<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.2" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">64819</article-id><article-id pub-id-type="doi">10.7554/eLife.64819</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell Biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Developmental Biology</subject></subj-group></article-categories><title-group><article-title>Dynamics of primitive streak regression controls the fate of neuromesodermal progenitors in the chicken embryo</article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes" id="author-214683"><name><surname>Guillot</surname><given-names>Charlene</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-9214-7509</contrib-id><email>charlene_guillot@hms.harvard.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-238695"><name><surname>Djeffal</surname><given-names>Yannis</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-215610"><name><surname>Michaut</surname><given-names>Arthur</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-189486"><name><surname>Rabe</surname><given-names>Brian</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-75455"><name><surname>Pourquié</surname><given-names>Olivier</given-names></name><email>pourquie@genetics.med.harvard.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Pathology, Brigham and Women’s Hospital</institution><addr-line><named-content content-type="city">Boston</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution>Department of Genetics, Harvard Medical School</institution><addr-line><named-content content-type="city">Boston</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution>Harvard Stem Cell Institute</institution><addr-line><named-content content-type="city">Boston</named-content></addr-line><country>United States</country></aff><aff id="aff4"><label>4</label><institution>Howard Hughes Medical Institute</institution><addr-line><named-content content-type="city">Boston</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Bronner</surname><given-names>Marianne E</given-names></name><role>Reviewing Editor</role><aff><institution>California Institute of Technology</institution><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Bronner</surname><given-names>Marianne E</given-names></name><role>Senior Editor</role><aff><institution>California Institute of Technology</institution><country>United States</country></aff></contrib></contrib-group><pub-date date-type="publication" publication-format="electronic"><day>06</day><month>07</month><year>2021</year></pub-date><pub-date pub-type="collection"><year>2021</year></pub-date><volume>10</volume><elocation-id>e64819</elocation-id><history><date date-type="received" iso-8601-date="2020-11-12"><day>12</day><month>11</month><year>2020</year></date><date date-type="accepted" iso-8601-date="2021-06-23"><day>23</day><month>06</month><year>2021</year></date></history><permissions><copyright-statement>© 2021, Guillot et al</copyright-statement><copyright-year>2021</copyright-year><copyright-holder>Guillot et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-64819-v2.pdf"/><abstract><p>In classical descriptions of vertebrate development, the segregation of the three embryonic germ layers completes by the end of gastrulation. Body formation then proceeds in a head to tail fashion by progressive deposition of lineage-committed progenitors during regression of the primitive streak (PS) and tail bud (TB). The identification by retrospective clonal analysis of a population of neuromesodermal progenitors (NMPs) contributing to both musculoskeletal precursors (paraxial mesoderm) and spinal cord during axis formation challenged these notions. However, classical fate mapping studies of the PS region in amniotes have so far failed to provide direct evidence for such bipotential cells at the single-cell level. Here, using lineage tracing and single-cell RNA sequencing in the chicken embryo, we identify a resident cell population of the anterior PS epiblast, which contributes to neural and mesodermal lineages in trunk and tail. These cells initially behave as monopotent progenitors as classically described and only acquire a bipotential fate later, in more posterior regions. We show that NMPs exhibit a conserved transcriptomic signature during axis elongation but lose their epithelial characteristicsin the TB. Posterior to anterior gradients of convergence speed and ingression along the PS lead to asymmetric exhaustion of PS mesodermal precursor territories. Through limited ingression and increased proliferation, NMPs are maintained and amplified as a cell population which constitute the main progenitors in the TB. Together, our studies provide a novel understanding of the PS and TB contribution through the NMPs to the formation of the body of amniote embryos.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>neuromesodermal progenitor</kwd><kwd>bipotency</kwd><kwd>cell dynamics</kwd><kwd>direct lineage tracing</kwd><kwd>single cell analysis</kwd><kwd>body axis formation</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Chicken</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100003043</institution-id><institution>EMBO</institution></institution-wrap></funding-source><award-id>ALTF 406-2015</award-id><principal-award-recipient><name><surname>Guillot</surname><given-names>Charlene</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>RO1HD097068-02</award-id><principal-award-recipient><name><surname>Pourquié</surname><given-names>Olivier</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Inverse gradients of cell ingression and division in the epiblast allow the bipotent progenitors in the anterior streak to become the main progenitors for posterior axis formation from the tail bud.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>The amniote primitive streak (PS), equivalent of the amphibian blastopore, forms at the midline of the embryo during gastrulation. It marks the location where epithelial cells of the epiblast undergo epithelium to mesenchyme conversion and ingress to form the mesoderm and endoderm. At the end of gastrulation, the PS has reached its maximum length and begins to regress, laying in its wake the tissues that will form the embryonic body. When regression is complete, the remnant of the PS morphs into a poorly organized mass of cells located at the posterior end of the embryo, the tail bud, which generates the posterior-most regions of the body (<xref ref-type="bibr" rid="bib68">Stern, 2004</xref>). Fate mapping studies in avian and mouse embryos have shown that at the beginning of PS regression the mesodermal trunk progenitors are found in the epiblast along the PS (<xref ref-type="bibr" rid="bib40">Kinder et al., 1999</xref>; <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>; <xref ref-type="bibr" rid="bib61">Schoenwolf et al., 1992</xref>; <xref ref-type="bibr" rid="bib64">Smith et al., 1994</xref>; <xref ref-type="bibr" rid="bib66">Spratt and Condon, 1947</xref>; <xref ref-type="bibr" rid="bib71">Tam and Beddington, 1987</xref>; <xref ref-type="bibr" rid="bib78">Wilson and Beddington, 1996</xref>). These studies demonstrated that the anteroposterior distribution of mesodermal progenitors in the PS epiblast reflects their future medio-lateral fate. Cells within the node generate the notochord, and the most anterior PS cells produce the paraxial mesoderm, while the territories of the intermediate, lateral plate and extraembryonic mesoderm lie in progressively more posterior regions of the PS. The recent discovery of a new population of axis progenitor stem cells, the neuromesodermal progenitors (NMPs) in mouse, has led to reconsider the PS role in amniote body formation (<xref ref-type="bibr" rid="bib73">Tzouanacou et al., 2009</xref>). These bipotent stem cells generating large clones containing both neural and mesodermal derivatives along the forming body axis were identified by a retrospective strategy, which did not allow to precisely localize them in the embryo. Intriguingly, direct reconstruction of the epiblast cell lineage from high-resolution light-sheet imaging of developing mouse embryos did not identify bipotential NMP cells in the PS region but only cells fated to one or the other lineage (<xref ref-type="bibr" rid="bib46">McDole et al., 2018</xref>). Similar retrospective tracking experiments based on time-lapse movies of fluorescent cells in transgenic chicken embryos expressing GFP have led to identify a small population of epiblast cells that gives rise to descendants lying in neural and mesodermal territories (<xref ref-type="bibr" rid="bib79">Wood et al., 2019</xref>). In the chicken and mouse embryo, extensive fate mappings of the PS region have been performed, but they did not reveal the existence of NMPs giving rise to paraxial mesoderm and neural tube (<xref ref-type="bibr" rid="bib6">Brown and Storey, 2000</xref>; <xref ref-type="bibr" rid="bib36">Iimura et al., 2007</xref>; <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>; <xref ref-type="bibr" rid="bib61">Schoenwolf et al., 1992</xref>; <xref ref-type="bibr" rid="bib63">Selleck and Stern, 1991</xref>; <xref ref-type="bibr" rid="bib71">Tam and Beddington, 1987</xref>; <xref ref-type="bibr" rid="bib78">Wilson and Beddington, 1996</xref>; <xref ref-type="bibr" rid="bib77">Wilson et al., 2009</xref>). Grafts of small territories of the epiblast adjacent to the anterior PS in avian or mouse embryos can give rise to both neural and mesodermal derivatives, suggesting that this territory could contain NMPs (<xref ref-type="bibr" rid="bib22">Garcia-Martinez et al., 1993</xref>; <xref ref-type="bibr" rid="bib36">Iimura et al., 2007</xref>; <xref ref-type="bibr" rid="bib80">Wymeersch et al., 2016</xref>). In mouse, cells of this region (caudal lateral epiblast and node streak border) coexpress the neural marker Sox2 and the mesodermal marker T/Brachyury and were proposed to include the NMP population (<xref ref-type="bibr" rid="bib80">Wymeersch et al., 2016</xref>). However, these grafting experiments do not allow to distinguish between a population of bipotential cells and a mixture of precursors committed to each lineage. To our knowledge, the only direct evidence for epiblast precursors able to give rise to both neural and mesodermal lineages in amniotes comes from single-cell injections of horseradish peroxidase in the mouse epiblast followed by embryo culture (<xref ref-type="bibr" rid="bib21">Forlani et al., 2003</xref>). In this work, six clones with descendants in both lineages have been obtained from injections between the late streak and head fold stage. However, this study was performed before identification of NMPs by retrospective cloning and the bifated clones are not discussed in the article. Thus, the localization and fate of NMPs in amniotes remain incompletely understood.</p><p>Here, we performed direct lineage analysis of cells in the anterior PS epiblast of chicken embryos using two different approaches: labeling cells with a barcoded retroviral library and a Brainbow-derived strategy (<xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref>). We show that single cells of the SOX2/T-positive region of the anterior PS are NMPs that can contribute to both neural tube and paraxial mesoderm and self-renew during formation of more posterior regions of the body. As most published fate mappings have been analyzed only after short term and did not study formation of the posterior regions of the embryo, cells of the anterior epiblast were considered monopotent and their bipotentiality went undetected. Thus, our findings reconcile the existence of bipotential NMPs demonstrated in mouse with the large body of amniote fate mappings described in classical developmental biology literature. We also performed single-cell RNA-sequencing (scRNAseq) analyses of the region encompassing the anterior PS epiblast and tail bud during axis elongation. This led to the identification of a cluster exhibiting two developmental trajectories leading to neural and mesodermal fates as expected for NMPs. We identified a similar cluster from published scRNAseq datasets from posterior tissues of equivalent stages of developing mouse embryos. In mouse and chicken embryos, these NMP populations maintained a conserved transcriptional identity segregating from their neural and mesodermal descendants as a single-cell cluster. During formation of the posterior body, the NMP population nevertheless underwent maturation characterized by expression of posterior Hox genes and loss of the epithelial phenotype. Moreover, using in toto imaging, we show that a posterior-to-anterior gradient of cell convergence speed toward the PS coupled to ingression results in the progressive exhaustion of the PS from its posterior end. This leads to the successive disappearance of the territories of the extraembryonic, lateral plate, intermediate mesoderm, and non-NMP paraxial mesoderm precursors (PMPs). Increased proliferation combined with limited ingression of cells ensures the self-renewal and expansion of the territory of clonally related bipotential NMPs during body formation, which constitutes the last remnant of the PS to contribute to the tail bud. Thus, our work provides a direct demonstration of the existence of NMP cells in amniotes and a mechanistic understanding for their sustained contribution to axis elongation.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Characterization of the SOX2/T-positive territory of the epiblast and the anterior PS region</title><p>As co-expression of SOX2 and T has been proposed to identify NMPs in mouse embryos (<xref ref-type="bibr" rid="bib80">Wymeersch et al., 2016</xref>), we first set out to characterize the double-positive SOX2/T population in the epiblast during development of the chicken embryo. At stage 4<sup>-</sup> HH (<xref ref-type="bibr" rid="bib30">Hamburger and Hamilton, 1992</xref>), SOX2 is only expressed in the neural plate in the anterior epiblast and its expression domain progressively expands posteriorly to reach the anterior PS and the adjacent epiblast at stage 4-5HH (<xref ref-type="fig" rid="fig1">Figure 1A</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A–C</xref>). SOX2 expression levels show a graded pattern, which peaks in the anterior neural plate and decreases in the epiblast lateral to the anterior-most PS (<xref ref-type="fig" rid="fig1">Figure 1A</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D–F</xref>). No SOX2 expression is detected in the epiblast adjacent to the posterior PS. At these stages, T expression shows a reverse gradient along the PS, with low levels in the epiblast around the node region and high levels in the posterior end of the PS (<xref ref-type="fig" rid="fig1">Figure 1B</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1E, F</xref>). At stage 4+HH, these opposing gradients begin to overlap in the epiblast lateral to the anterior PS, defining a SOX2/T territory that forms an inverted V capping the PS (<xref ref-type="fig" rid="fig1">Figure 1C, D</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1G, H</xref>). At stage 5HH, numerous double-positive SOX2/T cells are found in the epiblast of the anterior PS region, with the underlying mesoderm expressing the paraxial mesoderm-specific marker MSGN1 (<xref ref-type="fig" rid="fig1">Figure 1E, F, E’, F’</xref>, levels 2 and 3, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1G, H</xref>). Posterior to this domain, the epiblast of the PS region expresses T but not SOX2, while the underlying mesoderm maintains a high level of MSGN1 expression (<xref ref-type="fig" rid="fig1">Figure 1E, F, E’’, F’’</xref>, level 4). Posterior to these two domains, in regions of the epiblast corresponding to the prospective intermediate mesoderm/lateral plate and the extraembryonic mesoderm (<xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>), epiblast cells express T but not SOX2 and no MSGN1-positive cells are found in the underlying mesoderm (<xref ref-type="fig" rid="fig1">Figure 1E, F</xref>, level 5). Therefore, the presumptive paraxial mesoderm territory of the epiblast of the anterior PS can be subdivided into an anterior domain where cells co-express SOX2 and T corresponding to the presumptive NMP territory and a posterior PMP domain where cells express T but not SOX2 (<xref ref-type="fig" rid="fig1">Figure 1D, E’, E’’</xref>). Both domains are characterized by the production of MSGN1-positive PMPs.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Characterization of the SOX2/T-positive territory of the epiblast.</title><p>(<bold>A–C</bold>) Whole-mount embryos and (<bold>E, F</bold>) transverse cryosections showing the immunolocalization of SOX2 (<bold>A</bold>), T (<bold>B</bold>), T and SOX2 (<bold>C, E</bold>), and MSGN1 (<bold>F</bold>) in chicken embryos at stage 5HH. (<bold>D</bold>) Schematic representation of the expression of T (blue: high; green: low), SOX2 (red), and SOX2/T (gold) in a stage 5HH chicken embryo. The level of the tissue sections in (<bold>E, F</bold>) is shown with dashed double arrows labeled from 1 to 5 from anterior to posterior. (<bold>E’, F’</bold>) Higher magnification of the NMP region (level 3, <bold>E</bold>, <bold>F</bold>). (<bold>E’’, F’’</bold>) Higher magnification of the PMP region (level 4, <bold>E, F</bold>). (n = 7 embryos for whole mount; n = 3 for cryosections). PS regions are defined based on distance from Hensen’s node as described in <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>. (<bold>G</bold>) Maximum intensity projections from confocal images of chicken embryos immunostained for T (green) and SOX2 (red) proteins. Double-positive cells are shown in yellow. White hatched line in the 25-somite embryo marks the end of the neural tube (red) and the NMP region (orange) (n = 23 embryos analyzed in total). (<bold>H</bold>) Diagram summarizing the experimental procedure to label NMP cells in stage 5HH embryos using electroporation of a fluorescent reporter in the epiblast of the anterior PS region (in green) followed by analysis at the tail bud stage. (<bold>I, J</bold>) Fate of descendants of cells of the NMP region electroporated at stage 5HH with an H2B-RFP plasmid and imaged in time lapse at the 25-somite stage in the tail bud region. Z-projection from confocal images (<bold>I</bold>) and tracks (<bold>J</bold>) of a time-lapse movie showing the movements of the cells in the NMP territory for 10 hr (<xref ref-type="video" rid="video1">Video 1</xref>). Tracks were color-coded a posteriori. Neural, mesodermal, and NMP cell trajectories are shown in red, green, and gold, respectively. NP: neural plate; NMP: neuromesodermal progenitors; PMP: presomitic mesoderm progenitors; LPP: lateral plate progenitors; EMP: extraembryonic mesoderm progenitors; n: node; epi: epiblast; Meso: mesoderm; PS: primitive streak; NT: neural tube. Arrowheads: Hensen’s node. Asterisk: primitive streak. (<bold>A</bold>–<bold>D</bold>, G–<bold>J</bold>) Dorsal views. Anterior to the top. Scale bar: 100 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig1-v2.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Onset of SOX2/T expression cells in chicken.</title><p>(<bold>A–C</bold>) Representative maximum z-projections of confocal images of T and SOX2 whole-mount immunohistochemistry from stage 4 to stage 5HH. (<bold>D–F</bold>) Representative line profile intensities showing the quantification of the fluorescence intensity of the SOX2 (red) and T (green) staining along the anteroposterior axis of the embryos (y axis). 0 marks the anterior neural plate. Orange arrowheads: position of Hensen’s node representative of the anterior border of the primitive streak (PS). (<bold>G</bold>) Maximum z-projection of embryos stained in whole mount with SOX2/T antibodies showing the localization and the number of the SOX2/T double-positive cells (in yellow) in the anterior PS region. Within each color channel, we threshold the cells expressing T and SOX2 in the nucleus. The double-positive cells are identified by creating a new image with the thresholded image such as only cells expressing T and SOX2 are visible and quantified. Single positive cells are not shown. (<bold>H</bold>) Quantification of the number of SOX2/T double-positive cells between stage 4 and 5HH. Dorsal views, anterior to the top. Asterisk marks the tip of PS. White arrowheads: Hensen’s node (n = 18; seven embryos at stage 4HH, four at stage 4+HH, seven at stage 5HH). Scale bar: 100 µm.</p><p><supplementary-material id="fig1s1sdata1"><label>Figure 1—figure supplement 1—source data 1.</label><caption><title>Number of T/SOX2 double-positive cells during early chicken stages.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-fig1-figsupp1-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig1-figsupp1-v2.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 2.</label><caption><title>Fate of cells of the anterior PS region at the tail bud stage.</title><p>(<bold>A</bold>) Dorsal z-section of a 25-somite embryo showing the superficial localization of the descendants from the cells co-electroporated at stage 5 HH in the NMP region of the anterior PS with a GAP43-Venus and an H2B-RFP plasmid (marking the membrane and the nucleus, respectively). (<bold>B</bold>) Diagram showing the dorsal region of the tail bud region where cells were tracked in (<bold>C</bold>–<bold>E</bold>). (<bold>C–E</bold>) Images of tracked cells of the anterior PS that become neural (<bold>C</bold>), remain NMP, (<bold>D</bold>) or become PSM (<bold>E</bold>) cells. NMP cells are circled in gold, neural cells are circled in red, and PSM cells are circled in green (52 cells tracked in three embryos). NT: neural tube; NMP: neuromesodermal progenitors; PSM: presomitic mesoderm; PS: primitive streak. Anterior to the top, dorsal views. Scale bar: 100 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig1-figsupp2-v2.tif"/></fig></fig-group></sec><sec id="s2-2"><title>Cells of the anterior primitive streak epiblast contribute to the neural tube and paraxial mesoderm tissues during axis formation</title><p>In order to explore the fate of cells of the SOX2/T-positive region of the anterior PS, we first used a library of barcoded defective retroviruses expressing GFP (<xref ref-type="bibr" rid="bib31">Harwell et al., 2015</xref>) to infect the epiblast of the anterior PS region at stage 5HH (<xref ref-type="fig" rid="fig2">Figure 2A, B</xref>). Embryos were reincubated for 36 hr, and single fluorescent cells were manually harvested from the paraxial mesoderm and neural tube from embryo sections for subsequent barcode analysis. We identified seven clones expressing unique barcodes (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). Four clones contained cells both in the neural tube and in somites/presomitic mesoderm (PSM), indicating the bipotential nature of the infected cells of the epiblast of the anterior PS region. Descendants of bipotent cells were found in both anterior (before somite 27, which marks the transition between primary and secondary neurulation; <xref ref-type="bibr" rid="bib43">Le Douarin et al., 1998</xref>), and posterior regions of the axis (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). To confirm these observations, we performed lineage tracing of the SOX2/T region of the epiblast using genetic labeling based on the Brainbow-derived MAGIC markers (<xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref>). To mark cells in the SOX2/T domain, we co-electroporated plasmids expressing a self-excising Cre recombinase and the Nucbow transgene together with the TolII transposase to drive transgene integration. Electroporation of this set of constructs allows to permanently mark cell nuclei with a specific color code generated by the unique combination of different fluorescent proteins triggered by random recombination of the Nucbow cassette (<xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref>). This color code is then stably transmitted to each daughter cell and can be retrieved by confocal imaging and quantification of the color hues. Using very fine electrodes, we could electroporate as low as 10 epiblast cells of the anterior PS region at stage 5HH (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). We harvested embryos 36 hr (stage 17HH, <xref ref-type="fig" rid="fig2">Figure 2B, D</xref>) and 56 hr (stage 20HH, <xref ref-type="fig" rid="fig2">Figure 2H, I</xref>) after electroporation. We identified 47 clones containing a total of 690 cells in the neural tube and paraxial mesoderm in six embryos (<xref ref-type="fig" rid="fig2">Figure 2D–K</xref>). While we found both monopotent neural and mesodermal clones, the majority of the clones were bipotent (<xref ref-type="fig" rid="fig2">Figure 2E–G, J, K</xref>). Bipotent clones were found both in the anterior and posterior region, and they often exhibit descendants of only one lineage in some regions and of the other lineage in other regions (<xref ref-type="fig" rid="fig2">Figure 2F, K</xref>). Thus, our lineage-tracing analysis provides direct evidence for the existence of bipotent NMP cells located in the SOX2/T region of the anterior PS epiblast in the chicken embryo.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Cells of the SOX2/T-positive territory of the anterior primitive streak epiblast contribute to the neural tube and paraxial mesoderm tissues during axis formation.</title><p>(<bold>A</bold>) Schematic diagram showing the strategy used to decipher if the neuromesodermal progenitor (NMP) territory is a mix of monopotent cells (left) or composed of bipotent cells (right). Schemes show an example of a cell that has been marked by retroviral barcoding or genetic color coding and its expected outcome in the different cases (arrows). The color indicates the neural (red, N), the mesodermal (green, M), and the neuromesodermal (gold, NM) identities. (<bold>B</bold>) Experimental procedure showing the infected or electroporated region of the epiblast at stage 5HH (left, green) and the stage at which embryos were harvested for analysis (n = 3). (<bold>C</bold>) (left) Diagram showing the neural tube (red) and paraxial mesoderm (green) in the anterior (light) and posterior (dark) regions of the embryo. (Right) Pie graphs showing the distribution of the neural (red) and mesodermal (green) cells anterior (light) or posterior (dark) to the 27th somite in the seven clones identified by retrovirus labeling analyzed (n = 110 cells in three embryos). (<bold>D</bold>) Confocal z-section showing the region of a stage 17HH embryo shown in (<bold>H</bold>) and acquired using three separated laser paths to retrieve the color codes genetically encoded as described in <xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref>. (<bold>E</bold>) Triplot diagrams showing the distribution of descendants of cells labeled with different Nucbow combinations in the anterior (top) and posterior (bottom) regions of seven clones in a representative stage 17HH embryo. Each symbol represents a cell identified based on the percentage of red, blue, and yellow expressed. The symbols are colored based on their clonal identity. Squares: neural cells; stars: mesodermal cells. (<bold>F</bold>) (left) Region analyzed showing the different axial levels. (Right) Axial distribution of the clones in three-stage 17HH embryos. Red bars: neural cells; green bars: mesodermal cells. (<bold>G</bold>) Quantification of the different clones: mesodermal (M, green), neural (N, red), and bipotent neuromesodermal clones (NM, gold) at stage 17HH (left) and stage 20HH (right) (n = 16 clones, 271 cells in three embryos) and (n = 40 clones, 519 cells in three embryos), respectively. (<bold>H</bold>) Experimental procedure showing the electroporated region of the epiblast at stage 5HH (left, green) and the stage at which embryos were harvested for analysis (n = 3). (<bold>I</bold>) Confocal z-section using three-color imaging (<xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref>) corresponding to the posterior region of a stage 20HH embryo shown in (<bold>H</bold>). (<bold>J</bold>) Triplots showing the distribution of 10 representative clones in the anterior (left) and posterior (right) regions of a stage 20HH embryo electroporated at stage 5HH. Squares: neural cells; stars: mesodermal cells. (<bold>K</bold>) (left) Region analyzed showing the different axial levels. (Right) Axial distribution of the clones in three embryos. Green bars: mesodermal cells; red bars: neural cells, double line: anteroposterior axis. M: mesoderm; N: neural; NM: neuromesodermal; S: somite; HL: hindlimb; D: dorsal views. Anterior to the top. Scale bar: 100 µm.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Retrovirus and Brainbow labeling of chicken embryo.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-fig2-data1-v2.xlsx"/></supplementary-material></p><p><supplementary-material id="fig2sdata2"><label>Figure 2—source data 2.</label><caption><title>Matlab code for clone identification.</title></caption><media mime-subtype="zip" mimetype="application" xlink:href="elife-64819-fig2-data2-v2.zip"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Quantification of the number of epiblast cells electroporated.</title><p>(<bold>A</bold>) Brightfield (left) and fluorescence (right) images of a stage 5HH chicken embryo 4 hr after one pulse of electroporation on each side of the anterior primitive streak (PS) with an H2B-RFP plasmid. The electroporated areas are within the orange box. (<bold>B</bold>) Higher magnification of the orange box shown in (<bold>A</bold>). Fluorescent nuclei in electroporated cells are shown in yellow, and the electroporated areas are circled in red. (<bold>C</bold>) Violin plot showing the quantification of the number of fluorescent nuclei 4 hr after one pulse or two successive pulses of electroporation at the same location (n = 4 embryos).</p><p><supplementary-material id="fig2s1sdata1"><label>Figure 2—figure supplement 1—source data 1.</label><caption><title>Number of electroporated cells after one or two pulses.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-fig2-figsupp1-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig2-figsupp1-v2.tif"/></fig></fig-group><p>We next investigated the fate of the SOX2/T territory during axis formation. During PS regression, that is, up to the 10–12-somite stage, the SOX2/T cells were maintained in the epiblast lateral to the anterior-most part of the PS, below Hensen’s node (arrowhead, <xref ref-type="fig" rid="fig1">Figure 1G</xref>). After the 10-somite stage, cells were found in continuity with the posterior-most SOX2-positive/T-negative neural tube (<xref ref-type="fig" rid="fig1">Figure 1G</xref>). These SOX2/T cells eventually became located in a superficial region of the tail bud at the 25-somite stage where they remain at least until stage 26HH (<xref ref-type="bibr" rid="bib52">Olivera-Martinez et al., 2012</xref>; <xref ref-type="fig" rid="fig1">Figure 1G</xref>). In order to analyze the lineage continuity of cells of the anterior PS region, we performed local electroporations of small groups of epiblast cells with a H2B-RFP reporter in ovo, targeting the SOX2/T-positive territory of the anterior PS region at stage 5HH (<xref ref-type="fig" rid="fig1">Figure 1H</xref>). We next performed confocal live imaging of the labeled embryos to track the RFP-expressing cells at the 25-somite stage (<xref ref-type="video" rid="video1">Video 1</xref>). At this stage, electroporated cells were found in the neural tube, paraxial mesoderm, and superficial region of the tail bud where the SOX2/T cells were identified (<xref ref-type="fig" rid="fig1">Figure 1G, I</xref>, <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A, B</xref>). Thus, this tail bud territory contains descendants of the SOX2/T cells of the anterior PS epiblast region of stage 5HH embryos. We next performed time-lapse imaging to track fluorescent cells from this superficial SOX2/T-positive territory to examine their fate (<xref ref-type="fig" rid="fig1">Figure 1H–J</xref>, <xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref>). We observed anterior cells undergoing limited movements along the AP axis and moving to join the neural tube (<xref ref-type="fig" rid="fig1">Figure 1J</xref>, red tracks, <xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref>). These cells subsequently acquired the characteristic mediolateral elongated shape of neural tube cells (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2C</xref>, <xref ref-type="video" rid="video2">Video 2</xref>). Cells in the middle of the SOX2/T territory moved in the AP direction but undergo very limited medial to lateral movements (<xref ref-type="fig" rid="fig1">Figure 1J</xref>, gold tracks, <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2D</xref>, <xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref>). These cells neither joined the neural tube nor the mesoderm, suggesting that they remained in a progenitor state. In contrast, some posterior cells undergo dorsal to ventrolateral movements into the mesoderm (<xref ref-type="fig" rid="fig1">Figure 1J</xref>, green tracks, <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2E</xref>, <xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref>). Therefore, our data supports lineage continuity and conserved bipotential fate of the SOX2/T territory during axis elongation, suggesting that NMPs constitute a stem cell population able to contribute to the neural and mesodermal fates and to self-renew.