary-material" rid="supp4">Supplementary file 4</xref>. The standard deviation from the average expression level in counts per million in each cell line for all genes is plotted. Error bars represent standard deviation. Data are representative of three independent experiments.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig3-figsupp1-v2.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>UPR induction in knockout cell lines.</title><p>(<bold>A</bold>) The indicated cells were lysed and whole cell lysate were resolved by SDS-PAGE and imaged by immunoblotting against BiP and GAPDH. DMSO was used as a vehicle control with tunicamycin (5 μg/ml) as a positive control. Data is representative of three independent experiments with quantification displayed in (<bold>B</bold>). BiP expression levels were normalized to that of wild-type cells and the corresponding GAPDH loading control. Error bars denote standard deviation. Asterisks denote a p-value of less than 0.05. (<bold>C</bold>) A subset of genes induced by the ATF6 UPR branch was analyzed by mRNA expression level as described in <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>. Data are representative of three independent experiments. IRE1 (<bold>D</bold>) and PERK (<bold>E</bold>) induced genes characterized as described in (<bold>C</bold>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig3-figsupp2-v2.tif"/></fig></fig-group><p>Next, the reglucosylation of the type II membrane protein, ectonucleotide pyrophosphatase/phosphodiesterase family member 1 (ENPP1) was analyzed (<xref ref-type="fig" rid="fig3">Figure 3L</xref>). ENPP1 was found to be reglucosylated at similar levels in <italic>ALG6<sup>-/-</sup></italic> (7%) and <italic>ALG6</italic>/<italic>UGGT1<sup>-/-</sup></italic> (7%) cells. In <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells, reglucosylation increased to 12%, while in <italic>ALG6</italic>/<italic>UGGT1</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells reglucosylation decreased to 1% (<xref ref-type="fig" rid="fig3">Figure 3I and J</xref>). These results suggest that ENPP1 can be reglucosylated by both UGGT1 and UGGT2, with a slight preference for UGGT1, supporting the TMT mass spectrometry results (<xref ref-type="fig" rid="fig3">Figure 3K</xref>).</p><p>The reglucosylation of the smaller soluble lysosomal protein, HexB, was also tested (<xref ref-type="fig" rid="fig3">Figure 3M–P</xref>). HexB is processed into three disulfide-bonded chains in the lysosome (<xref ref-type="bibr" rid="bib49">Mahuran et al., 1988</xref>). Only immature or ER localized proHexB was affinity purified by GST-CRT (<xref ref-type="fig" rid="fig3">Figure 3M</xref>, lanes 2, 5, 8, and 11). HexB was reglucosylated at 34% in <italic>ALG6<sup>-/-</sup></italic> cells (<xref ref-type="fig" rid="fig3">Figure 3N</xref>). No significant change in glucosylation levels occurred when UGGT1 was also knocked out (35%). However, a reduction to 20% reglucosylation of HexB was observed in <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells, and complete loss of reglucosylation was seen in <italic>ALG6</italic>/<italic>UGGT1</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells. <italic>ALG6</italic>/<italic>UGGT1<sup>-/-</sup></italic> cells consistently displayed increased levels of expression of HexB (<xref ref-type="fig" rid="fig3">Figure 3M</xref>, lane 4), and this was consistent with RNAseq data (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2B</xref>). These results confirm the mass spectrometry results that showed HexB to be a favored substrate of UGGT2 (<xref ref-type="fig" rid="fig3">Figure 3O</xref>). It is also notable that HexB, as the first validated substrate of UGGT2, is highly reglucosylated. As reglucosylation was not observed for any of the validated substrates tested when both UGGT1 and UGGT2 were knocked out, these glucosyltransferases appear to be responsible for the reglucosylation of N-glycans in the ER. Taken together, these results demonstrate that the mass spectrometry screen accurately identified substrates of the UGGTs, as well as differentiated between substrates specific to either UGGT1 or UGGT2.</p></sec><sec id="s2-5"><title>Analysis of UGGT substrates</title><p>To investigate the properties of the substrates modified by the UGGTs and identify potential types of proteins UGGT1 and UGGT2 modify, a systematic analysis of the substrates of the UGGTs was performed and compared to the general properties of the N-glycoproteome. All characteristics were analyzed using UniprotKB annotations. Initially, the length of substrates was compared to the N-glycoproteome. The N-glycoproteome ranged widely in size, from elabela (54 amino acids) to mucin-16 (14,507 amino acids). The overall amino acid distribution of the N-glycoproteome was significantly shifted smaller compared to the size of UGGT substrates (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). The median size of the N-glycoproteome was 443 amino acids, compared to 737 for UGGT substrates found in <italic>ALG6<sup>-/-</sup></italic> cells. Substrates of both UGGT1 (718 amino acid median) and UGGT2 (585 amino acids) are significantly larger when compared to the N-glycoproteome. This increase in length may lead to more complex folding trajectories, requiring increased engagement with the lectin chaperones for efficient maturation.</p><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Analysis of substrates of the UDP-glucose:glycoprotein glucosyltransferase (UGGT)s and the N-glycoproteome.</title><p>(<bold>A</bold>) Amino acid lengths of each protein in the indicated data sets were visualized by scatter plot overlaid with a box and whisker plot. Amino acid number was obtained via UniprotKB. All scatter plots with box and whisker plots were generated using R and the ggplot package. The number of N-glycans (<bold>B</bold>) or Cys residues (<bold>C</bold>) for each protein in the indicated data sets was visualized by scatter plot overlaid with a box and whisker plot with the numbers determined using their UniprotKB annotation. (<bold>D</bold>) The isoelectric point (pI) values for each protein in the indicated data sets was visualized by scatter plot overlaid with a box and whisker plot. The pI values were obtained via ExPASy theoretical pI prediction. (<bold>E</bold>) The computationally predicted N-glycoproteome and the indicated reglucosylation substrates were determined as either soluble or transmembrane using UniprotKB annotations. The transmembrane portion of each data set was then analyzed for type I, type II, or multi-pass topology using the associated UniprotKB annotation. Proteins that were annotated by UniprotKB as transmembrane but lacked topology information were labeled as undefined. (<bold>F</bold>) The computationally determined N-glycoproteome was separated into soluble, type I, type II, and multi-pass transmembrane proteins using UniprotKB annotations. Luminally exposed amino acids were computationally determined using UniprotKB annotations for each subset of the N-glycoproteome and each indicated reglucosylation substrate data set. The resulting data was visualized by scatter plot overlaid with a box and whisker plot. (<bold>G</bold>) The indicated N-glycoproteome subsets were analyzed for N-glycan content using UniprotKB annotation and visualized by scatter plot overlaid with a box and whisker plot, as described. (<bold>H</bold>) The indicated N-glycoproteome subsets were analyzed for predicted pI using ExPASy theoretical pI prediction and visualized by scatter plot overlaid with a box and whisker plot.</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Characteristics of the N-glycoproteome.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-fig4-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig4-v2.tif"/></fig><p>The distribution of the number of N-glycans possessed by the N-glycoproteome (median of two glycans per glycoprotein) was also shifted significantly smaller than that of UGGT1 (seven glycans) or UGGT2 (five glycans) substrates (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). All the UGGT substrates displayed a decreased density of proteins at low N-glycan content values that are heavily populated in the N-glycoproteome. Despite the identification of UGGT1 and UGGT2 substrates generally containing high numbers of N-glycans, multiple substrates possessed as few as two N-glycans, suggesting that the experimental approach did not require a high number of monoglucosylated glycans for GST-CRT affinity isolation but substrates possessing multiple reglucosylated sites are likely affinity isolated more efficiently by the GST-CRT pull downs.</p><p>The ER maintains an oxidizing environment that supports the formation of disulfide bonds. Complex folding pathways can involve the engagement of oxidoreductases, such as the calnexin/calreticulin-associated oxidoreductase ERp57, to catalyze disulfide bond formation and isomerization (<xref ref-type="bibr" rid="bib51">Margittai and Sitia, 2011</xref>; <xref ref-type="bibr" rid="bib44">Kozlov and Gehring, 2020</xref>). The most common number of Cys in UGGT substrates was similar to the N-glycoproteome Cys content (2 Cys, <xref ref-type="fig" rid="fig4">Figure 4C</xref>). However, the median number of Cys residues for the N-glycoproteome (11 Cys) is smaller than that found in <italic>ALG6<sup>-/-</sup></italic> cells (16 Cys) and <italic>ALG6/UGGT2<sup>-/-</sup></italic> cells (13 Cys). In contrast, a median of nine Cys was observed for UGGT2 substrates. Therefore, UGGT1 appears to display a slight preference for proteins with high Cys content, when compared to the N-glycoproteome and UGGT2 substrates.</p><p>UGGT1 or UGGT2 substrates displayed similar pI distributions with pIs predominantly near a pH of 6.0, while a second smaller cluster centered around a pH of 8.5. Interestingly, a pronounced low-density region was observed at pH 7.9 under all conditions, presumably due to the instability of proteins with pIs of a similar pH to that of the ER. The N-glycoproteome displayed a more bimodal distribution with significant population of both acidic and basic pIs (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). These results suggest that both UGGT1 and UGGT2 preferentially engage proteins with low pIs.</p><p>The predicted topologies of the substrates of the UGGTs and the N-glycoproteome were also analyzed. Approximately 70% of the N-glycoproteome is comprised of membrane proteins, with half of these membrane proteins possessing multiple transmembrane domains, followed by single membrane pass proteins with a type I orientation (a third) with the remainder being type II membrane proteins (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). A total of 43% of UGGT substrates in <italic>ALG6<sup>-/-</sup></italic> cells contained a transmembrane domain with the vast majority of these substrates having their C-terminus localized to the cytosol in a type I orientation, while two substrates possessed the reverse type II orientation and a single multi-pass membrane substrate (NPC1) was identified. When the UGGTs were considered separately, about half of the UGGT1 substrates (<italic>ALG6/UGGT2<sup>-/-</sup></italic> cells) possessed at least one transmembrane domain, with 70% of these membrane proteins being in the type I orientation, a quarter in a type II orientation, and two being multi-pass proteins (NPC1 and scavenger receptor class B member 1 [SR-BI]). In contrast to UGGT1, the majority of UGGT2 substrates were soluble proteins (72%) with the breakdown of remaining transmembrane proteins being similar to that of UGGT1 with the majority being type I membrane proteins. The preference of UGGTs for type I transmembrane proteins is likely caused by their larger luminal-exposed domains and N-glycan numbers compared to multi-pass membrane proteins (<xref ref-type="fig" rid="fig4">Figure 4F and G</xref>). Notably, substrates of the UGGTs had larger luminal domains than the membrane proteins of the N-glycoproteome, though especially for the multi-pass membrane proteins (<xref ref-type="fig" rid="fig4">Figure 4F</xref>). Furthermore, while the pIs of type II and polytopic membrane proteins were bimodal, they were overall more basic, which appears to be a property disfavored by UGGT substrates (<xref ref-type="fig" rid="fig4">Figure 4H</xref>). Overall, these results show that UGGT1 efficiently modifies both soluble and membrane associated proteins, while UGGT2 strongly favors soluble substrates.</p></sec><sec id="s2-6"><title>Efficient IGF-1R trafficking requires lectin chaperone engagement</title><p>A number of natural substrates of the UGGTs were identified using a glycoproteomics approach with gene edited cell lines. As reglucosylation by the UGGTs can direct multiple rounds of lectin chaperone binding, the necessity for reglucosylation to support the efficient maturation of a reglucosylated substrate was investigated. IGF-1R is proteolytically processed in the <italic>trans</italic>-Golgi by proprotein convertases including furin, facilitating the monitoring of IGF-1R trafficking from the ER to the Golgi (<xref ref-type="bibr" rid="bib46">Lehmann et al., 1998</xref>). The requirement for lectin chaperone binding and reglucosylation to aid IGF-1R trafficking was analyzed.</p><p>Initially, cells were treated without or with the inhibitor of α-glucosidases I and II, DNJ, to accumulate IGF-1R in the triglucosylated state to bypass entry into the calnexin/calreticulin binding cycle (<xref ref-type="bibr" rid="bib30">Hammond and Helenius, 1994</xref>; <xref ref-type="bibr" rid="bib32">Hebert et al., 1995</xref>). At steady state as probed by immunoblotting of cell lysates, IGF-1R accumulated in the ER localized pro form relative to the mature form after DNJ treatment (<xref ref-type="fig" rid="fig5">Figure 5A</xref>), resulting in a 19% decrease in the level of the <italic>trans</italic>-Golgi processed mature protein (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). This indicated that the lectin chaperone binding cycle helps support efficient IGF-1R trafficking.</p><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Calnexin/calreticulin cycle role for IGF-1R trafficking.</title><p>(<bold>A</bold>) Wild-type HEK293-EBNA1-6E cells treated without or with deoxynojirimycin (DNJ; 500 μM) for 12 hr were lysed and whole cell lysate samples were resolved by reducing 9% SDS-PAGE and imaged by immunoblotting against IGF-1R. Data are representative of three independent experiments with quantification shown in (<bold>B</bold>). Percent of IGF-1R mature was calculated by dividing the amount of mature protein by the total protein in each lane. Errors bars represent standard deviation. Asterisk denotes a p-value of less than 0.05. (<bold>C</bold>) The indicated cell lines were lysed in RIPA buffer. Samples were split evenly between non-treated and PNGaseF or EndoH treated. Samples were visualized by immunoblotting against IGF-1R and data are representative of three independent experiments with quantification displayed in (<bold>D</bold>). (<bold>E</bold>) Indicated cells were treated without or with DNJ, pulsed with [<sup>35</sup>S]-Met/Cys for 1 hr and chased for the indicated times. Cells were lysed and samples were immunoprecipitated using anti-β IGF-1R antibody and resolved by reducing SDS-PAGE and imaged by autoradiography. Data are representative of three independent experiments with quantification shown in (<bold>F</bold>).</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Quantifications for IGF-1R trafficking puse chase.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-fig5-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig5-v2.tif"/></fig><p>There are two modes for engaging the lectin chaperone cycle: initial binding, which can potentially commence co-translationally for glycoproteins such as IGF-1R that have N-glycans located at their N-terminus through their trimming of the terminal two glucoses by glucosidases I and II; or by rebinding, which is directed by the reglucosylation of unglucosylated species by the UGGTs (<xref ref-type="bibr" rid="bib16">Caramelo and Parodi, 2015</xref>; <xref ref-type="bibr" rid="bib45">Lamriben et al., 2016</xref>). The contribution of each mode of monoglucose generation for the proper trafficking of IGF-1R was analyzed.</p><p>IGF-1R maturation was investigated in <italic>ALG6<sup>-/-</sup></italic> cells as in these cells the N-glycan transferred to the nascent substrate is non-glucosylated, leading to a lack of initial glucosidase trimming mediated lectin chaperone binding. Reglucosylation by the UGGTs is required for lectin chaperone binding in <italic>ALG6<sup>-/-</sup></italic> cells. Similar to DNJ treatment in WT cells, <italic>ALG6<sup>-/-</sup></italic> cells demonstrate a 20% decrease in mature IGF-1R relative to the pro form at steady state (<xref ref-type="fig" rid="fig5">Figure 5C</xref>, lanes 1 and 3, and <xref ref-type="fig" rid="fig5">Figure 5D</xref>). As hypoglycosylation can occur in a substrate dependent manner in <italic>Alg6<sup>-/-</sup></italic> cells (<xref ref-type="bibr" rid="bib72">Shrimal and Gilmore, 2015</xref>), the mobility of IGF-1R with and without N-glycans (PNGase F treated) was monitored by comparing the mobility of IGF-1R by SDS-PAGE and immunoblotting of WT and <italic>ALG6<sup>-/-</sup></italic> cell lysates. IGF-1R, and similarly, CI-M6PR, appeared to be fully glycosylated, while HexB migrated faster when synthesized in <italic>ALG6<sup>-/-</sup></italic> cells likely due to hypoglycosylation (<xref ref-type="fig" rid="fig5">Figure 5C</xref> and <xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3</xref>). To confirm that the pro form of IGF-1R represented ER localized protein rather than protein trafficked out of the ER but not processed by proprotein convertases, IGF-1R from WT and <italic>Alg6<sup>-/-</sup></italic> cells was treated with the endoglycosidase EndoH. As EndoH cleaves high-mannose glycans that are preferentially present in the ER or early Golgi, an increase in mobility by SDS-PAGE suggests ER localization. In both WT and <italic>Alg6<sup>-/-</sup></italic> cells, Pro IGF-1R was observed to be EndoH sensitive, while mature IGF-1R was found to be largely EndoH resistant (<xref ref-type="fig" rid="fig5">Figure 5C</xref>, lanes 2 and 5), suggesting the accumulation of pro IGF-1R in <italic>Alg6<sup>-/-</sup></italic> cells represents impaired ER trafficking rather than impaired processing in the <italic>trans</italic>-Golgi. Altogether, these steady state results suggest that lectin chaperone binding is important for efficient IGF-1R maturation.</p><p>As steady state results can be impacted by changes in protein synthesis and turnover, a radioactive pulse-chase approach was used to follow protein synthesized during a 1 hr [<sup>35</sup>S]-Met/Cys pulse interval followed by chasing for up to 2 hr under non-radioactive conditions. Pulse-chase experiments are generally performed with overexpressed tag constructs to accumulate and isolate sufficient protein for monitoring. Here endogenous IGF-1R was isolated by immunoprecipitation with anti-IGF-1R antibodies and analyzed by SDS-PAGE and autoradiography to determine the percent of IGF-1R that was properly processed to its mature form in the <italic>trans</italic>-Golgi. IGF-1R was found to traffic efficiently out of the ER and to the Golgi in WT cells as 59% of the total protein after a 2 hr chase was mature IGF-1R (<xref ref-type="fig" rid="fig5">Figure 5E</xref>, lanes 1–3, and F). When lectin chaperone binding was inhibited by treatment with DNJ, mature IGF-1R was diminished to 22%, underscoring the importance of lectin chaperone binding (<xref ref-type="fig" rid="fig5">Figure 5E</xref>, lanes 4–6, and F).