<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1 20151215//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">67578</article-id><article-id pub-id-type="doi">10.7554/eLife.67578</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Biochemistry and Chemical Biology</subject></subj-group></article-categories><title-group><article-title>Sec17/Sec18 can support membrane fusion without help from completion of SNARE zippering</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-83734"><name><surname>Song</surname><given-names>Hongki</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-3761-5434</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/><xref ref-type="fn" rid="fn1">†</xref></contrib><contrib contrib-type="author" id="author-227788"><name><surname>Torng</surname><given-names>Thomas L</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0003-2295-2777</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/><xref ref-type="fn" rid="fn1">†</xref></contrib><contrib contrib-type="author" id="author-9065"><name><surname>Orr</surname><given-names>Amy S</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-0266-0390</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-1054"><name><surname>Brunger</surname><given-names>Axel T</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">http://orcid.org/0000-0001-5121-2036</contrib-id><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf2"/></contrib><contrib contrib-type="author" corresp="yes" id="author-8988"><name><surname>Wickner</surname><given-names>William T</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-8431-0468</contrib-id><email>William.T.Wickner@dartmouth.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution>Department of Biochemistry and Cell Biology Geisel School of Medicine at Dartmouth</institution><addr-line><named-content content-type="city">Hanover</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution>Howard Hughes Medical Institute and Department of Molecular and Cellular Physiology Stanford University</institution><addr-line><named-content content-type="city">Stanford</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Rizo</surname><given-names>Josep</given-names></name><role>Reviewing Editor</role><aff><institution>University of Texas Southwestern Medical Center</institution><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Malhotra</surname><given-names>Vivek</given-names></name><role>Senior Editor</role><aff><institution>The Barcelona Institute of Science and Technology</institution><country>Spain</country></aff></contrib></contrib-group><author-notes><fn fn-type="other" id="fn1"><label>†</label><p>HS and TLT are co-first authors of this work</p></fn><fn fn-type="other" id="fn2"><label>‡</label><p>HS and TLT are co-first authors of this work</p></fn></author-notes><pub-date date-type="publication" publication-format="electronic"><day>04</day><month>05</month><year>2021</year></pub-date><pub-date pub-type="collection"><year>2021</year></pub-date><volume>10</volume><elocation-id>e67578</elocation-id><history><date date-type="received" iso-8601-date="2021-02-16"><day>16</day><month>02</month><year>2021</year></date><date date-type="accepted" iso-8601-date="2021-04-30"><day>30</day><month>04</month><year>2021</year></date></history><permissions><copyright-statement>© 2021, Song et al</copyright-statement><copyright-year>2021</copyright-year><copyright-holder>Song et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-67578-v2.pdf"/><related-article ext-link-type="doi" id="ra1" related-article-type="commentary" xlink:href="10.7554/eLife.70298"/><abstract><p>Membrane fusion requires R-, Qa-, Qb-, and Qc-family SNAREs that zipper into RQaQbQc coiled coils, driven by the sequestration of apolar amino acids. Zippering has been thought to provide all the force driving fusion. Sec17/αSNAP can form an oligomeric assembly with SNAREs with the Sec17 C-terminus bound to Sec18/NSF, the central region bound to SNAREs, and a crucial apolar loop near the N-terminus poised to insert into membranes. We now report that Sec17 and Sec18 can drive robust fusion without requiring zippering completion. Zippering-driven fusion is blocked by deleting the C-terminal quarter of any Q-SNARE domain or by replacing the apolar amino acids of the Qa-SNARE that face the center of the 4-SNARE coiled coils with polar residues. These blocks, singly or combined, are bypassed by Sec17 and Sec18, and SNARE-dependent fusion is restored without help from completing zippering.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>membrane fusion</kwd><kwd>yeast vacuoles</kwd><kwd>SNAREs</kwd><kwd>HOPS</kwd><kwd>Sec17</kwd><kwd>Sec18</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>S. cerevisiae</italic></kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R35GM118037</award-id><principal-award-recipient><name><surname>Wickner</surname><given-names>William T</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R37MH63105</award-id><principal-award-recipient><name><surname>Brunger</surname><given-names>Axel T</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Sec18(NSF) and Sec17(αSNAP) provide a parallel pathway to fusion that is independent of energy from SNARE zippering.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Membrane fusion requires Rab-family GTPases and SNARE proteins. SNAREs constitute four families, termed R, Qa, Qb, and Qc (<xref ref-type="bibr" rid="bib11">Fasshauer et al., 1998</xref>). Each of them has an N-domain, an α-helical SNARE domain of 50–60 aminoacyl residues with heptad-repeat apolar residues, and often a C-terminal membrane anchor. Each SNARE α-helical turn is termed a ‘layer.’ The central ‘0-layer’ of each fully-assembled SNARE complex has inwardly-oriented arginyl (for R-SNAREs) or glutaminyl (for Qa, Qb, and Qc SNAREs) residues, forming a polar center to the otherwise hydrophobic core of the 4-helical SNARE bundle (<xref ref-type="bibr" rid="bib53">Sutton et al., 1998</xref>). The SNARE domain layers are numbered from the 0-layer, in the positive direction toward the SNARE C-termini and in the negative direction toward the N-domains. Prior to 4-SNARE assembly, individual SNARE domains are random coil (<xref ref-type="bibr" rid="bib10">Fasshauer et al., 1997</xref>; <xref ref-type="bibr" rid="bib17">Hazzard et al., 1999</xref>). Sec1/Munc18 (SM) family proteins catalyze the N- to C-directional assembly of SNAREs anchored to each tethered membrane (<xref ref-type="bibr" rid="bib12">Fiebig et al., 1999</xref>; <xref ref-type="bibr" rid="bib48">Sørensen et al., 2006</xref>; <xref ref-type="bibr" rid="bib2">Baker et al., 2015</xref>; <xref ref-type="bibr" rid="bib34">Orr et al., 2017</xref>; <xref ref-type="bibr" rid="bib21">Jiao et al., 2018</xref>). Each SNARE domain transitions from random coil to α-helix as the heptad-repeat apolar amino acyl residues become sequestered into the interior of the coiled coils (<xref ref-type="bibr" rid="bib10">Fasshauer et al., 1997</xref>; <xref ref-type="bibr" rid="bib53">Sutton et al., 1998</xref>). This hydrophobic collapse relies on the exclusion of water and is the driving force for SNARE assembly (<xref ref-type="bibr" rid="bib48">Sørensen et al., 2006</xref>). Completion of SNARE zippering can release up to 40 kBT per SNARE complex (<xref ref-type="bibr" rid="bib15">Gao et al., 2012</xref>; <xref ref-type="bibr" rid="bib30">Min et al., 2013</xref>; <xref ref-type="bibr" rid="bib64">Zhang, 2017</xref>) to overcome the 40–90 kBT hydration barrier for membrane stalk formation, the dominant energy barrier for fusion (<xref ref-type="bibr" rid="bib1">Aeffner et al., 2012</xref>). Upon fusion, the <italic>trans</italic>-SNARE complex becomes a <italic>cis</italic>-complex, anchored to the fused membrane bilayer. Sec17 (αSNAP) and SNAREs are receptors for the Sec18 (NSF) AAA ATPase (<xref ref-type="bibr" rid="bib8">Clary et al., 1990</xref>; <xref ref-type="bibr" rid="bib61">Winter et al., 2009</xref>; <xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>). Sec18 uses the energy from ATP binding and hydrolysis to disassemble SNAREs for further fusion cycles (<xref ref-type="bibr" rid="bib43">Söllner et al., 1993</xref>; <xref ref-type="bibr" rid="bib55">Ungermann et al., 1998</xref>; <xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>) and to disassemble dead-end SNARE complexes (<xref ref-type="bibr" rid="bib62">Xu et al., 2010</xref>; <xref ref-type="bibr" rid="bib23">Lai et al., 2017</xref>; <xref ref-type="bibr" rid="bib7">Choi et al., 2018</xref>; <xref ref-type="bibr" rid="bib47">Song and Wickner, 2019</xref>; <xref ref-type="bibr" rid="bib22">Jun and Wickner, 2019</xref>).</p><p>The molecular interactions between Sec18/NSF, Sec17/αSNAP, and neuronal SNAREs were illuminated by determination of their structures when assembled without membrane anchors into the NSF/αSNAP/SNARE complex, also referred to as the 20S particle (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>; <xref ref-type="bibr" rid="bib59">White et al., 2018</xref>). The heart of these structures is the 4-helical bundle of the R, Qa, Qb, and Qc SNARE domains. Between two and four Sec17/αSNAP form a right<bold>-</bold>handed assembly surrounding the left-handed superhelical coiled coils of the SNARE complex. In this structure, the N-terminal apolar loop of each αSNAP is poised to enter a lipid bilayer adjacent to the SNARE transmembrane (TM) domains.</p><p>Yeast vacuole fusion, a model of non-neuronal fusion, has been studied in vivo (<xref ref-type="bibr" rid="bib56">Wada et al., 1992</xref>), in vitro with the isolated organelle (<xref ref-type="bibr" rid="bib60">Wickner, 2010</xref>), and in a reconstituted proteoliposome-based reaction with purified components (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib52">Stroupe et al., 2009</xref>; <xref ref-type="bibr" rid="bib69">Zick and Wickner, 2016</xref>). Each protein implicated by the in vivo genetics is required for the reconstitution: the Rab Ypt7, the R-SNARE Nyv1, and Q-SNAREs Vam3, Vti1, and Vam7 (hereafter referred to as R, Qa, Qb, and Qc), and a large hexameric protein termed HOPS (<bold><underline>ho</underline></bold>motypic fusion and vacuole <bold><underline>p</underline></bold>rotein <bold><underline>s</underline></bold>orting) with multiple direct affinities. Two HOPS subunits bind Ypt7, anchored on each membrane (<xref ref-type="bibr" rid="bib4">Brett et al., 2008</xref>), to mediate tethering (<xref ref-type="bibr" rid="bib18">Hickey and Wickner, 2010</xref>). A third HOPS subunit is Vps33, the vacuolar Sec1/Munc18 (SM) protein, with direct capacity to bind R and Qa SNARE domains, in parallel and in register (<xref ref-type="bibr" rid="bib2">Baker et al., 2015</xref>). HOPS also has direct affinity for the Qb and Qc SNAREs (<xref ref-type="bibr" rid="bib51">Stroupe et al., 2006</xref>; <xref ref-type="bibr" rid="bib45">Song et al., 2020</xref>) and for vacuolar lipids (<xref ref-type="bibr" rid="bib33">Orr et al., 2015</xref>). Some functions of HOPS correspond to fusion factors in other systems; neuronal Munc13 cooperates with Munc18 in SNARE assembly (<xref ref-type="bibr" rid="bib37">Richmond et al., 2001</xref>; <xref ref-type="bibr" rid="bib24">Ma et al., 2011</xref>; <xref ref-type="bibr" rid="bib23">Lai et al., 2017</xref>). Munc18 corresponds to the HOPS subunit Vps33, but the protein that mediates the Munc13 function for vacuole fusion is unclear. The association of HOPS with Ypt7 and vacuolar lipids allosterically activates HOPS to catalyze SNARE assembly (<xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>). When the SNAREs are initially in 4-SNARE complexes on two apposed membranes, fusion requires Sec17, Sec18, and ATP to disassemble these <italic>cis</italic>-SNARE complexes and liberate the SNAREs for assembly into <italic>trans</italic>-complexes (<xref ref-type="bibr" rid="bib28">Mayer et al., 1996</xref>; <xref ref-type="bibr" rid="bib31">Nichols et al., 1997</xref>; <xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>).