</p><media id="video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-64819-video1.mp4"><label>Video 1.</label><caption><title>Tracking descendants of the anterior primitive streak (PS) epiblast at 25 somites.</title><p>Time-lapse movie of dorsal maximum z-projections showing descendants from the neuromesodermal progenitor (NMP) region electroporated at stage 5HH with an H2B-RFP plasmid in time lapse. t = 4 min between frames, movie = 10 hr. z-sectioning = 4 μm. 20× objective, LSM 780.</p></caption></media><media id="video2" mime-subtype="mp4" mimetype="video" xlink:href="elife-64819-video2.mp4"><label>Video 2.</label><caption><title>Tracking the fate of descendants of the anterior epiblast at 25 somites.</title><p>Time-lapse movie of dorsal maximum z-projections of a 25-somite embryo showing the localization and fate of descendants from cells of the anterior primitive streak (PS) epiblast region co-electroporated at stage 5HH with a GAP43-Venus and an H2B-RFP plasmid (marking the membrane and the nucleus, respectively). The SOX2/T region of the tail bud is delimited by the white lines. Tracks of selected cells are shown. Color code indicates the z position of the cells (yellow: dorsal; blue: ventral). t = 8 min between frames. z-sectioning = 4 μm. 20× objective, LSM 780.</p></caption></media></sec><sec id="s2-3"><title>scRNAseq analysis of the precursors of posterior tissues during axis formation in chicken and mouse</title><p>To characterize the molecular identity of these NMPs, we performed scRNAseq of cells dissociated from a micro-dissected region encompassing the anterior PS in stage 5HH and in 6-somite embryos as well as the tail bud of 35-somite embryos (<xref ref-type="fig" rid="fig3">Figure 3A–C</xref>). We used the inDrops sequencing platform to analyze 2059 cells at stage 5HH, 1628 cells at the 6-somite, and 3561 cells at the 35-somite stage. We identified clusters that could be assigned expected cell identities of the dissected regions for each developmental stage based on the expression of specific genes (<xref ref-type="fig" rid="fig3">Figure 3A–C</xref> and <xref ref-type="supplementary-material" rid="supp1">Supplementary files 1</xref> and <xref ref-type="supplementary-material" rid="supp2">2</xref>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). Expression of the genes at the corresponding stages was validated based on the Geisha In Situ hybridization database (<ext-link ext-link-type="uri" xlink:href="http://geisha.arizona./">http://geisha.arizona./</ext-link>). Heat maps showing the top differentially expressed genes used to identify the clusters are shown in <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>, and the lists of differentially expressed genes are shown in <xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Single-cell RNA-sequencing (scRNAseq) analysis of the posterior tissue precursors during posterior axis formation.</title><p>(<bold>A–C</bold>) (left) Diagrams of a stage 5HH (<bold>A</bold>), a 6-somite (<bold>B</bold>), and a 35-somite (<bold>C</bold>) chicken embryo showing the region dissected and analyzed by scRNAseq in the hatched red boxes, which includes the NMP territory (in gold). (Right) <italic>k</italic>-NN graph showing the 2059 cells sequenced from stage 5HH embryos (<bold>A</bold>), the 1628 cells sequenced from 6-somite embryos (<bold>B</bold>), and the 3561 cells sequenced from 35-somite embryos (<bold>C</bold>) visualized with Uniform Manifold Approximation and Projection (UMAP). Single cells are colored based on Leiden clustering identities. (<bold>D</bold>) Dotplot showing the expression level of NMP signature genes in the chicken neural, NMP, and PSM clusters. (<bold>E–G</bold>) <italic>k</italic>-NN graphs combining all sequenced cells from stage 5HH, 6-somite and 35-somite chicken embryos (total: 7992 cells), visualized with UMAP and colored following Leiden clustering to show cell identities (<bold>E</bold>), or by developmental stage (<bold>F</bold>) or to show cells of the neural, NMP, PSM, and somite clusters (in red), which were used for the subsequent analysis shown in (<bold>H–J</bold>). Note that cells in the tan color belong to different cluster identities with less than 50 cells, and we decided to show them to represent the entirety of the data but do not analyze them in our study. (<bold>H–J</bold>) <italic>k</italic>-NN graphs showing cells of the chicken neural, NMP, PSM, and somite clusters extracted based on the analysis shown in (<bold>E–G</bold>) (total: 2801 cells) from stage 5HH, 6-somite, and 35-somite visualized with diffusion map (diffmap) and analyzed using Leiden clustering to show cell identities that include neural, NMP, PSM, and somite (<bold>H</bold>), as well as the developmental stage (<bold>I</bold>) or pseudo-temporal ordering with the NMP cluster as the starting node (<bold>J</bold>). (<bold>K–M</bold>) <italic>k</italic>-NN graphs showing cells of the mouse neural, NMP, and PSM clusters extracted based on the analysis shown in <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref> (total: 27,083 cells) from stage E7.0–E9.5 visualized with diffusion map (diffmap) and analyzed using Leiden clustering to show cell identities that include neural, NMP, and PSM (<bold>K</bold>), as well as the developmental stage (<bold>L</bold>) or pseudo-temporal ordering with the NMP cluster as the starting node (<bold>M</bold>). (<bold>N</bold>) Dotplot showing the expression level of NMP signature genes in mouse in the neural, NMP, and PSM clusters. Ecto: ectoderm; Endo: endoderm; Epi: epiblast; Meso: mesoderm; LP: lateral plate; NMP: neuromesodermal progenitors; NT: neural tube; NC: notochord; PSM: presomitic mesoderm; postPS: posterior PS; SOM: somite; LP2: lateral plate 2; MG: mixed gastrulation in (<bold>D</bold>, <bold>N</bold>). Circle size shows the percentage of cells expressing the gene in the cluster. Color shows the normalized level of expression. Normalization is done by gene across the clusters.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Single-cell RNA-sequencing (scRNAseq) analysis of stage 5HH to 35-somite chicken embryos.</title><p>(<bold>A–C</bold>) Top: Uniform Manifold Approximation and Projection (UMAP) plots showing Leiden clustering of the three chicken stages analyzed and the expression of neural (<italic>HES5</italic>), mesodermal (<italic>MEOX1</italic>), and neuromesodermal (<italic>WNT8A</italic>) genes in red, green, and gold respectively. Bottom: Heat maps showing the top 10 differentially expressed genes for each clusters. (<bold>D</bold>) UMAP plots of the different batches of cells within the corresponding stages analyzed. Pink and purple (stage 5HH); light and dark blue (6-somite); light and dark green (35-somite); and a merge of all the stages (All).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig3-figsupp1-v2.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>Analysis of combined data from stage 5HH, 6-somite, and 35-somite chicken embryos and identification of chicken neuromesodermal progenitor (NMP) signature genes.</title><p>(<bold>A</bold>) Venn diagram showing the intersection of the top 100 differentially expressed genes from stage 5HH, 6-somite, and 35-somite embryos. (<bold>B</bold>) Uniform Manifold Approximation and Projection (UMAP) plots showing Leiden clustering of the data combined from the three chicken developmental stages and the expression of the neural tube (<italic>HES5, PAX6</italic>), mesodermal (<italic>MSGN1, MEOX1, TCF15</italic>), and neuromesodermal (<italic>TBXT, FGF19, WNT8A,RASGRP3, FGF8, WNT3A</italic>) genes in red, green, and gold, respectively. (<bold>C</bold>) A <italic>k</italic>-NN classifier (linear discriminant analysis [LDA]) trained on clusters of the E9.5 mouse was used to predict identities of cells of the clusters (<xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>). The heat map shows the fraction of E9.5 assignments for each cluster. SOM: somite; aNTB: anterior neural tube; pNTB: posterior neural tube; PSM: presomitic mesoderm. (<bold>D</bold>) Pseudo-temporal ordering of gene expression. Heat map showing genes with significant dynamic expression ordered by peak expression, and selected markers of the neural (N) (<italic>PAX6, HES5, GBX2, PDGFA</italic>) and paraxial mesoderm (<italic>MSGN1, DLL1, MEOX1, TCF15, RIPPLY2</italic>) differentiation from the NMP state (<italic>EVX1, FGF8, FGF19, TBXT, WNT8A</italic>). Color bars indicate Leiden cluster identities and pseudo-temporal position.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig3-figsupp2-v2.tif"/></fig><fig id="fig3s3" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 3.</label><caption><title>Analysis of combined data from E7.0 to E9.5 mouse embryos to identify the neuromesodermal progenitor (NMP), presomitic mesoderm (PSM), neural, and somite clusters.</title><p>(<bold>A</bold>) Uniform Manifold Approximation and Projection (UMAP) showing the integration of the two mouse datasets (<xref ref-type="bibr" rid="bib55">Pijuan-Sala et al., 2019</xref> and <xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>) by stage (n = 120,679 cells), (<bold>B</bold>) Identification of the neural tube (NT), NMP, PSM, and somite (S) clusters from the dataset shown in (<bold>A</bold>) using the Leiden algorithm. (<bold>C</bold>) Expression of the genes used for identifying the NT (Pax6, Sox2), NMP (Nkx1.2, T, Sox2), PSM (T, Tbx6), and somite (Meox1) clusters identification (<bold>D</bold>). NT (red), NMP (pink), PSM (green), and somite (purple). (<bold>C</bold>) Heat map showing the top 10 differentially expressed genes for the NT, PSM, NMP, and somite clusters. (<bold>C–E</bold>) Pseudo-temporal ordering of gene expression in cells of the NMP, PSM, neural tube, and somite clusters. Heat map showing the genes with significant dynamic expression ordered by peak expression, and selected markers of the neural (<italic>Pax6, Hes5, Gbx2, Pdgfa</italic>) and paraxial mesoderm (<italic>Msgn1, Dll1, Meox1, Tcf15, Ripply2</italic>) differentiation from the NMP state (Evx<italic>1, Fgf8, FGF17, T, Wnt8a</italic>). Color bars indicate Leiden cluster identities and pseudo-temporal position. Neural: red; PSM: light green; somite: dark green; NMP: gold.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig3-figsupp3-v2.tif"/></fig><fig id="fig3s4" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 4.</label><caption><title>Expression of neuromesodermal progenitor (NMP) signature genes in chicken and mouse.</title><p>(<bold>A, B</bold>) Projections of the expression of NMP signature genes on the diffmap plots (top left) of the nNeural tube (NT), NMP, presomitic mesoderm (PSM), and somite (S) clusters identified with the Leiden algorithm in chicken (<bold>A</bold>) and mouse embryos (<bold>B</bold>).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig3-figsupp4-v2.tif"/></fig></fig-group><p>At stage 5HH, we identified a large cluster corresponding to epiblast cells, characterized by the expression of <italic>SALL4</italic> or <italic>FRZB</italic>. Another cluster contained cells co-expressing markers of paraxial mesoderm (<italic>MSGN1, MEOX1</italic>) and lateral plate (<italic>TWIST1, GATA5</italic>), suggesting that they correspond to ingressed mesoderm contributing to the anterior-most somites as recently shown in mouse embryos (<xref ref-type="bibr" rid="bib28">Guibentif et al., 2021</xref>). A cluster containing early neural plate cells characterized by expression of <italic>SFRP2</italic> and <italic>PDGFA</italic>, as well as small clusters corresponding to the endoderm (<italic>SOX17, FOXA2</italic>) and the notochord (<italic>CHRD, NOTO</italic>), was also identified. The last cluster (yellow) expressing genes such as <italic>TBXT, CDH2, GJA1,</italic> and <italic>WNT8A</italic> is found in between neural and mesodermal clusters, suggesting that it could represent the NMP population (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). At the 6-somite stage, the large epiblast cluster was not present anymore. We identified a cluster of cells expressing PSM markers such as <italic>MSGN1</italic> or <italic>TCF15</italic> but no lateral plate markers, suggesting that they are precursors of more posterior somites. There were also two clusters of cells expressing genes associated with posterior PS (<italic>MSX2, JAM3, BAMBI</italic>) and LP (<italic>PITX2, GATA2</italic>) identities. We also identified clusters with neural (<italic>HES5, PDGFA</italic>), notochord (<italic>NOTO</italic>), and endoderm (<italic>SOX17</italic>) identities. A large cluster of cells connected to the neural and PSM clusters represents putative NMPs (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). At the 35-somite stage, cell populations of expected cell fates were clearly segregated, with clusters of LP (<italic>MSX2</italic>, <italic>PRRX1</italic>), blood (<italic>HBZ</italic>), notochord (<italic>CHRD</italic>), neural (<italic>HES5, PAX6</italic>), and ectoderm (<italic>EPCAM, WNT6</italic>). Cells with a PSM (<italic>MSGN1, DLL1</italic>) and somitic identity (<italic>MEOX1, TCF15</italic>) also formed separate clusters. As for the earlier stages, there was a putative NMP cluster lying between the neural and PSM clusters (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). Thus, at the three developmental stages, we observed a potential NMP cluster showing an identity different from ingressed mesoderm, neural plate, endoderm, and epiblast (<xref ref-type="fig" rid="fig3">Figure 3A–C</xref>). We identified a signature of genes that are differentially expressed in this cluster and conserved in the three potential NMP clusters. These include <italic>TBXT, GJA1, DLL1, APCDD1, WLS, CDH2, ATP2B1, FGF19, APLP2, WNT5A, GAD1, PALD1, AKAP12, EPHA1, </italic>a<italic>nd WNT8A</italic> (<xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). The majority of these genes are either targets or members of the Wnt pathway, which is critical for NMP differentiation in vivo and in vitro (<xref ref-type="bibr" rid="bib33">Henrique et al., 2015</xref>).</p><p>We next used the Leiden algorithm to perform a clustering analysis of the three developmental stages together (<xref ref-type="fig" rid="fig3">Figure 3E, F</xref>, <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>). This also led to the identification of clusters matching the well-known cell identities of the posterior region described above (<xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>), including a putative NMP cluster between the PSM and the NT clusters (<xref ref-type="fig" rid="fig3">Figure 3E</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2B</xref>). We extracted and reanalyzed 2801 cells of the NMP, neural tube, and paraxial mesoderm clusters (in red, <xref ref-type="fig" rid="fig3">Figure 3G</xref>). Using Leiden clustering algorithm, we found a unique NMP cluster composed of cells from all three developmental stages, lying in between clusters of cells of the NT and the PSM (<xref ref-type="fig" rid="fig3">Figure 3H, I</xref>). Using a linear discriminant analysis (LDA) classifier, we confirmed that identified clusters are related to clusters of similar identity from the posterior region of an E9.5 mouse embryo (<xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>; <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2C</xref>). An analysis of the pseudo-temporal developmental trajectory of NMPs shows two major differentiation paths leading either to neural or mesodermal fate, thus supporting the bipotentiality of these cells (<xref ref-type="fig" rid="fig3">Figure 3J</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2D</xref>). Altogether, our data suggest that chicken NMPs are maintained as a single-cell population with a distinct transcriptional identity during axis elongation.</p><p>We next performed a parallel analysis in mouse, combining a mouse embryo scRNAseq dataset of embryos ranging from E7 to E8.5 (116,312 cells) (<xref ref-type="bibr" rid="bib55">Pijuan-Sala et al., 2019</xref>) with our data of an E9.5 mouse embryo posterior region (4367 cells) (<xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>) in order to cover a similar developmental period to our chicken scRNAseq data. Clustering analysis combined with examination of the top differentially expressed genes in the clusters identified NT and paraxial mesoderm clusters (PSM and somite) as well as a distinct cluster lying in between, in which cells express <italic>T, Sox2,</italic> and <italic>Nkx1.2</italic>, suggesting that these cells are NMPs (<xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>; <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3A–C</xref>, <xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>). We next extracted cells of the NMP, neural, and PSM/somite clusters from this dataset to analyze them separately. Leiden-based reclustering analysis led to the identification of NT, NMP, PSM, and somite clusters (<xref ref-type="fig" rid="fig3">Figure 3K</xref>). The NMP cluster includes cells from all the developmental stages analyzed starting from E7.0 up to E9.5, indicating that these cells are maintained as a stable population during axis elongation (<xref ref-type="fig" rid="fig3">Figure 3L</xref>, <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>). Using pseudotime analysis, we identified two main developmental trajectories arising from the NMP cluster and leading to neural and mesodermal identities, supporting the bipotentiality of these cells (<xref ref-type="fig" rid="fig3">Figure 3M</xref>, <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3E</xref>). This is consistent with previous reports indicating that NMPs first form at E7.0 in mouse embryos (<xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>; <xref ref-type="bibr" rid="bib28">Guibentif et al., 2021</xref>), that is, at a roughly equivalent stage to chicken embryos (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>), which corresponds to the beginning of PS regression. Most NMP signature genes common to the three chicken NMP clusters were also expressed in the mouse NMP cluster (<xref ref-type="fig" rid="fig3">Figure 3D, N</xref>, <xref ref-type="fig" rid="fig3s4">Figure 3—figure supplement 4</xref>). A third developmental trajectory was also observed within the NMP cluster, correlating with the age of the embryo (<xref ref-type="fig" rid="fig3">Figure 3K–M</xref>). This suggests that while they exhibit a largely conserved transcriptional identity, cells of the NMP cluster nevertheless show some maturation during axis elongation. This trajectory is also visible in the chicken pseudotime analysis although it is less conspicuous (<xref ref-type="fig" rid="fig3">Figure 3J</xref>).</p><p>Altogether, our data identify NMPs as a cell population conserved in chicken and mouse that exhibit a distinct identity from mesodermal and neural cells. These cells first become specified at the beginning of PS regression and remain as a population of bipotential precursors contributing both to the neural and mesodermal territories during formation of the posterior embryonic axis.</p></sec><sec id="s2-4"><title>Quantitative analysis of the transition states between NMP, neural, and PSM fates in the mouse and chicken embryo</title><p>We next used a trajectory inference technique based on optimal-transport (Waddington-OT [WOT]) to analyze quantitatively how NMP cells transition between the NMP, PSM, and neural states (<xref ref-type="bibr" rid="bib60">Schiebinger et al., 2019</xref>). This method allows to compute the probability distribution in gene-expression space where each cell has a distribution of both probable origins and probable fates. By inferring the temporal couplings with optimal transport of the cells between NMPs, PSM, and the neural tube, we reconstructed their probabilistic developmental trajectories in a transport map. The trajectories represent the probability vector for a cell to join the cluster of interest at day E9.5 in the mouse dataset and at 35 somites in the chicken dataset. We first extracted cells from mouse and chicken NMP clusters as well as their expected descendants of the PSM and neural tube from the clusters identified above. Following batch correction, Principal Component Analysis (PCA), and Uniform Manifold Approximation and Projection (UMAP) projection, cells were clustered using Leiden, leading to the identification of NMP, PSM, and neural tube clusters (<xref ref-type="fig" rid="fig4">Figure 4A, B</xref>). We next applied WOT to this restricted dataset. This approach identified PSM and neural clusters as NMP descendants, while cells of the NMP cluster were classified as ancestors to both the neural and PSM cellular states (<xref ref-type="fig" rid="fig4">Figure 4A, B</xref>). This strategy identified two trajectories from NMP to PSM and from NMP to NT reflecting the expected fate of these cells during development. It also showed a third trajectory within the NMP cluster, supporting the self-renewal and maturation of these cells during development (<xref ref-type="fig" rid="fig4">Figure 4A, B</xref>). These results identify bifated neural and mesodermal precursors within the same gene-expression space. Now that we identified the cell sets at both the beginning (NMP) and ending timepoints (neural and mesodermal), we computed the transition table showing the transported mass from the NMP cells toward the NMP, neural, and PSM cellular states (<xref ref-type="fig" rid="fig4">Figure 4C, D</xref>). We find that NMPs can self-maintain by contributing to the NMP cell state itself (36% in chick and 37% in mouse), suggesting that they are able to self-renew. The NMP cells also transition toward the neural (33% in chick and 36% in mouse) and mesodermal states (31% PSM in chick and 27% in PSM).</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>NMPs trajectory analysis in silico.</title><p>(<bold>A, B</bold>) (left) Uniform Manifold Approximation and Projection (UMAP) projection of cells of the NMP, neural, and PSM clusters, extracted from the mouse (<bold>A</bold>) and chicken (<bold>B</bold>) datasets showing the cell types identified following Leiden unsupervised clustering and differential gene-expression analysis. 2362 cells for the chicken dataset and 12072 cells for the mouse dataset. (Middle) Developmental trajectories of the cells of the NMP, PSM, and neural tube clusters at day E9.5 in the mouse dataset and stage 35 somites in the chicken dataset identified with the Waddington-OT pipeline. Optimal transport was used to infer temporal couplings in the mouse dataset at time E7, E7.15, E7.25, E7.5, 7E.75, E8, E8.5, E9, and in the chicken dataset at stage 5HH, 6 somites, 35 somites, subclustered for NMP, PSM, and neural tube. (Right) Distribution of cells by developmental age. (<bold>C, D</bold>) Transition tables representing the amount of mass transported from NMPs to the other cell types from day E7 to day E9.5 for the mouse dataset (<bold>C</bold>) and from stage 5HH to 35 somites for the chicken dataset (<bold>D</bold>). (<bold>E</bold>) Predicted transcription factors enriched in cells most likely to transition to each particular fate from day E7 to day E9.5 for the mouse dataset and from stage 5HH to 35-somites for the chicken dataset (transcription factors found in the mouse dataset but not in the chicken dataset are annotated with *). (<bold>F, G</bold>) Normalized Log gene expression of the predicted transcription factors for each cell type during axis elongation in mice (<bold>F</bold>) and chicken (<bold>G</bold>). NMP: neuromesodermal progenitors; PSM: presomitic mesoderm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Predictive transcription factor gene trends along trajectory of the neuromesodermal progenitor (NMP) fate.</title><p>(<bold>A</bold>) Mice and (<bold>B</bold>) chicken. Log-normalized expression of the predicted transcription factors associated with the NMP fate during development. X-axis represents developmental time in days.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig4-figsupp1-v2.tif"/></fig></fig-group><p>We also studied the transcription factor gene sets underlying the neural and mesodermal trajectories (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). The WOT analysis identified transcription factors that are enriched in cells most likely to transition to each particular fate (<xref ref-type="supplementary-material" rid="supp3">Supplementary file 3</xref>). The limited sequencing depth of the chicken dataset severely limited the resolution of the analysis. Thus we focused on the mouse dataset in which we identified transcription factors that can predict the different fates analyzed. We confirmed that the expression trends of these genes are showing a coherent progression both in mouse and chicken datasets and generated a curated list of the putative transcription factors associated to NMP maturation (gold), PSM (green), and neural tube (red) trajectories (<xref ref-type="fig" rid="fig4">Figure 4E–G</xref>, <xref ref-type="supplementary-material" rid="supp3">Supplementary file 3</xref>). We identified transcription factors that are both up- and downregulated in the NMP trajectory in both species. These include Rarg, Tbxt, Etv5, Mnx1, Msx1, Evx1, which were also found in chicken NMPs as well as Nkx1.2*,Cdx2*, Cdx4*, Arid3b*, which were very low or not detected in the chicken dataset (<xref ref-type="fig" rid="fig4">Figure 4E–G</xref>, <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). Plotting the expression level of these genes in the three clusters during development shows that they are all preferentially expressed in the NMP cluster (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). Interestingly, transcription factors such as Mnx1 have been identified in the chordoneural hinge of mouse embryos, where NMPs are proposed to reside (<xref ref-type="bibr" rid="bib81">Wymeersch et al., 2019</xref>), but their role in NMP differentiation has not been investigated. Altogether, our single-cell analysis in mouse and chicken identified cells within the NMP clusters as ancestors of cells from both PSM and neural tube. It also identified interesting transcription factor candidates potentially implicated in maintenance and differentiation of NMPs.</p></sec><sec id="s2-5"><title>An epithelium to mesenchyme transition during NMP maturation</title><p>While in the combined datasets NMPs form a single cluster, we nevertheless observed a temporal trajectory within the NMP cluster in both species (<xref ref-type="fig" rid="fig3">Figures 3J, M</xref> and <xref ref-type="fig" rid="fig4">4A, B</xref>). Reanalyzing the NMP cells only with Leiden clustering identified NMP early and late clusters in both chicken and mouse embryo datasets (<xref ref-type="fig" rid="fig5">Figure 5A–H</xref>, <xref ref-type="supplementary-material" rid="supp1">Supplementary files 1</xref> and <xref ref-type="supplementary-material" rid="supp2">2</xref>). As expected, a major difference between these clusters is linked to the collinear activation of Hox genes with expression of paralogs 9–13 being restricted to the late clusters (<xref ref-type="fig" rid="fig5">Figure 5D, H</xref>). Removing Hox genes from the analysis still led to the identification of early and late clusters respectively characterized by sets of specific genes (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A, B</xref>, <xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>). Significant overlap was observed when comparing the top differentially expressed genes in the mouse and chicken early and late clusters to published early and late NMP gene lists (<xref ref-type="supplementary-material" rid="supp4">Supplementary file 4; </xref><xref ref-type="bibr" rid="bib15">Dias et al., 2020</xref>; <xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>; <xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>; <xref ref-type="bibr" rid="bib81">Wymeersch et al., 2019</xref>). We noted that, in both species, genes associated with an epithelial state such as <italic>EPCAM</italic> or <italic>CDH1</italic> were significantly upregulated in the early cluster (as expected due to the epithelial nature of the epiblast at these stages) and downregulated in the late ones (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1E, F</xref>, <xref ref-type="supplementary-material" rid="supp4">Supplementary file 4</xref>). In contrast, genes preferentially associated to a mesenchymal state such as <italic>ZEB1, VIM,</italic> or <italic>MMP2</italic> were upregulated in the late clusters (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1E, F</xref>). To assess globally if NMP early and late cells were undergoing EMT, we performed a Gene Set Enrichment Analysis (GSEA) using the epithelial to mesenchymal transition gene set (<xref ref-type="bibr" rid="bib70">Subramanian et al., 2005</xref>). We find a positive enrichment score (NES) only for the late NMP clusters in chicken and mouse, suggesting that NMP cells in the tail bud are undergoing Epithelial to Mesenchymal Transition (EMT) (<xref ref-type="fig" rid="fig5">Figure 5I–L</xref>). To confirm these observations, we performed immunostaining of the epiblast and tail bud sections from stage 5 and stage 18HH (30–36 somites) chicken embryos with the epithelial marker E-cadherin (<xref ref-type="fig" rid="fig5">Figure 5M, N</xref>). Consistent with our single-cell data analysis, we found that SOX2/T double-positive cells in the epiblast (i.e., early NMPs) exhibit strong apical expression of CDH1. In contrast, SOX2/T cells in the tail bud (i.e., late NMPs) do not express CDH1 while strong expression is detected in the adjacent epithelial ectoderm. This argues that during their maturation SOX2/T cells lose their original epithelial characteristics in the tail bud, concomitantly with expression of the more posterior Hox gene paralog groups.</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Downregulation of neuromesodermal progenitors’ (NMPs) epithelial phenotype during development.</title><p>(<bold>A, B</bold>) <italic>k</italic>-NN graphs showing cells of the chicken NMP cluster identified in the analysis shown in <xref ref-type="fig" rid="fig3">Figure 3H</xref> (total: 706 cells) from stage 5HH, 6-somite, and 35-somite visualized with Uniform Manifold Approximation and Projection (UMAP) and analyzed using Leiden clustering. Major clusters include an NMP early cluster (gold) and an NMP late cluster (goldenrod) (<bold>A</bold>). (<bold>B</bold>) Distribution of cells by developmental age. (<bold>C, D</bold>) Dotplot showing the expression levels of NMP signature (<bold>C</bold>) and HOX genes (<bold>D</bold>) in chicken NMP clusters. (<bold>E, F</bold>) <italic>k</italic>-NN graphs showing cells of the mouse NMP cluster identified in the analysis shown in <xref ref-type="fig" rid="fig3">Figure 3K</xref> (total: 5628 cells) from stage E7.0–E9.5, visualized with UMAP and analyzed using Leiden clustering. Major clusters include the early NMP and late NMP clusters (<bold>E</bold>). (<bold>F</bold>) Distribution of cells by developmental age. (<bold>G</bold>) Dotplot showing the expression levels of NMP signature genes in mouse NMP clusters. Note that <italic>Fgf19</italic> is not expressed in mouse. Both <italic>Sox2</italic> and <italic>Nkx1.2</italic> genes are detected in mouse data and added to the dotplot. (<bold>H</bold>) Dotplot showing the expression levels of Hox genes in mouse NMP clusters. (<bold>I–L</bold>) Gene Set Enrichment Analysis (GSEA) of early NMP clusters in chicken (<bold>I</bold>) and mouse (<bold>J</bold>) and of late NMP clusters in chicken (<bold>K</bold>) and mouse (<bold>L</bold>) using the Hallmark Epithelium to Mesenchymal Transition gene set. The normalized enrichment score (NES) is based on the gene set enrichment scores and accounts for differences in gene set size and in correlations between gene sets and the expression dataset. The top portion of the plot shows the running enrichment score (ES) for the gene set as the analysis walks down the ranked list. The middle portion of the plot shows where the members of the gene set appear in the ranked list of genes. The bottom portion of the plot shows the value of the ranking metric as you move down the list of ranked genes. (<bold>M, N</bold>) Representative immunostaining of E-cadherin/CDH1, T/Brachyury, and SOX2 in cryosections of the NMP-containing anterior PS region in stage 5HH (<bold>M</bold>) and of the tail bud region of stage 18HH (<bold>N</bold>) in chicken embryos. PS: primitive streak; Endo: endoderm; Meso: mesoderm; PSM: paraxial mesoderm; Nt: neural tube. Asterisk shows the NMP domain dorsal to the top (<bold>M</bold>). D: dorsal; V: ventral and anterior to the top (<bold>N</bold>). Scale bar: 100 µm (n = 3 embryos). Circle sizes in (<bold>C, D, G, H</bold>) show the percentage of cells expressing the gene in the cluster. Color shows the normalized level of expression. Normalization is done by clusters across all the Hox genes.