</p><p>To delineate the contributions of early compared to late lectin chaperone binding, IGF-1R trafficking was followed in gene edited cells that control the mechanisms for lectin chaperone engagement. A single early round of lectin chaperone binding will be permitted in the absence of both UGGTs or rebinding would only be directed by the UGGT present with knockouts of a single UGGT. Alternatively, early lectin chaperone binding as dictated by glucosidase trimming will be absent in the <italic>ALG6<sup>-/-</sup></italic> cells where lectin chaperone binding is directed solely through glucosylation by the UGGTs. Monitoring the trafficking of IGF-1R in these cells will allow us to determine the contributions of the different steps in the lectin chaperone binding cycle for proper IGF-1R maturation.</p><p>When both UGGTs were absent in <italic>UGGT1/2<sup>-/-</sup></italic> cells, the percent of mature IGF-1R after 2 hr of chase decreased to 42%. In agreement with early glycoproteomics and affinity isolation results showing IGF-1R was largely a UGGT1 substrate, UGGT2 knockout alone had little influence on IGF-1R trafficking while the knocking out of UGGT1 supported IGF-1R trafficking similar to the double UGGT deletion (<xref ref-type="fig" rid="fig5">Figure 5E,</xref> lanes 7–15, and F). These results support a role for UGGT1 in optimizing IGR-1R trafficking.</p><p>To determine the importance of early chaperone binding directed by the glucosidases, IGF-1R trafficking was monitored in <italic>ALG6<sup>-/-</sup></italic> cells that support reglucosylation but lack the ability for early binding to the lectin chaperones as directed by glucosidase trimming of the triglucosylated species. In <italic>ALG6<sup>-/-</sup></italic> cells, the percent of mature IGF-1R was significantly decreased to 21%, indicative of an important contribution of the initial round of lectin binding, as was suggested by steady state data (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). The addition of DNJ to <italic>ALG6<sup>-/-</sup></italic> cells would be expected to trap IGF-1R in a monoglucosylated state after glucosylation, allowing the effect of prolonged interaction with the lectin chaperones to be observed. Under this condition, IGF-1R was strongly retained in the ER with no increase observed in the level of mature IGF-1R observed even after 2 hr of chase (<xref ref-type="fig" rid="fig5">Figure 5E</xref>, lanes 16–21, and F). Altogether these results demonstrate that while early (glucosidase-mediated) and late (UGGT-mediated) lectin chaperone binding contribute to the efficient trafficking from the ER and subsequent Golgi processing of IGF-1R, early lectin chaperone binding appears to be most critical for supporting proper IGF-1R maturation.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>As lectin chaperone binding is directed by the covalent modification of substrates by the UGGTs, the identification of <italic>bona fide</italic> substrates of the UGGTs is central to understand the impact the lectin chaperone network has on cellular homeostasis. Features of proteins alone cannot accurately predict which chaperones will be required for efficient folding and quality control (<xref ref-type="bibr" rid="bib2">Adams et al., 2019b</xref>). Previous studies involving the UGGTs have focused mainly on the overexpression of biasedly selected substrates or using purified proteins, providing uncertain biological relevance (<xref ref-type="bibr" rid="bib65">Ritter and Helenius, 2000</xref>; <xref ref-type="bibr" rid="bib77">Taylor et al., 2003</xref>; <xref ref-type="bibr" rid="bib15">Caramelo et al., 2004</xref>; <xref ref-type="bibr" rid="bib73">Soldà et al., 2007</xref>; <xref ref-type="bibr" rid="bib58">Pearse et al., 2008</xref>; <xref ref-type="bibr" rid="bib28">Ferris et al., 2013</xref>; <xref ref-type="bibr" rid="bib76">Tannous et al., 2015</xref>). Here we used a quantitative glycoproteomics-based strategy to identify 71 natural cellular substrates of the UGGTs. When compared to the N-glycoproteome that represents the total population of potential substrates (4361 N-glycoproteins in human cells), the UGGTs favored the modification of more complex, multidomain proteins with large numbers of N-glycans. These results are in agreement with the common requirement of chaperones for the proper folding of more complex proteins (<xref ref-type="bibr" rid="bib9">Balchin et al., 2016</xref>; <xref ref-type="bibr" rid="bib10">Balchin et al., 2020</xref>). The lectin chaperone system is part of the robust chaperone network necessary to promote the efficient folding and quality control of substrates and mitigate harmful misfolding events that are associated with a large range of pathologies.</p><p>The discovery of 33 UGGT2 cellular substrates provides the first evidence of intact UGGT2 acting as a quality control factor in cells (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). Previous work demonstrated that UGGT2 is enzymatically active against chemically engineered glycosylated substrates using purified components or when the catalytic domain of UGGT2 was appended to the folding sensor domain of UGGT1 (<xref ref-type="bibr" rid="bib6">Arnold and Kaufman, 2003</xref>; <xref ref-type="bibr" rid="bib75">Takeda et al., 2014</xref>). The lower number of UGGT2 substrates compared to UGGT1 (66 substrates) is likely due, at least in part, to UGGT2 being expressed at a fraction of the level of UGGT1 (~4% in HeLa cells <xref ref-type="bibr" rid="bib39">Itzhak et al., 2016</xref>). Of special note is the preference of UGGT2 for lysosomal substrates as eight of the nine preferential UGGT2 substrates are lysosomal proteins (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). The preferential UGGT2 substrates are all soluble proteins, while half of the preferential UGGT1 substrates contained transmembrane domains indicative of a further preference of UGGT2 for soluble proteins (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). Given the preference of UGGT2 for soluble lysosomal proteins, it would be of interest in future studies to examine lysosomes in <italic>UGGT2<sup>-/-</sup></italic> cells or mice as a number of the UGGT2 substrates are associated with lysosomal storage diseases including metachromatic leukodystrophy (arylsulfatase A), Fabry (alpha-galactosidase A), Sandhoff (β-hexosaminidase subunit β), and Schindler (α-N-acetylgalactosaminidase) diseases (<xref ref-type="bibr" rid="bib50">Mahuran, 1999</xref>; <xref ref-type="bibr" rid="bib17">Cesani et al., 2016</xref>; <xref ref-type="bibr" rid="bib27">Ferreira and Gahl, 2017</xref>).</p><p>UGGT1 serves as the predominant ER glycoprotein quality control sensor. While overall the 66 UGGT1 substrates are evenly distributed between soluble and membrane proteins, the majority of the most efficiently reglucosylated proteins are membrane proteins (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). Seventy percent of the membrane proteins modified by UGGT1 are in the type I orientation possessing luminal N-glycosylated domains of significant length. Only two substrates of the UGGTs are multi-pass membrane proteins (NPC1 and SR-BI). In contrast to most polytopic membrane proteins that have little exposure to the ER lumen (<xref ref-type="fig" rid="fig4">Figure 4F</xref>), both NPC1 and SR-BI have large heavily glycosylated luminal domains. The enrichment of UGGT1 for transmembrane proteins may be influenced through a weak association with the ER membrane or a general slower and more complex folding process for membrane proteins that provides a longer window for modification. As a majority of the UGGT substrates are found in oligomeric complexes, the UGGTs might also exhibit a preference for unassembled subunits to help ensure proper protein assembly in the ER.</p><p>An important question to ask is what is the basis for the differing substrate specificities of UGGT1 and UGGT2? They display sequence identities that are high within the catalytic domains (83% identical) and lower in their folding sensor domains (49%) (<xref ref-type="bibr" rid="bib6">Arnold and Kaufman, 2003</xref>). This sequence disparity within the folding sensor domain may drive altered substrate selection. In addition, UGGT1 and UGGT2 may reside in separate subdomains within the ER, and this could contribute to substrate accessibility. The CLN6/CLN8 transmembrane complex appears to recognize lysosomal proteins within the ER for COPII packaging in support of a possible mechanism of lysosomal substrate selection (<xref ref-type="bibr" rid="bib7">Bajaj et al., 2020</xref>). An additional possibility addressed was that the level of expression of the lysosomal proteins identified as UGGT2 substrates may be augmented in <italic>ALG6/UGGT1<sup>-/-</sup></italic>cells. However, only the mRNA expression level of β-hexosaminidase subunit β was increased relative to <italic>ALG6<sup>-/-</sup></italic> or WT cells, as supported by immunoblot data (<xref ref-type="fig" rid="fig3">Figure 3M</xref>), with the remaining preferential UGGT2 lysosomal substrates displaying no significant change in mRNA expression levels (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). The increased expression of β-hexosaminidase subunit β in <italic>ALG6/UGGT1<sup>-/-</sup></italic> cells may be attributed to induction by UPR, as in these cells a slight induction primarily through the ATF6 branch of the UPR was observed (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). Further studies will be required to understand the varying selectivities of the UGGTs.</p><p>With some 4350 possible N-glycosylated proteins as potential UGGT substrates, why were only 71 proteins identified as substrates of the UGGTs? First, many proteins are expected to fold in a chaperone independent manner, especially small, simple proteins. Second, our stringent isolation approach prioritized high quality substrates with at least a threefold induction for GST-CRT/GST-CRT-Y109A binding. Third, the profile of reglucosylated substrates is likely cell-type dependent with additional substrates expected to be identified in cell types with heavy secretory pathway loads such as pancreatic cells or hepatocytes, compared to the kidney line used here. Fourth,~1500 proteins of the N-glycoproteome are multi-pass transmembrane proteins (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). This class of protein was strongly de-enriched as substrates of the UGGTs, likely due to their limited luminal exposure, minimal N-glycan content, and difficulties in isolating hydrophobic polytopic membrane proteins (<xref ref-type="fig" rid="fig4">Figure 4F and G</xref>). This reduces the pool of favored substrates by one-third. Finally, the monoglucosylated protein isolation procedure that relies on CST-CRT pull downs is likely influenced by the number of monoglucosylated sites on a protein. While multiple UGGT substrates with two N-glycans were identified, suggesting extensive glycosylation is not a requirement, the number of monoglucosylated glycans on a substrate is expected to have an impact on the efficiency of substrate isolation and identification. We hope to identify specific sites of reglucosylation in future studies. These results would demonstrate if reglucosylation occurs on multiple sites or a small number of sites.</p><p>Protein expression levels are also expected to play some role in substrate identification. However, it does not appear to be a major determining factor as multiple strong substrates were expressed at or below an average protein level for the N-glycoproteome and no correlation between mRNA expression level and the TMT mass spectrometry fold increase for the GST-CRT/GST-CRT-Y109A fraction was observed (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>). It would be of interest to determine if proteotoxic stress would increase levels and the range of reglucosylated substrates as both the pool of non-native proteins and the amount of the UPR-induced substrates of the UGGTs would be expected to increase.</p><p>As carbohydrate binding can be dictated initially by glucosidase trimming followed by additional later rounds of binding dictated by UGGT reglucosylation, it is of importance to understand which stage of the binding cycle contributes most significantly to proper protein maturation and cell homeostasis. N-glycans in <italic>Sacchromyces cerevisiae</italic> and other single cell species are transferred post-translationally as they are missing the OST isoform subunit that interacts with the Sec61 translocon and supports early co-translational modification (<xref ref-type="bibr" rid="bib68">Ruiz-Canada et al., 2009</xref>; <xref ref-type="bibr" rid="bib71">Shrimal et al., 2019</xref>). A second OST isoform appears in multicellular organisms that is translocon-associated (<xref ref-type="bibr" rid="bib13">Braunger et al., 2018</xref>; <xref ref-type="bibr" rid="bib62">Ramírez et al., 2019</xref>). In addition, reglucosylation activity was first observed in single cell parasites of <italic>Trypanosoma cruzi</italic> where glycans are transferred as Man<sub>9</sub>GlcNAc<sub>2</sub> moieties thereby bypassing the initial glucosidase initiated binding step observed in metazoans (<xref ref-type="bibr" rid="bib57">Parodi and Cazzulo, 1982</xref>). These seminal <italic>T. cruzi</italic> studies from Parodi and colleagues that first discovered the (re)glucosylation activity, later attributed to UGGT1, were the inspiration for the development of the experimental <italic>ALG6<sup>-/-</sup></italic> system used in this study to isolate substrates of the UGGTs. Conservation analysis of glycosylation and the lectin chaperone pathway suggests that reglucosylation supporting the quality control function of the calnexin cycle evolved prior to its role in assisting in earlier folding events.</p><p>Using CRISPR edited cell lines, the contributions of the various steps for chaperone binding engagement for the UGGT1 substrate IGF-1R was experimentally explored as its processing in the Golgi provided a robust Golgi trafficking assay. Furthermore, IGF-1R is a target in cancer biology as it is important for cell growth (<xref ref-type="bibr" rid="bib70">Sell et al., 1994</xref>; <xref ref-type="bibr" rid="bib24">Desbois-Mouthon et al., 2006</xref>; <xref ref-type="bibr" rid="bib21">Chng et al., 2006</xref>; <xref ref-type="bibr" rid="bib43">King et al., 2014</xref>; <xref ref-type="bibr" rid="bib54">Mutgan et al., 2018</xref>). When binding to the lectin chaperones was blocked in WT cells by glucosidase inhibition with DNJ treatment, supporting the production of triglucosylated trapped species, the percent of processed IGF-1R strongly decreased compared to untreated cells. This demonstrated a requirement of lectin chaperone engagement for the efficient maturation, trafficking, and processing of IGF-1R. In <italic>UGGT1/2<sup>-/-</sup></italic> cells, IGF-1R can enter the first round of glucosidase-mediated binding to the lectin chaperones but rebinding directed primarily by UGGT1-mediated reglucosylation cannot occur (<xref ref-type="fig" rid="fig5">Figures 5E and F</xref> and <xref ref-type="fig" rid="fig6">6</xref>). This led to a reduced efficiency in the accumulation of mature IGF-1R. The first round of lectin chaperone binding is bypassed in <italic>ALG6<sup>-/-</sup></italic> cells as the N-glycans transferred to proteins do not contain glucoses (<xref ref-type="fig" rid="fig6">Figure 6</xref>). Therefore, only the rebinding events mediated by reglucosylation takes place. More strikingly in <italic>ALG6<sup>-/-</sup></italic> cells, this led to a dramatic reduction in IGF-1R processing at a greater level than in <italic>UGGT1/2<sup>-/-</sup></italic> cells, indicating the first round of binding to the lectin chaperones was most critical for IGF-1R maturation. The addition of DNJ in <italic>ALG6<sup>-/-</sup></italic> cells supported the trapping of reglucosylated side chains and severely reduced Golgi processing, suggesting that reglucosylation-mediated persistent interaction with the lectin chaperones delays IGF-1R exit from the ER.</p><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Model for IGF-1R engagement by the lectin chaperone cycle.</title><p>In wild-type (WT) cells, N-glycans with three terminal glucoses are appended to IGF-1R. Trimming of two terminal glucoses by glucosidases I/II generates a monoglucosylated protein that supports an initial round of interaction with calreticulin (calnexin not shown, denoted by a 1). Trimming of the final glucose by glucosidase II yields a non-glucosylated N-glycan. If recognized as non-native primarily by UDP-glucose:glycoprotein glucosyltransferase (UGGT)1, and to a lesser extent UGGT2, IGF-1R may then be reglucosylated, supporting a second round of interaction with calreticulin (denoted by a 2<sup>+</sup>). Multiple rounds of trimming, reglucosylation, and binding to calnexin or calreticulin can occur until proper folding and trafficking. Under this system, IGF-1R is efficiently trafficked from the ER and mature IGF-1R accumulates. When glucosidase I/II activity is inhibited by treatment with deoxynojirimycin (DNJ) in WT cells, all rounds of binding to the lectin chaperones are ablated and IGF-1R is retained in the ER, yielding primarily pro IGF-1R. In <italic>UGGT1/2<sup>-/-</sup></italic> cells, initial binding to calnexin or calreticulin directed by glucosidases I/II trimming is maintained but rebinding via reglucosylation does not occur. Under this system, IGF-1R is inefficiently trafficked from the ER. In <italic>ALG6<sup>-/-</sup></italic> cells, N-glycans are transferred without glucoses, eliminating the initial round of binding to calnexin or calreticulin by glucosidases trimming. Only the second round of binding is supported by UGGT1, and to a lesser extend UGGT2, mediated reglucosylation. Upon treatment with DNJ, reglucosylated IGF-1R may persistently interact with the lectin chaperones resulting in ER retention.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-fig6-v2.tif"/></fig><p><italic>ALG6<sup>-/-</sup></italic> cells permitted the trapping of substrates glucosylated by the UGGTs. These cells are also expected to support the enhancement of glucosylation of glycoproteins that are more reliant upon early lectin chaperone intervention. As observed for IGF-1R, the lack of early intervention of the lectin chaperones directed by glucosidase trimming might lead to misfolding, thereby creating a better substrate for the UGGTs. The use of the cell lines lacking the ability to initiate lectin chaperone binding by the glucosidase trimming (<italic>Alg6<sup>-/-</sup></italic>) or UGGT reglucosylation (<italic>UGGT<sup>-/-</sup></italic> cells) provides a platform to delineate which part of the lectin chaperone binding cycle has the greatest influence of glycoprotein maturation and trafficking.</p><p>Understanding the proteins that interact with or rely on chaperone systems will advance our understanding of protein homeostasis (<xref ref-type="bibr" rid="bib38">Houry et al., 1999</xref>; <xref ref-type="bibr" rid="bib42">Kerner et al., 2005</xref>). Large multi-domain proteins such as IGF-1R and many of the other substrates of the UGGTs have apparently evolved to utilize the lectin chaperone system to help direct their complex folding trajectories. The co-evolution of chaperones and their substrates has led to the expansion of the complexity of the proteome for multicellular organisms (<xref ref-type="bibr" rid="bib9">Balchin et al., 2016</xref>; <xref ref-type="bibr" rid="bib64">Rebeaud et al., 2020</xref>). The large group of substrates of the UGGTs identified here represents glycoproteins that utilize multiple rounds of lectin chaperone engagement for proper maturation and are likely more prone to misfold under stress. Future studies will determine if this increased vulnerability makes these substrates more susceptible to misfold under disease conditions where cell homeostasis is challenged.