</p><p>Though early studies have suggested that disassembly of <italic>cis</italic>-SNARE complexes might be the sole function of Sec17 and Sec18 (<xref ref-type="bibr" rid="bib28">Mayer et al., 1996</xref>), recent findings have broadened our understanding of their roles. While SNAREs are a core fusion machine (<xref ref-type="bibr" rid="bib58">Weber et al., 1998</xref>), a complete fusion machine (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib69">Zick and Wickner, 2016</xref>) also requires the Rab, its tethering effector, an SM-family protein, and the NSF/Sec18 and αSNAP/Sec17 SNARE chaperones. In this more complete context, Sec17 and Sec18 also contribute to fusion per se: (1) <italic>trans</italic>-SNARE complexes, which form in a Ypt7-dependent manner between vacuoles, bear Sec17 in comparable abundance to the SNAREs (<xref ref-type="bibr" rid="bib62">Xu et al., 2010</xref>). (2) Fusion between proteoliposomes has been reconstituted with purified components. When tethering is by non-specific agents, fusion is inhibited by Sec17, Sec18, and ATP (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>). However, Sec17, Sec18, and ATP stimulate fusion with HOPS (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>; <xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>). (3) A pioneering study by <xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>, showed that the Qc3Δ deletion of several heptads at the C-terminus of the Qc SNARE blocks the fusion of isolated yeast vacuoles, but this block is overcome by the addition of Sec17. Qc3Δ, ending at the SNARE domain layer +3 and thus lacking layers +4 to +8, blocks vacuole fusion in vivo as well, and overexpression of Sec17 partially restores cellular vacuole morphology (<xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>). Reconstituted in vitro fusion with limiting Sec17 concentrations, where Sec17 will not restore fusion, also requires Sec18 (<xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>). It has been unclear whether the Sec17 bypass of this deletion of the C-terminal Qc region is particular to just this one SNARE or is general for any Q-SNARE, and whether Sec17 simply contributes its SNARE-binding energy to the energy of 3-SNARE zippering or whether it drives fusion by other means. (4) Fusion reactions with initially separate SNAREs can require Sec17, and this fusion is stimulated by Sec18 without ATP hydrolysis (<xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>; <xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>). Sec17 alone stimulates the fusion of reconstituted proteoliposomes with wild-type SNAREs, and the degree of stimulation is a function of the lipid headgroup and fatty acyl composition (<xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>). An intermediate in fusion accumulates during HOPS-dependent fusion without Sec17, allowing a sudden burst of fusion upon Sec17 addition (<xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>). Single-molecule pulling studies have also revealed that αSNAP stabilizes SNARE complexes (<xref ref-type="bibr" rid="bib26">Ma et al., 2016</xref>, but see <xref ref-type="bibr" rid="bib38">Ryu et al., 2015</xref>). However, the mechanism by which HOPS-dependent fusion is stimulated by Sec17/Sec18 has been unclear.</p><p>Complete SNARE zippering is considered essential for SNARE-dependent fusion (<xref ref-type="bibr" rid="bib48">Sørensen et al., 2006</xref>). We now report that Sec17 has a second mode of promoting fusion, which can compensate for incomplete zippering. Fusion with SNAREs and HOPS is completely arrested when several heptad repeats in the C-terminal region of the SNARE core complex are removed from any one of the three Q-SNAREs. With any such C-terminally truncated Q-SNARE domain, or even with C-terminal truncations to both Qb and Qc, blocked fusion is restored by Sec17 and Sec18 without ATP hydrolysis. Association between the C-terminal heptads of the R and the single remaining full-length Qa-SNARE, each anchored to one of the docked membranes, would not yield the same assembly energy as with wild-type SNAREs (<xref ref-type="bibr" rid="bib53">Sutton et al., 1998</xref>) and would contribute far less force toward the bilayer rearrangements of fusion. The N-terminal apolar loop of Sec17 is particularly important for this function of Sec17, and it may stabilize SNARE bundles or trigger fusion by insertion into lipid bilayers. Zippering-driven fusion is also arrested with full-length SNARE domains when the apolar, inward-facing residues of the Qa SNARE layers +4 to +8 are replaced by Ala, Ser, or Gly, but in each case fusion is restored by Sec17, Sec18, and non-hydrolyzable ATPγS. Strikingly, even fusion that is blocked by the concurrent replacement of apolar residues from the +4 to +8 layers of Qa and the deletion of the +4 to +8 layers of both Qb and Qc, removing all capacity for hydrophobic collapse between the +4 and +8 layers of the R and Q SNAREs, is fully restored by Sec17 and Sec18. We propose that Sec17 either creates a favorable folding environment for the assembly of the remaining full-length SNARE domains or directly promotes bilayer remodeling through insertion of the apolar loops of several SNARE-bound Sec17s or acts by a combination of these two mechanisms.