</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Time in the primitive streak before ingression from the tracking.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-fig5-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig5-v2.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Characterization of the early and late neuromesodermal progenitor (NMP) clusters.</title><p>(<bold>A, B</bold>) <italic>k</italic>-NN graphs visualized with Uniform Manifold Approximation and Projection (UMAP) showing cells of the chicken NMP cluster (of the three developmental stages) after Hox genes removal from the analysis. Leiden clustering was used to show cell identities, which include an early NMP cluster (NMP gold) and a late NMP cluster (NMP, dark gold) (<bold>A</bold>), as well as the distribution of cells by developmental stage (<bold>B</bold>) (n = 769 cells). (<bold>C, D</bold>) Pseudo-temporal ordering of the genes differentially expressed in the early and late NMP clusters in chicken (<bold>C</bold>) and mouse (<bold>D</bold>). Color bars indicate Leiden cluster identities and pseudo-temporal position. (<bold>E, F</bold>) Heat map showing expression of genes associated with the epithelial (<italic>CLDN1, EPCAM, CDH1</italic>) and mesenchymal (<italic>TWIST1, VIM, ZEB1, MMP2</italic>) states in chicken (<bold>E</bold>) and mouse (<bold>F</bold>). Color bars indicate Leiden cluster identities and pseudo-temporal position.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig5-figsupp1-v2.tif"/></fig></fig-group></sec><sec id="s2-6"><title>Comparison of NMP signature genes across species and datasets</title><p>We compared our top list of genes differentially expressed in NMPs identified in chicken (304 genes, false discovery rate (FDR) &lt; 0.05) and mouse (top 350 genes, FDR &lt; 0.05) datasets (<xref ref-type="supplementary-material" rid="supp5">Supplementary file 5</xref>). We found 44 conserved genes between the two species showing a striking enrichment in Wnt pathway genes including known targets such as <italic>Axin2, T,</italic> and <italic>Fgf8</italic> as well as pathway members including <italic>Wnt3a/5a/5b/8a</italic> and <italic>Wls</italic>. We next compared the signature genes for the chicken NMP population identified in this study with NMP signatures identified in mouse embryos (<xref ref-type="bibr" rid="bib15">Dias et al., 2020</xref>; <xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>; <xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>; <xref ref-type="bibr" rid="bib28">Guibentif et al., 2021</xref>) as well as in human SOX2/T-positive cells differentiated in vitro (<xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>; <xref ref-type="supplementary-material" rid="supp5">Supplementary file 5</xref>). We identified 38 genes conserved in four or five of the six datasets. This list includes signaling proteins such as Wnt5a, Wnt8a, Fgf17, and Cyp26a1 as well as T and Nkx1.2. Interestingly, the glucose transporters (Slc2a3 [glut3] and Slc2a1 [glut1]) as well as the lactate dehydrogenase isoforms (Ldha and Ldhb) were also identified in this list consistent with the high level of glycolysis occurring in the tail bud of chicken and mouse embryos (<xref ref-type="bibr" rid="bib7">Bulusu et al., 2017</xref>; <xref ref-type="bibr" rid="bib51">Oginuma et al., 2017</xref>). This list also included genes coding for transcription factors such as Cdx1/2/4, Evx1, Hes3, Sp5/8, and Hoxc9. Other genes usually associated to NMPs such as Sox2, Wnt3a, Fgf8, an Axin2 were shared by three out of the six gene signature lists. When the chicken NMP signature identified in this study was compared to the transcriptional signature of human NMP-like cells (top 350 genes), we identified 30 conserved genes including WNT5B, WLS, T, SP5/8, AXIN2, APCDD1, EVX1, LDHB, and B3GT7 as conserved between the two species. These genes were also conserved when comparing our mouse NMP signature to the human SOX2/T cells dataset but also included genes such as NKX1.2, SLC2A3, and CDX1/2. (<xref ref-type="supplementary-material" rid="supp5">Supplementary file 5</xref>). Overall, our data argues for a conserved gene expression signature of NMP cells between chicken mouse and human, presenting a striking enrichment of genes of the Wnt and glycolytic pathways.</p></sec><sec id="s2-7"><title>Limited convergence and ingression of the NMP territory in the epiblast</title><p>We next analyzed the cellular dynamics in the epiblast during PS regression. We performed long-term tracking of epiblast cells from stage 4+HH to 15 somites after nuclear cell labeling using the live marker nuclear red (<xref ref-type="video" rid="video3">Video 3</xref>). We measured the longevity of epiblast cell tracks to localize zones where trajectories end due to cell ingression (<xref ref-type="fig" rid="fig6">Figure 6A, B</xref>, <xref ref-type="video" rid="video4">Video 4</xref>). Posterior cell trajectories are less persistent than anterior ones, indicating that cells in the posterior part of the PS exit the epiblast layer sooner than cells of the anterior region. The tracks of cells in the anterior PS region show mainly angles with the midline between 0° and 45°, indicating limited convergence toward the midline. In contrast, epiblast cells in the posterior half of the PS show angles from 45° to 90° throughout PS regression, suggesting that these cells converge toward the midline to join the PS (<xref ref-type="fig" rid="fig6">Figure 6C, D</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). To measure the speed of cell convergence along the PS, we plotted the instantaneous speed of cells in the lateromedial (V<sub>LM</sub>) and anteroposterior (V<sub>AP</sub>) directions over time as a function of their position along the PS (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). This revealed a low V<sub>LM</sub> in the anterior PS region compared to the posterior PS. In contrast, epiblast cells of the anterior PS region show a high V<sub>AP</sub>, similar to that of the node, suggesting that they follow the node posterior movements. V<sub>AP</sub> decreases progressively in the LP domain to become minimal in the posterior-most region. A similar analysis at a later stage of PS regression (stage 6 HH-5-somites) revealed similar cell dynamics and trajectories for epiblast cells of the anterior PS region maintaining low lateral to medial and high anteroposterior speed (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1B, C</xref>). Thus, epiblast cells exhibit a posterior to anterior gradient of convergence speed toward the PS (<xref ref-type="fig" rid="fig6">Figure 6F</xref>).</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Limited convergence and ingression of the NMP territory in the epiblast.</title><p>(<bold>A</bold>) Representative snapshots from a time-lapse movie of a stage 5HH chicken embryo in which the epiblast was labeled with nuclear red (<xref ref-type="video" rid="video4">Video 4</xref>). Tracks of single-labeled nuclei are shown at three different PS levels at three different timepoints (0, 1, and 2 hr) to illustrate differences in longevity of the cells (n = 3 embryos) (NMP: gold; PMP/LPP: green; EMP: blue). (<bold>B</bold>) Quantification of tracks longevity measured as the ratio of tracks number after 1 and 2 hr divided by the number of tracks at t<sub>0</sub> in each of the colored regions shown in <xref ref-type="fig" rid="fig3">Figure 3A</xref>. t<sub>0</sub> marks the start of time-lapse movies of stage 5HH chicken embryos labeled with nuclear red. Gold, green, and blue show tracks in the NMP, PMP/LPP, and EMP domains, respectively, corresponding to the tracks shown in <xref ref-type="fig" rid="fig5">Figure 5A</xref> (n = 3; n = 1502 tracks). Two-way ANOVA NMP-PMP/LPP; NMP-EMP. *p&lt;0.05. (<bold>C</bold>) Representative color-coded time projection showing tracks of epiblast cells at the anterior and posterior PS level after nuclear red labeling in a stage 5HH chicken embryo. The tracks color code represents early timepoints in cyan and later timepoints in yellow (n = 3 embryos). (<bold>D</bold>) Representative quantification of the angle with the midline of tracks shown in (<bold>C</bold>). Top: anterior PS region; bottom: posterior PS region (n = 3 embryos). (<bold>E</bold>) Representative mean lateral to medial speed (V<sub>LM</sub>) and anterior to posterior speed (V<sub>AP</sub>) over time of epiblast cells labeled with nuclear red in stage 5HH chicken embryos. Y axis represents AP position along the embryo. Color code indicates time of measurement since beginning of the movie (n = 3 embryos). (<bold>F</bold>) Diagram showing the main direction of epiblast cell movements as a function of their AP position in the epiblast. The length of arrows is proportional to convergence speed. (<bold>G</bold>) Representative snapshots from a confocal movie of the PS region of a chicken embryo labeled dorsally at stage 5HH with nuclear red and imaged from the ventral side to show epiblast cells ingression (n = 3 embryos). (<bold>H</bold>) Representative intensity measurement of the nuclear red signal from the ventral side along the PS of the movie shown in (<bold>G</bold>). Y axis, distance to Hensen’s node (n = 3 embryos). (<bold>I</bold>) Representative whole-mount immunohistochemistry with anti-laminin (white) in a stage 5HH chicken embryo. Ventral view (n = 3 embryos). Dorsal views, anterior to the top. EMP: extraembryonic progenitors; NMP: neuromesodermal progenitors; PMP: presomitic mesoderm progenitor; LPP: lateral plate progenitor; PS: primitive streak. Arrowhead shows Hensen’s node position. Scale bar: 100 µm.</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>Double-positive T/SOX2 cells, pattern of cell division, and time in the primitive streak before ingression.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-fig6-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig6-v2.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Quantification of longevity, cell speed, and trajectories in time-lapse movies of nuclear red-labeled chicken embryos.</title><p>(<bold>A</bold>) Maximum time color-coded projection showing the tracks of cells labeled with nuclear red in a stage 5HH chicken embryo analyzed at the 6-somite stage. Early to later timepoints are indicated by cyan to magenta to yellow color code. (<bold>B, C</bold>) Mean medial to lateral speed (V<sub>ML</sub>, <bold>C</bold>) and anterior to posterior speed (V<sub>AP</sub>, <bold>D</bold>) over time of epiblast cells labeled with nuclear red in stage 5HH chicken embryos imaged by confocal imaging in vitro at the 5-somite stage. Y axis represents AP position along the embryo. The color code indicates the time of analysis from purple to yellow where blue is t = 0 min (stage 7HH) and yellow is t = 184 min. (<bold>D, E</bold>) Color-coded time projection of the epiblast cells labeled in ovo with nuclear red in stage 5HH chicken embryos, imaged by confocal imaging in vitro (<bold>D</bold>) showing different track angles with the midline quantified in (<bold>E</bold>). Early timepoints are in cyan, later timepoints are in yellow. Dorsal views, anterior to the top. EMP: extraembryonic progenitors; NP: neural plate; NMP: neuromesodermal progenitors; PMP: presomitic mesoderm progenitor; LPP: lateral plate progenitor; PS: primitive streak (n = 3 embryos). Scale bar: 100 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig6-figsupp1-v2.tif"/></fig></fig-group><media id="video3" mime-subtype="mp4" mimetype="video" xlink:href="elife-64819-video3.mp4"><label>Video 3.</label><caption><title>Long-term tracking of a nuclear red stained embryo.</title><p>Time-lapse movie of dorsal maximum z-projections of epiblast cells labeled with nuclear red showing their tracks from stage 5HH to 5 somites during PS regression. Colors indicate the z-position from magenta (dorsal) to yellow (ventral). t = 4 min between frames, z-sectioning = 4 μm. 20× objective, LSM 780. NMP: neuromesodermal progenitors; PMP: presomitic mesoderm progenitors; LPP: lateral plate progenitors. PS = primitive streak; NT: neural tube.</p></caption></media><media id="video4" mime-subtype="mp4" mimetype="video" xlink:href="elife-64819-video4.mp4"><label>Video 4.</label><caption><title>Longevity of tracks along the primitive streak (PS).</title><p>3.5 hr time-lapse movie of a stage 5HH chicken embryo in which the epiblast was labeled with nuclear red. Tracks of single-labeled nuclei are shown at three different AP levels of the PS to illustrate differences in longevity of the cells. Dorsal view (neuromesodermal progenitor [NMP]: gold; paraxial mesoderm precursor [PMP]/lateral plate progenitor [LPP]: green; extraembryonic mesoderm progenitor [EMP]: blue). t = 4 min. 20× objective, LSM 780.</p></caption></media><p>To quantify the global dynamics of cell ingression along the PS, we selectively marked epiblast cells by applying nuclear red dorsally at stage 4+HH. This procedure, when performed in ovo, only labels the dorsal epiblast but not ingressed mesodermal cells or the endoderm. We performed confocal movies from the ventral side of the embryo to measure the increase of mean fluorescence intensity over time along the PS (<xref ref-type="fig" rid="fig6">Figure 6G</xref>, <xref ref-type="video" rid="video5">Video 5</xref>). Since only epiblastic cells are marked at the beginning of the movie, the mesodermal layer will progressively acquire new fluorescent cells over time, reflecting the dynamic of cell ingression. We observed a gradual posterior to anterior increase of fluorescence over time in the mesoderm along the PS (<xref ref-type="fig" rid="fig6">Figure 6G, H</xref>). In addition, we could fit the different curves of intensity measurements along the anteroposterior axis to a linear curve, indicating an anteroposterior gradient of cell ingression of epiblastic cells along the PS (<xref ref-type="fig" rid="fig6">Figure 6H</xref>). This ingression pattern parallels the distribution of laminin along the PS, which progressively disappears posteriorly (<xref ref-type="fig" rid="fig6">Figure 6I</xref>), consistent with a more active ingression behavior. Together, these experiments demonstrate that the epiblast gradient of convergence speed is coupled to graded cell ingression along the PS anteroposterior axis with minimal ingression in the anterior PS region where NMP cells reside.</p><media id="video5" mime-subtype="mp4" mimetype="video" xlink:href="elife-64819-video5.mp4"><label>Video 5.</label><caption><title>Dynamics of mesodermal cell ingression.</title><p>Time-lapse movie showing ventral z-maximum projections of the primitive streak (PS) region of a chicken embryo labeled dorsally at stage 5HH with nuclear red. t = 15 min. z = 4 μm. 20× objective, LSM 780.</p></caption></media></sec><sec id="s2-8"><title>An anterior to posterior gradient of proliferation counteracts ingression in the anterior PS epiblast</title><p>We noted that the number of SOX2/T cells gradually increases from stage 4+HH to reach a peak around 30 somites (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). As limited convergence and ingression is observed in the NMP territory, this increase is most likely explained by cell proliferation. During PS regression, we observed a higher number of phospho-histone 3 (pH3)-positive cells relative to the total number of cells (mitotic index) in the anterior region of the PS compared to more posterior ones (<xref ref-type="fig" rid="fig7">Figure 7B, C</xref>). We performed confocal live imaging of fluorescent H2B-Cherry quail embryos and observed more dividing cells in the anterior PS compared to more posterior regions at the same developmental stage (<xref ref-type="fig" rid="fig7">Figure 7D</xref>). This confirmed the existence of a higher mitotic index in the anterior region compared to more posterior parts of the PS (<xref ref-type="bibr" rid="bib67">Stern, 1979</xref>).</p><fig-group><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>An anterior to posterior gradient of proliferation counteracts ingression in the anterior primitive streak (PS) epiblast.</title><p>(<bold>A</bold>) Quantification of the number of SOX2/T double-positive cells in chicken embryos from stage 4HH to 35-somite (n = 38 embryos). (<bold>B</bold>) Snapshots of the posterior region of chicken embryos from stage 5HH to 20-somite stained in whole-mount with an anti-phosphorylated histone H3 (pH3) antibody. (<bold>C</bold>) Quantifications of the mitotic index along the PS in the boxes shown in (<bold>B</bold>). Orange box: 250 µm from node; green box: 750 µm from node; blue box: 1200 µm from node (n = 13 embryos). Unpaired t-test; **p=0.0017 and 0.0022; *p=0.0187, p=0.0278. (<bold>D</bold>) Quantification of the number of dividing cells in H2B-Cherry transgenic quails at stage 4+/5HH in the anterior and posterior PS (n = 6). Paired t-test; ***p=0.0001. (<bold>E</bold>) Tracks and (<bold>F</bold>) quantification of trajectories of the neuromesodermal progenitor (NMP) (gold) and lateral plate progenitor (LPP) (gray) cells during PS regression (n = 159 cells, 80 posterior, 79 anterior in seven embryos). (<bold>G</bold>) Quantification of the time interval between two rounds of division in cells of the NMP region measured in time-lapse movies (n = 12 inter-division events in four embryos). (<bold>B</bold>, <bold>E</bold>) Dorsal views, anterior to the top. Arrowhead shows Hensen’s node position. Scale bar: 100 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig7-v2.tif"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 1.</label><caption><title>Analysis of cell division profiles in the SOX2/T region.</title><p>(<bold>A</bold>) Tracks of three rounds of cell division of an epiblast cell of the SOX2/T-positive territory in an H2B-RFP electroporated chicken embryo imaged for 12 hr starting at stage 5HH (corresponding to <xref ref-type="video" rid="video6">Video 6</xref>). d1, d2, d3: the division events. (<bold>B</bold>) Based on the location of daughter cells after cell division, we defined the cell division as symmetric (symmetric neuromesodermal progenitor [NMP]: when both daughter cells remain in the primitive streak [PS]; symmetric mesoderm: when both daughter cells subsequently join the mesoderm [d3]) or asymmetric (when one daughter cell remains in the PS and the other daughter cell joins the mesoderm) (d1, d2). We identified 33 division events in seven embryos, which are shown in (<bold>A</bold>). Scale bars: 100 µm.</p><p><supplementary-material id="fig7s1sdata1"><label>Figure 7—figure supplement 1—source data 1.</label><caption><title>Type of cell division in the neuromesodermal progenitor (NMP) domain.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-fig7-figsupp1-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig7-figsupp1-v2.tif"/></fig></fig-group><p>We next manually tracked individual electroporated cells and measured the time spent in the PS prior to cell ingression (<xref ref-type="fig" rid="fig7">Figure 7E, F</xref>). All the cells tracked in the mid PS region spent from 1 to 3 hr in the PS before ingressing. In contrast, only 35% of the tracked cells in the anterior PS region show such fast ingression dynamics (within 1–3 hr), whereas 65% remain in the PS for more than 7 hr (<xref ref-type="fig" rid="fig7">Figure 7F</xref>). The number of SOX2/T cells increases from 50 to 550 cells in around 40 hr (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). Knowing the percentage of ingressing cells in the anterior PS region (35%), we can predict the evolution of the cell population using a geometric series formula: U<sub>n</sub>=q<sup>n</sup> × U<sub>0</sub> classically used in analysis of population dynamics. Here, n is the number of cell divisions, q is the doubling parameter of the non-ingressed population (here 2 * 0.65 = 1.3), and U<sub>0</sub> is the initial population, that is, 50 cells. To obtain a population of 550 cells, the model predicts n = 9 or 10 cell cycles (U<sub>9</sub> = 530, U<sub>10</sub> = 689), suggesting a cell cycle time around 4 hr. We manually tracked individual dividing cells and their daughter cells in the anterior PS region over 10 hr to determine the time between two divisions. We identified symmetric cell divisions where the two daughter cells remain in the epiblast after cell division, consistent with self-renewal of this population. The cell cycle time for such symmetric divisions is around 4.5 hr in agreement with the number of divisions predicted by the model (<xref ref-type="fig" rid="fig7">Figure 7G</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A, B</xref>, <xref ref-type="video" rid="video6">Video 6</xref>). Other symmetric cell divisions gave rise to two daughter cells entering the mesoderm (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). We also observed asymmetric cell divisions where one of the daughter cells ingresses after cell division, thus suggesting a specification of one of the daughter cells to a mesodermal fate (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A, B</xref>). Thus, we show that cells in the NMP region exhibit rapid cell divisions together with limited cell ingression, allowing their self-renewal and amplification during formation of the posterior body.</p><media id="video6" mime-subtype="mp4" mimetype="video" xlink:href="elife-64819-video6.mp4"><label>Video 6.</label><caption><title>Tracking cell division time in the SOX2/T region.</title><p>Tracking of cell divisions in cells of the SOX2/T region electroporated with an H2B-RFP plasmid at stage 5HH. d1, d2, d3: division events; PS: primitive streak. t = 6 min. 10× objective, Leica DMR.</p></caption></media></sec><sec id="s2-9"><title>Posterior to anterior exhaustion of PS progenitor territories results in NMPs remaining as the major PS remnant in the tail bud</title><p>The posterior gradients of convergence speed and ingression combined with increased proliferation in the anterior PS region are expected to lead to progressive asymmetric disappearance of the PS precursor territories in a posterior to anterior order. To test this hypothesis, we generated time-lapse movies of GFP-expressing transgenic chicken embryos from stage 5HH to 10-somite. We tracked specific positions along the PS approximately corresponding to the boundaries between the NMP and paraxial mesoderm progenitors (PMPs), the PMP and lateral plate progenitors (LPPs), and LPP and extraembryonic mesoderm progenitor (EMP) (<xref ref-type="fig" rid="fig1">Figures 1D</xref> and <xref ref-type="fig" rid="fig7">7A, B</xref>, <xref ref-type="video" rid="video7">Video 7</xref>). We observed a faster reduction of the posterior PS domains, with the extraembryonic territory disappearing first, followed by the LP territory whose ingression is completed at the 10-somite stage (<xref ref-type="fig" rid="fig8">Figure 8A, D</xref>; <xref ref-type="bibr" rid="bib49">Moreau et al., 2019</xref>; <xref ref-type="bibr" rid="bib65">Spratt, 1947</xref>). After this stage, most T-positive progenitors of the superficial layer of the tail bud also express SOX2, suggesting that they correspond to the remnant of the epiblast flanking the anterior PS and remain the only axial progenitors left in the tail bud (<xref ref-type="fig" rid="fig8">Figure 8D</xref>). Thus, the precursor territories along the PS do not disappear at the same rate. We observe a sequential posterior to anterior exhaustion of the territories of the extraembryonic mesoderm, the lateral plate, and the SOX2-negative PMPs, which results in finally locating the NMP territory in the tail bud (<xref ref-type="fig" rid="fig8">Figure 8D</xref>).</p><media id="video7" mime-subtype="mp4" mimetype="video" xlink:href="elife-64819-video7.mp4"><label>Video 7.</label><caption><title>Long-term tracking of the mesodermal progenitors.</title><p>13 hr time-lapse movie of a GFP chicken embryo starting at stage 5HH (left). Fate of the color-coded mesodermal primitive streak (PS) progenitor territories during regression is shown in the right movie. NMP: neuromesodermal progenitors (gold); PMP: presomitic mesoderm progenitors (green); LPP: lateral plate progenitor; LPP-EMP: extraembryonic mesoderm precursors (blue-purple). Arrowhead: Hensen’s node. Anterior to the top. t = 4 min. 20× objective, LSM 780.</p></caption></media><fig id="fig8" position="float"><label>Figure 8.</label><caption><title>Posterior to anterior exhaustion of primitive streak (PS) progenitor territories results in NMPs remaining as the major PS remnant in the tail bud.</title><p>(<bold>A, B</bold>) Snapshots from a 13 hr time-lapse movie of a chicken embryo starting at stage 5HH. The approximate position of the boundaries is shown by colored dots (<bold>A</bold>), and the corresponding territories are shown (<bold>B</bold>) during PS regression. Boundaries between NMP-PMP, PMP-LPP, and LPP-EMP are illustrated by orange, green, and blue dots (<bold>A</bold>) and color transition (<bold>B</bold>), respectively. The initial position of groups of cells marking the boundaries between the different PS territories was identified based on their distance to Hensen’s node (white arrowhead) as established in our experiments and in <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>. These groups of cells were tracked during PS regression to follow the fate of the different PS territories (n = 3 embryos). Dorsal views. (<bold>C</bold>) Schematics illustrating the position of the opposite gradients of cell proliferation and ingression in the epiblast during PS regression. (<bold>D</bold>) Schematics summarizing the dynamics of the NMP territory (gold) during PS regression in embryos of stage 5HH and 6-somite and around PS to tail bud transition (12-somite embryo). (<bold>A–D</bold>) Dorsal views, anterior to the top. AP: anteroposterior; NMP: neuromesodermal progenitors (gold); PMP: presomitic mesoderm progenitors (green); LPP: lateral plate progenitor (blue); EMP: extraembryonic mesoderm precursors (purple). Arrowhead: Hensen’s node (n = 3 embryos). Scale bar: 100 µm.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-64819-fig8-v2.tif"/></fig></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>NMPs are a population of stem cells that generate most of the posterior spinal cord, vertebrae, and skeletal muscles. Surprisingly, this cell population was only recently discovered using retrospective clonal analysis in mouse (<xref ref-type="bibr" rid="bib73">Tzouanacou et al., 2009</xref>). The identification of such an important population of stem cells came much as a surprise because none of the many classical fate mapping studies of the epiblast and PS of the chicken or mouse embryo performed so far ever reported the identification of such bipotent precursors (<xref ref-type="bibr" rid="bib6">Brown and Storey, 2000</xref>; <xref ref-type="bibr" rid="bib36">Iimura et al., 2007</xref>; <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>; <xref ref-type="bibr" rid="bib61">Schoenwolf et al., 1992</xref>; <xref ref-type="bibr" rid="bib63">Selleck and Stern, 1991</xref>; <xref ref-type="bibr" rid="bib71">Tam and Beddington, 1987</xref>; <xref ref-type="bibr" rid="bib78">Wilson and Beddington, 1996</xref>; <xref ref-type="bibr" rid="bib77">Wilson et al., 2009</xref>). While the retrospective technique employed to first identify mouse NMPs unambiguously identified these bipotent stem cells, it could however not locate them in the embryo (<xref ref-type="bibr" rid="bib73">Tzouanacou et al., 2009</xref>). Thus, direct identification of the amniote NMPs and their location in the embryo is still lacking. Here, we used lineage tracing and scRNAseq to identify and characterize NMPs as a population of stem cells located in the SOX2/T-expressing region of the anterior PS epiblast in the chicken embryo. We show that cells expressing the mesodermal marker T and the neural marker SOX2 are first found in the epiblast adjacent to the anterior PS and Hensen’s node region at the beginning of PS regression. This domain appears at a similar stage of mouse development and occupies a position similar to the SOX2/T domain of the node-streak border and the caudal lateral epiblast proposed to contain NMPs in mouse embryos (<xref ref-type="bibr" rid="bib80">Wymeersch et al., 2016</xref>). In both mouse and chicken embryos, this domain contains cells fated to give rise to both neural and mesodermal derivatives, suggesting that they are functionally equivalent (<xref ref-type="bibr" rid="bib22">Garcia-Martinez et al., 1993</xref>; <xref ref-type="bibr" rid="bib80">Wymeersch et al., 2016</xref>). However, so far the bipotentiality of these cells has not been established at the single-cell level. We performed lineage tracing using a barcoded retroviral library and Brainbow-derived MAGIC markers (<xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref>) to show that single cells of the SOX2/T region are bipotential and can contribute both to the neural tube and paraxial mesoderm along the trunk axis in chicken embryos. We further demonstrate clonal continuity and transcriptional homogeneity between early NMPs of the PS and late ones in the tail bud.</p><p>The significant contribution of cells of the SOX2/T territory of the anterior PS to both neural and mesodermal lineages has been missed in previous fate mapping studies of this region in chicken embryos (<xref ref-type="bibr" rid="bib6">Brown and Storey, 2000</xref>; <xref ref-type="bibr" rid="bib20">Fernández-Garre et al., 2002</xref>; <xref ref-type="bibr" rid="bib32">Henrique et al., 1997</xref>; <xref ref-type="bibr" rid="bib36">Iimura et al., 2007</xref>; <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>; <xref ref-type="bibr" rid="bib61">Schoenwolf et al., 1992</xref>; <xref ref-type="bibr" rid="bib63">Selleck and Stern, 1991</xref>). Compared to these studies, we analyzed our lineage-tracing experiments at significantly later stages after in ovo labeling (stage 17–20HH instead of stage 10–14HH). Thus, while these fate maps indicate that cells of the anterior PS epiblast initially produce either neural or mesoderm descendants, a trend also observed in mouse clones (<xref ref-type="bibr" rid="bib73">Tzouanacou et al., 2009</xref>), NMPs can give rise to both lineages but mostly later, in more posterior regions of the body. These observations are consistent with recent grafts of the epiblast territory in 6-somite chicken embryos showing that the territory first produces neural and then both mesodermal and neural derivatives (<xref ref-type="bibr" rid="bib39">Kawachi et al., 2020</xref>). Direct identification of bipotential cells with a neural and mesodermal fate has been reported in zebrafish where they segregate during gastrulation and contribute to the most posterior part of the axis (<xref ref-type="bibr" rid="bib1">Attardi et al., 2018</xref>). In zebrafish, however, only monopotent cells were found in the tail bud (<xref ref-type="bibr" rid="bib1">Attardi et al., 2018</xref>; <xref ref-type="bibr" rid="bib38">Kanki and Ho, 1997</xref>), while this is not the case in chicken (this report) and mouse (<xref ref-type="bibr" rid="bib73">Tzouanacou et al., 2009</xref>).