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type <break/>(species) or <break/>resource</th><th valign="top">Designation</th><th valign="top">Source or <break/>reference</th><th valign="top">Identifiers</th><th valign="top">Additional <break/>information</th></tr></thead><tbody><tr><td valign="top">Strain, strain background (<italic>Escherichia coli</italic>)</td><td valign="top">Top10</td><td valign="top">Thermo Fisher</td><td valign="top">Cat# C404003</td><td valign="top">Chemically competent</td></tr><tr><td valign="top">Cell line (<italic>H. sapiens</italic>)</td><td valign="top">Hek293-EBNA1-6E</td><td valign="top">This paper</td><td valign="top">(RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/CVCL_HF20">CVCL_HF20</ext-link>)</td><td valign="top">Experimental results</td></tr><tr><td valign="top">Cell line (<italic>H. sapiens</italic>)</td><td valign="top">Hek293-EBNA1-6E <italic>ALG6<sup>-/-</sup></italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top">Experimental results</td></tr><tr><td valign="top">Cell line (<italic>H. sapiens</italic>)</td><td valign="top">Hek293-EBNA1-6E <italic>ALG6/UGGT1<sup>-/-</sup></italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top">Experimental results</td></tr><tr><td valign="top">Cell line <break/>(<italic>H. sapiens</italic>)</td><td valign="top">Hek293-EBNA1-6E <italic>ALG6/UGGT2<sup>-/-</sup></italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top">Experimental results</td></tr><tr><td valign="top">Cell line (<italic>H. sapiens</italic>)</td><td valign="top">Hek293-EBNA1-6E <italic>ALG6/UGGT1/2<sup>-/-</sup></italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top">Experimental results</td></tr><tr><td valign="top">Cell line (<italic>H. sapiens</italic>)</td><td valign="top">Hek293-EBNA1-6E <italic>UGGT1<sup>-/-</sup></italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top">Experimental results</td></tr><tr><td valign="top">Cell line (<italic>H. sapiens</italic>)</td><td valign="top">Hek293-EBNA1-6E <italic>UGGT2<sup>-/-</sup></italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top">Experimental results</td></tr><tr><td valign="top">Cell line (<italic>H. sapiens</italic>)</td><td valign="top">Hek293-EBNA1-6E <italic>UGGT1/2<sup>-/-</sup></italic></td><td valign="top">This paper</td><td valign="top"/><td valign="top">Experimental results</td></tr><tr><td valign="top">Antibody</td><td valign="top">IGF-1 receptor β (D23H3) <break/>(rabbit monoclonal)</td><td valign="top">Cell Signaling</td><td valign="top">Cat # 9750</td><td valign="top">WB (1:1000) <break/>IP (1:1000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">IGF-IIR/CI-M6PR (D3V8C) <break/>(rabbit monoclonal)</td><td valign="top">Cell Signaling</td><td valign="top">Cat# 14364</td><td valign="top">WB (1:1000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">β-hexosaminidase subunit β (EPR7978) <break/>(rabbit monoclonal)</td><td valign="top">Abcam</td><td valign="top">Cat# (ab140649)</td><td valign="top">WB (1:500)</td></tr><tr><td valign="top">Antibody</td><td valign="top">BiP (C50B12) <break/>(rabbit monoclonal)</td><td valign="top">Cell Signaling</td><td valign="top">Cat# 3177</td><td valign="top">WB (1:1000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">ENPP1 (N2C2) <break/>(rabbit polyclonal)</td><td valign="top">Genetex</td><td valign="top">Cat# GTX103447</td><td valign="top">WB (1:500)</td></tr><tr><td valign="top">Antibody</td><td valign="top">UGGT1 <break/>(rabbit polyclonal)</td><td valign="top">Genetex</td><td valign="top">Cat# GTX66459</td><td valign="top">WB (1:1000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Glyceraldehyde 3-Phosphate <break/>(mouse monoclonal)</td><td valign="top">Millipore Sigma</td><td valign="top">Cat# (MAB374)</td><td valign="top">WB (1:1000)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pGEX-3X-GST-CRT (plasmid)</td><td valign="top"><xref ref-type="bibr" rid="bib8">Baksh and Michalak, 1991</xref></td><td valign="top"/><td valign="top">Available from the Hebert lab upon request</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pGEX-3X-GST-CRT-Y109A (plasmid)</td><td valign="top">This paper</td><td valign="top"/><td valign="top">Available from the Hebert lab upon request</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">gh260</td><td valign="top"><xref ref-type="bibr" rid="bib55">Narimatsu et al., 2018</xref></td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/Addgene_106851">Addgene_106851</ext-link></td><td valign="top">gRNA for ALG6<sup>-/-</sup></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">gh172</td><td valign="top"><xref ref-type="bibr" rid="bib55">Narimatsu et al., 2018</xref></td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/Addgene_106833">Addgene_106833</ext-link></td><td valign="top">gRNA for UGGT1<sup>-/-</sup></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">gh173</td><td valign="top"><xref ref-type="bibr" rid="bib55">Narimatsu et al., 2018</xref></td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/Addgene_106834">Addgene_106834</ext-link></td><td valign="top">gRNA for UGGT2<sup>-/-</sup></td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">Cas9-GFP <break/>CAS9PBKS</td><td valign="top"><xref ref-type="bibr" rid="bib48">Lonowski et al., 2017</xref></td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/Addgene_68371">Addgene_68371</ext-link></td><td valign="top">Cas9 for CRISPR-mediated knockout</td></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top">CRT-Y109A_F</td><td valign="top">This paper</td><td valign="top">PCR primers</td><td valign="top">GGGGGCGGCGCCGTGAAGCT</td></tr><tr><td valign="top">Sequence-based reagent</td><td valign="top">CRT-Y109A_R</td><td valign="top">This paper</td><td valign="top">PCR primers</td><td valign="top">CCGGAAACAGCTTCACGTAGCCGC</td></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">TMT10plex, 0.8 mg</td><td valign="top">Thermo Fisher</td><td valign="top">Cat# 90110</td><td valign="top"/></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">TMT6plex, 0.8 mg</td><td valign="top">Thermo Fisher</td><td valign="top">Cat# 90061</td><td valign="top"/></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">BCA protein quantification kit</td><td valign="top">Pierce</td><td valign="top">Cat# 23227</td><td valign="top"/></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">C18 tips</td><td valign="top">Pierce</td><td valign="top">Cat # 87784</td><td valign="top"/></tr><tr><td valign="top">Commercial assay or kit</td><td valign="top">Quantitative colorimetric peptide assay</td><td valign="top">Pierce</td><td valign="top">Cat # 23275</td><td valign="top"/></tr></tbody></table></table-wrap><sec id="s4-1"><title>Reagents</title><p>Antibodies used were: rabbit monoclonal IGF-1 receptor β (D23H3, Cell Signaling), rabbit monoclonal IGF-IIR/CI-M6PR (D3V8C, Cell signaling), rabbit monoclonal BiP (C50B12, Cell Signaling), rabbit monoclonal β-hexosaminidase subunit β (HEXB) (EPR7978, Abcam), rabbit polyclonal ENPP1 (N2C2, Genetex), rabbit polyclonal UGGT1 (GTX66459, Genetex), mouse monoclonal glyceraldehyde 3-phosphate (MAB374, Millipore Sigma), and IRDye × anti-rabbit secondary (LiCor). All chemicals were purchased from Millipore-Sigma, except where indicated.</p></sec><sec id="s4-2"><title>Cell culture</title><p>HEK293-EBNA1-6E cells were employed and used as the parental line to create all CRISPR/Cas9 edited lines (<xref ref-type="bibr" rid="bib78">Tom et al., 2008</xref>). Cells were cultured in DMEM (Sigma) supplemented with certified 10% fetal bovine serum (Gibco) at 37°C at 5% CO<sub>2</sub>. Cells were tested for the presence of mycoplasma using a universal mycoplasma detection kit (ATCC, Cat # 30–012K).</p></sec><sec id="s4-3"><title>CRISPR/Cas9-mediated knock outs</title><p>HEK293-EBNA1-6E <italic>ALG6<sup>-/</sup></italic><sup>-</sup>, <italic>ALG6/UGGT1<sup>-/-</sup></italic>, <italic>ALG6/UGGT2<sup>-/-</sup></italic>, <italic>ALG6/UGGT1/UGGT2<sup>-/-</sup></italic>, <italic>UGGT1<sup>-/-</sup></italic>, <italic>UGGT2<sup>-/-</sup></italic>, and <italic>UGGT1/2<sup>-/-</sup></italic> cells were generated via CRISPR/Cas9 using gRNA plasmids gh260, gh172, and gh173, and Cas9-GFP plasmid CAS9PBKS (<xref ref-type="bibr" rid="bib48">Lonowski et al., 2017</xref>; <xref ref-type="bibr" rid="bib55">Narimatsu et al., 2018</xref>). Plasmids gh260 (106851), gh172 (106833), gh173 (106834), and CAS9PBKS (68371) were from Addgene. Knockout cell lines were generated by co-transfecting HEK293-EBNA1-6E cells at 70% confluency in a 10 cm plate with 7 μg of both the associated gRNA and Cas9-GFP plasmid, using a 2.5 μg of PEI per 1 μg of plasmid. Cells were grown for 48 hr prior to trypsinization and collection. After trypsinization, cells were washed twice with sorting buffer (1% FBS, 1 mM EDTA, PBS) and resuspended in sorting buffer at approximately 1 million cells per milliliter. Cells were bulk separated using flow assisted cell sorting based on the top 10% of Cas9-GFP expressing cells (FACS Aria II SORP, Becton Dickinson and Company). Cells were then plated at 5,000, 10,000, and 20,000 cells per 10 cm plate in pre-conditioned DMEM media with 20% FBS. Colonies derived from a single cell were isolated using cell cloning cylinders (Bellco Glass), trypsinized from the plate, and further passaged. Knockouts were confirmed by immunoblotting and staining for UGGT1 or, where antibodies were not available, isolating genomic DNA using a genomic DNA isolation kit (PureLink genomic DNA mini kit, Thermo Fisher), PCR amplification of the genomic DNA region of interest, and insertion of genomic DNA into pcDNA3.1−. Plasmids were then sequenced for conformation (Genewiz).</p></sec><sec id="s4-4"><title>GST-CRT purification</title><p>The plasmid for pGEX-3X GST-CRT was from Prof. M. Michalak (University of Alberta). pGEX-3X GST-CRT-Y109A was generated by site-directed mutagenesis. GST-CRT was expressed in BL21 <italic>E. coli</italic> cells in LB medium containing ampicillin at 100 μg/ml. Cultures were grown at 37°C with shaking until an O.D. of A<sub>600</sub> = 0.6. Protein expression was then induced by treating cultures with 8.32 mg/l IPTG for 2 hr. Cultures were centrifuged at 3000 g for 10 min. Cell pellets were lysed with cold lysis buffer (1 mM phenylmethylsulfonyl fluoride, 2% Triton X-100, PBS pH 7.4) and resuspended. Resuspended cells were lysed in a microfluidizer (110L, Microfluidics) at 18,000 psi for two passes. The cell lysate was centrifuged for 40 min at 8000 g at 4°C. Lysate was filtered through a 0.45 μm filter. Two milliliters bed volume glutathione sepharose beads (GE Lifesciences, Cat# GE17-0756-01) per liter of lysate was equilibrated in wash buffer (1% Triton X-100, 1 mM PMSF, PBS pH 7.4), added to cleared lysate, and rotated at 4°C for 3 hr. Beads were precipitated through centrifugation at 1000 g for 5 min at 4°C. The beads were washed twice in wash buffer. One milliliter of elution buffer (10 mM reduced glutathione, 1 mM PMSF, 50 mM Tris pH 8.5) was added to beads for resuspension and incubated for 5 min at 4°C. Beads were precipitated by centrifugation at 1000 g for 5 min 4°C. The eluate was collected and a total of six elutions were collected. Resulting eluate was tested for purity and protein amount on a reducing SDS-PAGE and stained with Imperial protein stain (Thermo Fisher, Cat# 24617). Elutions were then combined and protein concentration was quantified by a Bradford assay (Bio-Rad). Purified protein was then stored at −80°C in a 20% glycerol PBS buffer at 1 mg/ml.</p></sec><sec id="s4-5"><title>GST-CRT isolation and TMT mass spectrometry sample preparation</title><p>Five 10 cm plates were seeded with 3.5 million cells and allowed to grow for 48 hr. Cells were treated with N-butyldeoxynojirimycin hydrochloride (DNJ) (Cayman Chemicals, Cat # 21065) at 500 μM for 1 hr. Prior to lysis, the media was aspirated and cells were washed once with filter sterilized PBS. Cells were lysed in 1 ml of lysis buffer (20 mM MES, 100 mM NaCl, 30 mM Tris pH 7.5, 0.5% Triton X-100) per plate. Samples were shaken at 4°C for 5 min and centrifuged at 20,800 g at 4°C for 5 min. Lysate was pre-cleared with 25 μl bed volume of buffer-equilibrated glutathione beads per 1 ml of lysate under rotation for 1 hr at 25 μl bed volume. Beads were precipitated by centrifugation at 950 g at 4°C for 5 min. Glutathione beads were pre-incubated with either GST-CRT or GST-CRT-Y109A by equilibrating 25 μl bed volume/pull-down glutathione beads with lysis buffer. Beads were incubated with 100 μg of purified GST-CRT/pull-down under gentle rotation at 4°C for 3 hr and then centrifuged at 950 g at 4°C for 5 min and washed twice with lysis buffer. Supernatant was collected and split in half, with one half incubated for 14 hr at 4°C under gentle rotation with glutathione beads pre-incubated with GST-CRT and the other half under the same conditions with GST-CRT-Y109A.</p><p>After incubation with GST-CRT beads, samples were washed once in lysis buffer without protease inhibitors and twice in 100 mM triethylammonium bicarbonate (Thermo Fisher Cat# 90114). After the final wash, samples were incubated with 10 μl of 50 mM DTT (Pierce, Cat# A39255) for 1 hr at room temperature under gentle agitation. Samples were treated with 2 μl of 125 mM iodoacetamide (Pierce, Cat# A39271) and incubated for 20 min under gentle agitation, protected from light. Samples were digested with 5 μg of trypsin (Promega, Cat# V5280) at 37°C overnight under agitation. Peptide concentration was quantified using a BCA protein quantification kit (Pierce, Cat# 23227). 10plex or 6plex TMT (Thermo Fisher 0.8 mg) were resuspended in mass spectrometry grade acetonitrile and was added to digested peptide and incubated for 1 hr at room temperature, per manufacturer’s instructions. Labeling was quenched by adding hydroxylamine to 0.25% and incubating for 15 min at room temperature. Labeled samples were pooled, treated with 1,000 units of glycerol-free PNGaseF (NEB, Cat# P0705S), and incubated for 2 hr at 37°C. Samples were cleaned using C18 tips (Pierce, Cat# 87784) and eluted in 75% mass spectrometry grade acetonitrile, 0.1% formic acid (TCI Chemicals). Sample peptide concentration was then quantified using a colorimetric assay (Pierce, Cat# 23275).</p></sec><sec id="s4-6"><title>Mass spectrometry data acquisition</title><p>An aliquot of each sample equivalent to 3 μg was loaded onto a trap column (Acclaim PepMap 100 pre-column, 75 μm × 2 cm, C18, 3 μm, 100 Å, Thermo Scientific) connected to an analytical column (Acclaim PepMap RSLC column C18 2 μm, 100 Å, 50 cm × 75 μm ID, Thermo Scientific) using the autosampler of an Easy nLC 1000 (Thermo Scientific) with solvent A consisting of 0.1% formic acid in water and solvent B, 0.1% formic acid in acetonitrile. The peptide mixture was gradient eluted into an Orbitrap Fusion mass spectrometer (Thermo Scientific) using a 180 min gradient from 5 to 40%B (A: 0.1% formic acid in water, B:0.1% formic acid in acetonitrile) followed by a 20 min column wash with 100% solvent B. The full scan MS was acquired over range 400–1400 m/z with a resolution of 120,000 (@ m/z 200), AGC target of 5e5 charges, and a maximum ion time of 100 ms and 2 s cycle time. Data-dependent MS/MS scans were acquired in the linear ion trap using CID with a normalized collision energy 35%. For quantitation of scans, synchronous precursor selection was used to select 10 most abundant product ions for subsequent MS^three using AGC target 5e4 and fragmentation using HCD with NCE 55% and resolution in the Orbitrap 60,000. Dynamic exclusion of each precursor ion for 30 s was employed. Data were analyzed using Proteome Discoverer 2.4.1 (Thermo Scientific). Raw spectral data are deposited to MassIVE (<ext-link ext-link-type="uri" xlink:href="ftp://massive.ucsd.edu/MSV000086514/">ftp://massive.ucsd.edu/MSV000086514/</ext-link>).</p></sec><sec id="s4-7"><title>Computational determination of the human N-glycoproteome and substrates analyses</title><p>The human N-glycoproteome was defined by the total predicted N-glycosylated proteins from the reviewed human proteome from the UniprotKB (accessed 8/10/2020). Both manual and automated curations of the data set were performed to remove mitochondrial proteins as well as proteins smaller than 50 amino acids from the data set. All annotations were derived directly from the UniprotKB information and annotations available for these proteins were analyzed in R. Determination of the pI values were performed by the pI/MW tool on the Expasy database.</p></sec><sec id="s4-8"><title>Reglucosylation validation assay</title><p>Five 10 cm plates were seeded with 3.5 million cells each and allowed to grow for 48 hr. Cells were treated with DNJ at 500 μM for 14 hr. Prior to lysis, the media was aspirated and cells were washed once with filter sterilized PBS. Cells were lysed in 1 ml of MNT (20 mM MES, 100 mM NaCl, 30 mM Tris pH 7.5, 0.5% Triton X-100) with protease inhibitors (50 µM Calpain inhibitor I, 1 μM pepstatin, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 400 μM PMSF) and 20 mM N-ethyl maleimide, shaken vigorously for 5 min at 4°C, and centrifuged for 5 min at 17,000 g at 4°C. Fifty microliter bed volume of glutathione beads was added to each pull-down and incubated for 1 hr at 4°C under gentle rotation. Beads were then precipitated by centrifugation at 1000 g for 5 min at 4°C. Supernatant was collected with 10% used for WCL and the remainder split evenly between GST-CRT and GST-CRT-Y109A conjugated glutathione beads, which were generated as previously described, and incubated for 16 hr at 4°C under gentle rotation. Beads were precipitated at 1000 g for 5 min at 4°C. Supernatant was aspirated and beads were washed twice with lysis buffer without protease inhibitors. Beads were treated with reducing sample buffer (30 mM Tris-HCl pH 6.8, 9% SDS, 15% glycerol, 0.05% bromophenol blue). WCLs were trichloroacetic acid (TCA) precipitated by adding TCA to cell lysate to a final concentration of 10%. Cell lysate was then briefly rotated and allowed to incubate on ice for 15 min before centrifugation at 17,000 g for 10 min at 4°C. Supernatants were aspirated and washed twice with cold acetone and centrifuged at 17,000 g for 10 min at 4°C. Supernatants were aspirated and the remaining precipitant was allowed to dry for 5 min at room temperature and briefly at 65°C. Precipitated protein was resuspended in sample buffer. Samples were resolved on a 9% reducing SDS-PAGE and imaged by immunoblotting.</p><p>Quantification of immunoblots was conducted using ImageJ software. The amount of protein found in the GST-CRT-Y109A lane was subtracted from the amount of protein in the associated WT GST-CRT lane. This value was then divided by the amount of protein found in the WCL multiplied by 5 to account for the dilution factor and then multiplied by 100. The resulting value yielded the percent reglucosylation in each cell type.</p></sec><sec id="s4-9"><title>Metabolic labeling and IGF-1R immunoprecipitation</title><p>Two million cells were plated in 6 cm plates and allowed to grow for 40 hr. Cells were pulse labeled for 1 hr with 120 μCi of EasyTag Express<sup>35</sup>S Protein Labeling Mix [<sup>35</sup>S]-Cys/Met (PerkinElmer; Waltham, MA). Immediately after the radioactive pulse, cells were washed with PBS and either lysed in MNT with a protease inhibitor cocktail (Halt protease and phosphatase inhibitor single-use cocktail, Thermo Fisher) and 20 mM NEM, or chased for indicated time using regular growth media. Where indicated, cells were treated with 500 μM DNJ for 30 min prior to [<sup>35</sup>S]-Cys/Met labeling and through the chase. Cell lysates were shaken for 5 min at 4°C, centrifuged at 17,000 g for 5 min at 4°C, and the supernatants were collected. Samples were pre-cleared with a 20 μl bed volume of protein-A sepharose beads (GE Healthcare) by end-over-end rotation for 1 hr at 4°C. The supernatants were collected and incubated with a 30 μl bed volume of protein-A-sepharose beads and 1.5 μl of α-IGF-1 receptor β (D23H3) XP (Cell Signaling) per sample. Samples were washed with MNT without protease inhibitors or NEM and eluted in sample buffer. Samples were then resolved on a 9% reducing SDS-PAGE, imaged using a GE Typhoon FLA 9500 phosphorimager (GE Healthcare), and quantified using ImageJ.