</p></sec><sec id="s2" sec-type="results"><title>Results</title><p>Vacuole SNAREs (<xref ref-type="fig" rid="fig1">Figure 1A</xref>) have an N-domain and a SNARE domain. Several of them have a TM anchor, but Qc lacks a hydrophobic membrane anchor, and instead associates with membranes through its affinities for the other SNAREs, for HOPS (<xref ref-type="bibr" rid="bib51">Stroupe et al., 2006</xref>), and for phosphatidylinositol 3-phosphate through its N-terminal PX domain (<xref ref-type="bibr" rid="bib6">Cheever et al., 2001</xref>). SNARE domain layers are numbered from the central 0-layer, as shown. Fusion requires that R- and at least one Q-SNARE be anchored to docked membranes (<xref ref-type="bibr" rid="bib46">Song and Wickner, 2017</xref>). When they are, soluble forms of the other Q-SNAREs without membrane anchors, termed sQ (<xref ref-type="fig" rid="fig1">Figure 1A</xref>), will support Ypt7/HOPS-dependent fusion. Vacuolar SNAREs with C-terminal truncations, corresponding to partial zippering, form stable complexes (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>), supporting their use in fusion studies. Based on the single-particle cryo-EM (Electron Microscope) structure of the homologous human neuronal NSF/αSNAP/SNARE complex (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>), we modeled the associations of Sec17 (αSNAP) (<xref ref-type="fig" rid="fig1">Figure 1B</xref>) and Sec18 (NSF) with vacuolar SNAREs, viewed in profile or in an end-on view from the membrane (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). In this model, we assume that four Sec17 monomers (<xref ref-type="fig" rid="fig1">Figure 1B</xref>) assemble together, surrounding the 4-SNARE coiled coil (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). In contrast, only two αSNAP molecules have been observed in EM structures of the NSF/αSNAP/V7-SNARE complex (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>) and the NSF/αSNAP/SNARE complex that included the linker between the two SNAP-25 SNARE domains (<xref ref-type="bibr" rid="bib59">White et al., 2018</xref>). The presence of the SNAP-25 linker in these two complexes may interfere with the binding of the other two αSNAP molecules. Since the vacuolar SNARE complex does not contain a linker between SNARE domains, it is reasonable to postulate that four Sec17 molecules bind to the vacuolar SNARE complex, but the precise number of Sec17 molecules is yet to be determined for the Sec18/Sec17/vacuolar SNARE complex. Rapid fusion needs Sec17 and Sec18 in addition to HOPS and SNAREs (<xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>). To understand how they work together, we exploited direct assays of SNARE associations to show that incompletely zippered SNAREs can associate stably and that HOPS allows Sec17 to promote the completion of zippering and SNARE complex stability. We then examined their functional relationships to show that SNARE-bound Sec17 and Sec18 can promote rapid fusion when energy from zippering is greatly reduced or lost.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Model of the Sec18/Sec17/vacuolar SNARE complex and Sec17 mutations.</title><p>(<bold>A</bold>) Schematic of the four yeast vacuolar SNAREs, the soluble Q-SNAREs (sQx), and their deletion derivatives sQx3Δ lacking regions C-terminal to the +3 layer of the SNARE domain. (<bold>B</bold>) Structure of Sec17 (<xref ref-type="bibr" rid="bib36">Rice and Brunger, 1999</xref>, PDB ID 1QQE). Residues mutated in certain experiments are highlighted as in <xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>. (<bold>C</bold>) Modeling of the vacuolar Sec18/Sec17/SNARE complex. MODELLER (<xref ref-type="bibr" rid="bib57">Webb and Sali, 2016</xref>) was used to create individual homology models of the vacuolar SNARE complex (Nyv1, Vam3, Vti1, Vam7) and of Sec18 starting from the coordinates of synaptobrevin-2, SNAP-25, syntaxin-1A, and NSF in the cryo-EM structure of the neuronal 20S complex (PDB ID 3J96) (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>). These homology models, together with the crystal structure of Sec17 (PDB ID 1QQE) (<xref ref-type="bibr" rid="bib36">Rice and Brunger, 1999</xref>), were fit into the cryo-EM structure of the neuronal 20S complex (PDB ID 3J96) (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>). We used PDB ID 3J96 because this cryo-EM structure did not include the SNAP-25 linker and the H<sub>abc</sub> domain of syntaxin-1A. The vacuolar SNARE complex (Nyv1, Vam3, Vti1, Vam7) also does not include a linker between any of the SNARE motifs; in all structures of NSF/αSNAP/ternary SNARE complexes determined thus far, four αSNAP molecules are observed for SNARE complexes that do not contain a linker connecting two of the SNARE domains (<xref ref-type="bibr" rid="bib59">White et al., 2018</xref>), and we therefore included four Sec17 molecules in our model of the vacuolar 20S complex. In the PDB coordinate file supplied as Source Data File of the homology model of the Sec18/Sec17/vacuolar SNARE complex, Sec18 molecules, chains A–F; Sec17, chains G–J; Nyv1, chain K; Vam3, chain L; Vti1, chain M; Vam7, chain N are included. Colors: cyan: Nyv1; magenta: Vam3; yellow: Vti1; salmon: Vam7; gray, orange, green, slate: Sec17; yellow, magenta, gray, blue, salmon, green: Sec18. Cartoon representations are shown. Two views related by a 90-degree rotation are included (left: side view; right: membrane-end view).</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>Source data file (PDB) for <xref ref-type="fig" rid="fig1">Figure 1C</xref>.