</p><p>scRNAseq analysis of the posterior embryonic region during PS to tail bud transition in chicken and mouse revealed a distinct NMP cluster lying between a cluster of PSM cells and one of neural cells. Using two different trajectory inference analysis methods (diffusion pseudotime and WOT), we identified two developmental trajectories leading from NMPs to these neural and PSM clusters, consistent with the bipotentiality of these cells. While the mouse NMP cluster shows expression of the NMP markers <italic>T, Sox2,</italic> and <italic>Nkx1.2</italic>, only <italic>T</italic> was identified in the chicken NMP cluster. <italic>SOX2</italic> and <italic>NKX1.2</italic> (<italic>SAX1</italic>) expression was neither found in the NMP cluster nor in neural tissue, suggesting a problem with annotation in the chicken genome. Alternatively, this might reflect a difference in sequencing depth as the chicken dataset was obtained using the inDrops pipeline, whereas most of the mouse data was obtained with the 10X platform. From our analysis, we identified a signature of genes enriched in the NMP clusters, including a majority of effectors and targets of wnt signaling, which is known to play a key role in the differentiation of this lineage (<xref ref-type="bibr" rid="bib33">Henrique et al., 2015</xref>). Most of these signature genes are expressed in all chicken and mouse NMP clusters. Using WOT trajectory analysis, we identified cells within the NMP cluster as ancestors of the paraxial mesoderm and neural clusters in the mouse and chicken embryo. We were not able to find any bias for the NMP contribution toward the neural or mesodermal fate. This result aligns with our lineage-tracing data, which does not show any preferential enrichment toward a specific fate in our analysis timeframe. Interestingly, we identified genes associated to the NMP trajectory, including previously undescribed ones such as RARG or MNX1 in both the mouse and chicken datasets. We also identified expected transcription factors that are predictive of the fate differentiation toward the neural (PAX6) and PSM lineages (MSGN1). It will be interesting to investigate how these genes function during differentiation of these lineages. Using diffusion pseudotime and WOT analyses, we also identified a developmental trajectory within the NMP cluster, suggesting that NMP cells undergo maturation during axis formation. This is supported by the identification of clusters of early and late NMPs characterized by expression of specific genes in both chicken and mouse. As reported for mouse embryos (<xref ref-type="bibr" rid="bib81">Wymeersch et al., 2019</xref>), late NMPs are characterized by the expression of more posterior Hox genes in both chicken and mouse. We also observed that genes associated to the epithelial state such as <italic>EpCAM, CDH1,</italic> or <italic>GJA1</italic> are downregulated while genes associated to the mesenchymal state are upregulated at tail bud stages in both species. This is consistent with observations in mouse where tail bud progenitors were shown to undergo incomplete EMT during later stages of axial elongation (<xref ref-type="bibr" rid="bib15">Dias et al., 2020</xref>).</p><p>As reported for mouse embryos (<xref ref-type="bibr" rid="bib80">Wymeersch et al., 2016</xref>; <xref ref-type="bibr" rid="bib81">Wymeersch et al., 2019</xref>), we observe an increase in SOX2/T cell numbers during axis elongation, indicating that these cells can self-renew while giving rise to a progeny in the paraxial mesoderm and in the neural tube. Labeling experiments in mouse and chicken embryos have identified a population of epiblast cells in the region of the anterior PS and Hensen’s node, which behave as stem cells, giving rise to descendants in the paraxial mesoderm while being able to self-renew (<xref ref-type="bibr" rid="bib8">Cambray and Wilson, 2002</xref>; <xref ref-type="bibr" rid="bib9">Cambray and Wilson, 2007</xref>; <xref ref-type="bibr" rid="bib36">Iimura et al., 2007</xref>; <xref ref-type="bibr" rid="bib48">McGrew et al., 2008</xref>; <xref ref-type="bibr" rid="bib50">Nicolas et al., 1996</xref>; <xref ref-type="bibr" rid="bib63">Selleck and Stern, 1991</xref>; <xref ref-type="bibr" rid="bib77">Wilson et al., 2009</xref>). These cells were proposed to contribute mostly to medial somites while lateral somitic cells are derived from more posterior areas of the PS (<xref ref-type="bibr" rid="bib36">Iimura et al., 2007</xref>; <xref ref-type="bibr" rid="bib63">Selleck and Stern, 1991</xref>). The anterior SOX2/T territory encompasses Hensen’s node and the epiblast adjacent to the anterior PS and approximately corresponds to the territory containing the stem cells fated to give rise to medial somites. The epiblast territory immediately posterior to the SOX2/T territory does not express SOX2 and exhibits many cells positive for the paraxial mesoderm-specific marker MSGN1 (this study). This territory likely corresponds to the prospective territory of lateral somites, which does not show a stem cell behavior, giving rise to descendants spanning only ~5–7 segments (<xref ref-type="bibr" rid="bib36">Iimura et al., 2007</xref>; <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>). Our data suggest that this territory becomes largely exhausted at the end of PS regression, resulting in posterior somites to derive mostly from the NMPs (<xref ref-type="fig" rid="fig8">Figure 8D</xref>). This is consistent with observations in chicken and mouse demonstrating that the selective contribution of different PS territories to medial or lateral somitic territories only applies to anterior somites (<xref ref-type="bibr" rid="bib9">Cambray and Wilson, 2007</xref>; <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>).</p><p>We observed a posterior to anterior gradient of convergence in the epiblast associated to a parallel gradient of ingression in the PS. A parallel posterior to anterior gradient of cell motility of ingressed mesodermal cells has been documented along the regressing PS (<xref ref-type="bibr" rid="bib83">Zamir et al., 2006</xref>). These graded movements in the mesoderm are largely controlled by a gradient of Fgf8 acting as a repellent on newly ingressed mesodermal cells at this stage (<xref ref-type="bibr" rid="bib82">Yang et al., 2002</xref>). This cellular dynamics suggests that the movement away from the posterior PS could act as a sink for the epiblastic territories generating these progenitors. These cell movements in the epiblast and the ingressing mesoderm could explain the progressive exhaustion of the PS from its posterior end first described for the extraembryonic territory (<xref ref-type="bibr" rid="bib65">Spratt, 1947</xref>). Importantly, our data show that the precursor territories along the PS do not disappear at the same rate. We observe a sequential posterior to anterior exhaustion of the territories of the extraembryonic mesoderm, the lateral plate, and the SOX2-negative PMPs (<xref ref-type="fig" rid="fig8">Figure 8D</xref>). Combined to an increased proliferation in the NMP region, this could explain why the SOX2/T territory eventually remains as the major remnant of the PS in the tail bud after PS regression. Thus, while most of the PS behave as a transit zone for committed progenitors as proposed by <xref ref-type="bibr" rid="bib54">Pasteels, 1937</xref>, its anterior-most region behaves more like a blastema, containing multipotential cells as predicted by Wetzel (<xref ref-type="bibr" rid="bib58">Romanoff, 1960</xref>; <xref ref-type="bibr" rid="bib76">Wetzel, 1929</xref>). The fact that the tail bud contains multipotent NMPs in addition to monopotent territories such as the precursors of the notochord or the hindgut could explain the long-standing controversy on whether the tail bud functions as a blastema or as a mosaic of committed precursors (<xref ref-type="bibr" rid="bib10">Catala et al., 1995</xref>; <xref ref-type="bibr" rid="bib13">Davis and Kirschner, 2000</xref>; <xref ref-type="bibr" rid="bib25">Gont et al., 1993</xref>; <xref ref-type="bibr" rid="bib34">Holmdahl, 1925</xref>).</p><p>Here, we show that NMPs can contribute to a single type of derivative (neural or mesodermal) for several segments followed by another type in the next segments, as reported in mouse embryos (<xref ref-type="bibr" rid="bib73">Tzouanacou et al., 2009</xref>). This argues for a striking plasticity of NMPs and rules out simple models of asymmetric divisions for the generation of neural and mesodermal descendants. Furthermore, as reported in mouse, we also observed bifated clones that do not contribute to the tail bud (<xref ref-type="bibr" rid="bib73">Tzouanacou et al., 2009</xref>). Plasticity of the NMPs is supported by heterotopic grafts of the NMP epiblast territory into territories fated to become neural or mesodermal, which resulted in the donor cells to adopt the fate of their new territory in chicken or mouse embryos (<xref ref-type="bibr" rid="bib23">Garcia-Martinez et al., 1997</xref>; <xref ref-type="bibr" rid="bib48">McGrew et al., 2008</xref>; <xref ref-type="bibr" rid="bib80">Wymeersch et al., 2016</xref>). Our results also show that the transcriptional identity of the NMP population remains largely stable throughout axis formation. This suggests that the NMP population behaves as a unique stem cell population that remains uncommitted toward either lineage, with its descendants acquiring their identity only after entering the territory of the paraxial mesoderm or the neural tube. Such plasticity is supported by the observation that SOX2/T-positive NMP-like cells generated in vitro can be induced to differentiate to either neural or mesodermal cells by changing the culture conditions (<xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>; <xref ref-type="bibr" rid="bib17">Edri et al., 2019a</xref>; <xref ref-type="bibr" rid="bib18">Edri et al., 2019b</xref>; <xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>; <xref ref-type="bibr" rid="bib26">Gouti et al., 2014</xref>; <xref ref-type="bibr" rid="bib33">Henrique et al., 2015</xref>; <xref ref-type="bibr" rid="bib72">Turner et al., 2014</xref>). The difficulty to observe NMPs in vivo contrasts with the ease with which NMP-like cells can be obtained in vitro from mouse or human pluripotent stem cells. NMPs have been generated in 2D cultures by activation of Wnt signaling at the epiblast-like stage (<xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>; <xref ref-type="bibr" rid="bib17">Edri et al., 2019a</xref>; <xref ref-type="bibr" rid="bib18">Edri et al., 2019b</xref>; <xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>; <xref ref-type="bibr" rid="bib26">Gouti et al., 2014</xref>; <xref ref-type="bibr" rid="bib33">Henrique et al., 2015</xref>; <xref ref-type="bibr" rid="bib72">Turner et al., 2014</xref>). Analysis of 3D cultures such as gastruloids induced in vitro from mouse ES cells also shows that most of the cells forming these structures belong to the neural tube and paraxial mesoderm lineage, suggesting that they are largely derived from an initial NMP population (<xref ref-type="bibr" rid="bib2">Beccari et al., 2018</xref>; <xref ref-type="bibr" rid="bib19">Faustino Martins et al., 2020</xref>; <xref ref-type="bibr" rid="bib74">van den Brink et al., 2020</xref>). NMP-like cells generated in vitro express both SOX2 and T and single-cell RNA-sequencing demonstrated that they form a very homogeneous population with characteristics similar to the endogenous SOX2/T cells (<xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>; <xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>). Our comparison of chicken, mouse, and human NMP cells identified by scRNAseq points to an significant level of conservation of the transcriptional signature of this population. Overall, our work answers an important conundrum on the existence and fate of the NMPs in vivo, an elusive stem cell population in amniotes.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th valign="top">Reagent type <break/>(species) or resource</th><th valign="top">Designation</th><th valign="top">Source or reference</th><th valign="top">Identifiers</th><th valign="top">Additional information</th></tr></thead><tbody><tr><td valign="top">Strain, strain background</td><td valign="top"><italic>Gallus gallus</italic></td><td valign="top">Charles River Laboratories, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_003792">SCR_003792</ext-link></td><td valign="top">Specific-pathogen-free chicken (SPF) eggs</td><td valign="top"/></tr><tr><td valign="top">Strain, strain background</td><td valign="top"><italic>Gallus gallus</italic></td><td valign="top">Susan Chapman at Clemson University; South Carolina; USA, RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/SCR_011159">SCR_011159</ext-link> <break/><xref ref-type="bibr" rid="bib47">McGrew et al., 2004</xref></td><td valign="top"/><td valign="top">Cytoplasmic GFP eggs</td></tr><tr><td valign="top">Strain, strain background</td><td valign="top">Northern Bobwhite quail</td><td valign="top">Ozark Hatcheries <break/><xref ref-type="bibr" rid="bib5">Bénazéraf et al., 2017</xref></td><td valign="top"/><td valign="top">Transgenic quails expressing H2B-Cherry</td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">Paraformaldehyde</td><td valign="top">Sigma</td><td valign="top">158127</td><td valign="top"/></tr><tr><td valign="top">Antibody</td><td valign="top">T/Brachyury (goat polyclonal)</td><td valign="top">R&amp;D Systems</td><td valign="top">AF2085</td><td valign="top">IF (1/1000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">SOX2 (rabbit polyclonal)</td><td valign="top">Millipore RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2286686">AB_2286686</ext-link></td><td valign="top">Cat# AB5603</td><td valign="top">IF (1/1000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">E-Cadherin (mouse monoclonal)</td><td valign="top">Abcam <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_1310159">AB_1310159</ext-link></td><td valign="top">ab76055</td><td valign="top">IF (1/250)</td></tr><tr><td valign="top">Antibody</td><td valign="top">N-Cadherin (rabbit polyclonal)</td><td valign="top">Abcam <break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_298943">AB_298943</ext-link></td><td valign="top">ab12221</td><td valign="top">IF (1/250)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Fibronectin (mouse)</td><td valign="top">DSHB</td><td valign="top">MT4S</td><td valign="top">IF (1/50)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Laminin (rabbit)</td><td valign="top">Sigma-Aldrich RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_477163">AB_477163</ext-link></td><td valign="top">Cat# L9393</td><td valign="top">IF (1/200)</td></tr><tr><td valign="top">Antibody</td><td valign="top">Phospho-histone 3 (rabbit polyclonal)</td><td valign="top">Santa Cruz BiotechnologyRRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/AB_2233067">AB_2233067</ext-link></td><td valign="top">sc-8656</td><td valign="top">IF (1/1000)</td></tr><tr><td valign="top">Antibody</td><td valign="top">MSGN1 (rabbit polyclonal)</td><td valign="top">Pourquie Laboratory <break/><xref ref-type="bibr" rid="bib51">Oginuma et al., 2017</xref></td><td valign="top"/><td valign="top">IF (1/1000)</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pCAGG-H2B- Venus</td><td valign="top">Pourquie Laboratory <break/><xref ref-type="bibr" rid="bib14">Denans et al., 2015</xref></td><td valign="top"/><td valign="top">pCAGG backbone</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pCAGG-H2B-RFP</td><td valign="top">Pourquie Laboratory <break/><xref ref-type="bibr" rid="bib14">Denans et al., 2015</xref></td><td valign="top"/><td valign="top">pCAGG backbone</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pCAGG-GAP43-Venus</td><td valign="top">Pourquie Laboratory <break/><xref ref-type="bibr" rid="bib51">Oginuma et al., 2017</xref></td><td valign="top"/><td valign="top">pCAGG backbone</td></tr><tr><td valign="top">Chemical compound, drug</td><td valign="top">NucRed Live 647 ReadyProbes Reagent</td><td valign="top">Thermo Fisher</td><td valign="top">R37106</td><td valign="top">Two drops in 1 ml</td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">MOSAIC plug-in from ImageJ</td><td valign="top">ImageJ <break/><xref ref-type="bibr" rid="bib59">Sbalzarini and Koumoutsakos, 2005</xref></td><td valign="top"/><td valign="top"/></tr><tr><td valign="top">Software, algorithm</td><td valign="top">Tracs reconstruction</td><td valign="top">Arthur Michaut</td><td valign="top">This study</td><td valign="top">Python-based homemade code</td></tr><tr><td valign="top">Software, algorithm</td><td valign="top">K mean Brainbow clustering</td><td valign="top"><xref ref-type="supplementary-material" rid="fig2sdata2">Figure 2—source data 2</xref></td><td valign="top">MATLAB</td><td valign="top"/></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">pQCGICIDPA</td><td valign="top">Retroviral barcoding</td><td valign="top">This study</td><td valign="top">pQCXIX backbone</td></tr><tr><td valign="top">Recombinant DNA reagent</td><td valign="top">Tol2-CAG::Nucbow</td><td valign="top">RRID:<ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/Addgene_158992">Addgene_158992</ext-link> <break/><xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref></td><td valign="top"/><td valign="top">pCX backbone</td></tr></tbody></table></table-wrap><sec id="s4-1"><title>Chicken embryos</title><p>All animal experiments were performed in accordance to all relevant guidelines and regulations. The office for protection from Research Risks (OPRR) has interpreted ‘live vertebrate animal’ to apply to avians (e.g., chick embryos) only after hatching. All of the studies proposed in this project only concern early developmental stages (prior to 5 days of incubation); therefore, no IACUC-approved protocol is required. Fertilized chicken eggs were obtained from commercial sources. Fertilized eggs from transgenic chickens expressing cytoplasmic GFP ubiquitously (<xref ref-type="bibr" rid="bib47">McGrew et al., 2004</xref>) were obtained from Susan Chapman at Clemson University. Fertilized eggs from transgenic quails expressing H2B-Cherry (<xref ref-type="bibr" rid="bib5">Bénazéraf et al., 2017</xref>) were obtained from Ozark Hatcheries. Eggs were incubated at 38°C in a humidified incubator, and embryos were staged according to <xref ref-type="bibr" rid="bib30">Hamburger and Hamilton, 1992</xref>. We cultured chicken embryos mainly from stage 5HH on a ring of Whatman paper on agar plates as described in the EC culture protocol (<xref ref-type="bibr" rid="bib12">Chapman et al., 2001</xref>).</p></sec><sec id="s4-2"><title>Immunohistochemistry</title><p>For whole-mount immunohistochemistry, stage 3–20HH chicken embryos were fixed in 4% paraformaldehyde (PFA; 158127, Sigma) diluted in PBS 1X at 4°C overnight. The embryos were rinsed and permeabilized in PBS-0.1% Titon, three times 30 min, and incubated in blocking solution (PBS-0.1% Triton, 1% donkey serum; D9663, Sigma) prior to incubating with primary and secondary antibodies. Embryos were incubated in antibodies against T/Brachyury (1/1000, R&amp;D Systems: AF2085), SOX2 (1/1000, Millipore: ab5603), E-cadherin (1/250 Abcam: ab76055), N-cadherin (1/250, Abcam: ab12221), fibronectin (1/50 DSHB: MT4S), laminin (1/200, Sigma: L9393), phospho-histone 3 (1/1000, Santa Cruz: sc-8656), MSGN1 (1/1000) (<xref ref-type="bibr" rid="bib51">Oginuma et al., 2017</xref>), diluted in blocking solution at 4°C overnight. Embryos were rinsed and washed three times 30 min in PBS-0.1% Triton, incubated 1 hr in blocking solution and incubated at 4°C overnight with secondary antibodies conjugated with Alexa Fluor (Molecular Probes) diluted in blocking solution. If the staining was not imaged in the following two days, post-fixing was performed using a 4% PFA solution.</p><p>For histological analysis, stage 5HH chicken embryos were fixed in 4% PFA. Embryos were then embedded in OCT compound and frozen in liquid nitrogen. Frozen sections (12 μm) were cut using a Leica Cryostat and incubated overnight at 4°C with the primary antibody diluted in blocking solution (same as above), and after washing in PBS-0.1% Triton, they were incubated overnight at 4°C with the secondary antibody conjugated with Alexa Fluor (Molecular probes) diluted in blocking solution. Sections were then washed in PBS-0.1% Triton before mounting in fluoromount-G (Thermo Fisher) and stored at 4°C overnight prior to imaging.</p><p>Images were captured using a laser scanning confocal microscope with a 10× or 20× objective (LSM 780, Zeiss). To image the whole embryo, we used the tiling and stitching function of the microscope (5 by 2 matrix) and z-sectioning (5 μm). Later stages (from 17HH) were imaged in clearing solution using the scale A2 clearing protocol from <xref ref-type="bibr" rid="bib29">Hama et al., 2011</xref>. For imaging, the embryo was placed in the clearing solution (4 M urea 0.1% Triton, 10% glycerol) 30 min prior to imaging in glass bottom dishes (Mattek).</p></sec><sec id="s4-3"><title>Plasmid preparation and electroporation</title><p>pCAGG-H2B-Venus and pCAGG-H2B-RFP have been described in <xref ref-type="bibr" rid="bib14">Denans et al., 2015</xref>, and pCAGG-GAP43-Venus has been described in <xref ref-type="bibr" rid="bib51">Oginuma et al., 2017</xref>. Chicken embryos at stage 4 or 5HH were prepared for in ovo electroporation. Eggs were windowed and a DNA solution (1 μg/μl) mixed in PBS, 30% glucose, and 0.1% Fast Green was microinjected in the egg, in the space between the vitelline membrane and the epiblast in the first 500 μm posterior to the node or 1500 μm posterior to the node to target the NMP or the LPPs, respectively. Electroporation was carried out using two pulses at 5 V for 1 ms on each side of the PS in the NMP and LP domains (four locations) using a needle electrode (CUY614, Nepa Gene, Japan) and an ECM 830 electroporator (BTX Harvard Apparatus). This procedure only labels the superficial epiblast layer (<xref ref-type="bibr" rid="bib37">Iimura and Pourquié, 2008</xref>). Eggs were then re-incubated for 1–2 hr at 38°C, and embryos were dissected and prepared for EC culture imaging in six-well imaging plates as described in <xref ref-type="bibr" rid="bib14">Denans et al., 2015</xref>. For lineage-tracing experiments, we performed the same procedure as above but using only one pulse on each side of the PS in the NMP domain to minimize the number of electroporated cells.</p></sec><sec id="s4-4"><title>Nuclear red labeling in vivo</title><p>The nuclear red solution was prepared from the NucRed Live 647 ReadyProbes Reagent (Thermo Fisher) and diluted in PBS 1X as indicated by the manufacturer's experimental procedures. Sparse nuclear labeling of the dorsal epiblast was performed in ovo by injecting the nuclear red solution between the epiblast and the vitelline membrane at the PS level. The solution was left for 15 min to perform the long-term epiblast tracking and 30 min for monitoring ingression. The embryos were then dissected, rinsed in PBS, and mounted on paper filter for EC culture to perform live imaging from the dorsal side for the long-term epiblast tracking and from the ventral side for measuring cell ingression.</p><p>Time-lapse imaging, ingression, and cell-cycle length measurements stage 5HH chicken embryos were cultured ventral side up on a microscope stage using a custom-built time-lapse station (<xref ref-type="bibr" rid="bib4">Bénazéraf et al., 2010</xref>). We used a computer-controlled, wide-field (10× objective) epifluorescent microscope (Leica DMR) workstation, equipped with a motorized stage and cooled digital camera (QImaging Retiga 1300i), to acquire 12-bit grayscale intensity images (492 × 652 pixels). For each embryo, several images corresponding to different focal planes and different fields were captured at each single timepoint (frame). The acquisition rate used was 10 frames per hour (6 min between frames). To quantify cell ingression and division, the image sequence was registered to the node displacement by tracking the advancement of Hensen’s node as a function of time using the manual tracking plug-in in ImageJ (<xref ref-type="bibr" rid="bib14">Denans et al., 2015</xref>). Cell division events were manually tracked in long-term movies of H2B:GFP and RFP electroporated embryos. The time between divisions was estimated by counting the number of frames.</p><p>To analyze the dynamics of mesodermal precursor territories during PS regression, we tracked three small regions of the epiblast adjacent to the PS located at a distance of 500, 700, and 1000 μm from Hensen’s node at stage 5HH in transgenic chicken embryos expressing GFP. Embryos were imaged with a Zeiss LSM 780 confocal microscope with temperature control. At stage 5HH, the entire PS is around 2000 μm in length. According to our fate mapping (see <xref ref-type="fig" rid="fig1">Figure 1</xref>) and <xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>, these three regions correspond to transition zones between the NMP-PSM, PSM-LP, and LP-EM territories, respectively. The NMP territory is maintained over the first 500 μm from the node and remains in the <italic>sinus rhomboidalis</italic> region during PS regression. The PSM progenitor domain is found posterior to the NMP territory in the anterior third of the PS approximately extending 670 μm posterior to the node. We observed that electroporation of the region located 750 μm posterior to the node is labeling LP cells (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Thus, we tracked the area located 700 μm posterior to the node, which approximately corresponds to the transition zone between the precursors of paraxial mesoderm and LP. The posterior half of the PS in stage 5HH chicken embryos mostly gives rise to extraembryonic mesoderm (<xref ref-type="bibr" rid="bib57">Psychoyos and Stern, 1996</xref>). Thus, we considered the boundary between lateral plate and EMPs to be at 1000 μm from Hensen’s node. These different regions were followed using the manual tracking module from imageJ in 10 hr time-lapse movies spanning from stage 5HH to the 10-somite stage. <xref ref-type="video" rid="video7">Video 7</xref> shows a representative movie where the different territories have been color-coded to visualize their dynamics during PS regression.</p></sec><sec id="s4-5"><title>Cell tracking analysis</title><p>Whole epiblast cell tracking was performed using the MOSAIC plug-in from ImageJ (<xref ref-type="bibr" rid="bib59">Sbalzarini and Koumoutsakos, 2005</xref>). Tracks were then visualized and analyzed using a custom code in Python. Cell velocities were computed by calculating the discrete displacements. In order to back-track cells in regions of interest, groups of cells were selected at any given time using selection tools provided by the Scikit-image package (<xref ref-type="bibr" rid="bib62">scikit-image contributors et al., 2014</xref>). Trajectories were then plotted using the Matplotlib package (<xref ref-type="bibr" rid="bib35">Hunter, 2007</xref>).</p><p>Color-coded time projections were generated using the color-coded projection module from Zen software. Early to late timepoints are shown using the following color sequence: cyan, magenta, and yellow.</p></sec><sec id="s4-6"><title>Cell proliferation analysis</title><p>Stage 5, 8, 12, 13HH chicken embryos were dissected, fixed in 4% PFA, and immunostained with phospho-histone H3 (pH3) antibody (1/1000, Millipore) as described above. In the penultimate wash, Hoechst (1/1000) was added to label cell nuclei. The number of proliferative cells was measured in 250 by 250 μm squares at three different locations along the PS (center of the area being at 250, 750, and 1200 μm from the node). Proliferative cells were identified by automated segmentation of pH3-positive cells using ImageJ via thresholding the images and using the analyze particle module. Hoechst-positive cells were also segmented using the same procedure and their number was used to normalize to the cell density in each square. The percentage of dividing cells was obtained by dividing the number of pH3 cells by the number of Hoechst-positive cells in each square and multiplying by 100. A minimum of five embryos was analyzed for each stage. We also performed similar measurements on live H2B:Cherry quail embryo at stage 5HH in the anterior (around the node) and posterior (LPP region). We used a high threshold, which identifies cells in mitosis (that show a brighter Cherry signal due to chromatin condensation), while all the other cells in the tissue are identified with a lower threshold.</p></sec><sec id="s4-7"><title>Analysis of the localization and number of NMPs</title><p>Chicken embryos from stage 4 to 20HH were harvested and fixed in 4% PFA at 4°C overnight. Embryos were immunostained in whole mount using T/Brachyury, SOX2, and Alexa Fluor 647 Phalloidin (1/500 Thermo Fisher: A22287) combinations and imaged by confocal laser microscopy (LSM 780, Zeiss). SOX2/T-double positive cells were segmented and counted using ImageJ software. To identify the double-positive cells, cells in the T and SOX2 channel were manually thresholded (around 1.3% of the histogram). We used the image calculator tool from ImageJ to generate a new image by performing the image operation T AND SOX2 and identify the double-positive cells. Cell were then counted automatically by the ‘Analyze Particle’ module on ImageJ (particle size &lt; 500 pixel square). Embryos were grouped by stage, and data is shown in <xref ref-type="fig" rid="fig5">Figure 5A</xref>. n = 7 at stage 4HH; n = 11 at stage 5HH; n = 6 at 5–10 somites; n = 5 at 15–20 somites; n = 5 at 30 somites; n = 4 at 35 somites and older. Total n = 38 embryos.</p></sec><sec id="s4-8"><title>Lineage tracing and quantification</title><sec id="s4-8-1"><title>Cloning of a high-complexity barcoded retroviral genomic plasmid library</title><p>The plasmid library used to generate the barcoded retrovirus was based on the pQCXIX backbone. First, this backbone was digested with NotI and XhoI. A Gibson assembly reaction was performed using three PCR-generated fragments to insert the EGFP, IRES, and Cre recombinase, creating pQCGIC (<xref ref-type="bibr" rid="bib24">Gibson et al., 2009</xref>). These PCR fragments were generated using the indicated primers from pCAG-EGFP, pQCXIX, and pCAG-Cre plasmids, respectively. This plasmid was then digested with XhoI and PvuII, and an intron disrupted polyadenylation sequence (IDPA) amplified from a gBlock (IDT) was inserted with a Gibson assembly reaction, creating pQCGICIDPA. Finally, the dsDNA barcode insert sequence was prepared from an Ultramer Oligo (IDT), QCGICbc_oligo, with PCR. This ultramer was synthesized with 12 SW repeats, resulting in a GC balanced 24 bp barcode. pQCGICIDPA was digested with XhoI, and a 170 µl Gibson assembly reaction was performed with 8.5 µg of linearized vector and 1.24 µg of insert. This reaction was purified and electroporated into three 100 µl aliquots of electrocompetent DH10β <italic>Escherichia coli</italic>. Following a 1 hr outgrowth in 12 ml SOC at 37°C with shaking, dilutions were plated on LB agarose plates with carbenicillin to determine complexity, and the remaining transformation was added to 500 ml of LB with carbenicillin and grown for 16 hr at 37°C. The liquid culture was split into four and plasmid was purified with the Qiagen Maxiprep Kit. A plate with 1/1 × 10<sup>4</sup> of the transformation grew approximately 1 × 10<sup>3</sup> colonies, indicating a total library complexity of 1 × 10<sup>7</sup>.</p><p><table-wrap id="inlinetable1" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th valign="top">Target</th><th valign="top">Primer name</th><th valign="top">F primer sequence</th><th valign="top">R primer sequence</th></tr></thead><tbody><tr><td valign="top">EGFP</td><td valign="top">CAGtoQCpreI</td><td valign="top">CAGGAATTGATCCGCATTCTGCAGTCGACGGTACC</td><td valign="top">GAGGCCTACCGGTGCAAGTCAGATGCTCAAGGGGC</td></tr><tr><td valign="top">IRES</td><td valign="top">QCIRES</td><td valign="top">GCACCGGTAGGCCTC</td><td valign="top">GACGCGTGATCAAGCTTATCATC</td></tr><tr><td valign="top">Cre</td><td valign="top">CretoQCpostI</td><td valign="top">GCTTGATCACGCGTCGCAAAGAATTCTGAGCCGCC</td><td valign="top">TGGACCACTGATATCTCGAGCGGCCGCTATCACAGATCTT</td></tr><tr><td valign="top">IDPA</td><td valign="top">QCGICidpa</td><td valign="top">AGATCTGTGATAGCGGCCGCTCGAGATATCAGTGGTCCAGGCTCAATAAAGGGCAGGTAAGTATCAAGGTTAC</td><td valign="top">ATGGCTCGTACTCTATAGGCTTCAGACGCGTTCGGATTTGATC</td></tr><tr><td valign="top">QCGICbc_insert</td><td valign="top">QCGICbc</td><td valign="top">AGATCTGTGATAGCGGCCGCCCCTGGCTCACAAATACCACTGAGATCT</td><td valign="top">GAGCCTGGACCACTGATATCCCCCATAATTTTTGGCAGAGGGAAAAAGATCT</td></tr><tr><td valign="top">IDPA gblock</td><td colspan="3" valign="top">AATAAAGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGTTCTGTGTGTTGGTTTTTTGTGTGTTCTGGATCAAATCCGAACGCGT</td></tr><tr><td valign="top">QCGICbc_oligo</td><td colspan="3" valign="top">AGATCTGTGATAGCGGCCGCCCCTGGCTCACAAATACCACTGAGATCTSWSWSWSWSWSWSWSWSWSWSWSWAGATCTTTTTCCCTCTGCCAAAAATTATGGGGGATATCAGTGGTCCAGGCTC</td></tr></tbody></table></table-wrap></p></sec><sec id="s4-8-2"><title>Preparation of replication-incompetent retrovirus</title><p>Replication-incompetent retrovirus was produced and concentrated as previously described (<xref ref-type="bibr" rid="bib3">Beier et al., 2011</xref>; <xref ref-type="bibr" rid="bib11">Cepko and Pear, 2001</xref>). Briefly, on day 1, eleven 150 cm plates with HEK 293T cells at 70–80% confluency were transiently transfected each with 13.5 µg of pQCGICbcIDPA, 6.75 µg pMN gagpol (<xref ref-type="bibr" rid="bib53">Ory et al., 1996</xref>), and 2.25 µg of a plasmid expressing the EnvA envelope (<xref ref-type="bibr" rid="bib42">Landau and Littman, 1992</xref>) using PEI (Polysciences, 24765; 90 µg per plate). Media was replaced on day 2, and viral supernatant was collected on days 3 and 4 and stored at −80°C. The supernatant was thawed, and virus was concentrated via ultracentrifugation (49,000 ×g for 2 hr at 4°C). Virus was resuspended in 270 µl of media and aliquoted in 10–20 µl aliquots and stored at −80°C. Titer was determined by infecting HEK 293T cells expressing the avian TVA receptor and was found to be approximately 4 × 10<sup>8</sup> infectious particles per milliliter.</p></sec><sec id="s4-8-3"><title>Retroviral infection</title><p> 1 μl of the virus preparation was diluted in 10 μl of PBS 1X and 0.1% Fast Green to form the virus mix. The virus mix was placed in ovo on top of the NMP region for 1 hr and washed with PBS 1X. The eggs where then sealed with tape and reincubated for 36 hr.