</p></sec><sec id="s4-10"><title>Glycosylation assay</title><p>Three million cells for each indicated cell line were plated in a 10 cm plate and allowed to grow for 48 hr. Cells were lysed in 300 μl RIPA buffer (1% SDS, 1% NP-40, 0.5% sodium deoxycholate, 150 mM NaCl, 50 mM Tris-HCl pH 8.0) with protease inhibitor cocktail and 20 mM NEM. Samples were then sonicated for 20 s at 40% amplitude (Sonics vibra cell VC130PB), shaken vigorously for 5 min, and centrifuged for 5 min at 17,000 g. Twenty microliters of the resulting lysate was heated at 95°C for 5 min and treated with either 10 μl of PNGaseF or EndoH for 1 hr at 37°C, according to the manufacturer’s instructions (NEB). Samples were diluted 1:1 into sample buffer and imaged by immunoblotting.</p></sec><sec id="s4-11"><title>RNAseq library preparation and sequencing</title><p>Three million cells for each indicated cell line were plated in 10 cm plates and allowed to grow for 48 hr. Cells were then lysed in TRIzol buffer and RNA was isolated using RNA Clean Concentrate Kit with in-column DNase-I treatment (Zymo Research Corp), following manufacturer's instructions. The quantity of RNA was assayed on Qubit using RNA BR assay (Life Technologies Corp), and quality was assessed on Agilent 2100 Bioanalyzer using RNA 6000 Nano Assay (Agilent Technologies Inc). Total RNA was used to isolate poly(A) mRNA using NEBNext Poly(A) mRNA Magnetic Isolation Module, and libraries were prepared using NEBNext UltraII Directional RNA Library Prep Kit for Illumina (New England Biolabs) following manufacturer's instructions. The quantity of library was assayed using Qubit DNA HS assay (Life Technologies Corp), and quality was analyzed on Bioanalyzer (Agilent Technologies Inc). Libraries were sequenced on Illumina NextSeq 500 platform using NextSeq 500/550 High Output v2 kit (150 cycles) with 76 bp paired-end sequencing chemistry.</p><p>Sequence quality was assessed using FastQC (<xref ref-type="bibr" rid="bib4">Andrews, 2010</xref>) and MultiQC (<xref ref-type="bibr" rid="bib26">Ewels et al., 2016</xref>). Reads were aligned to the hg38 human reference genome using STAR (<xref ref-type="bibr" rid="bib25">Dobin et al., 2013</xref>). Transcript abundance was quantified using RSEM (<xref ref-type="bibr" rid="bib47">Li and Dewey, 2011</xref>) and normalized to counts per million (CPM) in R using the edgeR software package (<xref ref-type="bibr" rid="bib66">Robinson et al., 2010</xref>). Analyses to compare gene expression between cell types was conducted in Excel by finding the average CPM in the pool of genes of interest for the associated cell type and determining the standard deviation away from the average for each gene of interest. Raw RNAseq data are deposited to NCBI Gene Expression Omnibus at <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE162262">https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE162262</ext-link>.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>This work was supported by the National Institutes of Health under award number (GM086874 to DNH); and a Chemistry-Biology Interface program training grant (T32GM008515 to BMA and NPC). Mass spectral data were obtained at the University of Massachusetts Mass Spectrometry Center (Director Dr. Steve Eyles). Flow cytometry and RNAseq data were conducted at the University of Massachusetts Flow Cytometry Core Facility (Director Dr. Amy Burnside) and the Genomics Resource Laboratory (Director Dr. Ravi Ranjan), respectively. John Swenson conducted the analysis of raw RNAseq data.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Resources, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Data curation, Formal analysis, Validation, Visualization, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Resources, Validation, Investigation</p></fn><fn fn-type="con" id="con4"><p>Resources</p></fn><fn fn-type="con" id="con5"><p>Conceptualization, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="sdata1"><label>Source data 1.</label><caption><title>Number of glycans per 100 amino acids for UGGT substrates and N-glycoproteome.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-data1-v2.xlsx"/></supplementary-material><supplementary-material id="sdata2"><label>Source data 2.</label><caption><title>Protein feature analysis of UGGT substrates and N-glycoproteome.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-data2-v2.xlsx"/></supplementary-material><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>UGGT1 and UGGT2 expression.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-supp1-v2.xlsx"/></supplementary-material><supplementary-material id="supp2"><label>Supplementary file 2.</label><caption><title>mRNA expression analysis of UGGT1 and UGGT2 substrates.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-supp2-v2.xlsx"/></supplementary-material><supplementary-material id="supp3"><label>Supplementary file 3.</label><caption><title>Beta-hexosminidase subunit beta expression trafficking and hypoglycosylation and CI-M6PR hypoglycosylation.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-63997-supp3-v2.xlsx"/></supplementary-material><supplementary-material id="supp4"><label>Supplementary file 4.</label><caption><title>mRNA expression of lysosomal preferential UGGT2 substrates.</title></caption><media mime-subtype="octet-stream" mimetype="application" xlink:href="elife-63997-supp4-v2.csv"/></supplementary-material><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="docx" mimetype="application" xlink:href="elife-63997-transrepform-v2.docx"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>All data generated during this study are included in the manuscript or supporting files.</p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Adams</surname> <given-names>BM</given-names></name><name><surname>Oster</surname> <given-names>ME</given-names></name><name><surname>Hebert</surname> <given-names>DN</given-names></name></person-group><year iso-8601-date="2019">2019a</year><article-title>Protein quality control in the endoplasmic reticulum</article-title><source>The Protein Journal</source><volume>38</volume><fpage>317</fpage><lpage>329</lpage><pub-id pub-id-type="doi">10.1007/s10930-019-09831-w</pub-id><pub-id pub-id-type="pmid">31004255</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Adams</surname> <given-names>BM</given-names></name><name><surname>Ke</surname> <given-names>H</given-names></name><name><surname>Gierasch</surname> <given-names>LM</given-names></name><name><surname>Gershenson</surname> <given-names>A</given-names></name><name><surname>Hebert</surname> <given-names>DN</given-names></name></person-group><year iso-8601-date="2019">2019b</year><article-title>Proper secretion of the serpin antithrombin relies strictly on thiol-dependent quality control</article-title><source>Journal of Biological Chemistry</source><volume>294</volume><fpage>18992</fpage><lpage>19011</lpage><pub-id pub-id-type="doi">10.1074/jbc.RA119.010450</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aebi</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>N-linked protein glycosylation in the ER</article-title><source>Biochimica Et Biophysica Acta (BBA) - Molecular Cell Research</source><volume>1833</volume><fpage>2430</fpage><lpage>2437</lpage><pub-id pub-id-type="doi">10.1016/j.bbamcr.2013.04.001</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="software"><person-group person-group-type="author"><name><surname>Andrews</surname> <given-names>S</given-names></name></person-group><year iso-8601-date="2010">2010</year><data-title>FastQC: a quality control tool for high throughput sequence data</data-title><source>Babraham Bioinformatics</source><version designator="3">GPL v3</version><ext-link ext-link-type="uri" xlink:href="https://www.bioinformatics.babraham.ac.uk/projects/fastqc/">https://www.bioinformatics.babraham.ac.uk/projects/fastqc/</ext-link></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Arnold</surname> <given-names>SM</given-names></name><name><surname>Fessler</surname> <given-names>LI</given-names></name><name><surname>Fessler</surname> <given-names>JH</given-names></name><name><surname>Kaufman</surname> <given-names>RJ</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Two homologues encoding human UDP-glucose:glycoprotein glucosyltransferase differ in mRNA expression and enzymatic activity</article-title><source>Biochemistry</source><volume>39</volume><fpage>2149</fpage><lpage>2163</lpage><pub-id pub-id-type="doi">10.1021/bi9916473</pub-id><pub-id pub-id-type="pmid">10694380</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Arnold</surname> <given-names>SM</given-names></name><name><surname>Kaufman</surname> <given-names>RJ</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>The noncatalytic portion of human UDP-glucose:glycoprotein glucosyltransferase I confers UDP-glucose binding and transferase function to the catalytic domain</article-title><source>Journal of Biological Chemistry</source><volume>278</volume><fpage>43320</fpage><lpage>43328</lpage><pub-id pub-id-type="doi">10.1074/jbc.M305800200</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bajaj</surname> <given-names>L</given-names></name><name><surname>Sharma</surname> <given-names>J</given-names></name><name><surname>di Ronza</surname> <given-names>A</given-names></name><name><surname>Zhang</surname> <given-names>P</given-names></name><name><surname>Eblimit</surname> <given-names>A</given-names></name><name><surname>Pal</surname> <given-names>R</given-names></name><name><surname>Roman</surname> <given-names>D</given-names></name><name><surname>Collette</surname> <given-names>JR</given-names></name><name><surname>Booth</surname> <given-names>C</given-names></name><name><surname>Chang</surname> <given-names>KT</given-names></name><name><surname>Sifers</surname> <given-names>RN</given-names></name><name><surname>Jung</surname> <given-names>SY</given-names></name><name><surname>Weimer</surname> <given-names>JM</given-names></name><name><surname>Chen</surname> <given-names>R</given-names></name><name><surname>Schekman</surname> <given-names>RW</given-names></name><name><surname>Sardiello</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>A CLN6-CLN8 complex recruits lysosomal enzymes at the ER for golgi transfer</article-title><source>The Journal of Clinical Investigation</source><volume>130</volume><fpage>4118</fpage><lpage>4132</lpage><pub-id pub-id-type="doi">10.1172/JCI130955</pub-id><pub-id pub-id-type="pmid">32597833</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Baksh</surname> <given-names>S</given-names></name><name><surname>Michalak</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="1991">1991</year><article-title>Expression of calreticulin in <italic>Escherichia coli</italic> and identification of its Ca2+ binding domains</article-title><source>The Journal of Biological Chemistry</source><volume>266</volume><fpage>21458</fpage><lpage>21465</lpage><pub-id pub-id-type="pmid">1939178</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Balchin</surname> <given-names>D</given-names></name><name><surname>Hayer-Hartl</surname> <given-names>M</given-names></name><name><surname>Hartl</surname> <given-names>FU</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>In vivo aspects of protein folding and quality control</article-title><source>Science</source><volume>353</volume><elocation-id>aac4354</elocation-id><pub-id pub-id-type="doi">10.1126/science.aac4354</pub-id><pub-id pub-id-type="pmid">27365453</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Balchin</surname> <given-names>D</given-names></name><name><surname>Hayer-Hartl</surname> <given-names>M</given-names></name><name><surname>Hartl</surname> <given-names>FU</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Recent advances in understanding catalysis of protein folding by molecular chaperones</article-title><source>FEBS Letters</source><volume>594</volume><fpage>2770</fpage><lpage>2781</lpage><pub-id pub-id-type="doi">10.1002/1873-3468.13844</pub-id><pub-id pub-id-type="pmid">32446288</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barlowe</surname> <given-names>C</given-names></name><name><surname>Helenius</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Cargo capture and bulk flow in the early secretory pathway</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>32</volume><fpage>197</fpage><lpage>222</lpage><pub-id pub-id-type="doi">10.1146/annurev-cellbio-111315-125016</pub-id><pub-id pub-id-type="pmid">27298089</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Beck</surname> <given-names>M</given-names></name><name><surname>Hurt</surname> <given-names>E</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>The nuclear pore complex: understanding its function through structural insight</article-title><source>Nature Reviews Molecular Cell Biology</source><volume>18</volume><fpage>73</fpage><lpage>89</lpage><pub-id pub-id-type="doi">10.1038/nrm.2016.147</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Braunger</surname> <given-names>K</given-names></name><name><surname>Pfeffer</surname> <given-names>S</given-names></name><name><surname>Shrimal</surname> <given-names>S</given-names></name><name><surname>Gilmore</surname> <given-names>R</given-names></name><name><surname>Berninghausen</surname> <given-names>O</given-names></name><name><surname>Mandon</surname> <given-names>EC</given-names></name><name><surname>Becker</surname> <given-names>T</given-names></name><name><surname>Förster</surname> <given-names>F</given-names></name><name><surname>Beckmann</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Structural basis for coupling protein transport and N-glycosylation at the mammalian endoplasmic reticulum</article-title><source>Science</source><volume>360</volume><fpage>215</fpage><lpage>219</lpage><pub-id pub-id-type="doi">10.1126/science.aar7899</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cacan</surname> <given-names>R</given-names></name><name><surname>Duvet</surname> <given-names>S</given-names></name><name><surname>Labiau</surname> <given-names>O</given-names></name><name><surname>Verbert</surname> <given-names>A</given-names></name><name><surname>Krag</surname> <given-names>SS</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Monoglucosylated oligomannosides are released during the degradation process of newly synthesized glycoproteins</article-title><source>Journal of Biological Chemistry</source><volume>276</volume><fpage>22307</fpage><lpage>22312</lpage><pub-id pub-id-type="doi">10.1074/jbc.M101077200</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Caramelo</surname> <given-names>JJ</given-names></name><name><surname>Castro</surname> <given-names>OA</given-names></name><name><surname>de Prat-Gay</surname> <given-names>G</given-names></name><name><surname>Parodi</surname> <given-names>AJ</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>The endoplasmic reticulum glucosyltransferase recognizes nearly native glycoprotein folding intermediates</article-title><source>Journal of Biological Chemistry</source><volume>279</volume><fpage>46280</fpage><lpage>46285</lpage><pub-id pub-id-type="doi">10.1074/jbc.M408404200</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Caramelo</surname> <given-names>JJ</given-names></name><name><surname>Parodi</surname> <given-names>AJ</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>A sweet code for glycoprotein folding</article-title><source>FEBS Letters</source><volume>589</volume><fpage>3379</fpage><lpage>3387</lpage><pub-id pub-id-type="doi">10.1016/j.febslet.2015.07.021</pub-id><pub-id pub-id-type="pmid">26226420</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cesani</surname> <given-names>M</given-names></name><name><surname>Lorioli</surname> <given-names>L</given-names></name><name><surname>Grossi</surname> <given-names>S</given-names></name><name><surname>Amico</surname> <given-names>G</given-names></name><name><surname>Fumagalli</surname> <given-names>F</given-names></name><name><surname>Spiga</surname> <given-names>I</given-names></name><name><surname>Filocamo</surname> <given-names>M</given-names></name><name><surname>Biffi</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Mutation update of <italic>ARSA</italic> and <italic>PSAP</italic> genes causing metachromatic leukodystrophy</article-title><source>Human Mutation</source><volume>37</volume><fpage>16</fpage><lpage>27</lpage><pub-id pub-id-type="doi">10.1002/humu.22919</pub-id><pub-id pub-id-type="pmid">26462614</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname> <given-names>W</given-names></name><name><surname>Helenius</surname> <given-names>J</given-names></name><name><surname>Braakman</surname> <given-names>I</given-names></name><name><surname>Helenius</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Cotranslational folding and calnexin binding during glycoprotein synthesis</article-title><source>PNAS</source><volume>92</volume><fpage>6229</fpage><lpage>6233</lpage><pub-id pub-id-type="doi">10.1073/pnas.92.14.6229</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cherepanova</surname> <given-names>N</given-names></name><name><surname>Shrimal</surname> <given-names>S</given-names></name><name><surname>Gilmore</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>N-linked glycosylation and homeostasis of the endoplasmic reticulum</article-title><source>Current Opinion in Cell Biology</source><volume>41</volume><fpage>57</fpage><lpage>65</lpage><pub-id pub-id-type="doi">10.1016/j.ceb.2016.03.021</pub-id><pub-id pub-id-type="pmid">27085638</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cherepanova</surname> <given-names>NA</given-names></name><name><surname>Venev</surname> <given-names>SV</given-names></name><name><surname>Leszyk</surname> <given-names>JD</given-names></name><name><surname>Shaffer</surname> <given-names>SA</given-names></name><name><surname>Gilmore</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Quantitative glycoproteomics reveals new classes of STT3A- and STT3B-dependent N-glycosylation sites</article-title><source>Journal of Cell Biology</source><volume>218</volume><fpage>2782</fpage><lpage>2796</lpage><pub-id pub-id-type="doi">10.1083/jcb.201904004</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chng</surname> <given-names>WJ</given-names></name><name><surname>Gualberto</surname> <given-names>A</given-names></name><name><surname>Fonseca</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>IGF-1R is overexpressed in poor-prognostic subtypes of multiple myeloma</article-title><source>Leukemia</source><volume>20</volume><fpage>174</fpage><lpage>176</lpage><pub-id pub-id-type="doi">10.1038/sj.leu.2403997</pub-id><pub-id pub-id-type="pmid">16239907</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Daniels</surname> <given-names>R</given-names></name><name><surname>Kurowski</surname> <given-names>B</given-names></name><name><surname>Johnson</surname> <given-names>AE</given-names></name><name><surname>Hebert</surname> <given-names>DN</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>N-linked glycans direct the cotranslational folding pathway of influenza hemagglutinin</article-title><source>Molecular Cell</source><volume>11</volume><fpage>79</fpage><lpage>90</lpage><pub-id pub-id-type="doi">10.1016/S1097-2765(02)00821-3</pub-id><pub-id pub-id-type="pmid">12535523</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dell'Angelica</surname> <given-names>EC</given-names></name><name><surname>Payne</surname> <given-names>GS</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Intracellular cycling of lysosomal enzyme receptors: cytoplasmic tails' tales</article-title><source>Cell</source><volume>106</volume><fpage>395</fpage><lpage>398</lpage><pub-id pub-id-type="doi">10.1016/s0092-8674(01)00470-6</pub-id><pub-id