</title></caption><media mime-subtype="zip" mimetype="application" xlink:href="elife-67578-fig1-data1-v2.zip"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig1-v2.tif"/><permissions><copyright-statement>© 2017, Schwartz et al</copyright-statement><copyright-year>2017</copyright-year><copyright-holder>Schwartz et al</copyright-holder><license><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref> <license-p><xref ref-type="fig" rid="fig1">Figure 1B</xref> reproduced from Figure 5A <xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>, eLife, published under the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International Public License.</ext-link></license-p> </license></permissions></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>SNARE associations during partial zippering.</title><p>Purified full-length vacuolar SNAREs will spontaneously, though slowly, assemble into a parallel 4-helical coiled coil structure, which extends from the N-terminal (−7) layer of the SNARE domain to the C-terminal (+8) end of the SNARE domain. While the association of neuronal SNAREs has been studied extensively, the association of full-length or truncated vacuole SNAREs has received less study. Full-length R-SNARE, with a 6his-tag on its N-terminus, was mixed in octylglucoside with full-length Q-SNAREs, with soluble Q-SNAREs (sQ), or with sQ3Δs. Stable spontaneous complexes were isolated with nickel-NTA beads and examined by immunoblot. Complex formation with full-length SNAREs (lane 1) was not blocked by the absence of transmembrane domain from Qa, Qb, or﻿ both (lanes 2–4) or by the 3Δ deletion in the C-terminal end of the SNARE domain in any one or two Q-SNAREs (lanes 5–10). (<bold>A</bold>) Reactions (50 µl) containing 2.5 µM of each SNARE in Buffer 151 (20 mM HEPES-NaOH, pH 7.4, 150 mM NaCl, 10% glycerol, 1% ß-OG, 20mM imidazole) were nutated at 4°C for 2 hr. A 40 µl portion of each was transferred to a 0.5 ml Eppendorf tube containing 20 µl of a 50% slurry of Qiagen Nickel-NTA Agarose in Buffer 151. Suspensions were nutated at 4°C for 1 hr. Loosely bound proteins were removed by four successive suspensions in 0.5 ml Buffer 151, each followed by centrifugation (500x<italic>g</italic>, 6 min, 4°C) and removal of the supernatant. Bound proteins were eluted by boiling the agarose in 50 µl of sodium dodecyl sulphate (SDS) sample buffer (50 mM TrisCl, pH 6.8, 5% glycerol, 2% SDS, 0.2% bromophenol blue, 1% ß-mercaptoethanol) for 5 min. Samples were analyzed by SDS-PAGE followed by immunoblotting. (<bold>B</bold>) Western blots of three identical experiments were scanned and analyzed with UN-SCAN-IT Software (Silk Scientific, Orem, UT). Average pixel values were set at 100 for the all-wild-type positive control (lane 1). Means and standard deviations are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig1-figsupp1-v2.tif"/></fig></fig-group><sec id="s2-1"><title>Sec17 alters SNARE complex conformation</title><p>The capacity of vacuolar SNAREs to form stable partially zippered structures raised the question of whether these SNAREs can zipper efficiently, especially when anchored to membranes or associated with other fusion proteins such as HOPS. To study the kinetics of SNARE interactions, we employed an ensemble fluorescence resonance energy transfer (FRET) assay of vacuolar SNARE associations (<xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>). The Qc-SNARE was prepared with a unique cysteinyl residue in any of three positions (<xref ref-type="fig" rid="fig2">Figure 2A</xref>), either the native Cys208, which is upstream (U) of the SNARE domain or, after substitution of serine for this cysteine, with Met250Cys at the N-terminal end of the SNARE domain or with Ala316Cys at the C-terminal end of the SNARE domain. Each was derivatized with Oregon Green 488. Fusion proteins were also prepared with a unique cysteine either immediately N-terminal, or C-terminal, to the Qb SNARE domain, and each was derivatized with Alexa Fluor 568. As a model for exploring the effects of HOPS and Sec17 on SNARE dynamics, these fluorescent proteins were co-incubated with proteoliposomes bearing Ypt7, R, and Qa. <italic>cis</italic>-SNARE complex assembly can occur spontaneously on these proteoliposomes, but assembly is stimulated by HOPS, allowing direct comparison of HOPS-dependent and HOPS-independent SNARE assembly (<xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>). The average FRET efficiency in these studies is modest because they include, in bulk reactions, all the fluorescent Qb and Qc, many of which do not enter SNARE complexes. SNARE complex assembly with HOPS gave a high average FRET efficiency when fluorophores were at the N-terminus of the Qb SNARE domain and at or near the N-terminal end of the Qc SNARE domain (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, red and yellow curves). There was a lower FRET efficiency when the fluorophores were at opposite ends of the Qc and Qb SNARE domains (<xref ref-type="fig" rid="fig2">Figure 2B</xref>; blue, green, and indigo). When both fluorophores were at the C-terminal ends of the Qb and Qc SNARE domains, a low signal was seen (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, purple), similar to the average FRET efficiency when fluorophores were at opposite ends of the SNARE domains, thus suggesting incomplete zippering. After 1 hr, Sec17 was added to each reaction. Strikingly, Sec17 only enhanced the average FRET efficiency between C-terminal fluorophores, rapidly rising to the level seen when the fluorophores were together at the N-terminii of the SNARE domains (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, purple; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>), indicating a Sec17-induced change at the C-terminal end of the SNARE complex. Sec17/αSNAP may promote the zippering of isolated SNARE domains (<xref ref-type="bibr" rid="bib26">Ma et al., 2016</xref>) but is now seen to act in the context of membranes and HOPS.