</p></sec><sec id="s4-8-4"><title>Quantification</title><p>To retrieve the different barcodes, we manually harvested individual fluorescent cells from transverse sections of embryos fixed 36 hr post infection. GFP-positive cells were handpicked under a microscope (20× objective) using single-use needles (BD Precision). Each cell/needle was put in an individual PCR tube containing the buffer for the PCR1, and its localization was recorded. The tissue of origin of the cells was visually identified on the sections. The barcodes were retrieved using two consecutive nested PCR amplifications and sequenced using Sanger sequencing. PCR primer 1: 1R-<named-content content-type="sequence">TCTCTGTCTCGACAAGCCCAG</named-content>, 1F-<named-content content-type="sequence">GATCATGCAAGCTGGTGGCTG</named-content>. PCR primer 2: 2R-<named-content content-type="sequence">CTTACCTGCCCTTTATTGAGCCTG</named-content>, 2F-<named-content content-type="sequence">CTGCTGGAAGATGGCGATGG</named-content>.</p></sec><sec id="s4-8-5"><title>Nucbow cell tracing</title><p>Lineage tracing was performed by co-electroporating the NMP region at stage 5HH in ovo as described above with the following constructs: a self-excising Cre recombinase (se-Cre), the Nucbow construct, and the TolII transposase as described in <xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref> in a 1/1/1 ratio at (1 µg/µl, each). We used similar concentrations for the Nucbow and transposase plasmids to that described in <xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref> but increased 10 times the concentration (1 µg/µl versus 0.1 µg/µl) of the se-Cre to favor fast recombination and integration. Because non-integrated Nucbow plasmids can remain episomal and transiently affect the color of a cell, we performed our analyses after 36 hr when the plasmids are expected to have fully diluted through cell division. 36 hr after electroporation, we see that the number of fluorescent cells has significantly decreased, suggesting that the episomal transgenes have now been diluted.</p><p>To perform lineage analysis, we fixed the electroporated embryos at stage 17HH and 20HH, and imaged them in clearing solution ScaleA2 (<xref ref-type="bibr" rid="bib29">Hama et al., 2011</xref>). The imaging was performed using an LSM 880 with Airyscan module in the three fluorescent channels following the same gating as in <xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref>.</p></sec><sec id="s4-8-6"><title>Quantification</title><p>Cells were manually segmented in the YFP and Cherry channel using ImageJ. Positions were assigned to the mesodermal and neural tube layers. Color retrieval was performed by measuring the intensity in the three channels, Cerulean, YFP, and Cherry so that the total of all the intensities was normalized to 1 and expressed in percentages similarly to <xref ref-type="bibr" rid="bib45">Loulier et al., 2014</xref>. Cluster assignment was performed using K-mean clustering followed by thresholding of only the cells with a silhouette &gt;0.4. The coordinates were then calculated in a triplot diagram for visualization. The cells in a clone were then reassigned to their original localization based on the Y value as a proxy for the anteroposterior position in the image.</p></sec></sec><sec id="s4-9"><title>scRNAseq analysis</title><sec id="s4-9-1"><title>Preparation of single-cell suspensions for scRNAseq</title><p>Single-cell dissociation protocols were optimized to achieve &gt;90% viability and minimize doublets before sample collection. To generate the samples, four embryos were harvested for each stage and cells were dissociated and captured on an inDrops (<xref ref-type="bibr" rid="bib41">Klein et al., 2015</xref>) setup on the same day. For stage 5HH and 6-somite samples, the anterior half of the PS including Hensen’s node and the posterior region of the neural plate were dissected. Two tail bud regions and two posterior ends (including the last somite formed, the PSM, and posterior neural tube and the tail bud) were dissected to generate the 35-somite sample. For single-cell dissociation, the dissected tissue was briefly rinsed in cold PBS and incubated in Accutase (Gibco) for 10–25 min at 37°C followed by mechanical dissociation. The cell suspension was analyzed with a hemocytometer to assess the quality of the dissociation and evaluate cell density. Dissociated cells were centrifuged at 350 g for 5 min at 4°C and resuspended at a concentration of 250,000 cells per microliter in 0.25% BSA in PBS. 2 × 3000 cells were sequenced per sample. Two biological replicates were collected per sample, and the sequencing data from both samples were combined for data analysis.</p></sec><sec id="s4-9-2"><title>Barcoding, sequencing, and mapping of single-cell transcriptomes</title><p>Single-cell transcriptomes were barcoded using the inDrops pipeline using V3 sequencing adapters as previously reported (<xref ref-type="bibr" rid="bib41">Klein et al., 2015</xref>). Following within-droplet reverse transcription, emulsions consisting of about 3000 cells were broken, frozen at −80°C, and prepared as individual RNA-seq libraries. inDrops libraries were sequenced on an Illumina NextSeq 500 using the NextSeq 75 High Output Kits using standard Illumina sequencing primers and 61 cycles for read 1 and 14 cycles for read 2, eight cycles each for index read 1 and index read 2. Raw sequencing data (FASTQ files) were processed using the inDrops.py bioinformatics pipeline available at <ext-link ext-link-type="uri" xlink:href="https://github.com/indrops/indrops">https://github.com/indrops/indrops</ext-link>, (copy archived at <ext-link ext-link-type="uri" xlink:href="https://archive.softwareheritage.org/swh:1:dir:b5ef69579269dd38e028724ce6a4d5545379ea6e;origin=https://github.com/indrops/indrops;visit=swh:1:snp:6a5aa2e6bf2416b08ffee33db867e3fb0eafeaec;anchor=swh:1:rev:2ad4669b72ea6ba794f962ed95b778560bdfde4a">swh:1:rev:2ad4669b72ea6ba794f962ed95b778560bdfde4a</ext-link>); <xref ref-type="bibr" rid="bib75">Veres, 2021</xref>. Transcriptome libraries were mapped to <italic>Gallus gallus</italic> transcriptome built from the GRCg6a (GCA_000002315.5) genome assembly. Bowtie version 1.1.1 was used with parameter –e 200.</p></sec><sec id="s4-9-3"><title>Processing of scRNAseq data</title><p>Single-cell counts matrices were processed and analyzed using ScanPy (1.4.3) and custom Python scripts (Code Availability). Low-complexity cell barcodes, which can arise from droplets that lack a cell but contain background RNA, were filtered in two ways. First, inDrops data were initially filtered to only include transcript counts originating from abundantly sampled cell barcodes. This determination was performed by inspecting a weighted histogram of unique molecular identifier–gene pair counts for each cell barcode and manually thresholding to include the largest mode of the distribution. Second, low-complexity transcriptomes were filtered out by excluding cell barcodes associated with &lt;400 expressed genes. Transcript unique molecular identifier counts for each biological sample were then reported as a transcript × cell table, adjusted by a total-count normalization, log-normalized, batch corrected (using bbknn module), and scaled to unit variance and zero mean. Note that for the WOT analysis the module ‘combat’ was also used for batch correction. Unless otherwise noted, each dataset was subset to the 1000 most highly variable genes, as determined by a bin-normalized overdispersion metric.</p></sec><sec id="s4-9-4"><title>Low-dimensional embedding and clustering</title><p>Processed single-cell data were projected into a 50-dimensional PCA subspace (<italic>k</italic> = 10 except 35-somite k = 15) nearest-neighbor graph using Euclidean distance and 50 PCA dimensions and visualized using UMAP representation. Clustering was performed using Leiden community detection algorithms.</p></sec><sec id="s4-9-5"><title>Identification of differentially expressed genes</title><p>Transcripts with significant cluster-specific enrichment were identified by t-test comparing cells of each cluster to cells from all other clusters in the same dataset. Genes were considered differentially expressed if they met the following criteria: log-transformed fold change &gt;0, adjusted p value&lt;0.05. FDR correction for multiple hypothesis testing was performed as described by Benjamini–Hochberg. The top 100 differentially expressed genes, ranked by FDR-adjusted p values, associated fold changes, and sample sizes (number of cells per cluster) are reported in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>. Gene names for the top 100 differentially expressed transcripts are reported in <xref ref-type="supplementary-material" rid="supp2">Supplementary file 2</xref>.</p></sec><sec id="s4-9-6"><title>Pseudo-spatiotemporal ordering and identification of differentially expressed genes</title><p>Pseudo-spatiotemporal orderings were constructed by randomly selecting a root cell from the NMP cluster and calculating the diffusion pseudotime distance of all remaining cells relative to the root. Trajectories were assembled for paths through specified clusters, with cells ordered by diffusion pseudotime values, as described in <xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>. Dynamically variable genes along the chicken NMP trajectory were identified as follows. In brief, sliding windows of 100 cells were first scanned to identify the two windows with maximum and minimum average expression levels for all genes individually. For each gene, a <italic>t</italic>-test was then performed between these two sets of 100 expression measurements (FDR &lt; 0.01). Scaled expression values for significant genes were then smoothened over a sliding window of 100 cells, ranked by peak expression and plotted as a heat map, shown in <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2D</xref> and <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3E</xref>. The same method was used to plot the dynamically variable genes to identify each cluster type as shown in <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–C</xref>, <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3E</xref>, and the genes diagnostic of the epithelial mesenchymal transition in the NMP early and late clusters in <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1E, F</xref>.</p></sec><sec id="s4-9-7"><title>Machine-learning classification of cell states</title><p>Cell state prediction using the chicken cell states was predicted using the LDA classifier trained on the mouse E9.5 embryos (<xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref>) after subsetting matching gene symbols for the E9.5 variable gene list and projecting into the E9.5-defined PCA subspace.</p></sec><sec id="s4-9-8"><title>Trajectory inference analysis using optimal-transport analysis</title><p>Waddington-OT 1.0.7 conceptual framework (<xref ref-type="bibr" rid="bib60">Schiebinger et al., 2019</xref>) was used to infer the temporal couplings of cells from the different samples collected independently at various timepoints. Transport matrices (also called 'transport maps') were created by connecting each pair of timepoints and using an estimate of cellular growth rates. To estimate the growth rate, we scored each cell according to its expression of various gene signatures (proliferation and apoptosis) as described in <xref ref-type="bibr" rid="bib60">Schiebinger et al., 2019</xref> and then model cellular growth with a Birth-Death Process, which assigns each cell a rate of division and a rate of death. The trajectory of a cell set refers to the sequence of ancestor distributions at earlier timepoints and descendant distributions at later timepoints. Ancestors were calculated by pushing back through the transport map and represented by intensity in the UMAP embedding of the dataset containing all cell sets. Transition tables were calculated to show the amount of mass transported from a cell type to another from a start and an end point. Predictive transcriptions factors for each cell fate of the datasets were obtained by creating fate matrix and searching for transcription factors that are enriched in cells most fated to transition to each particular fate (only transcriptions factor with a FDR &lt; 0.01 and a fraction expressed ratio &gt;1 between the timepoints were kept). Gene trends along trajectories were computed with non-scaled, log/normalized counts along trajectories.</p></sec><sec id="s4-9-9"><title>Gene Set Enrichment Analysis (GSEA)</title><p>List of genes and log fold-change values for each clusters obtained by differential expression (Wilcoxon rank-sum) were used as input for computing overlap with the Hallmark Epithelial Mesenchymal Transition gene set collection using the GSEA tool (<xref ref-type="bibr" rid="bib44">Liberzon et al., 2011</xref>; <xref ref-type="bibr" rid="bib70">Subramanian et al., 2005</xref>; <xref ref-type="bibr" rid="bib69">Subramanian et al., 1995</xref>) (<ext-link ext-link-type="uri" xlink:href="http://www.gsea-msigdb.org">http://www.gsea-msigdb.org</ext-link>), and only genes with p-values&lt;0.05 were kept. Results are plotted in <xref ref-type="fig" rid="fig5">Figure 5</xref> using the calculated normalized expression ratio (NES).</p></sec></sec><sec id="s4-10"><title>Data and code availability</title><p>scRNAseq data and code are available on GitHub: <ext-link ext-link-type="uri" xlink:href="https://github.com/PourquieLab/Guillot_2021">https://github.com/PourquieLab/Guillot_2021</ext-link> (copy archived at <ext-link ext-link-type="uri" xlink:href="https://archive.softwareheritage.org/swh:1:dir:5cfb1a531205d93bca51ccab9c40e20626fb9404;origin=https://github.com/PourquieLab/Guillot_2021;visit=swh:1:snp:054989b807cbf5ebbcfd8e2f08432649d4d9b7be;anchor=swh:1:rev:3d80f422bc5a675c08546cbb10ab79211e430b1e">swh:1:rev:3d80f422bc5a675c08546cbb10ab79211e430b1e</ext-link>; <xref ref-type="bibr" rid="bib56">Pourquie Lab, 2021</xref>).</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank members of the Pourquié lab, Domingos Henrique, Connie Cepko, Denis Duboule, Allon Klein, Dan Wagner, and Cliff Tabin for discussions and critical reading of the manuscript. We also thank Jean Livet for the MAGIC markers plasmids. We thank Dan Wagner, Samuel Wolock, and Jyoti Rao for their assistance with the sc-RNA analysis pipeline installation and discussions. Research in the Pourquié lab was funded by a grant from the National Institute of Health (RO1HD097068-02) and EMBO ALTF 406-2015 to CG. We thank the NeuroTechnology Studio at Brigham and Women’s Hospital for providing the confocal LSM 880 instrument access and consultation on data acquisition and data analysis. We thank the single cell core at Harvard Medical School and the Bauer Core facility at Harvard University for their assistance with the single cell experiment and sequencing.</p> </ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Formal analysis, YD performed the trajectory analysis in silico with CG and OP</p></fn><fn fn-type="con" id="con3"><p>Software, AM wrote the code to analyze the cell trajectories and their speed</p></fn><fn fn-type="con" id="con4"><p>Resources, BR constructed the viral library and prepared the viral solutions</p></fn><fn fn-type="con" id="con5"><p>Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>Table showing the cluster full names, cluster name abbreviation, and cell number at stage 5HH, 6 somites, 35 somites, all chicken embryo data, data subset from the chick (corresponding to <xref ref-type="fig" rid="fig3">Figures 3H</xref> and <xref ref-type="fig" rid="fig5">5H</xref>), chick and mouse data subsets shown in <xref ref-type="fig" rid="fig4">Figures 4A, B</xref> and <xref ref-type="fig" rid="fig5">5E</xref>, and the mouse subset data (<xref ref-type="fig" rid="fig3">Figure 3K</xref>).</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-supp1-v2.xlsx"/></supplementary-material><supplementary-material id="supp2"><label>Supplementary file 2.</label><caption><title>Tables showing the differentially expressed genes per clusters at stage 5HH, 6 somites, 35 somites, all chicken data, chicken data subset, neuromesodermal progenitor (NMP) early and late reclustering with and without HOX genes and the mouse subsets.</title><p>Each cluster is divided into three subcolumns where the first column indicates the gene name, the second column the p value, and the third the log fold changes. All the tables are ranked by z-score. The expression of the 10 first genes with the highest log fold change for each cluster is shown in the dotplots.</p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-supp2-v2.xlsx"/></supplementary-material><supplementary-material id="supp3"><label>Supplementary file 3.</label><caption><title>Predicted transcription factors identified by the Waddington-OT (WOT) analysis along the neuromesodermal progenitor (NMP), presomitic mesoderm (PSM), and neural trajectories.</title><p>List of all the genes that are differentially expressed in the cells with the highest probability to transition to each cell type; the list is then filtered by a curated list of transcription factors. The fraction expressed ratio (second column) represents the variation of cell fraction that express each gene between the first and second timepoint used to infer the trajectories (days 1–3 for chicken data and E7.25–E9.5 for mouse data). The false discovery rate (FDR) column show the FDR (adjusted p-value) for each gene.</p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-supp3-v2.xlsx"/></supplementary-material><supplementary-material id="supp4"><label>Supplementary file 4.</label><caption><title>Comparative analysis of the differentially expressed genes (DEGs) in the early and late neuromesodermal progenitor (NMP) clusters in mouse, chicken, and human models.</title><p>We used the list of differentially expressed genes identified in <xref ref-type="bibr" rid="bib15">Dias et al., 2020</xref>, <xref ref-type="bibr" rid="bib28">Guibentif et al., 2021</xref>; <xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>; the top 350 genes of Table 5 from <xref ref-type="bibr" rid="bib28">Guibentif et al., 2021</xref>. For the human gene list, we computed the list of DEG in the NMP cluster compared to the pluripotent stem cell cluster and took the 350 top genes from the <xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref> study. For the list identified in this study, the genes that were kept are those that have a false discovery rate (FDR) &gt; 0.05. To maintain a comparable number of genes, we decided to take only the top 350 genes when more than 1000 genes had an FDR &gt; 0.05. In this table, we also compared the newly identified gene from this study to the list of up- and downregulated genes from <xref ref-type="bibr" rid="bib81">Wymeersch et al., 2019</xref> providing from dissection of the node streak border NSB at E8.5 and the chordo-neural hinge CNH at E10.5 in mouse. The comparison of the different lists was done by using <ext-link ext-link-type="uri" xlink:href="http://www.molbiotools.com/listcompare">http://www.molbiotools.com/listcompare</ext-link>. For each analysis, we provide the matrix with the number of genes that are shared between two gene lists. We also provide the list of the shared items between all the lists and the gene list that intersect between two gene lists.</p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-supp4-v2.xlsx"/></supplementary-material><supplementary-material id="supp5"><label>Supplementary file 5.</label><caption><title>Comparative analysis of the neuromesodermal progenitor (NMP) gene lists in mouse, chicken, and human models.</title><p>We used the list of differentially expressed genes (DEGs) identified in <xref ref-type="bibr" rid="bib15">Dias et al., 2020</xref>, <xref ref-type="bibr" rid="bib28">Guibentif et al., 2021</xref>; <xref ref-type="bibr" rid="bib27">Gouti et al., 2017</xref>; the top 350 genes of Table 5 from <xref ref-type="bibr" rid="bib28">Guibentif et al., 2021</xref>. For the human gene list, we computed the list of DEG in the NMP cluster compared to the pluripotent stem cell cluster and took the 350 top genes from the <xref ref-type="bibr" rid="bib16">Diaz-Cuadros et al., 2020</xref> study. For the list identified in this study, the genes that were kept are those that have a false discovery rate (FDR) &gt; 0.05. To maintain a comparable number of genes, we decided to take only the top 350 genes when more than 1000 genes had an FDR &gt; 0.05 The comparison table was done by using <ext-link ext-link-type="uri" xlink:href="http://www.molbiotools.com/listcompare">http://www.molbiotools.com/listcompare</ext-link>. For each analysis, we provide the matrix with the number of genes that are shared between two gene lists. We also give the list of the shared items between all the lists and the gene list that intersect between two gene lists.</p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-64819-supp5-v2.xlsx"/></supplementary-material><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="docx" mimetype="application" xlink:href="elife-64819-transrepform-v2.docx"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>Sequencing data have been deposited in GEO under accession codes GSE161905. All the raw data to generate the graphs are given in a txt file.</p><p>The following dataset was generated:</p><p><element-citation id="dataset1" publication-type="data" specific-use="isSupplementedBy"><person-group person-group-type="author"><name><surname>Guillot</surname><given-names>C</given-names></name><name><surname>Pourquie</surname><given-names>O</given-names></name></person-group><year iso-8601-date="2019">2019</year><data-title>Single cell sequencing of posterior axis development in Gallus gallus</data-title><source>NCBI Gene Expression Omnibus</source><pub-id assigning-authority="NCBI" pub-id-type="accession" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE161905">GSE161905</pub-id></element-citation></p><p>The following previously published datasets were used:</p><p><element-citation id="dataset2" publication-type="data" specific-use="references"><person-group person-group-type="author"><collab>Pijuan-Sala</collab></person-group><year iso-8601-date="2017">2017</year><data-title>Timecourse single-cell RNAseq of whole mouse embryos harvested between days 6.5 and 8.5 of development</data-title><source>ArrayExpress</source><pub-id assigning-authority="EBI" pub-id-type="accession" xlink:href="https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-6967/">E-MTAB-6967</pub-id></element-citation></p><p><element-citation id="dataset3" publication-type="data" specific-use="references"><person-group person-group-type="author"><collab>Diaz-Cuadros</collab></person-group><year iso-8601-date="2020">2020</year><data-title>In vitro characterization of the human segmentation clock</data-title><source>NCBI Gene Expression Omnibus</source><pub-id assigning-authority="NCBI" pub-id-type="accession" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE114186">GSE114186</pub-id></element-citation></p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Attardi</surname> <given-names>A</given-names></name><name><surname>Fulton</surname> <given-names>T</given-names></name><name><surname>Florescu</surname> <given-names>M</given-names></name><name><surname>Shah</surname> <given-names>G</given-names></name><name><surname>Muresan</surname> <given-names>L</given-names></name><name><surname>Lenz</surname> <given-names>MO</given-names></name><name><surname>Lancaster</surname> <given-names>C</given-names></name><name><surname>Huisken</surname> <given-names>J</given-names></name><name><surname>van Oudenaarden</surname> <given-names>A</given-names></name><name><surname>Steventon</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Neuromesodermal progenitors are a conserved source of spinal cord with divergent growth dynamics</article-title><source>Development</source><volume>145</volume><elocation-id>dev166728</elocation-id><pub-id pub-id-type="doi">10.1242/dev.166728</pub-id><pub-id pub-id-type="pmid">30333213</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Beccari</surname> <given-names>L</given-names></name><name><surname>Moris</surname> <given-names>N</given-names></name><name><surname>Girgin</surname> <given-names>M</given-names></name><name><surname>Turner</surname> <given-names>DA</given-names></name><name><surname>Baillie-Johnson</surname> <given-names>P</given-names></name><name><surname>Cossy</surname> <given-names>AC</given-names></name><name><surname>Lutolf</surname> <given-names>MP</given-names></name><name><surname>Duboule</surname> <given-names>D</given-names></name><name><surname>Arias</surname> <given-names>AM</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Multi-axial self-organization properties of mouse embryonic stem cells into gastruloids</article-title><source>Nature</source><volume>562</volume><fpage>272</fpage><lpage>276</lpage><pub-id pub-id-type="doi">10.1038/s41586-018-0578-0</pub-id><pub-id pub-id-type="pmid">30283134</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Beier</surname> <given-names>KT</given-names></name><name><surname>Samson</surname> <given-names>ME</given-names></name><name><surname>Matsuda</surname> <given-names>T</given-names></name><name><surname>Cepko</surname> <given-names>CL</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Conditional expression of the TVA receptor allows clonal analysis of descendents from Cre-expressing progenitor cells</article-title><source>Developmental Biology</source><volume>353</volume><fpage>309</fpage><lpage>320</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2011.03.004</pub-id><pub-id pub-id-type="pmid">21397594</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bénazéraf</surname> <given-names>B</given-names></name><name><surname>Francois</surname> <given-names>P</given-names></name><name><surname>Baker</surname> <given-names>RE</given-names></name><name><surname>Denans</surname> <given-names>N</given-names></name><name><surname>Little</surname> <given-names>CD</given-names></name><name><surname>Pourquié</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>A random cell motility gradient downstream of FGF controls elongation of an amniote embryo</article-title><source>Nature</source><volume>466</volume><fpage>248</fpage><lpage>252</lpage><pub-id pub-id-type="doi">10.1038/nature09151</pub-id><pub-id pub-id-type="pmid">20613841</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bénazéraf</surname> <given-names>B</given-names></name><name><surname>Beaupeux</surname> <given-names>M</given-names></name><name><surname>Tchernookov</surname> <given-names>M</given-names></name><name><surname>Wallingford</surname> <given-names>A</given-names></name><name><surname>Salisbury</surname> <given-names>T</given-names></name><name><surname>Shirtz</surname> <given-names>A</given-names></name><name><surname>Shirtz</surname> <given-names>A</given-names></name><name><surname>Huss</surname> <given-names>D</given-names></name><name><surname>Pourquié</surname> <given-names>O</given-names></name><name><surname>François</surname> <given-names>P</given-names></name><name><surname>Lansford</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Multi-scale quantification of tissue behavior during amniote embryo Axis elongation</article-title><source>Development</source><volume>144</volume><fpage>4462</fpage><lpage>4472</lpage><pub-id pub-id-type="doi">10.1242/dev.150557</pub-id><pub-id pub-id-type="pmid">28835474</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brown</surname> <given-names>JM</given-names></name><name><surname>Storey</surname> <given-names>KG</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>A region of the vertebrate neural plate in which neighbouring cells can adopt neural or epidermal fates</article-title><source>Current Biology</source><volume>10</volume><fpage>869</fpage><lpage>872</lpage><pub-id pub-id-type="doi">10.1016/S0960-9822(00)00601-1</pub-id><pub-id pub-id-type="pmid">10899008</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bulusu</surname> <given-names>V</given-names></name><name><surname>Prior</surname> <given-names>N</given-names></name><name><surname>Snaebjornsson</surname> <given-names>MT</given-names></name><name><surname>Kuehne</surname> <given-names>A</given-names></name><name><surname>Sonnen</surname> <given-names>KF</given-names></name><name><surname>Kress</surname> <given-names>J</given-names></name><name><surname>Stein</surname> <given-names>F</given-names></name><name><surname>Schultz</surname> <given-names>C</given-names></name><name><surname>Sauer</surname> <given-names>U</given-names></name><name><surname>Aulehla</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Spatiotemporal analysis of a glycolytic activity gradient linked to mouse embryo mesoderm development</article-title><source>Developmental Cell</source><volume>40</volume><fpage>331</fpage><lpage>341</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2017.01.015</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cambray</surname> <given-names>N</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Axial progenitors with extensive potency are localised to the mouse chordoneural hinge</article-title><source>Development</source><volume>129</volume><fpage>4855</fpage><lpage>4866</lpage><pub-id pub-id-type="doi">10.1242/dev.129.20.4855</pub-id><pub-id pub-id-type="pmid">12361976</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cambray</surname> <given-names>N</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Two distinct sources for a population of maturing axial progenitors</article-title><source>Development</source><volume>134</volume><fpage>2829</fpage><lpage>2840</lpage><pub-id pub-id-type="doi">10.1242/dev.02877</pub-id><pub-id pub-id-type="pmid">17611225</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Catala</surname> <given-names>M</given-names></name><name><surname>Teillet</surname> <given-names>M-A</given-names></name><name><surname>Le Douarin</surname> <given-names>NM</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Organization and development of the tail bud analyzed with the quail-chick Chimaera system</article-title><source>Mechanisms of Development</source><volume>51</volume><fpage>51</fpage><lpage>65</lpage><pub-id pub-id-type="doi">10.1016/0925-4773(95)00350-A</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cepko</surname> <given-names>C</given-names></name><name><surname>Pear</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Retrovirus infection of cells in vitro and in vivo</article-title><source>Current Protocols in Molecular Biology</source><volume>9</volume><elocation-id>14</elocation-id><pub-id pub-id-type="doi">10.1002/0471142727.mb0914s36</pub-id><pub-id pub-id-type="pmid">18265282</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chapman</surname> <given-names>SC</given-names></name><name><surname>Collignon</surname> <given-names>J</given-names></name><name><surname>Schoenwolf</surname> <given-names>GC</given-names></name><name><surname>Lumsden</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Improved method for chick whole-embryo culture using a filter paper carrier</article-title><source>Developmental Dynamics</source><volume>220</volume><fpage>284</fpage><lpage>289</lpage><pub-id pub-id-type="doi">10.1002/1097-0177(20010301)220:3&lt;284::AID-DVDY1102&gt;3.0.CO;2-5</pub-id><pub-id pub-id-type="pmid">11241836</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Davis</surname> <given-names>RL</given-names></name><name><surname>Kirschner</surname> <given-names>MW</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>The fate of cells in the tailbud of <italic>Xenopus laevis</italic></article-title><source>Development</source><volume>127</volume><fpage>255</fpage><lpage>267</lpage><pub-id pub-id-type="doi">10.1242/dev.127.2.255</pub-id><pub-id pub-id-type="pmid">10603344</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Denans</surname> <given-names>N</given-names></name><name><surname>Iimura</surname> <given-names>T</given-names></name><name><surname>Pourquié</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Hox genes control vertebrate body elongation by collinear wnt repression</article-title><source>eLife</source><volume>4</volume><elocation-id>e04379</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.04379</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dias</surname> <given-names>A</given-names></name><name><surname>Lozovska</surname> <given-names>A</given-names></name><name><surname>Wymeersch</surname> <given-names>FJ</given-names></name><name><surname>Nóvoa</surname> <given-names>A</given-names></name><name><surname>Binagui-Casas</surname> <given-names>A</given-names></name><name><surname>Sobral</surname> <given-names>D</given-names></name><name><surname>Martins</surname> <given-names>GG</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name><name><surname>Mallo</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>A