pub-id-type="pmid">11525725</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Desbois-Mouthon</surname> <given-names>C</given-names></name><name><surname>Wendum</surname> <given-names>D</given-names></name><name><surname>Cadoret</surname> <given-names>A</given-names></name><name><surname>Rey</surname> <given-names>C</given-names></name><name><surname>Leneuve</surname> <given-names>P</given-names></name><name><surname>Blaise</surname> <given-names>A</given-names></name><name><surname>Housset</surname> <given-names>C</given-names></name><name><surname>Tronche</surname> <given-names>F</given-names></name><name><surname>Le Bouc</surname> <given-names>Y</given-names></name><name><surname>Holzenberger</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Hepatocyte proliferation during liver regeneration is impaired in mice with liver-specific IGF-1R knockout</article-title><source>The FASEB Journal</source><volume>20</volume><fpage>773</fpage><lpage>775</lpage><pub-id pub-id-type="doi">10.1096/fj.05-4704fje</pub-id><pub-id pub-id-type="pmid">16484330</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dobin</surname> <given-names>A</given-names></name><name><surname>Davis</surname> <given-names>CA</given-names></name><name><surname>Schlesinger</surname> <given-names>F</given-names></name><name><surname>Drenkow</surname> <given-names>J</given-names></name><name><surname>Zaleski</surname> <given-names>C</given-names></name><name><surname>Jha</surname> <given-names>S</given-names></name><name><surname>Batut</surname> <given-names>P</given-names></name><name><surname>Chaisson</surname> <given-names>M</given-names></name><name><surname>Gingeras</surname> <given-names>TR</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>STAR: ultrafast universal RNA-seq aligner</article-title><source>Bioinformatics</source><volume>29</volume><fpage>15</fpage><lpage>21</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/bts635</pub-id><pub-id pub-id-type="pmid">23104886</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ewels</surname> <given-names>P</given-names></name><name><surname>Magnusson</surname> <given-names>M</given-names></name><name><surname>Lundin</surname> <given-names>S</given-names></name><name><surname>Käller</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>MultiQC: summarize analysis results for multiple tools and samples in a single report</article-title><source>Bioinformatics</source><volume>32</volume><fpage>3047</fpage><lpage>3048</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btw354</pub-id><pub-id pub-id-type="pmid">27312411</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ferreira</surname> <given-names>CR</given-names></name><name><surname>Gahl</surname> <given-names>WA</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Lysosomal storage diseases</article-title><source>Translational Science of Rare Diseases</source><volume>2</volume><fpage>1</fpage><lpage>71</lpage><pub-id pub-id-type="doi">10.3233/TRD-160005</pub-id><pub-id pub-id-type="pmid">29152458</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ferris</surname> <given-names>SP</given-names></name><name><surname>Jaber</surname> <given-names>NS</given-names></name><name><surname>Molinari</surname> <given-names>M</given-names></name><name><surname>Arvan</surname> <given-names>P</given-names></name><name><surname>Kaufman</surname> <given-names>RJ</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>UDP-glucose:glycoprotein glucosyltransferase (UGGT1) promotes substrate solubility in the endoplasmic reticulum</article-title><source>Molecular Biology of the Cell</source><volume>24</volume><fpage>2597</fpage><lpage>2608</lpage><pub-id pub-id-type="doi">10.1091/mbc.e13-02-0101</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Forrester</surname> <given-names>A</given-names></name><name><surname>De Leonibus</surname> <given-names>C</given-names></name><name><surname>Grumati</surname> <given-names>P</given-names></name><name><surname>Fasana</surname> <given-names>E</given-names></name><name><surname>Piemontese</surname> <given-names>M</given-names></name><name><surname>Staiano</surname> <given-names>L</given-names></name><name><surname>Fregno</surname> <given-names>I</given-names></name><name><surname>Raimondi</surname> <given-names>A</given-names></name><name><surname>Marazza</surname> <given-names>A</given-names></name><name><surname>Bruno</surname> <given-names>G</given-names></name><name><surname>Iavazzo</surname> <given-names>M</given-names></name><name><surname>Intartaglia</surname> <given-names>D</given-names></name><name><surname>Seczynska</surname> <given-names>M</given-names></name><name><surname>van Anken</surname> <given-names>E</given-names></name><name><surname>Conte</surname> <given-names>I</given-names></name><name><surname>De Matteis</surname> <given-names>MA</given-names></name><name><surname>Dikic</surname> <given-names>I</given-names></name><name><surname>Molinari</surname> <given-names>M</given-names></name><name><surname>Settembre</surname> <given-names>C</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>A selective ER-phagy exerts procollagen quality control via a Calnexin-FAM134B complex</article-title><source>The EMBO Journal</source><volume>38</volume><elocation-id>e99847</elocation-id><pub-id pub-id-type="doi">10.15252/embj.201899847</pub-id><pub-id pub-id-type="pmid">30559329</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hammond</surname> <given-names>C</given-names></name><name><surname>Helenius</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>Folding of VSV G protein: sequential interaction with BiP and calnexin</article-title><source>Science</source><volume>266</volume><fpage>456</fpage><lpage>458</lpage><pub-id pub-id-type="doi">10.1126/science.7939687</pub-id><pub-id pub-id-type="pmid">7939687</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hartl</surname> <given-names>FU</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Protein misfolding diseases</article-title><source>Annual Review of Biochemistry</source><volume>86</volume><fpage>21</fpage><lpage>26</lpage><pub-id pub-id-type="doi">10.1146/annurev-biochem-061516-044518</pub-id><pub-id pub-id-type="pmid">28441058</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hebert</surname> <given-names>DN</given-names></name><name><surname>Foellmer</surname> <given-names>B</given-names></name><name><surname>Helenius</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Glucose trimming and reglucosylation determine glycoprotein association with calnexin in the endoplasmic reticulum</article-title><source>Cell</source><volume>81</volume><fpage>425</fpage><lpage>433</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(95)90395-X</pub-id><pub-id pub-id-type="pmid">7736594</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hebert</surname> <given-names>DN</given-names></name><name><surname>Foellmer</surname> <given-names>B</given-names></name><name><surname>Helenius</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Calnexin and calreticulin promote folding, delay oligomerization and suppress degradation of influenza hemagglutinin in microsomes</article-title><source>The EMBO Journal</source><volume>15</volume><fpage>2961</fpage><lpage>2968</lpage><pub-id pub-id-type="doi">10.1002/j.1460-2075.1996.tb00659.x</pub-id><pub-id pub-id-type="pmid">8670797</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hebert</surname> <given-names>DN</given-names></name><name><surname>Lamriben</surname> <given-names>L</given-names></name><name><surname>Powers</surname> <given-names>ET</given-names></name><name><surname>Kelly</surname> <given-names>JW</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>The intrinsic and extrinsic effects of N-linked glycans on glycoproteostasis</article-title><source>Nature Chemical Biology</source><volume>10</volume><fpage>902</fpage><lpage>910</lpage><pub-id pub-id-type="doi">10.1038/nchembio.1651</pub-id><pub-id pub-id-type="pmid">25325701</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hebert</surname> <given-names>DN</given-names></name><name><surname>Molinari</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>In and out of the ER: protein folding, quality control, degradation, and related human diseases</article-title><source>Physiological Reviews</source><volume>87</volume><fpage>1377</fpage><lpage>1408</lpage><pub-id pub-id-type="doi">10.1152/physrev.00050.2006</pub-id><pub-id pub-id-type="pmid">17928587</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Helenius</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>How N-linked oligosaccharides affect glycoprotein folding in the endoplasmic reticulum</article-title><source>Molecular Biology of the Cell</source><volume>5</volume><fpage>253</fpage><lpage>265</lpage><pub-id pub-id-type="doi">10.1091/mbc.5.3.253</pub-id><pub-id pub-id-type="pmid">8049518</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Helenius</surname> <given-names>A</given-names></name><name><surname>Aebi</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Roles of N-linked glycans in the endoplasmic reticulum</article-title><source>Annual Review of Biochemistry</source><volume>73</volume><fpage>1019</fpage><lpage>1049</lpage><pub-id pub-id-type="doi">10.1146/annurev.biochem.73.011303.073752</pub-id><pub-id pub-id-type="pmid">15189166</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Houry</surname> <given-names>WA</given-names></name><name><surname>Frishman</surname> <given-names>D</given-names></name><name><surname>Eckerskorn</surname> <given-names>C</given-names></name><name><surname>Lottspeich</surname> <given-names>F</given-names></name><name><surname>Hartl</surname> <given-names>FU</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Identification of in vivo substrates of the chaperonin GroEL</article-title><source>Nature</source><volume>402</volume><fpage>147</fpage><lpage>154</lpage><pub-id pub-id-type="doi">10.1038/45977</pub-id><pub-id pub-id-type="pmid">10647006</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Itzhak</surname> <given-names>DN</given-names></name><name><surname>Tyanova</surname> <given-names>S</given-names></name><name><surname>Cox</surname> <given-names>J</given-names></name><name><surname>Borner</surname> <given-names>GH</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Global, quantitative and dynamic mapping of protein subcellular localization</article-title><source>eLife</source><volume>5</volume><elocation-id>e16950</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.16950</pub-id><pub-id pub-id-type="pmid">27278775</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kapoor</surname> <given-names>M</given-names></name><name><surname>Ellgaard</surname> <given-names>L</given-names></name><name><surname>Gopalakrishnapai</surname> <given-names>J</given-names></name><name><surname>Schirra</surname> <given-names>C</given-names></name><name><surname>Gemma</surname> <given-names>E</given-names></name><name><surname>Oscarson</surname> <given-names>S</given-names></name><name><surname>Helenius</surname> <given-names>A</given-names></name><name><surname>Surolia</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Mutational analysis provides molecular insight into the carbohydrate-binding region of calreticulin: pivotal roles of tyrosine-109 and aspartate-135 in carbohydrate recognition</article-title><source>Biochemistry</source><volume>43</volume><fpage>97</fpage><lpage>106</lpage><pub-id pub-id-type="doi">10.1021/bi0355286</pub-id><pub-id pub-id-type="pmid">14705935</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Katta</surname> <given-names>SS</given-names></name><name><surname>Smoyer</surname> <given-names>CJ</given-names></name><name><surname>Jaspersen</surname> <given-names>SL</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Destination: inner nuclear membrane</article-title><source>Trends in Cell Biology</source><volume>24</volume><fpage>221</fpage><lpage>229</lpage><pub-id pub-id-type="doi">10.1016/j.tcb.2013.10.006</pub-id><pub-id pub-id-type="pmid">24268652</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kerner</surname> <given-names>MJ</given-names></name><name><surname>Naylor</surname> <given-names>DJ</given-names></name><name><surname>Ishihama</surname> <given-names>Y</given-names></name><name><surname>Maier</surname> <given-names>T</given-names></name><name><surname>Chang</surname> <given-names>HC</given-names></name><name><surname>Stines</surname> <given-names>AP</given-names></name><name><surname>Georgopoulos</surname> <given-names>C</given-names></name><name><surname>Frishman</surname> <given-names>D</given-names></name><name><surname>Hayer-Hartl</surname> <given-names>M</given-names></name><name><surname>Mann</surname> <given-names>M</given-names></name><name><surname>Hartl</surname> <given-names>FU</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Proteome-wide analysis of chaperonin-dependent protein folding in <italic>Escherichia coli</italic></article-title><source>Cell</source><volume>122</volume><fpage>209</fpage><lpage>220</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2005.05.028</pub-id><pub-id pub-id-type="pmid">16051146</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>King</surname> <given-names>H</given-names></name><name><surname>Aleksic</surname> <given-names>T</given-names></name><name><surname>Haluska</surname> <given-names>P</given-names></name><name><surname>Macaulay</surname> <given-names>VM</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Can we unlock the potential of IGF-1R inhibition in Cancer therapy?</article-title><source>Cancer Treatment Reviews</source><volume>40</volume><fpage>1096</fpage><lpage>1105</lpage><pub-id pub-id-type="doi">10.1016/j.ctrv.2014.07.004</pub-id><pub-id pub-id-type="pmid">25123819</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kozlov</surname> <given-names>G</given-names></name><name><surname>Gehring</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Calnexin cycle - structural features of the ER chaperone system</article-title><source>The FEBS Journal</source><volume>287</volume><fpage>4322</fpage><lpage>4340</lpage><pub-id pub-id-type="doi">10.1111/febs.15330</pub-id><pub-id pub-id-type="pmid">32285592</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lamriben</surname> <given-names>L</given-names></name><name><surname>Graham</surname> <given-names>JB</given-names></name><name><surname>Adams</surname> <given-names>BM</given-names></name><name><surname>Hebert</surname> <given-names>DN</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title><italic>N</italic>-Glycan-based ER molecular chaperone and protein quality control system: the calnexin binding cycle</article-title><source>Traffic</source><volume>17</volume><fpage>308</fpage><lpage>326</lpage><pub-id pub-id-type="doi">10.1111/tra.12358</pub-id><pub-id pub-id-type="pmid">26676362</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lehmann</surname> <given-names>M</given-names></name><name><surname>André</surname> <given-names>F</given-names></name><name><surname>Bellan</surname> <given-names>C</given-names></name><name><surname>Remacle-Bonnet</surname> <given-names>M</given-names></name><name><surname>Garrouste</surname> <given-names>F</given-names></name><name><surname>Parat</surname> <given-names>F</given-names></name><name><surname>Lissitsky</surname> <given-names>JC</given-names></name><name><surname>Marvaldi</surname> <given-names>J</given-names></name><name><surname>Pommier</surname> <given-names>G</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Deficient processing and activity of type I insulin-like growth factor receptor in the furin-deficient LoVo-C5 cells</article-title><source>Endocrinology</source><volume>139</volume><fpage>3763</fpage><lpage>3771</lpage><pub-id pub-id-type="doi">10.1210/endo.139.9.6184</pub-id><pub-id pub-id-type="pmid">9724028</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>B</given-names></name><name><surname>Dewey</surname> <given-names>CN</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome</article-title><source>BMC Bioinformatics</source><volume>12</volume><elocation-id>323</elocation-id><pub-id pub-id-type="doi">10.1186/1471-2105-12-323</pub-id><pub-id pub-id-type="pmid">21816040</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lonowski</surname> <given-names>LA</given-names></name><name><surname>Narimatsu</surname> <given-names>Y</given-names></name><name><surname>Riaz</surname> <given-names>A</given-names></name><name><surname>Delay</surname> <given-names>CE</given-names></name><name><surname>Yang</surname> <given-names>Z</given-names></name><name><surname>Niola</surname> <given-names>F</given-names></name><name><surname>Duda</surname> <given-names>K</given-names></name><name><surname>Ober</surname> <given-names>EA</given-names></name><name><surname>Clausen</surname> <given-names>H</given-names></name><name><surname>Wandall</surname> <given-names>HH</given-names></name><name><surname>Hansen</surname> <given-names>SH</given-names></name><name><surname>Bennett</surname> <given-names>EP</given-names></name><name><surname>Frödin</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Genome editing using FACS enrichment of nuclease-expressing cells and indel detection by amplicon analysis</article-title><source>Nature Protocols</source><volume>12</volume><fpage>581</fpage><lpage>603</lpage><pub-id pub-id-type="doi">10.1038/nprot.2016.165</pub-id><pub-id pub-id-type="pmid">28207001</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mahuran</surname> <given-names>DJ</given-names></name><name><surname>Neote</surname> <given-names>K</given-names></name><name><surname>Klavins</surname> <given-names>MH</given-names></name><name><surname>Leung</surname> <given-names>A</given-names></name><name><surname>Gravel</surname> <given-names>RA</given-names></name></person-group><year iso-8601-date="1988">1988</year><article-title>Proteolytic processing of pro-alpha and pro-beta precursors from human beta-hexosaminidase generation of the mature alpha and beta a beta b subunits</article-title><source>The Journal of Biological Chemistry</source><volume>263</volume><fpage>4612</fpage><lpage>4618</lpage><pub-id pub-id-type="pmid">2965147</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mahuran</surname> <given-names>DJ</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Biochemical consequences of mutations causing the GM2 gangliosidoses</article-title><source>Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease</source><volume>1455</volume><fpage>105</fpage><lpage>138</lpage><pub-id pub-id-type="doi">10.1016/S0925-4439(99)00074-5</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Margittai</surname> <given-names>E</given-names></name><name><surname>Sitia</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Oxidative protein folding in the secretory pathway and redox signaling across compartments and cells</article-title><source>Traffic</source><volume>12</volume><fpage>1</fpage><lpage>8</lpage><pub-id pub-id-type="doi">10.1111/j.1600-0854.2010.01108.x</pub-id><pub-id pub-id-type="pmid">20716108</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Molinari</surname> <given-names>M</given-names></name><name><surname>Calanca</surname> <given-names>V</given-names></name><name><surname>Galli</surname> <given-names>C</given-names></name><name><surname>Lucca</surname> <given-names>P</given-names></name><name><surname>Paganetti</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Role of EDEM in the release of misfolded glycoproteins from the calnexin cycle</article-title><source>Science</source><volume>299</volume><fpage>1397</fpage><lpage>1400</lpage><pub-id pub-id-type="doi">10.1126/science.1079474</pub-id><pub-id