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Sec17 modifies SNARE conformation in a HOPS- and zippering-dependent manner and stabilizes complexes with truncated SNARE domains.</title><p>(<bold>A</bold>) Schematic of fluorescently labeled SNARE constructs used in this study. SNAREs were derivatized as described previously (<xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>). Wild-type Qc contains a single Cys residue at 208 at the upstream (U) position. (N)- and (C)-labeled constructs replace residues 250 and 316 with Cys, while also replacing Cys208 with Ser. Each Qc construct was derivatized with Oregon Green 488 as described (<xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>). A fusion of maltose-binding protein (MBP), a TEV site, and the Qb SNARE domain (residues 133–187) was expressed with an added cysteinyl residue immediately upstream or downstream of the SNARE domain. Each Qb construct was derivatized with Alexa Fluor 568. Qc and Qb labeled with a fluorescent probe at any position are written as *Qc and *Qb. (<bold>B–G</bold>) Bar graphs are reported as the mean of the relative ensemble fluorescence resonance energy transfer (FRET) change (%) per trial with propagated standard deviation for n = 3 trials. The relative change was calculated by averaging 10 data points, each from just before Sec17 addition and from the end of the measurement period 20 min later, except where indicated. Specific time points used as well as the statistics for the propagation of uncertainty are shown in Supplementary Data. A bar graph representation for (B) and the kinetic curves for (C–G) are provided in <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref> . (<bold>B</bold>) Sec17 modifies the conformation of the C-terminus of the SNARE complex. Ypt7/RQa proteoliposomes were incubated with pairs of *Qb and *Qc labeled at the N, C, or upstream (U) locations as indicated in (A). Curves are averages of n = 3 trials, and the shaded regions behind each curve show the standard deviation per time point. (<bold>C</bold>) Sec17-promoted zippering requires HOPS. RQa proteoliposomes were incubated with either the N-labeled *Qb/*Qc pair (left) or the C-labeled *Qb/*Qc pair (right), with Ypt7 and HOPS as indicated. A reaction with a buffer (RB150) added instead of Sec17 serves as a negative control. (<bold>D</bold>) Sec17 does not promote C-terminal zippering if the SNARE domain of Qa is truncated. Ypt7/R proteoliposomes were incubated with C-terminally labeled *Qb and *Qc and either soluble Qa or Qa3Δ, and the relative FRET change was calculated over 10 min after Sec17 or buffer addition. (<bold>E</bold>) Sec17-induced zippering requires the apolar heptad-repeat amino acyl residues in Qa SNARE domain layers +4 to +8. Proteoliposomes bearing Ypt7, R-SNARE, and either wild-type Qa or Qa with the +4 to +8 layers inwardly-oriented apolar residues mutated to Gly were incubated with C-terminally labeled *Qb and *Qc, and then Sec17 or its mutants were added at t = 60 min. (<bold>F</bold>) Sec17-driven SNARE conformational change is stunted by the F22SM23S mutation of Sec17 (FSMS). Ypt/R proteoliposomes were incubated with sQa and C-terminally labeled *Qb and *Qc, and then Sec17 or mutants as indicated were added at t = 60 min. (<bold>G</bold>) Sec17 stabilizes incompletely zippered SNARE complexes. Ypt7/R proteoliposomes were incubated with sQa and C-terminally labeled *Qb and *Qc. Sec17 or the indicated mutants were added at t = 60 min. Non-fluorescent Qc (8.5 µM) was added at t = 80 min, and the loss of FRET over 35 min was measured starting immediately after the addition of non-fluorescent Qc.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Source data file (Excel) for <xref ref-type="fig" rid="fig2">Figure 2B</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-67578-fig2-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Statistics and representative kinetic data for <xref ref-type="fig" rid="fig2">Figure 2</xref>.</title><p>(<bold>A</bold>) Schematic of fluorescently labeled SNARE constructs used in this study. (<bold>B–G</bold>) Supplementary data for panels (B-G) in <xref ref-type="fig" rid="fig2">Figure 2</xref>. Subfigures are presented with the same subfigure labels and matching colors. All kinetic data are averages of three trials, and the shaded regions behind each curve show the standard deviation per time point. (<bold>B</bold>) The effect of Sec17 on SNARE average ensemble fluorescence resonance energy transfer (FRET) efficiency as a function of fluorophore position. The mean and standard deviation of three trials is shown for each reaction. (<bold>C</bold>) Representative kinetic data showing the effect of HOPS and Ypt7 on Sec17-induced zippering. Data for the N-terminally labeled *Qb/*Qc pair is shown on the left, and data for the C-terminally labeled pair is shown on the right. Reactions with HOPS are in purple, and reactions without HOPS are in orange. As a negative control, a buffer (RB150) was added instead of Sec17 for the reaction in gray. (<bold>D</bold>) Representative kinetic data showing that Sec17 has only minor effect on the average FRET efficiency of SNARE complexes bearing truncated Qa SNARE. (<bold>E</bold>) Representative kinetic data showing that Sec17 does not affect the average FRET efficiency of SNARE complexes bearing Qa SNARE with a mutated C-terminal half. (<bold>F</bold>) Representative kinetic data for the ability of Sec17 or mutants to promote C-terminal zippering of the SNARE complex. (<bold>G</bold>) Representative kinetic data showing that Sec17 stabilizes incompletely zippered SNARE complexes. Sec17, mutants, or buffer was added at t = 60 min (1), and non-fluorescent Qc was added at t = 80 min (2). Reactions containing wild-type Qc are shown with filled circles, and reactions with Qc3Δ are shown with open squares. The effect of wild-type Sec17 (red) is contrasted with no Sec17 (gray) in the left-side graph, and the four Sec17 mutants used in this experiment are compared in the right-side graph.