Tgfbr1/Snai1-dependent developmental module at the core of vertebrate axial elongation</article-title><source>eLife</source><volume>9</volume><elocation-id>e56615</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.56615</pub-id><pub-id pub-id-type="pmid">32597756</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Diaz-Cuadros</surname> <given-names>M</given-names></name><name><surname>Wagner</surname> <given-names>DE</given-names></name><name><surname>Budjan</surname> <given-names>C</given-names></name><name><surname>Hubaud</surname> <given-names>A</given-names></name><name><surname>Tarazona</surname> <given-names>OA</given-names></name><name><surname>Donelly</surname> <given-names>S</given-names></name><name><surname>Michaut</surname> <given-names>A</given-names></name><name><surname>Al Tanoury</surname> <given-names>Z</given-names></name><name><surname>Yoshioka-Kobayashi</surname> <given-names>K</given-names></name><name><surname>Niino</surname> <given-names>Y</given-names></name><name><surname>Kageyama</surname> <given-names>R</given-names></name><name><surname>Miyawaki</surname> <given-names>A</given-names></name><name><surname>Touboul</surname> <given-names>J</given-names></name><name><surname>Pourquié</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>In vitro characterization of the human segmentation clock</article-title><source>Nature</source><volume>580</volume><fpage>113</fpage><lpage>118</lpage><pub-id pub-id-type="doi">10.1038/s41586-019-1885-9</pub-id><pub-id pub-id-type="pmid">31915384</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edri</surname> <given-names>S</given-names></name><name><surname>Hayward</surname> <given-names>P</given-names></name><name><surname>Baillie-Johnson</surname> <given-names>P</given-names></name><name><surname>Steventon</surname> <given-names>BJ</given-names></name><name><surname>Martinez Arias</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2019">2019a</year><article-title>An epiblast stem cell-derived multipotent progenitor population for axial extension</article-title><source>Development</source><volume>146</volume><elocation-id>dev168187</elocation-id><pub-id pub-id-type="doi">10.1242/dev.168187</pub-id><pub-id pub-id-type="pmid">31023877</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edri</surname> <given-names>S</given-names></name><name><surname>Hayward</surname> <given-names>P</given-names></name><name><surname>Jawaid</surname> <given-names>W</given-names></name><name><surname>Martinez Arias</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2019">2019b</year><article-title>Neuro-mesodermal progenitors (NMPs): a comparative study between pluripotent stem cells and embryo-derived populations</article-title><source>Development</source><volume>146</volume><elocation-id>dev180190</elocation-id><pub-id pub-id-type="doi">10.1242/dev.180190</pub-id><pub-id pub-id-type="pmid">31152001</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Faustino Martins</surname> <given-names>J-M</given-names></name><name><surname>Fischer</surname> <given-names>C</given-names></name><name><surname>Urzi</surname> <given-names>A</given-names></name><name><surname>Vidal</surname> <given-names>R</given-names></name><name><surname>Kunz</surname> <given-names>S</given-names></name><name><surname>Ruffault</surname> <given-names>P-L</given-names></name><name><surname>Kabuss</surname> <given-names>L</given-names></name><name><surname>Hube</surname> <given-names>I</given-names></name><name><surname>Gazzerro</surname> <given-names>E</given-names></name><name><surname>Birchmeier</surname> <given-names>C</given-names></name><name><surname>Spuler</surname> <given-names>S</given-names></name><name><surname>Sauer</surname> <given-names>S</given-names></name><name><surname>Gouti</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Self-Organizing 3D human trunk neuromuscular organoids</article-title><source>Cell Stem Cell</source><volume>26</volume><fpage>172</fpage><lpage>186</lpage><pub-id pub-id-type="doi">10.1016/j.stem.2019.12.007</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernández-Garre</surname> <given-names>P</given-names></name><name><surname>Rodríguez-Gallardo</surname> <given-names>L</given-names></name><name><surname>Gallego-Díaz</surname> <given-names>V</given-names></name><name><surname>Alvarez</surname> <given-names>IS</given-names></name><name><surname>Puelles</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Fate map of the chicken neural plate at stage 4</article-title><source>Development</source><volume>129</volume><fpage>2807</fpage><lpage>2822</lpage><pub-id pub-id-type="doi">10.1242/dev.129.12.2807</pub-id><pub-id pub-id-type="pmid">12050131</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Forlani</surname> <given-names>S</given-names></name><name><surname>Lawson</surname> <given-names>KA</given-names></name><name><surname>Deschamps</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Acquisition of hox codes during gastrulation and axial elongation in the mouse embryo</article-title><source>Development</source><volume>130</volume><fpage>3807</fpage><lpage>3819</lpage><pub-id pub-id-type="doi">10.1242/dev.00573</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Garcia-Martinez</surname> <given-names>V</given-names></name><name><surname>Alvarez</surname> <given-names>IS</given-names></name><name><surname>Schoenwolf</surname> <given-names>GC</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Locations of the ectodermal and nonectodermal subdivisions of the epiblast at stages 3 and 4 of avian gastrulation and neurulation</article-title><source>Journal of Experimental Zoology</source><volume>267</volume><fpage>431</fpage><lpage>446</lpage><pub-id pub-id-type="doi">10.1002/jez.1402670409</pub-id><pub-id pub-id-type="pmid">8270895</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Garcia-Martinez</surname> <given-names>V</given-names></name><name><surname>Darnell</surname> <given-names>DK</given-names></name><name><surname>Lopez-Sanchez</surname> <given-names>C</given-names></name><name><surname>Sosic</surname> <given-names>D</given-names></name><name><surname>Olson</surname> <given-names>EN</given-names></name><name><surname>Schoenwolf</surname> <given-names>GC</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>State of commitment of prospective neural plate and prospective mesoderm in late gastrula/early neurula stages of avian embryos</article-title><source>Developmental Biology</source><volume>181</volume><fpage>102</fpage><lpage>115</lpage><pub-id pub-id-type="doi">10.1006/dbio.1996.8439</pub-id><pub-id pub-id-type="pmid">9015268</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gibson</surname> <given-names>DG</given-names></name><name><surname>Young</surname> <given-names>L</given-names></name><name><surname>Chuang</surname> <given-names>RY</given-names></name><name><surname>Venter</surname> <given-names>JC</given-names></name><name><surname>Hutchison</surname> <given-names>CA</given-names></name><name><surname>Smith</surname> <given-names>HO</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Enzymatic assembly of DNA molecules up to several hundred kilobases</article-title><source>Nature Methods</source><volume>6</volume><fpage>343</fpage><lpage>345</lpage><pub-id pub-id-type="doi">10.1038/nmeth.1318</pub-id><pub-id pub-id-type="pmid">19363495</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gont</surname> <given-names>LK</given-names></name><name><surname>Steinbeisser</surname> <given-names>H</given-names></name><name><surname>Blumberg</surname> <given-names>B</given-names></name><name><surname>de Robertis</surname> <given-names>EM</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Tail formation as a continuation of gastrulation: the multiple cell populations of the <italic>Xenopus</italic> tailbud derive from the late blastopore lip</article-title><source>Development</source><volume>119</volume><fpage>991</fpage><lpage>1004</lpage><pub-id pub-id-type="doi">10.1242/dev.119.4.991</pub-id><pub-id pub-id-type="pmid">7916680</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gouti</surname> <given-names>M</given-names></name><name><surname>Tsakiridis</surname> <given-names>A</given-names></name><name><surname>Wymeersch</surname> <given-names>FJ</given-names></name><name><surname>Huang</surname> <given-names>Y</given-names></name><name><surname>Kleinjung</surname> <given-names>J</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name><name><surname>Briscoe</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>In vitro generation of neuromesodermal progenitors reveals distinct roles for wnt signalling in the specification of spinal cord and paraxial mesoderm identity</article-title><source>PLOS Biology</source><volume>12</volume><elocation-id>e1001937</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pbio.1001937</pub-id><pub-id pub-id-type="pmid">25157815</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gouti</surname> <given-names>M</given-names></name><name><surname>Delile</surname> <given-names>J</given-names></name><name><surname>Stamataki</surname> <given-names>D</given-names></name><name><surname>Wymeersch</surname> <given-names>FJ</given-names></name><name><surname>Huang</surname> <given-names>Y</given-names></name><name><surname>Kleinjung</surname> <given-names>J</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name><name><surname>Briscoe</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A gene regulatory network balances neural and mesoderm specification during vertebrate trunk development</article-title><source>Developmental Cell</source><volume>41</volume><fpage>243</fpage><lpage>261</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2017.04.002</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guibentif</surname> <given-names>C</given-names></name><name><surname>Griffiths</surname> <given-names>JA</given-names></name><name><surname>Imaz-Rosshandler</surname> <given-names>I</given-names></name><name><surname>Ghazanfar</surname> <given-names>S</given-names></name><name><surname>Nichols</surname> <given-names>J</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name><name><surname>Göttgens</surname> <given-names>B</given-names></name><name><surname>Marioni</surname> <given-names>JC</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Diverse routes toward early somites in the mouse embryo</article-title><source>Developmental Cell</source><volume>56</volume><fpage>141</fpage><lpage>153</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2020.11.013</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hama</surname> <given-names>H</given-names></name><name><surname>Kurokawa</surname> <given-names>H</given-names></name><name><surname>Kawano</surname> <given-names>H</given-names></name><name><surname>Ando</surname> <given-names>R</given-names></name><name><surname>Shimogori</surname> <given-names>T</given-names></name><name><surname>Noda</surname> <given-names>H</given-names></name><name><surname>Fukami</surname> <given-names>K</given-names></name><name><surname>Sakaue-Sawano</surname> <given-names>A</given-names></name><name><surname>Miyawaki</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Scale: a chemical approach for fluorescence imaging and reconstruction of transparent mouse brain</article-title><source>Nature Neuroscience</source><volume>14</volume><fpage>1481</fpage><lpage>1488</lpage><pub-id pub-id-type="doi">10.1038/nn.2928</pub-id><pub-id pub-id-type="pmid">21878933</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hamburger</surname> <given-names>V</given-names></name><name><surname>Hamilton</surname> <given-names>HL</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>A series of normal stages in the development of the chick embryo. 1951</article-title><source>Developmental Dynamics</source><volume>195</volume><fpage>231</fpage><lpage>272</lpage><pub-id pub-id-type="doi">10.1002/aja.1001950404</pub-id><pub-id pub-id-type="pmid">1304821</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Harwell</surname> <given-names>CC</given-names></name><name><surname>Fuentealba</surname> <given-names>LC</given-names></name><name><surname>Gonzalez-Cerrillo</surname> <given-names>A</given-names></name><name><surname>Parker</surname> <given-names>PR</given-names></name><name><surname>Gertz</surname> <given-names>CC</given-names></name><name><surname>Mazzola</surname> <given-names>E</given-names></name><name><surname>Garcia</surname> <given-names>MT</given-names></name><name><surname>Alvarez-Buylla</surname> <given-names>A</given-names></name><name><surname>Cepko</surname> <given-names>CL</given-names></name><name><surname>Kriegstein</surname> <given-names>AR</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Wide dispersion and diversity of clonally related inhibitory interneurons</article-title><source>Neuron</source><volume>87</volume><fpage>999</fpage><lpage>1007</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2015.07.030</pub-id><pub-id pub-id-type="pmid">26299474</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Henrique</surname> <given-names>D</given-names></name><name><surname>Tyler</surname> <given-names>D</given-names></name><name><surname>Kintner</surname> <given-names>C</given-names></name><name><surname>Heath</surname> <given-names>JK</given-names></name><name><surname>Lewis</surname> <given-names>JH</given-names></name><name><surname>Ish-Horowicz</surname> <given-names>D</given-names></name><name><surname>Storey</surname> <given-names>KG</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>cash4, a novel achaete-scute homolog induced by Hensen's node during generation of the posterior nervous system</article-title><source>Genes &amp; Development</source><volume>11</volume><fpage>603</fpage><lpage>615</lpage><pub-id pub-id-type="doi">10.1101/gad.11.5.603</pub-id><pub-id pub-id-type="pmid">9119225</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Henrique</surname> <given-names>D</given-names></name><name><surname>Abranches</surname> <given-names>E</given-names></name><name><surname>Verrier</surname> <given-names>L</given-names></name><name><surname>Storey</surname> <given-names>KG</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Neuromesodermal progenitors and the making of the spinal cord</article-title><source>Development</source><volume>142</volume><fpage>2864</fpage><lpage>2875</lpage><pub-id pub-id-type="doi">10.1242/dev.119768</pub-id><pub-id pub-id-type="pmid">26329597</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Holmdahl</surname> <given-names>DE</given-names></name></person-group><year iso-8601-date="1925">1925</year><article-title>Experimentelle untersuchungen über die lage der grenze zwischen primärer und sekundärer körperentwicklung beim huhn</article-title><source>Anatomischer Anzeiger</source><volume>59</volume><fpage>393</fpage><lpage>396</lpage></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hunter</surname> <given-names>JD</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Matplotlib: a 2D graphics environment</article-title><source>Computing in Science &amp; Engineering</source><volume>9</volume><fpage>90</fpage><lpage>95</lpage><pub-id pub-id-type="doi">10.1109/MCSE.2007.55</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Iimura</surname> <given-names>T</given-names></name><name><surname>Yang</surname> <given-names>X</given-names></name><name><surname>Weijer</surname> <given-names>CJ</given-names></name><name><surname>Pourquié</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Dual mode of paraxial mesoderm formation during chick gastrulation</article-title><source>PNAS</source><volume>104</volume><fpage>2744</fpage><lpage>2749</lpage><pub-id pub-id-type="doi">10.1073/pnas.0610997104</pub-id><pub-id pub-id-type="pmid">17299044</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Iimura</surname> <given-names>T</given-names></name><name><surname>Pourquié</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Manipulation and electroporation of the avian segmental plate and somites in vitro</article-title><source>Methods in Cell Biology</source><volume>87</volume><fpage>257</fpage><lpage>270</lpage><pub-id pub-id-type="doi">10.1016/S0091-679X(08)00213-6</pub-id><pub-id pub-id-type="pmid">18485301</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kanki</surname> <given-names>JP</given-names></name><name><surname>Ho</surname> <given-names>RK</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>The development of the posterior body in zebrafish</article-title><source>Development</source><volume>124</volume><fpage>881</fpage><lpage>893</lpage><pub-id pub-id-type="doi">10.1242/dev.124.4.881</pub-id><pub-id pub-id-type="pmid">9043069</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kawachi</surname> <given-names>T</given-names></name><name><surname>Shimokita</surname> <given-names>E</given-names></name><name><surname>Kudo</surname> <given-names>R</given-names></name><name><surname>Tadokoro</surname> <given-names>R</given-names></name><name><surname>Takahashi</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Neural-fated self-renewing cells regulated by Sox2 during secondary neurulation in chicken tail bud</article-title><source>Developmental Biology</source><volume>461</volume><fpage>160</fpage><lpage>171</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2020.02.007</pub-id><pub-id pub-id-type="pmid">32059837</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kinder</surname> <given-names>SJ</given-names></name><name><surname>Tsang</surname> <given-names>TE</given-names></name><name><surname>Quinlan</surname> <given-names>GA</given-names></name><name><surname>Hadjantonakis</surname> <given-names>AK</given-names></name><name><surname>Nagy</surname> <given-names>A</given-names></name><name><surname>Tam</surname> <given-names>PP</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>The orderly allocation of mesodermal cells to the extraembryonic structures and the anteroposterior Axis during gastrulation of the mouse embryo</article-title><source>Development</source><volume>126</volume><fpage>4691</fpage><lpage>4701</lpage><pub-id pub-id-type="doi">10.1242/dev.126.21.4691</pub-id><pub-id pub-id-type="pmid">10518487</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Klein</surname> <given-names>AM</given-names></name><name><surname>Mazutis</surname> <given-names>L</given-names></name><name><surname>Akartuna</surname> <given-names>I</given-names></name><name><surname>Tallapragada</surname> <given-names>N</given-names></name><name><surname>Veres</surname> <given-names>A</given-names></name><name><surname>Li</surname> <given-names>V</given-names></name><name><surname>Peshkin</surname> <given-names>L</given-names></name><name><surname>Weitz</surname> <given-names>DA</given-names></name><name><surname>Kirschner</surname> <given-names>MW</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells</article-title><source>Cell</source><volume>161</volume><fpage>1187</fpage><lpage>1201</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2015.04.044</pub-id><pub-id pub-id-type="pmid">26000487</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Landau</surname> <given-names>NR</given-names></name><name><surname>Littman</surname> <given-names>DR</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Packaging system for rapid production of murine leukemia virus vectors with variable tropism</article-title><source>Journal of Virology</source><volume>66</volume><fpage>5110</fpage><lpage>5113</lpage><pub-id pub-id-type="doi">10.1128/jvi.66.8.5110-5113.1992</pub-id><pub-id pub-id-type="pmid">1321291</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Le Douarin</surname> <given-names>NM</given-names></name><name><surname>Teillet</surname> <given-names>MA</given-names></name><name><surname>Catala</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Neurulation in amniote vertebrates: a novel view deduced from the use of quail-chick chimeras</article-title><source>The International Journal of Developmental Biology</source><volume>42</volume><fpage>909</fpage><lpage>916</lpage><pub-id pub-id-type="pmid">9853821</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liberzon</surname> <given-names>A</given-names></name><name><surname>Subramanian</surname> <given-names>A</given-names></name><name><surname>Pinchback</surname> <given-names>R</given-names></name><name><surname>Thorvaldsdóttir</surname> <given-names>H</given-names></name><name><surname>Tamayo</surname> <given-names>P</given-names></name><name><surname>Mesirov</surname> <given-names>JP</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Molecular signatures database (MSigDB) 3.0</article-title><source>Bioinformatics</source><volume>27</volume><fpage>1739</fpage><lpage>1740</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btr260</pub-id><pub-id pub-id-type="pmid">21546393</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Loulier</surname> <given-names>K</given-names></name><name><surname>Barry</surname> <given-names>R</given-names></name><name><surname>Mahou</surname> <given-names>P</given-names></name><name><surname>Le Franc</surname> <given-names>Y</given-names></name><name><surname>Supatto</surname> <given-names>W</given-names></name><name><surname>Matho</surname> <given-names>KS</given-names></name><name><surname>Ieng</surname> <given-names>S</given-names></name><name><surname>Fouquet</surname> <given-names>S</given-names></name><name><surname>Dupin</surname> <given-names>E</given-names></name><name><surname>Benosman</surname> <given-names>R</given-names></name><name><surname>Chédotal</surname> <given-names>A</given-names></name><name><surname>Beaurepaire</surname> <given-names>E</given-names></name><name><surname>Morin</surname> <given-names>X</given-names></name><name><surname>Livet</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Multiplex cell and lineage tracking with combinatorial labels</article-title><source>Neuron</source><volume>81</volume><fpage>505</fpage><lpage>520</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2013.12.016</pub-id><pub-id pub-id-type="pmid">24507188</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McDole</surname> <given-names>K</given-names></name><name><surname>Guignard</surname> <given-names>L</given-names></name><name><surname>Amat</surname> <given-names>F</given-names></name><name><surname>Berger</surname> <given-names>A</given-names></name><name><surname>Malandain</surname> <given-names>G</given-names></name><name><surname>Royer</surname> <given-names>LA</given-names></name><name><surname>Turaga</surname> <given-names>SC</given-names></name><name><surname>Branson</surname> <given-names>K</given-names></name><name><surname>Keller</surname> <given-names>PJ</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>In toto imaging and reconstruction of Post-Implantation mouse development at the Single-Cell level</article-title><source>Cell</source><volume>175</volume><fpage>859</fpage><lpage>876</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2018.09.031</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McGrew</surname> <given-names>MJ</given-names></name><name><surname>Sherman</surname> <given-names>A</given-names></name><name><surname>Ellard</surname> <given-names>FM</given-names></name><name><surname>Lillico</surname> <given-names>SG</given-names></name><name><surname>Gilhooley</surname> <given-names>HJ</given-names></name><name><surname>Kingsman</surname> <given-names>AJ</given-names></name><name><surname>Mitrophanous</surname> <given-names>KA</given-names></name><name><surname>Sang</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Efficient production of germline transgenic chickens using lentiviral vectors</article-title><source>EMBO Reports</source><volume>5</volume><fpage>728</fpage><lpage>733</lpage><pub-id pub-id-type="doi">10.1038/sj.embor.7400171</pub-id><pub-id pub-id-type="pmid">15192698</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McGrew</surname> <given-names>MJ</given-names></name><name><surname>Sherman</surname> <given-names>A</given-names></name><name><surname>Lillico</surname> <given-names>SG</given-names></name><name><surname>Ellard</surname> <given-names>FM</given-names></name><name><surname>Radcliffe</surname> <given-names>PA</given-names></name><name><surname>Gilhooley</surname> <given-names>HJ</given-names></name><name><surname>Mitrophanous</surname> <given-names>KA</given-names></name><name><surname>Cambray</surname> <given-names>N</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name><name><surname>Sang</surname> <given-names>H</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Localised axial progenitor cell populations in the avian tail bud are not committed to a posterior hox identity</article-title><source>Development</source><volume>135</volume><fpage>2289</fpage><lpage>2299</lpage><pub-id pub-id-type="doi">10.1242/dev.022020</pub-id><pub-id pub-id-type="pmid">18508860</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moreau</surname> <given-names>C</given-names></name><name><surname>Caldarelli</surname> <given-names>P</given-names></name><name><surname>Rocancourt</surname> <given-names>D</given-names></name><name><surname>Roussel</surname> <given-names>J</given-names></name><name><surname>Denans</surname> <given-names>N</given-names></name><name><surname>Pourquie</surname> <given-names>O</given-names></name><name><surname>Gros</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Timed collinear activation of hox genes during gastrulation controls the avian forelimb position</article-title><source>Current Biology</source><volume>29</volume><fpage>35</fpage><lpage>50</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2018.11.009</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nicolas</surname> <given-names>JF</given-names></name><name><surname>Mathis</surname> <given-names>L</given-names></name><name><surname>Bonnerot</surname> <given-names>C</given-names></name><name><surname>Saurin</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Evidence in the mouse for self-renewing stem cells in the formation of a segmented longitudinal structure, the myotome</article-title><source>Development</source><volume>122</volume><fpage>2933</fpage><lpage>2946</lpage><pub-id pub-id-type="doi">10.1242/dev.122.9.2933</pub-id><pub-id pub-id-type="pmid">8787766</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oginuma</surname> <given-names>M</given-names></name><name><surname>Moncuquet</surname> <given-names>P</given-names></name><name><surname>Xiong</surname> <given-names>F</given-names></name><name><surname>Karoly</surname> <given-names>E</given-names></name><name><surname>Chal</surname> <given-names>J</given-names></name><name><surname>Guevorkian</surname> <given-names>K</given-names></name><name><surname>Pourquié</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A gradient of glycolytic activity coordinates FGF and wnt signaling during elongation of the body Axis in amniote embryos</article-title><source>Developmental Cell</source><volume>40</volume><fpage>342</fpage><lpage>353</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2017.02.001</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Olivera-Martinez</surname> <given-names>I</given-names></name><name><surname>Harada</surname> <given-names>H</given-names></name><name><surname>Halley</surname> <given-names>PA</given-names></name><name><surname>Storey</surname> <given-names>KG</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Loss of FGF-Dependent mesoderm identity and rise of endogenous retinoid signalling determine cessation of body Axis elongation</article-title><source>PLOS Biology</source><volume>10</volume><elocation-id>e1001415</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pbio.1001415</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ory</surname> <given-names>DS</given-names></name><name><surname>Neugeboren</surname> <given-names>BA</given-names></name><name><surname>Mulligan</surname> <given-names>RC</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes</article-title><source>PNAS</source><volume>93</volume><fpage>11400</fpage><lpage>11406</lpage><pub-id pub-id-type="doi">10.1073/pnas.93.21.11400</pub-id><pub-id pub-id-type="pmid">8876147</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pasteels</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="1937">1937</year><article-title>Etudes sur la gastrulation des vertébrés méroblastiques III Oiseaux IV Conclusions générales</article-title><source>ArchBiol</source><volume>48</volume><fpage>381</fpage><lpage>488</lpage></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pijuan-Sala</surname> <given-names>B</given-names></name><name><surname>Griffiths</surname> <given-names>JA</given-names></name><name><surname>Guibentif</surname> <given-names>C</given-names></name><name><surname>Hiscock</surname> <given-names>TW</given-names></name><name><surname>Jawaid</surname> <given-names>W</given-names></name><name><surname>Calero-Nieto</surname> <given-names>FJ</given-names></name><name><surname>Mulas</surname> <given-names>C</given-names></name><name><surname>Ibarra-Soria</surname> <given-names>X</given-names></name><name><surname>Tyser</surname> <given-names>RCV</given-names></name><name><surname>Ho</surname> <given-names>DLL</given-names></name><name><surname>Reik</surname> <given-names>W</given-names></name><name><surname>Srinivas</surname> <given-names>S</given-names></name><name><surname>Simons</surname> <given-names>BD</given-names></name><name><surname>Nichols</surname> <given-names>J</given-names></name><name><surname>Marioni</surname> <given-names>JC</given-names></name><name><surname>Göttgens</surname> <given-names>B</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>A single-cell molecular map of mouse gastrulation and early organogenesis</article-title><source>Nature</source><volume>566</volume><fpage>490</fpage><lpage>495</lpage><pub-id pub-id-type="doi">10.1038/s41586-019-0933-9</pub-id><pub-id pub-id-type="pmid">30787436</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="software"><person-group person-group-type="author"><collab>Pourquie Lab</collab></person-group><year iso-8601-date="2021">2021</year><data-title>Guillot_2021</data-title><source>Software Heritage</source><version designator="swh:1:rev:3d80f422bc5a675c08546cbb10ab79211e430b1e">swh:1:rev:3d80f422bc5a675c08546cbb10ab79211e430b1e</version><ext-link ext-link-type="uri" xlink:href="https://archive.softwareheritage.org/swh:1:rev:3d80f422bc5a675c08546cbb10ab79211e430b1e">https://archive.softwareheritage.org/swh:1:rev:3d80f422bc5a675c08546cbb10ab79211e430b1e</ext-link></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Psychoyos</surname> <given-names>D</given-names></name><name><surname>Stern</surname> <given-names>CD</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Fates and migratory routes of primitive streak cells in the chick embryo</article-title><source>Development</source><volume>122</volume><fpage>1523</fpage><lpage>1534</lpage><pub-id pub-id-type="doi">10.1242/dev.122.5.1523</pub-id><pub-id pub-id-type="pmid">8625839</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Romanoff</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1960">1960</year><source>The Avian Embryo: Structural and Functional Development</source><publisher-name>The Macmillan Company</publisher-name></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sbalzarini</surname> <given-names>IF</given-names></name><name><surname>Koumoutsakos</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Feature point tracking and trajectory analysis for video imaging in cell biology</article-title><source>Journal of Structural Biology</source><volume>151</volume><fpage>182</fpage><lpage>195</lpage><pub-id pub-id-type="doi">10.1016/j.jsb.2005.06.002</pub-id><pub-id pub-id-type="pmid">16043363</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schiebinger</surname> <given-names>G</given-names></name><name><surname>Shu</surname> <given-names>J</given-names></name><name><surname>Tabaka</surname> <given-names>M</given-names></name><name><surname>Cleary</surname> <given-names>B</given-names></name><name><surname>Subramanian</surname> <given-names>V</given-names></name><name><surname>Solomon</surname> <given-names>A</given-names></name><name><surname>Gould</surname> <given-names>J</given-names></name><name><surname>Liu</surname> <given-names>S</given-names></name><name><surname>Lin</surname> <given-names>S</given-names></name><name><surname>Berube</surname> <given-names>P</given-names></name><name><surname>Lee</surname> <given-names>L</given-names></name><name><surname>Chen</surname> <given-names>J</given-names></name><name><surname>Brumbaugh</surname> <given-names>J</given-names></name><name><surname>Rigollet</surname> <given-names>P</given-names></name><name><surname>Hochedlinger</surname> <given-names>K</given-names></name><name><surname>Jaenisch</surname> <given-names>R</given-names></name><name><surname>Regev</surname> <given-names>A</given-names></name><name><surname>Lander</surname> <given-names>ES</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Optimal-Transport