pub-id-type="pmid">12610306</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Molinari</surname> <given-names>M</given-names></name><name><surname>Galli</surname> <given-names>C</given-names></name><name><surname>Vanoni</surname> <given-names>O</given-names></name><name><surname>Arnold</surname> <given-names>SM</given-names></name><name><surname>Kaufman</surname> <given-names>RJ</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Persistent glycoprotein misfolding activates the glucosidase II/UGT1-driven calnexin cycle to delay aggregation and loss of folding competence</article-title><source>Molecular Cell</source><volume>20</volume><fpage>503</fpage><lpage>512</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2005.09.027</pub-id><pub-id pub-id-type="pmid">16307915</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mutgan</surname> <given-names>AC</given-names></name><name><surname>Besikcioglu</surname> <given-names>HE</given-names></name><name><surname>Wang</surname> <given-names>S</given-names></name><name><surname>Friess</surname> <given-names>H</given-names></name><name><surname>Ceyhan</surname> <given-names>GO</given-names></name><name><surname>Demir</surname> <given-names>IE</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Insulin/IGF-driven Cancer cell-stroma crosstalk as a novel therapeutic target in pancreatic Cancer</article-title><source>Molecular Cancer</source><volume>17</volume><elocation-id>66</elocation-id><pub-id pub-id-type="doi">10.1186/s12943-018-0806-0</pub-id><pub-id pub-id-type="pmid">29475434</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Narimatsu</surname> <given-names>Y</given-names></name><name><surname>Joshi</surname> <given-names>HJ</given-names></name><name><surname>Yang</surname> <given-names>Z</given-names></name><name><surname>Gomes</surname> <given-names>C</given-names></name><name><surname>Chen</surname> <given-names>YH</given-names></name><name><surname>Lorenzetti</surname> <given-names>FC</given-names></name><name><surname>Furukawa</surname> <given-names>S</given-names></name><name><surname>Schjoldager</surname> <given-names>KT</given-names></name><name><surname>Hansen</surname> <given-names>L</given-names></name><name><surname>Clausen</surname> <given-names>H</given-names></name><name><surname>Bennett</surname> <given-names>EP</given-names></name><name><surname>Wandall</surname> <given-names>HH</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>A validated gRNA library for CRISPR/Cas9 targeting of the human glycosyltransferase genome</article-title><source>Glycobiology</source><volume>28</volume><fpage>295</fpage><lpage>305</lpage><pub-id pub-id-type="doi">10.1093/glycob/cwx101</pub-id><pub-id pub-id-type="pmid">29315387</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oda</surname> <given-names>Y</given-names></name><name><surname>Hosokawa</surname> <given-names>N</given-names></name><name><surname>Wada</surname> <given-names>I</given-names></name><name><surname>Nagata</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>EDEM as an acceptor of terminally misfolded glycoproteins released from calnexin</article-title><source>Science</source><volume>299</volume><fpage>1394</fpage><lpage>1397</lpage><pub-id pub-id-type="doi">10.1126/science.1079181</pub-id><pub-id pub-id-type="pmid">12610305</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parodi</surname> <given-names>AJ</given-names></name><name><surname>Cazzulo</surname> <given-names>JJ</given-names></name></person-group><year iso-8601-date="1982">1982</year><article-title>Protein glycosylation in Trypanosoma cruzi. II. partial characterization of protein-bound oligosaccharides labeled “in vivo”</article-title><source>The Journal of Biological Chemistry</source><volume>257</volume><fpage>7641</fpage><lpage>7645</lpage><pub-id pub-id-type="pmid">7045110</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pearse</surname> <given-names>BR</given-names></name><name><surname>Gabriel</surname> <given-names>L</given-names></name><name><surname>Wang</surname> <given-names>N</given-names></name><name><surname>Hebert</surname> <given-names>DN</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>A cell-based reglucosylation assay demonstrates the role of GT1 in the quality control of a maturing glycoprotein</article-title><source>Journal of Cell Biology</source><volume>181</volume><fpage>309</fpage><lpage>320</lpage><pub-id pub-id-type="doi">10.1083/jcb.200712068</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pearse</surname> <given-names>BR</given-names></name><name><surname>Tamura</surname> <given-names>T</given-names></name><name><surname>Sunryd</surname> <given-names>JC</given-names></name><name><surname>Grabowski</surname> <given-names>GA</given-names></name><name><surname>Kaufman</surname> <given-names>RJ</given-names></name><name><surname>Hebert</surname> <given-names>DN</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>The role of UDP-Glc:glycoprotein glucosyltransferase 1 in the maturation of an obligate substrate prosaposin</article-title><source>Journal of Cell Biology</source><volume>189</volume><fpage>829</fpage><lpage>841</lpage><pub-id pub-id-type="doi">10.1083/jcb.200912105</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Quellhorst</surname> <given-names>GJ</given-names></name><name><surname>O'Rear</surname> <given-names>JL</given-names></name><name><surname>Cacan</surname> <given-names>R</given-names></name><name><surname>Verbert</surname> <given-names>A</given-names></name><name><surname>Krag</surname> <given-names>SS</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Nonglucosylated oligosaccharides are transferred to protein in MI8-5 Chinese hamster ovary cells</article-title><source>Glycobiology</source><volume>9</volume><fpage>65</fpage><lpage>72</lpage><pub-id pub-id-type="doi">10.1093/glycob/9.1.65</pub-id><pub-id pub-id-type="pmid">9884408</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rajagopalan</surname> <given-names>S</given-names></name><name><surname>Xu</surname> <given-names>Y</given-names></name><name><surname>Brenner</surname> <given-names>MB</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>Retention of unassembled components of integral membrane proteins by calnexin</article-title><source>Science</source><volume>263</volume><fpage>387</fpage><lpage>390</lpage><pub-id pub-id-type="doi">10.1126/science.8278814</pub-id><pub-id pub-id-type="pmid">8278814</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ramírez</surname> <given-names>AS</given-names></name><name><surname>Kowal</surname> <given-names>J</given-names></name><name><surname>Locher</surname> <given-names>KP</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Cryo-electron microscopy structures of human oligosaccharyltransferase complexes OST-A and OST-B</article-title><source>Science</source><volume>366</volume><fpage>1372</fpage><lpage>1375</lpage><pub-id pub-id-type="doi">10.1126/science.aaz3505</pub-id><pub-id pub-id-type="pmid">31831667</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rauniyar</surname> <given-names>N</given-names></name><name><surname>Yates</surname> <given-names>JR</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Isobaric Labeling-Based Relative Quantification in Shotgun Proteomics</article-title><source>Journal of Proteome Research</source><volume>13</volume><fpage>5293</fpage><lpage>5309</lpage><pub-id pub-id-type="doi">10.1021/pr500880b</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="preprint"><person-group person-group-type="author"><name><surname>Rebeaud</surname> <given-names>ME</given-names></name><name><surname>Mallik</surname> <given-names>S</given-names></name><name><surname>Goloubinoff</surname> <given-names>P</given-names></name><name><surname>Tawfik</surname> <given-names>DS</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>On the evolution of chaperones and co-chaperones and the expansion of proteomes across the tree of life</article-title><source>bioRxiv</source><pub-id pub-id-type="doi">10.1101/2020.06.08.140319</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ritter</surname> <given-names>C</given-names></name><name><surname>Helenius</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Recognition of local glycoprotein misfolding by the ER folding sensor UDP-glucose:glycoprotein glucosyltransferase</article-title><source>Nature Structural Biology</source><volume>7</volume><fpage>278</fpage><lpage>280</lpage><pub-id pub-id-type="doi">10.1038/74035</pub-id><pub-id pub-id-type="pmid">10742170</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Robinson</surname> <given-names>MD</given-names></name><name><surname>McCarthy</surname> <given-names>DJ</given-names></name><name><surname>Smyth</surname> <given-names>GK</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>edgeR: a bioconductor package for differential expression analysis of digital gene expression data</article-title><source>Bioinformatics</source><volume>26</volume><fpage>139</fpage><lpage>140</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btp616</pub-id><pub-id pub-id-type="pmid">19910308</pub-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Roversi</surname> <given-names>P</given-names></name><name><surname>Marti</surname> <given-names>L</given-names></name><name><surname>Caputo</surname> <given-names>AT</given-names></name><name><surname>Alonzi</surname> <given-names>DS</given-names></name><name><surname>Hill</surname> <given-names>JC</given-names></name><name><surname>Dent</surname> <given-names>KC</given-names></name><name><surname>Kumar</surname> <given-names>A</given-names></name><name><surname>Levasseur</surname> <given-names>MD</given-names></name><name><surname>Lia</surname> <given-names>A</given-names></name><name><surname>Waksman</surname> <given-names>T</given-names></name><name><surname>Basu</surname> <given-names>S</given-names></name><name><surname>Soto Albrecht</surname> <given-names>Y</given-names></name><name><surname>Qian</surname> <given-names>K</given-names></name><name><surname>McIvor</surname> <given-names>JP</given-names></name><name><surname>Lipp</surname> <given-names>CB</given-names></name><name><surname>Siliqi</surname> <given-names>D</given-names></name><name><surname>Vasiljević</surname> <given-names>S</given-names></name><name><surname>Mohammed</surname> <given-names>S</given-names></name><name><surname>Lukacik</surname> <given-names>P</given-names></name><name><surname>Walsh</surname> <given-names>MA</given-names></name><name><surname>Santino</surname> <given-names>A</given-names></name><name><surname>Zitzmann</surname> <given-names>N</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Interdomain conformational flexibility underpins the activity of UGGT, the eukaryotic glycoprotein secretion checkpoint</article-title><source>PNAS</source><volume>114</volume><fpage>8544</fpage><lpage>8549</lpage><pub-id pub-id-type="doi">10.1073/pnas.1703682114</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ruiz-Canada</surname> <given-names>C</given-names></name><name><surname>Kelleher</surname> <given-names>DJ</given-names></name><name><surname>Gilmore</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Cotranslational and posttranslational N-Glycosylation of polypeptides by distinct mammalian OST isoforms</article-title><source>Cell</source><volume>136</volume><fpage>272</fpage><lpage>283</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2008.11.047</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Satoh</surname> <given-names>T</given-names></name><name><surname>Song</surname> <given-names>C</given-names></name><name><surname>Zhu</surname> <given-names>T</given-names></name><name><surname>Toshimori</surname> <given-names>T</given-names></name><name><surname>Murata</surname> <given-names>K</given-names></name><name><surname>Hayashi</surname> <given-names>Y</given-names></name><name><surname>Kamikubo</surname> <given-names>H</given-names></name><name><surname>Uchihashi</surname> <given-names>T</given-names></name><name><surname>Kato</surname> <given-names>K</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Visualisation of a flexible modular structure of the ER folding-sensor enzyme UGGT</article-title><source>Scientific Reports</source><volume>7</volume><elocation-id>12142</elocation-id><pub-id pub-id-type="doi">10.1038/s41598-017-12283-w</pub-id><pub-id pub-id-type="pmid">28939828</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sell</surname> <given-names>C</given-names></name><name><surname>Dumenil</surname> <given-names>G</given-names></name><name><surname>Deveaud</surname> <given-names>C</given-names></name><name><surname>Miura</surname> <given-names>M</given-names></name><name><surname>Coppola</surname> <given-names>D</given-names></name><name><surname>DeAngelis</surname> <given-names>T</given-names></name><name><surname>Rubin</surname> <given-names>R</given-names></name><name><surname>Efstratiadis</surname> <given-names>A</given-names></name><name><surname>Baserga</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts</article-title><source>Molecular and Cellular Biology</source><volume>14</volume><fpage>3604</fpage><lpage>3612</lpage><pub-id pub-id-type="doi">10.1128/MCB.14.6.3604</pub-id><pub-id pub-id-type="pmid">8196606</pub-id></element-citation></ref><ref id="bib71"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shrimal</surname> <given-names>S</given-names></name><name><surname>Cherepanova</surname> <given-names>NA</given-names></name><name><surname>Mandon</surname> <given-names>ES</given-names></name><name><surname>Venev</surname> <given-names>SV</given-names></name><name><surname>Gilmore</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Asparagine-linked glycosylation is not directly coupled to protein translocation across the endoplasmic reticulum in <italic>Saccharomyces cerevisiae</italic> mol biol</article-title><source>Cell</source><volume>30</volume><fpage>2626</fpage><lpage>2638</lpage><pub-id pub-id-type="doi">10.1091/mbc.E19-06-0330</pub-id></element-citation></ref><ref id="bib72"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shrimal</surname> <given-names>S</given-names></name><name><surname>Gilmore</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Reduced expression of the oligosaccharyltransferase exacerbates protein hypoglycosylation in cells lacking the fully assembled oligosaccharide donor</article-title><source>Glycobiology</source><volume>25</volume><fpage>774</fpage><lpage>783</lpage><pub-id pub-id-type="doi">10.1093/glycob/cwv018</pub-id></element-citation></ref><ref id="bib73"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Soldà</surname> <given-names>T</given-names></name><name><surname>Galli</surname> <given-names>C</given-names></name><name><surname>Kaufman</surname> <given-names>RJ</given-names></name><name><surname>Molinari</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Substrate-specific requirements for UGT1-dependent release from calnexin</article-title><source>Molecular Cell</source><volume>27</volume><fpage>238</fpage><lpage>249</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2007.05.032</pub-id><pub-id pub-id-type="pmid">17643373</pub-id></element-citation></ref><ref id="bib74"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sousa</surname> <given-names>M</given-names></name><name><surname>Parodi</surname> <given-names>AJ</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>The molecular basis for the recognition of misfolded glycoproteins by the UDP-Glc:glycoprotein glucosyltransferase</article-title><source>The EMBO Journal</source><volume>14</volume><fpage>4196</fpage><lpage>4203</lpage><pub-id pub-id-type="doi">10.1002/j.1460-2075.1995.tb00093.x</pub-id><pub-id pub-id-type="pmid">7556060</pub-id></element-citation></ref><ref id="bib75"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Takeda</surname> <given-names>Y</given-names></name><name><surname>Seko</surname> <given-names>A</given-names></name><name><surname>Hachisu</surname> <given-names>M</given-names></name><name><surname>Daikoku</surname> <given-names>S</given-names></name><name><surname>Izumi</surname> <given-names>M</given-names></name><name><surname>Koizumi</surname> <given-names>A</given-names></name><name><surname>Fujikawa</surname> <given-names>K</given-names></name><name><surname>Kajihara</surname> <given-names>Y</given-names></name><name><surname>Ito</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Both isoforms of human UDP-glucose:glycoprotein glucosyltransferase are enzymatically active</article-title><source>Glycobiology</source><volume>24</volume><fpage>344</fpage><lpage>350</lpage><pub-id pub-id-type="doi">10.1093/glycob/cwt163</pub-id><pub-id pub-id-type="pmid">24415556</pub-id></element-citation></ref><ref id="bib76"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tannous</surname> <given-names>A</given-names></name><name><surname>Patel</surname> <given-names>N</given-names></name><name><surname>Tamura</surname> <given-names>T</given-names></name><name><surname>Hebert</surname> <given-names>DN</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Reglucosylation by UDP-glucose:glycoprotein glucosyltransferase 1 delays glycoprotein secretion but not degradation</article-title><source>Molecular Biology of the Cell</source><volume>26</volume><fpage>390</fpage><lpage>405</lpage><pub-id pub-id-type="doi">10.1091/mbc.E14-08-1254</pub-id><pub-id pub-id-type="pmid">25428988</pub-id></element-citation></ref><ref id="bib77"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Taylor</surname> <given-names>SC</given-names></name><name><surname>Thibault</surname> <given-names>P</given-names></name><name><surname>Tessier</surname> <given-names>DC</given-names></name><name><surname>Bergeron</surname> <given-names>JJ</given-names></name><name><surname>Thomas</surname> <given-names>DY</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Glycopeptide specificity of the secretory protein folding sensor UDP-glucose glycoprotein:glucosyltransferase</article-title><source>EMBO Reports</source><volume>4</volume><fpage>405</fpage><lpage>411</lpage><pub-id pub-id-type="doi">10.1038/sj.embor.embor797</pub-id><pub-id pub-id-type="pmid">12671684</pub-id></element-citation></ref><ref id="bib78"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tom</surname> <given-names>R</given-names></name><name><surname>Bisson</surname> <given-names>L</given-names></name><name><surname>Durocher</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Culture of HEK293-EBNA1 cells for production of recombinant proteins</article-title><source>Cold Spring Harbor Protocols</source><volume>2008</volume><elocation-id>pdb.prot4976</elocation-id><pub-id pub-id-type="doi">10.1101/pdb.prot4976</pub-id></element-citation></ref><ref id="bib79"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Uhlén</surname> <given-names>M</given-names></name><name><surname>Fagerberg</surname> <given-names>L</given-names></name><name><surname>Hallström</surname> <given-names>BM</given-names></name><name><surname>Lindskog</surname> <given-names>C</given-names></name><name><surname>Oksvold</surname> <given-names>P</given-names></name><name><surname>Mardinoglu</surname> <given-names>A</given-names></name><name><surname>Sivertsson</surname> <given-names>Å</given-names></name><name><surname>Kampf</surname> <given-names>C</given-names></name><name><surname>Sjöstedt</surname> <given-names>E</given-names></name><name><surname>Asplund</surname> <given-names>A</given-names></name><name><surname>Olsson</surname> <given-names>I</given-names></name><name><surname>Edlund</surname> <given-names>K</given-names></name><name><surname>Lundberg</surname> <given-names>E</given-names></name><name><surname>Navani</surname> <given-names>S</given-names></name><name><surname>Szigyarto</surname> <given-names>CA</given-names></name><name><surname>Odeberg</surname> <given-names>J</given-names></name><name><surname>Djureinovic</surname> <given-names>D</given-names></name><name><surname>Takanen</surname> <given-names>JO</given-names></name><name><surname>Hober</surname> <given-names>S</given-names></name><name><surname>Alm</surname> <given-names>T</given-names></name><name><surname>Edqvist</surname> <given-names>PH</given-names></name><name><surname>Berling</surname> <given-names>H</given-names></name><name><surname>Tegel</surname> <given-names>H</given-names></name><name><surname>Mulder</surname> <given-names>J</given-names></name><name><surname>Rockberg</surname> <given-names>J</given-names></name><name><surname>Nilsson</surname> <given-names>P</given-names></name><name><surname>Schwenk</surname> <given-names>JM</given-names></name><name><surname>Hamsten</surname> <given-names>M</given-names></name><name><surname>von Feilitzen</surname> <given-names>K</given-names></name><name><surname>Forsberg</surname> <given-names>M</given-names></name><name><surname>Persson</surname> <given-names>L</given-names></name><name><surname>Johansson</surname> <given-names>F</given-names></name><name><surname>Zwahlen</surname> <given-names>M</given-names></name><name><surname>von Heijne</surname> <given-names>G</given-names></name><name><surname>Nielsen</surname> <given-names>J</given-names></name><name><surname>Pontén</surname> <given-names>F</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Proteomics Tissue-based map of the human proteome</article-title><source>Science</source><volume>347</volume><elocation-id>1260419</elocation-id><pub-id pub-id-type="doi">10.1126/science.1260419</pub-id><pub-id pub-id-type="pmid">25613900</pub-id></element-citation></ref><ref id="bib80"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>N</given-names></name><name><surname>Glidden</surname> <given-names>EJ</given-names></name><name><surname>Murphy</surname> <given-names>SR</given-names></name><name><surname>Pearse</surname> <given-names>BR</given-names></name><name><surname>Hebert</surname> <given-names>DN</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>The Cotranslational Maturation Program for the Type II Membrane Glycoprotein <italic>Influenza</italic> Neuraminidase</article-title><source>Journal of Biological Chemistry</source><volume>283</volume><fpage>33826</fpage><lpage>33837</lpage><pub-id pub-id-type="doi">10.1074/jbc.M806897200</pub-id></element-citation></ref><ref id="bib81"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zielinska</surname> <given-names>DF</given-names></name><name><surname>Gnad</surname> <given-names>F</given-names></name><name><surname>Wiśniewski</surname> <given-names>JR</given-names></name><name><surname>Mann</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Precision mapping of an in vivo N-glycoproteome reveals rigid topological and sequence constraints</article-title><source>Cell</source><volume>141</volume><fpage>897</fpage><lpage>907</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2010.04.012</pub-id><pub-id pub-id-type="pmid">20510933</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.63997.