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig2-figsupp1-v2.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Direct binding of Sec17 to HOPS.</title><p>gvSince proteoliposome fusion promoted by synthetic tethers is inhibited by all concentrations of Sec17, whereas HOPS-dependent fusion is only inhibited by very high Sec17 levels (<xref ref-type="bibr" rid="bib47">Song and Wickner, 2019</xref>) and Sec17-triggered zippering requires HOPS (<xref ref-type="fig" rid="fig2">Figure 2C</xref>), we tested whether HOPS might directly associate with Sec17. Phosphatidylcholine liposomes were prepared without protein (‘naked’) or with TM-Sec17, a recombinant form of Sec17 with an N-terminal apolar transmembrane anchor (<xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>). These liposomes were incubated with HOPS, then floated through a density gradient. HOPS only bound in the presence of anchored Sec17, showing a direct and nearly stoichiometric binding between these proteins. (<bold>A</bold>) Liposomes composed of PC/PS/NBD (83.5/15/1.5%) were prepared from mixed micellar solutions by detergent dialysis as described in 'Materials and methods'. Liposomes bore either no proteins or TM-Sec17 (<xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>) at a 1:4000 protein to lipid molar ratio. Floatation assays were conducted as described in <xref ref-type="bibr" rid="bib45">Song et al., 2020</xref>) (<xref ref-type="fig" rid="fig2">Figure 2</xref>). In brief, 30 μl reactions in RB150 contained 0.5 mM liposomal lipid, 125 nM integral TM-Sec17 where present, 0.2% defatted bovine serum albumin (BSA), 1 mM MgCl<sub>2</sub>, and 500 nM HOPS. Reactions were incubated (1 hr, 30°C) and liposomes floated through Histodenz (Sigma, St Louis, MO) density medium. Collected samples were solubilized in 0.125% Thesit, adjusted for lipid recovered, and analyzed for bound proteins by immunoblot for Vps16, a HOPS subunit. Because the reaction contained four times more HOPS than integrally bound TM-Sec17, we express the standard curve as the percent of molar equivalence (to total liposomal TM-Sec17) of HOPS. (<bold>B</bold>) Western blots from three repetitions of this experiment were analyzed by UN-SCAN-IT Software with standard curves. Mean values and standard deviations are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig2-figsupp2-v2.tif"/></fig></fig-group></sec><sec id="s2-2"><title>Sec17-induced conformational change requires HOPS</title><p>Proteoliposomes with R, Qa, and Ypt7 (where indicated) were incubated with Qb-SNARE domain and Qc. Both SNARE domains were either fluorescently labeled at their N-termini (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, bars 1–5) or at their C-termini (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, bars 6–10). Incubations were in the presence or absence of HOPS. Sec17 addition after 1 hr did not enhance the average FRET efficiency between N-terminally disposed fluorophores in the presence or absence of HOPS (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, bars 1–5), but stimulated the average FRET efficiency between SNARE domain C-terminal fluorophores in a HOPS-dependent manner (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, bars 6–10), since the enhanced FRET between the SNAREs in the presence of HOPS and Sec17 (bar 9) is not seen without HOPS (bar 8) or without Sec17 (bar 10). This indicates a HOPS-dependent and Sec17-induced SNARE conformational change. This was diminished when zippering was inhibited by the absence of the +4 to +8 layers of sQa (<xref ref-type="fig" rid="fig2">Figure 2D</xref>, bar 1 vs. 3) or by the conversion of each inward-facing apolar residue of the full-length Qa SNARE domain layers +4 to +8 to Gly (<xref ref-type="fig" rid="fig2">Figure 2E</xref>, bar 1 vs. 3). The F22SM23S mutation of Sec17 (FSMS hereafter), diminishing the hydrophobicity of its N-domain loop (<xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>), reduced the Sec17 capacity for inducing HOPS-dependent conformational change (<xref ref-type="fig" rid="fig2">Figure 2F</xref>). We also examined the effects of other mutants of Sec17. The K159E,K163E mutation (KEKE hereafter) diminishes Sec17:SNARE association (<xref ref-type="bibr" rid="bib27">Marz et al., 2003</xref>); one of these residues (Sec17 K159) is in a pair (αSNAP K122, K163) that abolishes disassembly of the neuronal SNARE complex by NSF/αSNAP (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>). The C-terminal L291A,L292A mutation of Sec17 (LALA hereafter) interferes with its cooperation with Sec18 for SNARE complex disassembly (<xref ref-type="bibr" rid="bib3">Barnard et al., 1997</xref>; <xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>; <xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>), and 6AtoN is the conversion of six inward-facing acidic residues of Sec17, which face basic SNARE residues in the 20S structure (<xref ref-type="fig" rid="fig1">Figure 1C</xref>), to neutral residues. Neither KEKE, LALA, nor 6AtoN had a large effect on the capacity of Sec17 to promote HOPS-dependent conformational change (<xref ref-type="fig" rid="fig2">Figure 2F</xref>).