analysis of Single-Cell gene expression identifies developmental trajectories in reprogramming</article-title><source>Cell</source><volume>176</volume><fpage>928</fpage><lpage>943</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2019.01.006</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schoenwolf</surname> <given-names>GC</given-names></name><name><surname>Garcia-Martinez</surname> <given-names>V</given-names></name><name><surname>Dias</surname> <given-names>MS</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Mesoderm movement and fate during avian gastrulation and neurulation</article-title><source>Developmental Dynamics</source><volume>193</volume><fpage>235</fpage><lpage>248</lpage><pub-id pub-id-type="doi">10.1002/aja.1001930304</pub-id><pub-id pub-id-type="pmid">1600242</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><collab>scikit-image contributors</collab><name><surname>van der Walt</surname> <given-names>S</given-names></name><name><surname>Schönberger</surname> <given-names>JL</given-names></name><name><surname>Nunez-Iglesias</surname> <given-names>J</given-names></name><name><surname>Boulogne</surname> <given-names>F</given-names></name><name><surname>Warner</surname> <given-names>JD</given-names></name><name><surname>Yager</surname> <given-names>N</given-names></name><name><surname>Gouillart</surname> <given-names>E</given-names></name><name><surname>Yu</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>scikit-image: image processing in Python</article-title><source>PeerJ</source><volume>2</volume><elocation-id>e453</elocation-id><pub-id pub-id-type="doi">10.7717/peerj.453</pub-id><pub-id pub-id-type="pmid">25024921</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Selleck</surname> <given-names>MA</given-names></name><name><surname>Stern</surname> <given-names>CD</given-names></name></person-group><year iso-8601-date="1991">1991</year><article-title>Fate mapping and cell lineage analysis of Hensen's node in the chick embryo</article-title><source>Development</source><volume>112</volume><fpage>615</fpage><lpage>626</lpage><pub-id pub-id-type="doi">10.1242/dev.112.2.615</pub-id><pub-id pub-id-type="pmid">1794328</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname> <given-names>JL</given-names></name><name><surname>Gesteland</surname> <given-names>KM</given-names></name><name><surname>Schoenwolf</surname> <given-names>GC</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>Prospective fate map of the mouse primitive streak at 7.5 days of gestation</article-title><source>Developmental Dynamics</source><volume>201</volume><fpage>279</fpage><lpage>289</lpage><pub-id pub-id-type="doi">10.1002/aja.1002010310</pub-id><pub-id pub-id-type="pmid">7881130</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Spratt</surname> <given-names>NT</given-names></name></person-group><year iso-8601-date="1947">1947</year><article-title>Regression and shortening of the primitive streak in the explanted chick blastoderm</article-title><source>Journal of Experimental Zoology</source><volume>104</volume><fpage>69</fpage><lpage>100</lpage><pub-id pub-id-type="doi">10.1002/jez.1401040105</pub-id><pub-id pub-id-type="pmid">20285008</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Spratt</surname> <given-names>NT</given-names></name><name><surname>Condon</surname> <given-names>L</given-names></name></person-group><year iso-8601-date="1947">1947</year><article-title>Localization of prospective chordo and somite mesoderm during regression of the primitive streak in the chick blastoderm</article-title><source>The Anatomical Record</source><volume>99</volume><elocation-id>653</elocation-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stern</surname> <given-names>CD</given-names></name></person-group><year iso-8601-date="1979">1979</year><article-title>A re-examination of mitotic activity in the early chick embryo</article-title><source>Anatomy and Embryology</source><volume>156</volume><fpage>319</fpage><lpage>329</lpage><pub-id pub-id-type="doi">10.1007/BF00299630</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Stern</surname> <given-names>CD</given-names></name></person-group><year iso-8601-date="2004">2004</year><chapter-title>Gastrulation in the chick</chapter-title><person-group person-group-type="editor"><name><surname>Stern</surname> <given-names>C. D</given-names></name></person-group><source>Gastrulation: From Cells to Embryos</source><publisher-name>Cold Spring Harbor Laboratory Press</publisher-name><fpage>219</fpage><lpage>232</lpage></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Subramanian</surname> <given-names>V</given-names></name><name><surname>Meyer</surname> <given-names>BI</given-names></name><name><surname>Gruss</surname> <given-names>P</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Disruption of the murine homeobox gene Cdx1 affects axial skeletal identities by altering the mesodermal expression domains of hox genes</article-title><source>Cell</source><volume>83</volume><fpage>641</fpage><lpage>653</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(95)90104-3</pub-id><pub-id pub-id-type="pmid">7585967</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Subramanian</surname> <given-names>A</given-names></name><name><surname>Tamayo</surname> <given-names>P</given-names></name><name><surname>Mootha</surname> <given-names>VK</given-names></name><name><surname>Mukherjee</surname> <given-names>S</given-names></name><name><surname>Ebert</surname> <given-names>BL</given-names></name><name><surname>Gillette</surname> <given-names>MA</given-names></name><name><surname>Paulovich</surname> <given-names>A</given-names></name><name><surname>Pomeroy</surname> <given-names>SL</given-names></name><name><surname>Golub</surname> <given-names>TR</given-names></name><name><surname>Lander</surname> <given-names>ES</given-names></name><name><surname>Mesirov</surname> <given-names>JP</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles</article-title><source>PNAS</source><volume>102</volume><fpage>15545</fpage><lpage>15550</lpage><pub-id pub-id-type="doi">10.1073/pnas.0506580102</pub-id><pub-id pub-id-type="pmid">16199517</pub-id></element-citation></ref><ref id="bib71"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tam</surname> <given-names>PP</given-names></name><name><surname>Beddington</surname> <given-names>RS</given-names></name></person-group><year iso-8601-date="1987">1987</year><article-title>The formation of mesodermal tissues in the mouse embryo during gastrulation and early organogenesis</article-title><source>Development</source><volume>99</volume><fpage>109</fpage><lpage>126</lpage><pub-id pub-id-type="doi">10.1242/dev.99.1.109</pub-id><pub-id pub-id-type="pmid">3652985</pub-id></element-citation></ref><ref id="bib72"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Turner</surname> <given-names>DA</given-names></name><name><surname>Hayward</surname> <given-names>PC</given-names></name><name><surname>Baillie-Johnson</surname> <given-names>P</given-names></name><name><surname>Rué</surname> <given-names>P</given-names></name><name><surname>Broome</surname> <given-names>R</given-names></name><name><surname>Faunes</surname> <given-names>F</given-names></name><name><surname>Martinez Arias</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Wnt/β-catenin and FGF signalling direct the specification and maintenance of a neuromesodermal axial progenitor in ensembles of mouse embryonic stem cells</article-title><source>Development</source><volume>141</volume><fpage>4243</fpage><lpage>4253</lpage><pub-id pub-id-type="doi">10.1242/dev.112979</pub-id><pub-id pub-id-type="pmid">25371361</pub-id></element-citation></ref><ref id="bib73"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tzouanacou</surname> <given-names>E</given-names></name><name><surname>Wegener</surname> <given-names>A</given-names></name><name><surname>Wymeersch</surname> <given-names>FJ</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name><name><surname>Nicolas</surname> <given-names>JF</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Redefining the progression of lineage segregations during mammalian embryogenesis by clonal analysis</article-title><source>Developmental Cell</source><volume>17</volume><fpage>365</fpage><lpage>376</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2009.08.002</pub-id><pub-id pub-id-type="pmid">19758561</pub-id></element-citation></ref><ref id="bib74"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van den Brink</surname> <given-names>SC</given-names></name><name><surname>Alemany</surname> <given-names>A</given-names></name><name><surname>van Batenburg</surname> <given-names>V</given-names></name><name><surname>Moris</surname> <given-names>N</given-names></name><name><surname>Blotenburg</surname> <given-names>M</given-names></name><name><surname>Vivié</surname> <given-names>J</given-names></name><name><surname>Baillie-Johnson</surname> <given-names>P</given-names></name><name><surname>Nichols</surname> <given-names>J</given-names></name><name><surname>Sonnen</surname> <given-names>KF</given-names></name><name><surname>Martinez Arias</surname> <given-names>A</given-names></name><name><surname>van Oudenaarden</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Single-cell and spatial transcriptomics reveal somitogenesis in gastruloids</article-title><source>Nature</source><volume>582</volume><fpage>405</fpage><lpage>409</lpage><pub-id pub-id-type="doi">10.1038/s41586-020-2024-3</pub-id><pub-id pub-id-type="pmid">32076263</pub-id></element-citation></ref><ref id="bib75"><element-citation publication-type="software"><person-group person-group-type="author"><name><surname>Veres</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2021">2021</year><data-title>Project YAML file</data-title><source>Software Heritage</source><version designator="swh:1:rev:2ad4669b72ea6ba794f962ed95b778560bdfde4a">swh:1:rev:2ad4669b72ea6ba794f962ed95b778560bdfde4a</version><ext-link ext-link-type="uri" xlink:href="https://archive.softwareheritage.org/swh:1:rev:2ad4669b72ea6ba794f962ed95b778560bdfde4a">https://archive.softwareheritage.org/swh:1:rev:2ad4669b72ea6ba794f962ed95b778560bdfde4a</ext-link></element-citation></ref><ref id="bib76"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wetzel</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="1929">1929</year><article-title>Untersuchungen am hühnchen die entwicklung des keims während der ersten beiden bruttage</article-title><source>Wilhelm Roux' Archiv Für Entwicklungsmechanik Der Organismen</source><volume>119</volume><fpage>188</fpage><lpage>321</lpage><pub-id pub-id-type="doi">10.1007/BF02111186</pub-id></element-citation></ref><ref id="bib77"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wilson</surname> <given-names>V</given-names></name><name><surname>Olivera-Martinez</surname> <given-names>I</given-names></name><name><surname>Storey</surname> <given-names>KG</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Stem cells, signals and vertebrate body Axis extension</article-title><source>Development</source><volume>136</volume><fpage>1591</fpage><lpage>1604</lpage><pub-id pub-id-type="doi">10.1242/dev.021246</pub-id><pub-id pub-id-type="pmid">19395637</pub-id></element-citation></ref><ref id="bib78"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wilson</surname> <given-names>V</given-names></name><name><surname>Beddington</surname> <given-names>RS</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Cell fate and morphogenetic movement in the late mouse primitive streak</article-title><source>Mechanisms of Development</source><volume>55</volume><fpage>79</fpage><lpage>89</lpage><pub-id pub-id-type="doi">10.1016/0925-4773(95)00493-9</pub-id><pub-id pub-id-type="pmid">8734501</pub-id></element-citation></ref><ref id="bib79"><element-citation publication-type="preprint"><person-group person-group-type="author"><name><surname>Wood</surname> <given-names>TR</given-names></name><name><surname>Kyrsting</surname> <given-names>A</given-names></name><name><surname>Stegmaier</surname> <given-names>J</given-names></name><name><surname>Kucinski</surname> <given-names>I</given-names></name><name><surname>Kaminski</surname> <given-names>CF</given-names></name><name><surname>Mikut</surname> <given-names>R</given-names></name><name><surname>Voiculescu</surname> <given-names>O</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Neuromesodermal progenitors separate the axial stem zones while producing few single- and dual-fated descendants</article-title><source>bioRxiv</source><pub-id pub-id-type="doi">10.1101/622571</pub-id></element-citation></ref><ref id="bib80"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wymeersch</surname> <given-names>FJ</given-names></name><name><surname>Huang</surname> <given-names>Y</given-names></name><name><surname>Blin</surname> <given-names>G</given-names></name><name><surname>Cambray</surname> <given-names>N</given-names></name><name><surname>Wilkie</surname> <given-names>R</given-names></name><name><surname>Wong</surname> <given-names>FC</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Position-dependent plasticity of distinct progenitor types in the primitive streak</article-title><source>eLife</source><volume>5</volume><elocation-id>e10042</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.10042</pub-id><pub-id pub-id-type="pmid">26780186</pub-id></element-citation></ref><ref id="bib81"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wymeersch</surname> <given-names>FJ</given-names></name><name><surname>Skylaki</surname> <given-names>S</given-names></name><name><surname>Huang</surname> <given-names>Y</given-names></name><name><surname>Watson</surname> <given-names>JA</given-names></name><name><surname>Economou</surname> <given-names>C</given-names></name><name><surname>Marek-Johnston</surname> <given-names>C</given-names></name><name><surname>Tomlinson</surname> <given-names>SR</given-names></name><name><surname>Wilson</surname> <given-names>V</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Transcriptionally dynamic progenitor populations organised around a stable niche drive axial patterning</article-title><source>Development</source><volume>146</volume><elocation-id>dev168161</elocation-id><pub-id pub-id-type="doi">10.1242/dev.168161</pub-id><pub-id pub-id-type="pmid">30559277</pub-id></element-citation></ref><ref id="bib82"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname> <given-names>X</given-names></name><name><surname>Dormann</surname> <given-names>D</given-names></name><name><surname>Münsterberg</surname> <given-names>AE</given-names></name><name><surname>Weijer</surname> <given-names>CJ</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Cell movement patterns during gastrulation in the chick are controlled by positive and negative chemotaxis mediated by FGF4 and FGF8</article-title><source>Developmental Cell</source><volume>3</volume><fpage>425</fpage><lpage>437</lpage><pub-id pub-id-type="doi">10.1016/S1534-5807(02)00256-3</pub-id><pub-id pub-id-type="pmid">12361604</pub-id></element-citation></ref><ref id="bib83"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zamir</surname> <given-names>EA</given-names></name><name><surname>Czirók</surname> <given-names>A</given-names></name><name><surname>Cui</surname> <given-names>C</given-names></name><name><surname>Little</surname> <given-names>CD</given-names></name><name><surname>Rongish</surname> <given-names>BJ</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Mesodermal cell displacements during avian gastrulation are due to both individual cell-autonomous and convective tissue movements</article-title><source>PNAS</source><volume>103</volume><fpage>19806</fpage><lpage>19811</lpage><pub-id pub-id-type="doi">10.1073/pnas.0606100103</pub-id><pub-id pub-id-type="pmid">17179040</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.64819.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Bronner</surname><given-names>Marianne E</given-names></name><role>Reviewing Editor</role><aff><institution>California Institute of Technology</institution><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Wilson</surname><given-names>Valerie</given-names> </name><role>Reviewer</role><aff><institution>University of Edinburgh</institution><country>United Kingdom</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>This exciting paper characterizes the cellular dynamics of a population of stem cells, recently identified, called neuro-mesodermal progenitors in the chick embryo. By conducting prospective lineage trace and transcriptomic analysis, they identify dynamic cell behaviors that explain previous 'snapshot' studies showing that neuro-mesodermal progenitors contribute over long axial distances. This manuscript makes an important contribution to the understanding of how neuro-mesodermal progenitors contribute to vertebrate axial elongation and provides novel insights into axial morphogenesis.</p><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;Dynamics of primitive streak regression controls the fate of neuro-mesodermal progenitor cells in the chicken embryo&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Marianne Bronner as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Valerie Wilson (Reviewer #2).</p><p>The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.</p><p>Essential Revisions</p><p>1. Many of the concerns can be addressed by text changes and minor changes to the existing data presentation as detailed in the full reviews.</p><p>2. The main problems are with the bioinformatic analysis, where both reviewers highlight issues where the analysis is too superficial and needs further work.</p><p>3. Additional imaging quantification is required to support their findings.</p><p><italic>Reviewer #1:</italic></p><p>The paper entitled &quot;Dynamics of primitive streak regression controls the fate of neuro-mesodermal progenitor cells in the chicken embryo&quot; from Guillot and colleagues aims to characterize in the context of developing chick embryos the cellular dynamics of a population of stem cells, recently identified, called Neuro-Mesodermal Progenitors (NMPs). The authors provide several lines of evidence supporting their claims that overall look interesting, however, additional imaging quantification and more comprehensive analysis of their transcriptomic datasets are required to support their findings.</p><p>Specifically, the authors generated an important scRNA-seq dataset of micro-dissect regions of the chick embryos across developmental time points from stage 5 to 35-somites. Despite the dataset represents a crucial part of the paper supporting the authors' findings of this NMP population, the analysis is not deep enough and does not report several controls and markers. In figure 2 the authors should show heatmap of the marker genes used for classification. Louvain markers genes that define each cluster should be showed in a supplementary not as an unreadable table, instead, a dotplot or heatmap would be better. It is unclear whether Louvain clustering has been used to label the data, did the authors find that each Louvain cluster correspond to a defined cell identity? The pseudotime analysis is incomplete and superficial. Diffusion pseudotime strongly depends on the root cell selection. RNA velocity analysis and/or another trajectory analysis are required to better show lineage trajectory. Figure 4 L-K, the pesudotime time is not progressively ordered and it would be advisable to perform an alternative analysis to visualize lineage trajectory. Furthermore, gene expression trends should be identified and further discussed over those trajectories. The supporting information about the classification analysis using the mouse dataset is incomplete.</p><p>– In figure 1 the authors show <italic>SOX2</italic>-T double staining. Panels A-B-C represent the first evidence of <italic>SOX2</italic>-T co-expression in stage 5 chick embryos. The merged image is not provided together with the single panels A-B and only appear in panel G of the same figure, this is confusing. Panel B has two scale bars. The authors tried to show <italic>SOX2</italic>-T co-expression by thresholding and masking <italic>SOX2</italic>-T signals in panel C and Suppl. Figure 1. The authors should clearly explain how this thresholding is obtained. Is this manually set? Is this set based on global or local signal intensity distribution? Otsu thresholding? In order to avoid artifacts due to thresholding, the authors should also display a scatter plot showing nuclear intensity values for <italic>SOX2</italic>-T. FACS analysis and quantitative assessments of the percentage of cells would further strengthen the authors' claim.</p><p>– The authors should validate <italic>SOX2</italic>-T expression in quail embryos</p><p>– The authors should better discuss the mechanical forces that are implicated in epithelium to mesenchyme, and in the posterior gradient of proliferation that counteracts ingression in the anterior PS epiblast. Is this affecting/related to WNT or hyppo pathway?</p><p>– Can the authors speculate about the conservation of this phenomena in the human context? What is the evidence that this conserved in human?</p><p>– The authors speculate about in-vitro generated NMPs, did they try transplantation of in-vitro generate cells? Can they compare the transcriptomic signature of the human in-vitro generated NMP with the chick counterpart?</p><p>– The tables in Suppl. Figure 4 should be a supplementary table.</p><p>– In Suppl.Fig5D there is not scale bar to assess classification efficacy and material and methods do not describe how this analysis has been performed.</p><p>– The authors should substantially revise scRNA-seq data.</p><p><italic>Reviewer #2 :</italic></p><p>In this manuscript, the authors aimed firstly to prospectively identify cells with dual neural and mesodermal fate. Previous studies in mouse had determined that such dual-fated cells existed, and had narrowed down their location to subregions of the axial progenitor zone co-expressing <italic>Sox2</italic> and T. However, these studies had not shown that individual cells in the <italic>Sox2</italic>/T positive region were dual-fated. The authors use three approaches: live imaging, and two prospective clonal labelling studies of the <italic>Sox2</italic>/T positive region to show, for the first time, that indeed this region harbours dual-fated cells. This is an important missing piece of the current volume of work on NMPs. Whilst the rationale for the experiments are clear, it might be better to present this work more in the context of previous studies. It seems a little harsh to dismiss population fate mapping studies as 'failing to identify' NMPs rather than complementing the clonal analysis by identifying regions potentially harbouring NMPs. In addition, there are interesting parallels with the clonal analysis carried out in mouse. For example, not all NM clones contribute to the tail bud; the observation in live imaging studies that NMPs first contribute to the neural tube and later to mesoderm is also similar to the observations from mouse retrospective clonal analysis; this could perhaps be discussed more fully.</p><p>Next, the authors carry out single cell RNA-seq analyses of three stages of chick axial elongation, and compare these with existing datasets in mouse, adding data from a later stage of mouse embryos. This aspect of the study has again confirmed and extended previous studies, showing both similarities and differences between chick and mouse NMPs. Trajectory analysis suggests progression of NMPs towards neural and mesodermal lineages in both chick and mouse. This is a valuable resource for the community. However once again it would be good to present this aspect of the work in the context of previous studies showing maturation of NMPs over time and an increased mesenchymal transcriptomic signature of NMPs at late compared to early timepoints.</p><p>Finally, the authors carry out dynamic cell tracking and show that NMPs ingress later, and proliferate faster than more posteriorly-placed cells in the primitive streak, leading to exhaustion of the posterior populations and long-term retention of the NMP population. This part of the study is well-executed and contains important new information that advances our understanding of both NMPs and axial progenitors as a whole.</p><p>Suggestions for strengthening the science</p><p>1. The results presented in Figure 1 are a little difficult to interpret as there is some background fluorescence in <italic>Sox2</italic> and Msgn1 staining. Perhaps the thresholding strategy could be described in the supplementary data to support statements about <italic>Sox2</italic> positive time of emergence and the location of Msgn1 positive/<italic>Sox2</italic> negative axial levels. It would be good to cite the source of the fate mapping information locating NMP/PMP/LPP/EMP in Figure 1D- is it this study or another? The section at level 5 in Figure 1E is named LPP in 1E but corresponds to a region marked 'EMP' in Fig1D. Together these two factors make it hard for the reader to judge where the posterior limit of <italic>Sox2</italic>/T positive cells is, relative to Msgn1 and to regions of differential fate. Also, the text (p5) says there are 'low levels [of TBXT] in the node' but the expected high levels in the node/ emerging notochord are visible in Fig1E sections 1-2.</p><p>2. In Figure 2, the clustering shows two datasets, (which are presumably batches?) of cells for each stage in chick (st5 1 etc). However, the colour coding does not allow the reader to distinguish these. Do the batches occupy different positions in the UMAP plot? How was batch correction done?</p><p>3. The cells annotated as NMPs in chick show elevated expression of Hes5 (6-somite stage) and Dll1 (combined dataset) relative to the cells annotated as PSM or neural (Figure 3, S4,5). Also, some of the NMP signature markers are expressed in a higher percentage of the NMP population in mouse compared to chick. This suggests that the cluster annotated as NMPs in chick also includes the midline primitive streak. The absence of <italic>Sox2</italic> from this dataset is not, in my opinion, especially troublesome as it is expressed at low levels. However, it means that the chick single cell transcriptomes cannot be independently verified as NMPs and distinguished from midline streak cells. Perhaps the mouse data can help here. Instead of using the chick as a starting point to define the NMP phenotype, if the authors can work back from cells dissected from the <italic>Sox2</italic>/T positive regions (ie from Dias et al., <italic>eLife</italic> 2020 and Gouti et al., Dev Cell 2017), as well as the NMP annotations in the mouse atlas data used here (Pijuan-Sala et al), how well do the chick cells correspond to the mouse ones? If a narrower definition of NMPs is used in chick, does this remove any of the variation seen between mouse and chick?</p><p>4. The mouse NMP trajectory analysis (Figure 3M) shows two arrows. What do they represent? if just pseudotime, it looks more like a radiation in all directions from the centre. Interestingly this would suggest NMPs also progress (upwards on the Y axis) as NMPs in pseudotime. Is this effect seen in the chick NMPs?</p><p>4. The annotations of chick versus mouse early and late clusters are confusing, In chick, there are two early clusters (coloured the same) annotated nmp-1 and nmp-2, but these do not correspond to the two earlier stages. What do they correspond to? Some discussion of the heterogeneity would be appropriate- or possibly a reanalysis of the NMP annotation in point 3 above may highlight that one of these clusters is less NMP-like. In the mouse, there is one early subcluster and two late ones. These are also annotated nmp-1 and nmp-2. A different nomenclature should be used to highlight that they are not the same as the chick ones. Unlike the chick clusters, these seem to correspond to different stages of development.</p><p>Suggestions for improving the manuscript</p><p>1. The statements that no previous studies have prospectively identified neuromesodermal-fated cells (abstract, introduction p4, discussion p10) should be modified. Forlani et al., Development 2003 10.1242/dev.00573 and Wood et al. BioRXiv https://doi.org/10.1101/622571 show dual-fated cells in mouse and chick. I think that it would be fairer in the context of previous studies to cite the population or oligoclonal studies of Iimura and Pourquié, (2006) 10.1073/pnas.0610997104, Cambray and Wilson, (2007) 10.1242/dev.02877 and Brown and Storey, (2000) 10.1016/s0960-9822(00)00601-1 as showing potential locations for cells of dual neuromesodermal fate.</p><p>2. The words 'bipotent/monopotent' used throughout the manuscript is not appropriate for the studies here, which are demonstrating fate and not potency. I would suggest 'dual fate'.</p><p>3. NMPs are presented here as 'stem cells' when the transcriptome analysis shows they mature with time. It would be good to define exactly in what sense the term is being used- it is valid since the manuscript describes an enduring progenitor producing neural and mesodermal tissue but should be used with care.</p><p>4. p5. 'We identified 7 clones containing cells expressing the same barcodes' – could this text be modified to clarify, e.g. 'expressing unique (or clone-specific) barcodes'?</p><p>5. p7 para 2 'the NMP lineage' should be changed to something not implying lineage, e.g. 'cluster'</p><p>6. Figure S7 is entitled 'NMP early and late clusters are not due to different Hox genes expression'- since the authors show differential Hox gene expression, this statement should be moderated. The text describing this observation also suggests that the genes that are differentially expressed early and late in mouse and chick are different. However, many of the genes upregulated in the later chick stage are also upregulated in mouse, eg Wnt5a, Greb1, Fgf8, Figf18, Cyp26a1 (see Wymeersch et al., 10.1242/dev.168161). It would be good to comment on this.</p><p>7. Can the authors consider whether 'persistence' of cell tracks is the optimal term? It could suggest persistence of movement rather than just their continued observation over time. Is 'longevity' a possible alternative?</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.64819.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential Revisions</p><p>1. Many of the concerns can be addressed by text changes and minor changes to the existing data presentation as detailed in the full reviews.</p><p>2. The main problems are with the bioinformatic analysis, where both reviewers highlight issues where the analysis is too superficial and needs further work.</p><p>3. Additional imaging quantification is required to support their findings.</p></disp-quote><p>We thank the editor for the suggestions of improvement and have now thoroughly revised the text including new analyses as suggested. These are described below.</p><disp-quote content-type="editor-comment"><p>Reviewer #1:</p><p>The paper entitled &quot;Dynamics of primitive streak regression controls the fate of neuro-mesodermal progenitor cells in the chicken embryo&quot; from Guillot and colleagues aims to characterize in the context of developing chick embryos the cellular dynamics of a population of stem cells, recently identified, called Neuro-Mesodermal Progenitors (NMPs). The authors provide several lines of evidence supporting their claims that overall look interesting, however, additional imaging quantification and more comprehensive analysis of their transcriptomic datasets are required to support their findings.</p><p>Specifically, the authors generated an important scRNA-seq dataset of micro-dissect regions of the chick embryos across developmental time points from stage 5 to 35-somites. Despite the dataset represents a crucial part of the paper supporting the authors' findings of this NMP population, the analysis is not deep enough and does not report several controls and markers.</p></disp-quote><p>We agree with the reviewer and in the revised version, we now present a thoroughly revised analysis of the single cell RNAseq dataset as described below.</p><disp-quote content-type="editor-comment"><p>In figure 2 the authors should show heatmap of the marker genes used for classification. Louvain markers genes that define each cluster should be showed in a supplementary not as an unreadable table, instead, a dotplot or heatmap would be better. It is unclear whether Louvain clustering has been used to label the data, did the authors find that each Louvain cluster correspond to a defined cell identity?