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Miller</surname><given-names>Elizabeth A</given-names></name><role>Reviewing Editor</role><aff><institution>MRC Laboratory of Molecular Biology</institution><country>United Kingdom</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Miller</surname><given-names>Elizabeth A</given-names></name><role>Reviewer</role><aff><institution>MRC Laboratory of Molecular Biology</institution><country>United Kingdom</country></aff></contrib><contrib contrib-type="reviewer"><name><surname>Christianson</surname><given-names>John C</given-names></name><role>Reviewer</role><aff><institution>University of Oxford</institution><country>United Kingdom</country></aff></contrib><contrib contrib-type="reviewer"><name><surname>Sitia</surname><given-names>Roberto</given-names> </name><role>Reviewer</role><aff><institution>San Raffaele Scientific Institute</institution><country>Italy</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p>Thank you for submitting your article &quot;Quantitative glycoproteomics reveals substrate selectivity of the ER protein quality control sensors UGGT1 and UGGT2&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, including Elizabeth A Miller as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by David Ron as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: John C Christianson (Reviewer #2); Roberto Sitia (Reviewer #3).</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is &quot;in revision at <italic>eLife</italic>&quot;. Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)</p><p>Summary:</p><p>All reviewers were enthusiastic about the topic and quality of the work, which will make a substantive contribution to the chaperone and quality control community. However, reviewers had some good suggestions that would broaden the impact of the findings to the more general secretion/trafficking community.</p><p>Reviewers 1 and 2 both felt that the analysis of UGGT substrates could be deepened and the representation of the data improved. This would improve the utility of the dataset in terms of understanding of potential mechanisms of engagement and prediction of additional substrates. Specifically, we request further analysis of potential local determinants as suggested by reviewer 2 – domain structure, predicted disorder, etc.</p><p>Reviewers 1 and 3 had concerns about the pulse-chase experiments that should be addressed.</p><p>Finally, reviewer 3 raises a good point that the folding trajectory of clients might be altered by the absence of ALG6, which would impact recovery as UGGT substrates. Toning down the quantitative nature of the conclusions is probably warranted.</p><p><italic>Reviewer #1:</italic></p><p>UGGT has largely been studied using model substrates and non-physiological conditions. Here the Hebert lab uses a quantitative proteomics approach to define the full spectrum of endogenous substrates. On the whole the data seem very solid, the topic is important, and this seems like it will be a good resource for the community, but I think the overall impact is could be improved by addressing 2 specific concerns:</p><p>1) Figure 4: I question whether these density plots are a good way to present the data. Why not simple scatter plots that show the aa length for the different substrates. Related to this, it's not clear how &quot;significance&quot; was determined. In 4B, the number of glycans might be artifactually high in the UGGT substrate pool because of the nature of the GST purification. The authors claim that since substrates with few glycans were also detected, this isn't a concern, but I think sample bias can't be so simply ignored. Related to this, aa length of substrates may be similarly related to no. of glycans. Correcting for this might be possible.</p><p>2) Figure 5: The pulse-chase of IGF-R is essential to show that substrate fate is impacted by UGGT action. But the pulse-chase experiments shown are somewhat difficult for me to interpret. In the UGGT <sup>-/-</sup> conditions I don't see much mature form at all, certainly not increasing over time as the precursor would mature. Instead, I see decrease of the precursor, which might indicate degradation? This might amplify the impact and should be considered.</p><p><italic>Reviewer #2:</italic></p><p>This work by Adams and colleagues describes the identification of native client repertoires of the ER chaperones UGGT<sub>1/2</sub> family of glucosyltransferases, to better understand the key roles played during glycoprotein biogenesis. The work is well-conceived and executed, while being conveyed in a clear and concise manner. Bioinformatic analysis of identified clients leads the authors to suggest UGGT1 and 2 may prefer different clients with different localisations, topologies and structures. Data on some identified examples (e.g. IGF-1R, ENPP, HEX B) dissects the steps in maturation and role played by UGGT<sub>1/2</sub> to provide some mechanistic insight but would benefit from a bit more detail. However, these new data do open up the possibilities to better understand the scope of selective responsibilities of reglucosylation by UGGT1 and UGGT2 to govern the maturation efficiency within the glycoproteome.</p><p>The authors' clever scheme to isolate UGGT<sub>1/2</sub> clients using a combination of CRISPR-edited cell lines and lectin-based affinity purification together with quantitative proteomics appears quite powerful and allows them to isolate and identify selectively dependent client proteins, an obviously valuable dataset. A shortcoming might be that the features determined as preferential for UGGT<sub>1/2</sub> focus on the whole protein are not particularly specific, which leaves the reader wanting a bit more in depth analysis to draw out some potential &quot;local&quot; determinants. While analyses of the clients using UniProt defined features is certainly valid, it means the analysis and predictions are limited and not as detailed as they could have been.</p><p>1) It is not clear to this reviewer whether, in the example candidates studded with multiple glycosylation sites, whether it is always a single (or the same) glycan that determines engagement by UGGT1 or 2, or whether it varies and is rather, dependent upon the folded state of the protein. In lieu of performing detailed glycan analysis on clients, perhaps this could be discussed.</p><p>2) Moreover, are all glycosylation sites utilised in these clients or only some and does that influence UGGT<sub>1/2</sub> engagement? Perhaps the authors might address this as an aspect that might help understand selective recognition by UGGT1 or 2.</p><p>3) In regard to the UGGT<sub>1/2</sub> clients identified, are there intrinsic or local folding/maturation features that makes them more frequently in need of reglucosylation than the rest of the glycoproteome? If so, what might that feature be, if not something general like a TMD. Perhaps the authors could further assess the domain structures of clients, or the relative position of glycans within them to add an additional dimension. As a reader, I would like to better understand why these proteins and not the other 97% of glycoproteins enter this route of maturation.</p><p>4) Could UGGT activity play a determinant role in multimer assembly, say for the composition of the hexosaminidase dimer, for example where UGGT2 KO cells that reduce efficient trafficking of the HEX B subunit but not HEX A? Does this bias the composition and consequently function? More generally, could the activities of UGGT<sub>1/2</sub> offer a point of modulation for multimer composition? The authors raised the point of the impact of the UPR in the Discussion, which might be relevant.</p><p>5) The authors report that 70% of UGGT1 clients are Type I membrane proteins, but relative to the total number of Type I proteins in the glycoproteome, this number is relatively small. Why these proteins and not the remaining Type I's? Are there unique structural features, folding trajectories or glycan positions that provide some clue as to why these are preferentially engaging UGGT1? (slight reiteration of point 3)</p><p>6) If the 3-fold change cut-off is progressively lowered (or raised), how long do the UGGT<sub>1/2</sub> &quot;preferences&quot; outlined still hold true?</p><p><italic>Reviewer #3:</italic></p><p>In this clearly written manuscript, Adams et al. set up an ingenious system to identify the clients of UGGT1 and UGGT2. The former is known to act as a folding sensor in the ER lumen adding a glucose moiety to non-native glycoproteins so as to reinsert them in the calnexin/calreticulin cycle. It was not known whether UGGT2 has a role in living cells, and how this would differ from UGGT1.</p><p>Key to success was the use of CRISPR to generate cells lacking ALG6, an enzyme in the pathway that generates the oligosaccharide precursors to be transferred to certain asparagines in nascent glycoproteins. In the presence of glucosidase inhibitors, ALG6KO cells accumulated mono-glucosylated proteins only if UGGT1 and/or UGGT2 were present.</p><p>An elegant -omic comparison of mono-glucosylated proteins in WT, UGGT1KO, UGGT2KO and double knock outs, allowed the authors to demonstrate that i) both enzymes have activity in vivo; ii) they share some clients; ii) UGGT2 has preferential activity towards small, soluble proteins destined to endo-lysosomes, iii) UGGT1 prefers instead larger plasma-membrane proteins.</p><p>As a quantitative and qualitative characterization of the UGGT1-2 clientele is of general interest, the data deserve publication.</p><p>Altogether, the data support the conclusions taken. In this reviewer's opinion, however, there is a conceptual problem that the authors should consider and discuss. In the absence of ALG6, glycoprotein substrates are not able to bind calnexin and calreticulin before being glucosylated by the preferred UGGT. As this might shift the folding pathway, many potential clients of UGGT1 or 2 could go undetected. So, in all likelihood the proteins identified are indeed clients of either enzyme, but the quantitative conclusions should be softened and adequately discussed.</p><p>Figure 3. Somehow surprisingly, immunoblotting of the whole cell lysates reveals no significant differences in the mature/pro-form ratios in any of the three clients analyzed. This is hard to reconcile with the pulse-chase experiment shown for IGF-1R.The authors may wish to comment about this discrepancy.</p><p>Despite sustaining the conclusions taken by the authors, the gels shown in Figures 3I, 3M and 5E are of rather low quality. An effort to improve the aesthetics of the experiments is worth. In Figure 5, a one-hour pulse is quite long to follow the folding of a glycoprotein. A shorter pulse might reveal more details.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for submitting your article &quot;Quantitative glycoproteomics reveals substrate selectivity of the ER protein quality control sensors UGGT1 and UGGT2&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by three peer reviewers, including Elizabeth A Miller as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by David Ron as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: John C Christianson (Reviewer #2); Roberto Sitia (Reviewer #3).</p><p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p><p>We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, we are asking editors to accept without delay manuscripts, like yours, that they judge can stand as <italic>eLife</italic> papers without additional data, even if they feel that they would make the manuscript stronger. Thus the revisions requested below only address clarity and presentation.</p><p>Summary:</p><p>Secretory and membrane proteins are subject to strict quality control, driven in part by engagement with the lectin/chaperone system of the endoplasmic reticulum. Here, the authors have devised an elegant strategy to systematically identify clients that engage either of two separate glycosyltransferases that regulate engagement with this pathway. This analysis provides insight into properties that govern quality control and provide a framework for understanding how protein folding influences secretion.</p><p>Revisions:</p><p>With apologize for not catching the specific points mentioned by reviewer 1 below, we ask for textual changes that address these concerns. To be clear, we are not asking for additional experiments to be performed, although you may have data from the ALG6/UGGT<sub>1/2</sub><sup>-/-</sup> cells already, which would speak to point no. 1. If not, then perhaps you could include an acknowledgement that alternative pathways may contribute, or an explanation of why that is unlikely to be the case.</p><p><italic>Reviewer #1:</italic></p><p>The revised version is improved and addresses my previous concerns. On re-reading, however, I was struck by a couple of things that might be addressed by the authors textually. Alternatively, I may have missed something…</p><p>First, it seems that it would be a good idea to repeat the mass spectrometry in an ALG6/UGGT<sub>1/2</sub><sup>-/-</sup> triple KO/KD condition to know that hits recovered in the UGGT single mutants are not non-specific or arising from some redundant enzyme. This is shown in Figure 3 for specific substrates, so it may not be an issue, but it seemed to me to be a potentially important control.</p><p>Second, I seem to be missing something with regard to the hits recovered from the ALG6 KO cells versus those with the UGGT enzymes also KO'ed. I would have thought that the ALG6 proteome should encompass all UGGT hits, with smaller numbers of proteins recovered from the single mutants (and none recovered from a double). Yet, there are fewer proteins in the ALG6 <sup>-/-</sup> calnexin-precipitated proteome. What am I missing? Is this important?</p><p>Finally, in the analysis presented in Figure 4 (which is much easier to interpret now) I wonder if it's worth separating out the lysosomal N-glycoproteome given that the authors claim UGGT clients are more likely to be lysosomal proteins. If one just considers the lysosomal cohort of N-glycome, does this profile more closely resemble the UGGT proteome?</p><p>None of these are essential points, but might strengthen an already interesting study.</p><p><italic>Reviewer #2:</italic></p><p>The revised manuscript has taken on board the comments and suggestions of this reviewer to a satisfactory degree. While it would be desirable for the authors to have been able to say more about the determinants for client selectivity by UGGT<sub>1/2</sub>, this is a complex question and arguably beyond the scope of the current work. The quality of the images and graphs has been improved to better represent the data presented. Moreover, the authors have now included additional statements and/or paragraphs to clarify their results which were unclear or ambiguous. At present, the manuscript will be a valuable resource for the scientific community.</p><p><italic>Reviewer #3:</italic></p><p>In this reviewer's opinion, the authors provided satisfactory answers to the criticisms raised to the original version, and the data sustain the conclusions reached.</p><p>One can always improve the aesthetics of a paper, but there is a moment in which the information package can be considered sufficiently complete. This seems to be the case for this study.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.63997.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Reviewers 1 and 2 both felt that the analysis of UGGT substrates could be deepened and the representation of the data improved. This would improve the utility of the dataset in terms of understanding of potential mechanisms of engagement and prediction of additional substrates. Specifically, we request further analysis of potential local determinants as suggested by reviewer 2 – domain structure, predicted disorder, etc.</p><p>Reviewers 1 and 3 had concerns about the pulse-chase experiments that should be addressed.</p><p>Finally, reviewer 3 raises a good point that the folding trajectory of clients might be altered by the absence of ALG6, which would impact recovery as UGGT substrates. Toning down the quantitative nature of the conclusions is probably warranted.</p></disp-quote><p>We have thoroughly addressed all these points individually below. In short, provided below is: (1) a more in-depth analysis of the properties of the UGGT substrates using a variety of algorithms; (2) results presented as scatter plots rather than density plots; (3) new autorad images for the pulse/chase experiment and immunoblots along with new text that explains the results; and (4) added text that emphasizes the effect that the ALG6 deletion may have on early protein folding steps.</p><disp-quote content-type="editor-comment"><p>Reviewer #1:</p><p>UGGT has largely been studied using model substrates and non-physiological conditions. Here the Hebert lab uses a quantitative proteomics approach to define the full spectrum of endogenous substrates. On the whole the data seem very solid, the topic is important, and this seems like it will be a good resource for the community, but I think the overall impact is could be improved by addressing 2 specific concerns:</p><p>1) Figure 4: I question whether these density plots are a good way to present the data. Why not simple scatter plots that show the aa length for the different substrates. Related to this, it's not clear how &quot;significance&quot; was determined.