</p></disp-quote><p>We have now redone the entire analysis using Leiden clustering algorithm which performed better than Louvain at identifying tissue-specific clusters. As requested, we now present heatmaps showing the top 10 genes differentially expressed for each cluster in Figure 3 – Supplementary Figure 1 (for chicken) and in Figure 3 – Supplementary Figure 3 (for mouse). We have moved the gene tables originally presented in supplementary figures to a Supplementary File 2 which also includes dot plots showing the expression of genes used for identification of the clusters. We also discuss more in detail how the different clusters were identified at each developmental age in the revised text.</p><disp-quote content-type="editor-comment"><p>The pseudotime analysis is incomplete and superficial. Diffusion pseudotime strongly depends on the root cell selection. RNA velocity analysis and/or another trajectory analysis are required to better show lineage trajectory. Figure 4 L-K, the pesudotime time is not progressively ordered and it would be advisable to perform an alternative analysis to visualize lineage trajectory. Furthermore, gene expression trends should be identified and further discussed over those trajectories. The supporting information about the classification analysis using the mouse dataset is incomplete.</p></disp-quote><p>We now present a novel analysis of the developmental trajectories using the Waddington-OT pipeline developed by the Broad Institute (Schiebieger et al., 2019). This analysis, which is based on optimal transport, shows that the cells we identify as NMPs are indeed the most likely ancestors of both the Neural and PSM cells in the datasets. By analyzing the transport maps, this allows us to show the self-renewal of the NMP cell population and its maturation during axis elongation. We also use this tool to identify transcription factors associated with these different fates. We have added novel figures (Figure 4 and Figure 4- Supplementary Figure 1) to the revised text to describe these new results.</p><p>In addition, we have performed a Gene Set Enrichment Analysis of the early and late NMP clusters which shows an enrichment in genes associated to epithelium to mesenchyme transition in the late clusters in both species (shown in the new Figure 5). We have also completed the supporting information on the mouse dataset.</p><disp-quote content-type="editor-comment"><p>– In figure 1 the authors show SOX2-T double staining. Panels A-B-C represent the first evidence of SOX2-T co-expression in stage 5 chick embryos. The merged image is not provided together with the single panels A-B and only appear in panel G of the same figure, this is confusing.</p></disp-quote><p>In the revised version, we now show the merge of <italic>SOX2</italic> and T expression in Figure 1C instead of showing only the double-positive cells as in the previous version. We also show a blow-up of the sections of the NMP and PMP regions in Figure E’-F’ and E’’-F’’ to better illustrate the difference between these two regions which both contribute to the paraxial mesoderm as shown by the MSGN1 antibody labeling in the ingressed mesoderm.</p><disp-quote content-type="editor-comment"><p>Panel B has two scale bars.</p></disp-quote><p>This was corrected.</p><disp-quote content-type="editor-comment"><p>The authors tried to show SOX2-T co-expression by thresholding and masking SOX2-T signals in panel C and Suppl. Figure 1. The authors should clearly explain how this thresholding is obtained. Is this manually set? Is this set based on global or local signal intensity distribution? Otsu thresholding?</p></disp-quote><p>Thresholding of the <italic>SOX2</italic>/T cells shown in Figure 1C and Figure 1 – Supplementary Figure 1G was done manually with image J. We have now replaced the subtracted image originally shown in Figure 1C by an image showing the merge between T and <italic>SOX2</italic> staining which clearly identifies the double positive cells without thresholding. We have nevertheless left the subtracted image with the manual thresholding performed with image J in Figure 1 – Supplementary Figure 1G in the revised version. We also explained the thresholding in the legend of this figure and material and method section.</p><disp-quote content-type="editor-comment"><p>In order to avoid artifacts due to thresholding, the authors should also display a scatter plot showing nuclear intensity values for SOX2-T.</p></disp-quote><p>Since all the thresholding was performed manually, we could verify that virtually all cells in the images (shown in Figure 1- Supplementary Figure 1G) were indeed expressing both signals.</p><disp-quote content-type="editor-comment"><p>FACS analysis and quantitative assessments of the percentage of cells would further strengthen the authors' claim.</p></disp-quote><p>While this is an interesting suggestion, this experiment would be very challenging as the number of <italic>SOX2</italic>/T double positive cells is expected to be a few hundreds at the stages discussed. Thus, getting quantitative data on such a low number might be difficult. Moreover, since both markers are nuclear, this would require sorting after fixation and labeling of the cells which is much trickier than sorting for live cells labeled with a membrane marker. In addition, <italic>SOX2</italic> and T are expressed in overlapping opposite antero-posterior gradients in epiblast cells with significant co-expression in the epiblast adjacent to the anterior PS. The positioning of the gates for FACS analysis would be somehow arbitrary as neither marker is truly specific for the NMP population.</p><disp-quote content-type="editor-comment"><p>– The authors should validate SOX2-T expression in quail embryos</p></disp-quote><p>Recent work from the Benazeraf laboratory has examined the distribution of T-<italic>SOX2</italic> cells in the quail embryo and their distribution is similar to that we observe in the chicken embryo (Romanos et al., bioRxiv; doi: https://doi.org/10.1101/2020.11.18.388611).</p><disp-quote content-type="editor-comment"><p>– The authors should better discuss the mechanical forces that are implicated in epithelium to mesenchyme, and in the posterior gradient of proliferation that counteracts ingression in the anterior PS epiblast. Is this affecting/related to WNT or hyppo pathway?</p></disp-quote><p>While this is indeed an interesting question, our paper is mostly focused on the lineage and fate of NMP cells in the chicken embryo. We have no experimental data addressing the mechanical properties of ingressing cells and we are not aware of such data available in the literature for the stages considered in our study. Thus, we feel this discussion is beyond the scope of the paper.</p><disp-quote content-type="editor-comment"><p>– Can the authors speculate about the conservation of this phenomena in the human context? What is the evidence that this conserved in human?</p></disp-quote><p>Several groups including ours have reported that <italic>SOX2</italic>/T cells showing a similar identity to NMPs can be obtained from human pluripotent cells (ES/iPS) in vitro after Wnt activation. We have reanalyzed our human dataset from <italic>SOX2</italic>/T cells differentiated in vitro from iPS cells (day1 of Diaz-Cuadros et al., 2020) and observed that the list of human <italic>SOX2</italic>/T cells signature genes was much more similar to that of chicken and mouse when looking at the genes differentially expressed with the undifferentiated iPS only rather than with all the clusters as performed in the original publication. This revised list of human NMP signature genes is shown in Supplementary File 4 together with the genes conserved with chicken and mouse NMPs. We find a significant degree of conservation among the signature NMP genes in the three species and discuss these comparisons in a new paragraph in the revised text.</p><disp-quote content-type="editor-comment"><p>– The authors speculate about in-vitro generated NMPs, did they try transplantation of in-vitro generate cells? Can they compare the transcriptomic signature of the human in-vitro generated NMP with the chick counterpart?</p></disp-quote><p>We have not tried such transplantations of in vitro derived NMP cells and we believe this is beyond the scope of this work. Such work is however described in the following paper: “The Chick Caudolateral Epiblast Acts as a Permissive Niche for Generating Neuromesodermal Progenitor Behaviours Peter Baillie-Johnson, Octavian Voiculescu, Penny Hayward, and Benjamin Steventon”.</p><p>As suggested and discussed above, we have now compared the transcriptomic signature of cells of the chicken and mouse NMP clusters with that of the human NMP-like cells. This is now shown in Supplementary File 4.</p><disp-quote content-type="editor-comment"><p>– The tables in Suppl. Figure 4 should be a supplementary table.</p></disp-quote><p>We have moved the gene tables shown in supplementary figures to the Supplementary File 2 in the revised MS.</p><disp-quote content-type="editor-comment"><p>– In Suppl. Fig5D there is not scale bar to assess classification efficacy and material and methods do not describe how this analysis has been performed.</p></disp-quote><p>We apologize for this mistake, and we have now added it to the figure. The details of the analysis is presented in the material and method section: “Machine-learning classification of cell states”. The classification of the different cellular states was performed using an LDA classifier as described in Diaz-Cuadros et al., in vitro characterization of the human segmentation clock. Nature 580, 113-118, doi:10.1038/s41586-019-1885-9 (2020), which we now cite in the material and methods section.</p><disp-quote content-type="editor-comment"><p>– The authors should substantially revise scRNA-seq data.</p></disp-quote><p>As described above, we now provide a much deeper analysis of our single cell RNAseq data in the revised MS. We improved our analysis by changing our clustering method to Leiden that allows better identification of cell identities in the data. All the figures were remade with Leiden clustering.</p><p>We also provide an extended discussion of the datasets and the genes that were used to identify the various clusters in the revised text, as well as heat maps and dotplots of the genes used to identify the clusters in Figure 3 – Supplementary Figure 1 (chicken) and 6 (mouse) and in Supplementary File 2. In Figure 3F-M, we now show Diffmap plots to better illustrate the differentiation trajectories of the NMP cells.</p><p>We also performed a new analysis of the data using the Waddington-OT pipeline (Schiebieger et al., 2019). Unlike pseudotime, this analysis does not impose to select a root for the trajectories and considers the actual developmental time. This analysis shows that the NMP cells are the most probable common ancestors to the PSM and Neural cells in both chicken and mouse datasets. It also identifies a developmental trajectory in the NMP lineage which corresponds to their maturation during axis elongation. Using transport matrices, we could also quantify the contribution of NMPs to PSM, NT and NMPs and found equivalent contributions to these three lineages. This analysis therefore strongly supports the self-renewing properties of these cells. The WOT analysis also identified a number of interesting transcription factors associated with the NMP, PSM and neural fates. Expression patterns of a selection of transcription factors enriched in the NMPs is presented in Figure 4 – Supplementary Figure 1 and the extensive lists are provided in Supplementary File 3. We now also provide the expression levels of some genes involved in the NMP differentiation toward the mesodermal and neural cellular states in the new Figure 4 and in Figure 4 – Supplementary Figure 1. The results of the WOT analysis are described in a new paragraph in the revised text and shown as a new Figure 4.</p><p>We have also performed a Gene set enrichment analysis (GSEA) to compare the NMP early and late clusters identified using Leiden algorithm. This revealed an enrichment in genes associated to epithelium to mesenchyme transition in late vs early NMP clusters in both species. This analysis is now shown in Figure 5.</p><p>These new analyses led to new figures 3, 4 and 5 and Supplementary Figures 4, 5, 6, 7, 8 and 9 as well as new Supplementary Files 2, 3, 4 and 5.</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>In this manuscript, the authors aimed firstly to prospectively identify cells with dual neural and mesodermal fate. Previous studies in mouse had determined that such dual-fated cells existed, and had narrowed down their location to subregions of the axial progenitor zone co-expressing Sox2 and T. However, these studies had not shown that individual cells in the Sox2/T positive region were dual-fated. The authors use three approaches: live imaging, and two prospective clonal labelling studies of the Sox2/T positive region to show, for the first time, that indeed this region harbours dual-fated cells. This is an important missing piece of the current volume of work on NMPs. Whilst the rationale for the experiments are clear, it might be better to present this work more in the context of previous studies. It seems a little harsh to dismiss population fate mapping studies as 'failing to identify' NMPs rather than complementing the clonal analysis by identifying regions potentially harbouring NMPs. In addition, there are interesting parallels with the clonal analysis carried out in mouse. For example, not all NM clones contribute to the tail bud; the observation in live imaging studies that NMPs first contribute to the neural tube and later to mesoderm is also similar to the observations from mouse retrospective clonal analysis; this could perhaps be discussed more fully.</p></disp-quote><p>We agree and have revised the text along the lines suggested by the reviewer.</p><disp-quote content-type="editor-comment"><p>Next, the authors carry out single cell RNA-seq analyses of three stages of chick axial elongation, and compare these with existing datasets in mouse, adding data from a later stage of mouse embryos. This aspect of the study has again confirmed and extended previous studies, showing both similarities and differences between chick and mouse NMPs. Trajectory analysis suggests progression of NMPs towards neural and mesodermal lineages in both chick and mouse. This is a valuable resource for the community. However once again it would be good to present this aspect of the work in the context of previous studies showing maturation of NMPs over time and an increased mesenchymal transcriptomic signature of NMPs at late compared to early timepoints.</p></disp-quote><p>We agree and have now extended our analysis and compared the identified transcriptomic signature of the NMP clusters of the chicken and mouse datasets to a set of published NMP transcriptomic signatures from mouse (Gouti et al., 2017, Dias et al., 2020, Guibentif et al., 2021; Diaz-Cuadros et al., 2020) and human (in vitro derived) NMPs (Diaz-Cuadros et al., 2020). We also compare the signature of the early and late clusters identified in our analysis to early and late NMP signatures described by Gouti et al., (2017) and E8.0 NMPs from Dias et al., 2020. We also separately compare the signature of the early and late NMPs to the genes up and down regulated in small dissected regions of the NMP from the Node streak border (NSB, E8.5) and the Chordo neural hinge (CNH, E10.5) in mouse from Wymeersch et al., 2019. We added a paragraph describing these comparisons in the revised text and present these data in Supplementary Files 4 and 5.</p><disp-quote content-type="editor-comment"><p>Finally, the authors carry out dynamic cell tracking and show that NMPs ingress later, and proliferate faster than more posteriorly-placed cells in the primitive streak, leading to exhaustion of the posterior populations and long-term retention of the NMP population. This part of the study is well-executed and contains important new information that advances our understanding of both NMPs and axial progenitors as a whole.</p><p>Suggestions for strengthening the science</p><p>1. The results presented in Figure 1 are a little difficult to interpret as there is some background fluorescence in Sox2 and Msgn1 staining. Perhaps the thresholding strategy could be described in the supplementary data to support statements about Sox2 positive time of emergence and the location of Msgn1 positive/Sox2 negative axial levels.</p></disp-quote><p>We now provide higher magnification images of the T<sup>+</sup>/<italic>sox2</italic><sup>+</sup> and T<sup>+</sup>/<italic>SOX2</italic><sup>-</sup> and their corresponding MSGN1 regions as Figure 1 E’-F’ and E’’-F’’. Without thresholding, the images shown clearly illustrates the difference between the two paraxial mesoderm-producing regions which both exhibit MSGN1 positive nuclei in the mesodermal layer while <italic>SOX2</italic> is only seen in the epiblast of the anterior (level 3, NMP) and not in the posterior (level 4, PMP) regions. This shows that the paraxial mesoderm progenitor domain can be subdivided in 2 progenitor domains both producing paraxial mesodermal cells (MSGN1+).</p><disp-quote content-type="editor-comment"><p>It would be good to cite the source of the fate mapping information locating NMP/PMP/LPP/EMP in Figure 1D- is it this study or another?</p></disp-quote><p>The fate mapping used was from Psychoyos and Stern, (Development, 1996) who generated a very detailed fate map of the PS of the chicken embryo encompassing the stages described here. We have added this information to the revised text.</p><disp-quote content-type="editor-comment"><p>The section at level 5 in Figure 1E is named LPP in 1E but corresponds to a region marked 'EMP' in Fig1D. Together these two factors make it hard for the reader to judge where the posterior limit of Sox2/T positive cells is, relative to Msgn1 and to regions of differential fate.</p></disp-quote><p>We apologize for the oversight. This study is focused on the fate of paraxial mesoderm and we made no attempt to distinguish between the lateral plate and extraembryonic mesoderm territories of the posterior primitive streak. We have now relabeled the posterior primitive streak territory as LPP/EMP on Figure 1E. This corresponds to the territory devoid of MSGN1 expression.</p><disp-quote content-type="editor-comment"><p>Also, as a minor point, the text (p5) says there are 'low levels [of TBXT] in the node' but the expected high levels in the node/ emerging notochord are visible in Fig1E sections 1-2.</p></disp-quote><p>It is indeed right that the node shows high TBXT expression but the level of TBXT in the epiblast around the Node is low as seen in our quantifications and transverse sections in Fig1E sections 1-2. We meant 'low levels [of TBXT] in epiblast around the node’ and have changed the text accordingly.</p><disp-quote content-type="editor-comment"><p>2. In Figure 2, the clustering shows two datasets, (which are presumably batches?) of cells for each stage in chick (st5 1 etc). However, the colour coding does not allow the reader to distinguish these. Do the batches occupy different positions in the UMAP plot? How was batch correction done?</p></disp-quote><p>The 2 datasets are technical replicates. We agree that the color coding is not properly showing the heterogeneity of the data and we now provide a Figure 3F and in Figure 3 – Supplementary Figure 1 with a new set of colors. As seen in the new figures, the 2 datasets do not occupy different parts of the UMAP. In most cases, we used the module Bbknn for batch correction, but for the WOT analysis, we used the Combat module. We have added this information to the M&amp;Ms section.</p><disp-quote content-type="editor-comment"><p>3. The cells annotated as NMPs in chick show elevated expression of Hes5 (6-somite stage) and Dll1 (combined dataset) relative to the cells annotated as PSM or neural (Figure 3, S4,5). Also, some of the NMP signature markers are expressed in a higher percentage of the NMP population in mouse compared to chick. This suggests that the cluster annotated as NMPs in chick also includes the midline primitive streak. The absence of Sox2 from this dataset is not, in my opinion, especially troublesome as it is expressed at low levels. However, it means that the chick single cell transcriptomes cannot be independently verified as NMPs and distinguished from midline streak cells.</p></disp-quote><p>This is correct, as in our immunostaining we see that T-<italic>SOX2</italic> double positive cells are also present in the anterior primitive streak (in the groove) at stage 5HH (see Figure 1C and 1E level 3). This suggests that the distribution of NMPs might be slightly different in chicken compared to mouse embryos. This is supported by the observation that we cannot identify any PS specific cluster, although we cannot rule out that this due to the limited resolution of the dataset.</p><disp-quote content-type="editor-comment"><p>Perhaps the mouse data can help here. Instead of using the chick as a starting point to define the NMP phenotype, if the authors can work back from cells dissected from the Sox2/T positive regions (ie from Dias et al., eLife 2020 and Gouti et al., Dev Cell 2017), as well as the NMP annotations in the mouse atlas data used here (Pijuan-Sala et al.,), how well do the chick cells correspond to the mouse ones? If a narrower definition of NMPs is used in chick, does this remove any of the variation seen between mouse and chick?</p></disp-quote><p>We appreciate the suggestion which in principle could be a good way to present the data. The problem we are facing here, which we did not sufficiently highlight in the previous version of the paper, is that chicken cells were sequenced with Indrops, which provides limited depth, whereas mouse cells were sequenced with SMARTseq (Gouti et al.,) or 10x (Pijuan-Sala, Dias et al.,) which allows for more sequencing depth. This is probably the main reason why we do not identify <italic>Sox2</italic> or Nkx1.2 in our chicken dataset. This is also why it is difficult to identify the chicken NMPs based on the mouse NMP signature genes. However, the most stringent definition of NMPs is not based on expression of marker genes (in fact, we don’t even know whether <italic>SOX2</italic>/T cells are NMPs) but is based on their ability to give rise to both neural tube and PSM. This is the criterion we use to define NMPs in this analysis. Our new WOT analysis strongly argues that in both chicken and mouse, cells of the identified NMP clusters are ancestors to the PSM and Neural Tube.</p><p>We now present a comparison between the NMP signature we identified in chicken and mouse embryos and lists of genes identified as NMP signatures in mouse embryos and human NMP-like cells differentiated in vitro in the following papers: Gouti et al., Dev Cell 2017; Wymeersch et al., 2019; Dias et al., <italic>eLife</italic> 2020; Guibentif et al., Dev Cell, 2021, Diaz-Cuadros et al., Nature 2020. This analysis shows significant conservation of genes between these different lists. While only 38 genes are conserved in 4 or 5 of the 6 datasets compared. The most striking characteristic of this list is the strong enrichment in genes of the Wnt pathway, consistent with the requirement for Wnt signaling for NMP differentiation in vivo and in vitro. We also find an enrichment of genes involved in glycolysis in line with recent papers describing higher glycolytic activity required for Wnt signaling in the tail bud (Oginuma et al., 2017, 2020; Bulusu et al., 2017). This new analysis is detailed in a new paragraph in the revised text and described in Supplementary File 4 and 5.</p><disp-quote content-type="editor-comment"><p>4. The mouse NMP trajectory analysis (Figure 3M) shows two arrows. What do they represent? if just pseudotime, it looks more like a radiation in all directions from the centre. Interestingly this would suggest NMPs also progress (upwards on the Y axis) as NMPs in pseudotime. Is this effect seen in the chick NMPs?</p></disp-quote><p>As suggested, we now present diffusion maps plots in Figure 3 that better show the pseudotime trajectories toward the neural and mesodermal fates in chicken and mouse cells. Indeed, NMP also exhibit changes in pseudotime that parallel developmental time in both species although this is more subtle in chick than in mouse probably because of sequencing depth. We also performed a new analysis of the mouse and chicken datasets using the Waddington OT pipeline (Schiebieger et al., 2019). This analysis shows that the NMPs are the most probable ancestors of the PSM and neural cells. It also identifies a trajectory in the NMP cluster (confirming the trajectories observed in pseudotime) correlating with the age of the samples, suggesting maturation of these cells. We now describe these new analyses in detail and have added a new figure 4 to present this data.</p><disp-quote content-type="editor-comment"><p>4. The annotations of chick versus mouse early and late clusters are confusing, In chick, there are two early clusters (coloured the same) annotated nmp-1 and nmp-2, but these do not correspond to the two earlier stages. What do they correspond to? Some discussion of the heterogeneity would be appropriate- or possibly a reanalysis of the NMP annotation in point 3 above may highlight that one of these clusters is less NMP-like. In the mouse, there is one early subcluster and two late ones. These are also annotated nmp-1 and nmp-2. A different nomenclature should be used to highlight that they are not the same as the chick ones. Unlike the chick clusters, these seem to correspond to different stages of development.</p></disp-quote><p>The analysis of the early and late NMP clusters has been revisited using Leiden clustering (instead of Louvain initially). We now only find one early and late clusters in both species. We perform a GSEA analysis using the gene set “Epithelium to mesenchyme transition” which shows enrichment in the late clusters in both species. We also compared these early and late clusters to other similar datasets published in the literature (Gouti et al., 2017; Wymeersch et al., 2019; Dias et al., 2020; Dias-Cuadros et al., 2020). This part has been modified in the revised text and a new figure 5, Supplementary File 4 and Figure 5 – supplementary Figure 1 have been generated with the new data.</p><disp-quote content-type="editor-comment"><p>Suggestions for improving the manuscript</p><p>1. The statements that no previous studies have prospectively identified neuromesodermal-fated cells (abstract, introduction p4, discussion p10) should be modified. Forlani et al., Development 2003 10.1242/dev.00573 and Wood et al., BioRXiv https://doi.org/10.1101/622571 show dual-fated cells in mouse and chick.</p></disp-quote><p>We are well aware of the Forlani paper, where they perform single cell injections of HRP in epiblast cells. However, this study was intended for a different purpose (comparing the anterior boundaries of the clones with the timing of Hox gene activation). It is true that they show a few bipotent clones in their Figure 7 but this work was done before the identification of the NMPs in 2009 and in no place in the text do they refer to bi-potential precursors. We nevertheless introduced and discussed this reference in the text.</p><p>With respect to the Wood preprint, I don’t think they demonstrate the existence of dual-fated cells. Their data arguing for the dual fate is shown in Figure 5a-c which shows cell fate tracked for only 15 hours (ie up to the 5-somite stage approximately). Their designation of the neuro-mesodermal region is quite arbitrary. The main argument in support of a dual fate of these cells is that their descendants span neural and mesodermal territories after 15 hours when backtracked from time lapse movies (white bars on Figure 5c). However, at these stages, these two territories are not clearly separated into neural tube and paraxial mesoderm and thus the designation of the final fate is not supported by any anatomical or molecular landmark. This study is extremely preliminary and lacking critical details to evaluate the findings. I don’t think it would be fair to consider that this work (which is essentially contemporary to ours) first identified dual-fated cells in the chicken embryo. We nevertheless discuss this reference in the revised version of the manuscript.</p><disp-quote content-type="editor-comment"><p>I think that it would be fairer in the context of previous studies to cite the population or oligoclonal studies of Iimura and Pourquié, (2006) 10.1073/pnas.0610997104, Cambray and Wilson, (2007) 10.1242/dev.02877 and Brown and Storey, (2000) 10.1016/s0960-9822(00)00601-1 as showing potential locations for cells of dual neuromesodermal fate.</p></disp-quote><p>We were already discussing these studies in the previous version of this paper but have rewritten this part. We were not trying to diminish the merit of these oligoclonal studies, which are very elegant and compelling. Nevertheless, we believe it is fair to say that due to their design, these studies cannot prospectively identify bipotential cells, only territories.</p><disp-quote content-type="editor-comment"><p>2. The words 'bipotent/monopotent' used throughout the manuscript is not appropriate for the studies here, which are demonstrating fate and not potency. I would suggest 'dual fate'.</p></disp-quote><p>We respectfully disagree about using dual fated to describe NMP cells as dual fated means that the two fates can be observed. Thus, we believe using this term would only be appropriate for the description of a subset of the cells identified by the lineage analysis (and we do use it in some places) as in these experiments we can visualize the fate of the cells. However, in many cases, only one of the fates is realized even though the precursors (the NMPs) appear to be bipotent at the population level. For the scRNAseq analysis, the cells of the NMP cluster cannot be called dual-fated as the analysis does not reveal the actual fate of the cells. We believe the cells identified as NMP using this approach should be called bipotent.</p><disp-quote content-type="editor-comment"><p>3. NMPs are presented here as 'stem cells' when the transcriptome analysis shows they mature with time. It would be good to define exactly in what sense the term is being used- it is valid since the manuscript describes an enduring progenitor producing neural and mesodermal tissue but should be used with care.</p></disp-quote><p>We define NMPs as stem cells because they can give rise to differentiating progeny and self-renew. We now add further evidence for a self-renewing behavior with the WOT analysis transport maps which show that NMP contribute significantly to the NMP population itself over time. This is now shown in the revised Figure 4C-D. The fact that NMPs can also mature is a situation frequently observed for other stem cell types (fetal vs adult satellite cells or hematopoietic cells for instance). We have however removed stem cell from the title of the revised paper.</p><disp-quote content-type="editor-comment"><p>4. p5. 'We identified 7 clones containing cells expressing the same barcodes' – could this text be modified to clarify, e.g. 'expressing unique (or clone-specific) barcodes'?</p></disp-quote><p>This has been modified accordingly.</p><disp-quote content-type="editor-comment"><p>5. p7 para 2 'the NMP lineage' should be changed to something not implying lineage, e.g. 'cluster'</p></disp-quote><p>We agree and have removed NMP lineage from the revised text and replaced it by the appropriate clusters.</p><disp-quote content-type="editor-comment"><p>6. Figure S7 is entitled 'NMP early and late clusters are not due to different Hox genes expression'- since the authors show differential Hox gene expression, this statement should be moderated. The text describing this observation also suggests that the genes that are differentially expressed early and late in mouse and chick are different. However, many of the genes upregulated in the later chick stage are also upregulated in mouse, eg Wnt5a, Greb1, Fgf8, Figf18, Cyp26a1 (see Wymeersch et al., 10.1242/dev.168161). It would be good to comment on this.</p></disp-quote><p>We agree and have changed the title of what is now Figure 5 – supplementary Figure 1 with “Characterization of the early and late NMP clusters”. We have also performed a series of comparisons between the differentially expressed genes from the early and late NMP clusters identified in our chicken and mouse datasets and with the datasets from Gouti et al., 2017, Wymeersch et al., 2019, Dias et al., 2020 and Dias-Cuadros et al., 2020. We do find similarities between the gene signatures identified in our mouse and chicken early and late NMPs clusters and those identified in these studies and the results are now shown in the Supplementary File 4.</p><disp-quote content-type="editor-comment"><p>7. Can the authors consider whether 'persistence' of cell tracks is the optimal term? It could suggest persistence of movement rather than just their continued observation over time. Is 'longevity' a possible alternative?</p></disp-quote><p>We have made the corresponding change.</p></body></sub-article></article>