</p></disp-quote><p>As suggested, the data presented in Figure 4 has now been changed to scatter plots with box and whiskers. We agree that this representation provides a more complete display of the results. Thank you. Quartiles and medians are shown.</p><disp-quote content-type="editor-comment"><p>In 4B, the number of glycans might be artifactually high in the UGGT substrate pool because of the nature of the GST purification. The authors claim that since substrates with few glycans were also detected, this isn't a concern, but I think sample bias can't be so simply ignored.</p></disp-quote><p>This is an important point. We have added the following to the text to emphasize this concern: “Finally, the monoglucosylated protein isolation procedure that relies on CST-CRT pulldowns is likely influenced by the number of monoglucosylated sites on a protein. While multiple UGGT substrates with two N-glycans were identified, suggesting heavy glycosylation is not a requirement, the number of monoglucosylated glycans on a substrate is expected to have an impact on the efficiency of substrate isolation and identification.”</p><disp-quote content-type="editor-comment"><p>Related to this, aa length of substrates may be similarly related to no. of glycans. Correcting for this might be possible.</p></disp-quote><p>The number of glycans per 100 amino acids is higher in the UGGT1 and UGGT2 substrate sets as compared to the N-glycoproteome. This suggests that a preference for highly glycosylated protein is not due to the length of the substrates selecting for proteins with a large number of N-glycans, but rather a preference of UGGT1 and UGGT2. Please see the scatter plot in <xref ref-type="fig" rid="respfig1">Author response image 1</xref>.</p><fig id="respfig1"><label>Author response image 1.</label><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-resp-fig1-v2.tif"/></fig><disp-quote content-type="editor-comment"><p>2) Figure 5: The pulse-chase of IGF-R is essential to show that substrate fate is impacted by UGGT action. But the pulse-chase experiments shown are somewhat difficult for me to interpret. In the UGGT <sup>-/-</sup> conditions I don't see much mature form at all, certainly not increasing over time as the precursor would mature. Instead, I see decrease of the precursor, which might indicate degradation? This might amplify the impact and should be considered.</p></disp-quote><p>The quantification of the autorads involves three biological replicates. We have chosen a different autorad image for Figure 5E that better represents the results. Degradation may slightly affect the quantification of the percent of mature IGF-1R, but a consistent issue of degradation was not observed.</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>This work by Adams and colleagues describes the identification of native client repertoires of the ER chaperones UGGT<sub>1/2</sub> family of glucosyltransferases, to better understand the key roles played during glycoprotein biogenesis. The work is well-conceived and executed, while being conveyed in a clear and concise manner. Bioinformatic analysis of identified clients leads the authors to suggest UGGT1 and 2 may prefer different clients with different localisations, topologies and structures. Data on some identified examples (e.g. IGF-1R, ENPP, HEX B) dissects the steps in maturation and role played by UGGT<sub>1/2</sub> to provide some mechanistic insight but would benefit from a bit more detail. However, these new data do open up the possibilities to better understand the scope of selective responsibilities of reglucosylation by UGGT1 and UGGT2 to govern the maturation efficiency within the glycoproteome.</p><p>The authors' clever scheme to isolate UGGT<sub>1/2</sub> clients using a combination of CRISPR-edited cell lines and lectin-based affinity purification together with quantitative proteomics appears quite powerful and allows them to isolate and identify selectively dependent client proteins, an obviously valuable dataset. A shortcoming might be that the features determined as preferential for UGGT<sub>1/2</sub> focus on the whole protein are not particularly specific, which leaves the reader wanting a bit more in depth analysis to draw out some potential &quot;local&quot; determinants. While analyses of the clients using UniProt defined features is certainly valid, it means the analysis and predictions are limited and not as detailed as they could have been.</p></disp-quote><p>We have used a number of different available algorithms to analyze the UGGT substrates including Pfam (domain numbers), β sheet and α helix propensity (Deleage and Roux), and hydrophobicity (Kyte Doolittle). We had hoped to identify general features of the UGGT substrates that makes then better substrates for the UGGTs; however, there was no obvious properties identified. In future studies, we hope to define specific reglucosylation sites. This will permit us to analyze the local determinants or environment of the modified sites. Plots showing the number of domains predicted by pfam, hydrophobicity, and propensity for β sheet and α helix for each dataset is shown in <xref ref-type="fig" rid="respfig2">Author response image 2</xref>. The identified UGGT substrates demonstrate a slight increase in predicted domain content, but this is primarily due to a large portion of the N-glycoproteome containing 0 or 1 predicted domain. This likely represents the inability of pfam to accurately predict domains for this large and diverse set of proteins. Pfam also did not predict common domains between UGGT substrates. Little difference between the N-glycoproteome and the substrates could be observed for hydrophobicity, β sheet propensity, or α helix propensity. An excel table detailing the pfam results has been included in Source data 1. For each protein, the type and length of domains are listed. This analysis was not included in the manuscript as no substantive conclusions could be drawn.</p><fig id="respfig2"><label>Author response image 2.</label><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-resp-fig2-v2.tif"/></fig><disp-quote content-type="editor-comment"><p>1) It is not clear to this reviewer whether, in the example candidates studded with multiple glycosylation sites, whether it is always a single (or the same) glycan that determines engagement by UGGT1 or 2, or whether it varies and is rather, dependent upon the folded state of the protein. In lieu of performing detailed glycan analysis on clients, perhaps this could be discussed.</p></disp-quote><p>This question is of great interest to us. However, our data does not adequately address this question as substrates are affinity purified through GST-CRT pulldown and then trypsinized, resulting in a lack of spatial information. We plan to modify our approach in future studies to attempt to identify the specific sites of reglucosylation. This issue has been discussed in the manuscript through the addition of the following text: “In future studies, we hope to identify specific sites of reglucosylation. These results would demonstrate if reglucosylation occurs on multiple sites or a small number of sites that are influenced by their local environment.”</p><disp-quote content-type="editor-comment"><p>2) Moreover, are all glycosylation sites utilised in these clients or only some and does that influence UGGT<sub>1/2</sub> engagement? Perhaps the authors might address this as an aspect that might help understand selective recognition by UGGT1 or 2.</p></disp-quote><p>This concern is addressed above in point #1.</p><disp-quote content-type="editor-comment"><p>3) In regard to the UGGT<sub>1/2</sub> clients identified, are there intrinsic or local folding/maturation features that makes them more frequently in need of reglucosylation than the rest of the glycoproteome? If so, what might that feature be, if not something general like a TMD. Perhaps the authors could further assess the domain structures of clients, or the relative position of glycans within them to add an additional dimension. As a reader, I would like to better understand why these proteins and not the other 97% of glycoproteins enter this route of maturation.</p></disp-quote><p>This concern was addressed above with our description of the algorithms employed to search for defining features of substrates.</p><disp-quote content-type="editor-comment"><p>4) Could UGGT activity play a determinant role in multimer assembly, say for the composition of the hexosaminidase dimer, for example where UGGT2 KO cells that reduce efficient trafficking of the HEX B subunit but not HEX A? Does this bias the composition and consequently function? More generally, could the activities of UGGT<sub>1/2</sub> offer a point of modulation for multimer composition? The authors raised the point of the impact of the UPR in the Discussion, which might be relevant.</p></disp-quote><p>The following text has been added to address the potential role for UGGT1 and UGGT2 in multimer assembly: “As a majority of the UGGT substrates are found in oligomeric complexes, the UGGTs might also exhibit a preference for unassembled subunits to help ensure proper protein assembly in the ER.”</p><disp-quote content-type="editor-comment"><p>5) The authors report that 70% of UGGT1 clients are Type I membrane proteins, but relative to the total number of Type I proteins in the glycoproteome, this number is relatively small. Why these proteins and not the remaining Type I's? Are there unique structural features, folding trajectories or glycan positions that provide some clue as to why these are preferentially engaging UGGT1? (slight reiteration of point 3)</p></disp-quote><p>To clarify, 70% of the transmembrane (TM) containing UGGT1 hits were type I membrane proteins, not 70% of all UGGT1 hits. About one third of all Type I proteins in the N-glycoproteome pass the characteristics of UGGT1 substrates stated in the manuscript (300+ luminally exposed amino acids, 4+ N-glycans, ≤ 7 pI). All but one of the identified UGGT1 type I proteins possesses these features. A large fraction of type I proteins are poor UGGT1 substrates as they lack the characteristics discussed above. The remaining third of type I proteins may be chaperone-independent folder or UGGT1 substrates not identified by our assay here due to the applied three-fold cutoff, differences in cell-types, the number of reglucosylation sites modified or low expression. In addition, some of these type I membrane proteins may not be UGGT1 substrates due to unknown characteristics. The proteins in the N-glycoproteome that pass this test are provided in Source data 2. This table contains the protein name, accession number and sequence for each N-glycoproteome type I protein that passed the described substrate characteristic test, as well as their values associated with each parameter. These data are not included in the manuscript as a quantitative prediction algorithm requires a larger sample size and further refinement.</p><disp-quote content-type="editor-comment"><p>6) If the 3-fold change cut-off is progressively lowered (or raised), how long do the UGGT<sub>1/2</sub> &quot;preferences&quot; outlined still hold true?</p></disp-quote><p>Below the applied three-fold cutoff, an increasing percent of proteins that are not predicted to be localized to the secretory pathway are found. As such, the quality of these data are not sufficient to support the determination of the substrate preferences of UGGT<sub>1/2</sub>. We have applied a six-fold cutoff and found that the preferences remain similar to that found for the three-fold cutoff.</p><disp-quote content-type="editor-comment"><p>Reviewer #3:</p><p>[…]</p><p>Altogether, the data support the conclusions taken. In this reviewer's opinion, however, there is a conceptual problem that the authors should consider and discuss. In the absence of ALG6, glycoprotein substrates are not able to bind calnexin and calreticulin before being glucosylated by the preferred UGGT. As this might shift the folding pathway, many potential clients of UGGT1 or 2 could go undetected. So, in all likelihood the proteins identified are indeed clients of either enzyme, but the quantitative conclusions should be softened and adequately discussed.</p></disp-quote><p>We agree that this an important issue that we discussed only briefly in the original manuscript but should be emphasized as it greatly impacted our identification of UGGT substrates. We have added the following paragraph to the Discussion: “ALG6<sup>-/-</sup> cells permitted the trapping of substrates glucosylated by the UGGTs. These cells are also expected to support the enhancement of glucosylation of glycoproteins that are more reliant upon early lectin chaperone intervention. As observed for IGF-1R, the lack of early intervention of the lectin chaperones directed by glucosidase trimming might lead to misfolding; thereby creating a better substrate for the UGGTs. The use of the cell lines lacking the ability to initiate lectin chaperone binding by the glucosidase trimming (Alg6<sup>-/-</sup>) or UGGT reglucosylation (UGGT<sup>-/-</sup> cells) provides a platform to delineate which part of the lectin chaperone binding cycle has the greatest influence of glycoprotein maturation and trafficking.”</p><disp-quote content-type="editor-comment"><p>Figure 3. Somehow surprisingly, immunoblotting of the whole cell lysates reveals no significant differences in the mature/pro-form ratios in any of the three clients analyzed. This is hard to reconcile with the pulse-chase experiment shown for IGF-1R.The authors may wish to comment about this discrepancy.</p></disp-quote><p>The cell lines used in the immunoblots in Figure 3 are different than those used in the pulse chase experiment in Figure 5. The cell lines in Figure 3 (ALG6/UGGT1<sup>-/-</sup>, ALG6/UGGT2<sup>-/-</sup>, ALG6/UGGT<sub>1/2</sub><sup>-/-</sup>) were not used in Figure 5. There is likely minimal difference between the cell lines used in Figure 3 as data shown in Figure 5 demonstrates that IGF-1R is most dependent on initial cnx/crt binding, and as such deletion of UGGT1 or UGGT2 in an ALG6<sup>-/-</sup> background yields minimal changes in IGF-1R folding and trafficking efficiency.</p><disp-quote content-type="editor-comment"><p>Despite sustaining the conclusions taken by the authors, the gels shown in Figures 3I, 3M and 5E are of rather low quality. An effort to improve the aesthetics of the experiments is worth.</p></disp-quote><p>We have now included improved gels for Figures 3I, 3M, and 5E.</p><disp-quote content-type="editor-comment"><p>In Figure 5, a one-hour pulse is quite long to follow the folding of a glycoprotein. A shorter pulse might reveal more details.</p></disp-quote><p>As these experiments are conducted using endogenously expressed proteins with immunoprecipitations using antibodies directed against the endogenous protein rather than tags. A 30-min pulse does not yield a sufficient amount of protein for trafficking analysis. While some details may be lost due to the hour pulse, only a minimal amount of IGF-1R is mature at the 0 hr time point, suggesting an adequately immature population of protein is being examined.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><disp-quote content-type="editor-comment"><p>Reviewer #1:</p><p>The revised version is improved and addresses my previous concerns. On re-reading, however, I was struck by a couple of things that might be addressed by the authors textually. Alternatively, I may have missed something.</p><p>First, it seems that it would be a good idea to repeat the mass spectrometry in an ALG6/UGGT<sub>1/2</sub><sup>-/-</sup> triple KO/KD condition to know that hits recovered in the UGGT single mutants are not non-specific or arising from some redundant enzyme. This is shown in Figure 3 for specific substrates, so it may not be an issue, but it seemed to me to be a potentially important control.</p></disp-quote><p>To address this concern, we have added the following text: “As reglucosylation was not observed for any of the validated substrates tested when both UGGT1 and UGGT2 were knocked out, these glucosyltransferases appear to be responsible for the reglucosylation of N-glycans in the ER.”</p><p>Our reasoning for not performing the TMT labelling mass spec with the triple knockout cell lines is largely one of logistics. This negative control cell line was created a few months after the quantitative mass spec results were obtained with the single and double knockout cell lines. The value of performing the quantitative mass spec as a negative control was greatly diminished when we observed there was no glucosylation of any of the diverse substrates selected for validation in Figure 3. During this period, time in the lab and access to the mass spectrometry became restricted by the pandemic. Therefore, we decided that importance of moving the project and career of the graduate student performing the studies forward significantly outweighed the limited benefit of the additional negative control.</p><disp-quote content-type="editor-comment"><p>Second, I seem to be missing something with regard to the hits recovered from the ALG6 KO cells versus those with the UGGT enzymes also KO'ed. I would have thought that the ALG6 proteome should encompass all UGGT hits, with smaller numbers of proteins recovered from the single mutants (and none recovered from a double). Yet, there are fewer proteins in the ALG6 <sup>-/-</sup> calnexin-precipitated proteome. What am I missing? Is this important?</p></disp-quote><p>The explanation for this interesting (and initially surprising) point is found in the text:</p><p>“With the <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells, 66 N-glycosylated proteins were identified as reglucosylation substrates using the three-fold cutoff (GST-CRT/CST-CRT-Y109A) (Figure 2A). Nearly double the number of UGGT1 substrates were identified through this approach compared to using <italic>ALG6<sup>-/-</sup></italic> cells where both UGGT1 and UGGT2 were present. This expansion in substrate number is likely due to the ~50% increase in expression of UGGT1 in <italic>ALG6</italic>/<italic>UGGT2<sup>-/-</sup></italic> cells (Figure 2—figure supplement 1)…”</p><disp-quote content-type="editor-comment"><p>Finally, in the analysis presented in Figure 4 (which is much easier to interpret now) I wonder if it's worth separating out the lysosomal N-glycoproteome given that the authors claim UGGT clients are more likely to be lysosomal proteins. If one just considers the lysosomal cohort of N-glycome, does this profile more closely resemble the UGGT proteome?</p></disp-quote><p>As suggested, we separated out the lysosome N-glycoproteome to determine if it aligned more closely with the UGGT substrates identified using the three experimental cell lines than the overall N-glycoproteome used in Figure 4. However, as you can see from <xref ref-type="fig" rid="respfig3">Author response image 3</xref>, the lysosome N-glycoproteome aligns closely with the overall Nglycoproteomes in regard to amino acid length, glycan number and pI. The only parameter where the lysosome Nglycoproteome aligned better with the UGGT substrates was for UGGT2 substrates obtained <italic>from ALG6/UGGT1<sup>-/-</sup></italic> cells. Therefore, for the manuscript figure, we have chosen to use the complete N-glycoproteome that represents all the N-glycosylated substrates potentially available to the UGGTs for modification.</p><fig id="respfig3"><label>Author response image 3.</label><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-63997-resp-fig3-v2.tif"/></fig></body></sub-article></article>