</p><p>Since this Sec17-induced SNARE conformational change is seen with C-terminal fluors but not with N-terminal fluors, requires HOPS as the SNARE assembly catalyst, and requires SNAREs that can zipper, a major part of the conformational change may be zippering itself. This might be spontaneous after Sec17-induced release of HOPS from SNAREs (<xref ref-type="bibr" rid="bib9">Collins et al., 2005</xref>; <xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>) or be promoted by Sec17 binding along the SNAREs (<xref ref-type="fig" rid="fig1">Figure 1C</xref>), reflecting its affinity for the C-terminal region of SNARE bundles (<xref ref-type="bibr" rid="bib26">Ma et al., 2016</xref>). HOPS bound to SNAREs may inhibit C-terminal zippering, even though it helps to assemble the N-terminus of the four-helix bundle. Sec17 could then increase FRET because it displaces HOPS. Such C-terminal zippering would be favored by Sec17 binding, but could also be spontaneous in the absence of these factors.</p><p>Sec17 also interacts with partially zippered SNARE complex to promote SNARE complex stability. SNARE complex was assembled by HOPS on Ypt7/R proteoliposomes with soluble Qa, with the Qb SNARE domain labeled with a fluorophore at a cysteinyl residue upstream of the SNARE domain, and with Qc of full length (w.t.) or with the 3Δ C-terminal truncation, each bearing a fluorophore at its native cysteinyl residue upstream of the SNARE domain. When the complex of proteoliposomes with these fluorescent Qb and Qc had full-length SNARE domains, it was stable whether or not it included Sec17, as there was no loss of average FRET efficiency after addition of excess non-fluorescent Qc (<xref ref-type="fig" rid="fig2">Figure 2G</xref>, bars 1 and 2; <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1G</xref>). In contrast, fluorescent Qc3Δ was ‘chased’ by exchange with non-fluorescent Qc (bar 3), but Sec17 stabilized this SNARE complex, blocking the chase (bar 4). Thus, in the absence of Sec17, the assembly of Qc3Δ into partially zippered SNARE complex is reversible. Each domain of Sec17 helps to stabilize Qc3Δ against exchange (bars 5–8), especially the Sec17 N-terminal apolar loop (bar 5). The HOPS-dependent functions of Sec17, such as promotion of zippering, may be aided by the direct affinity between these proteins (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>).</p></sec><sec id="s2-3"><title>Generality of Sec17 and Sec18 bypass of arrested zippering</title><p>Sec17 can restore fusion when Qc has truncations at the C-terminal end of its SNARE domain (<xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>), stimulated by Sec18 (<xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>). We asked whether Sec17 can restore fusion with similar deletions of residues after the +3 layer in the other Q-SNAREs. Proteoliposomes bearing Ypt7 and R-SNARE were assayed for fusion with proteoliposomes bearing this Rab and any two anchored Q-SNAREs. Proteoliposome mixtures were incubated with HOPS, and the soluble form of the remaining Q-SNARE was deprived of its membrane anchor and a C-terminal portion of its SNARE domain (<xref ref-type="fig" rid="fig3">Figure 3</xref>; A, Qc3Δ; B, sQb3Δ; C, sQa3Δ). As reported by <xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>, there was no fusion with Qc3Δ unless 600 nM Sec17, 300 nM Sec18, and ATP or ATPγS were present (<xref ref-type="fig" rid="fig3">Figure 3A</xref>); these concentrations are in the physiological concentration ranges of Sec17 (150–1100 nM) and Sec18 (250–760 nM) (<xref ref-type="bibr" rid="bib19">Ho et al., 2018</xref>). While ATP and its non-hydrolyzable analog ATPγS support comparable fusion with wild-type SNAREs (<xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>), hydrolyzable ATP inhibits fusion through Sec17/Sec18-mediated disassembly of SNARE complexes when defective SNAREs such as Qc3Δ are present, a proofreading function. The same pattern was seen for fusion with sQb3Δ (<xref ref-type="fig" rid="fig3">Figure 3B</xref>) and sQa3Δ (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). The unique spatial disposition of the Sec17/αSNAP molecules with respect to each SNARE (<xref ref-type="fig" rid="fig1">Figure 1C</xref> and <xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>) makes it unlikely that Sec17 could somehow fill each of the gaps left by each of these deletions to shield apolar residues within the SNARE bundle and thereby continue to drive zippering, or that Sec17 binding could induce the remaining R and two Q +4 to +8 layers to somehow rotate to form a hydrophobic two- or three-layered core.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Fusion is blocked by deletion of the last five C-terminal SNARE domain layers from any single Q-SNARE and is restored by Sec17, Sec18, and ATP or ATPγS.</title><p>(<bold>A</bold>) Fusion incubations, as described in 'Materials and methods', had Ypt7/R and Ypt7/QaQb proteoliposomes (1:8000 Ypt7:lipid molar ratio, 1:16,000 SNARE:lipid molar ratio), 2 μM Qc3Δ, and, where indicated, 600 nM Sec17, 300 nM Sec18, 1 mM ATP (red), or ATPγS (blue). (<bold>B</bold>) Fusion with 2 μM sQb3Δ and with Ypt7/QaQc-tm proteoliposomes, but otherwise as in (<bold>A</bold>). (<bold>C</bold>) Fusion with 2 μM sQa3Δ and with Ypt7/QbQc-tm proteoliposomes, but otherwise as in (<bold>A</bold>). Mean and standard deviations from three independent experiments are shown in <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Source data file (Excel) for <xref ref-type="fig" rid="fig3">Figure 3A,B and C</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-67578-fig3-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Statistics for <xref ref-type="fig" rid="fig3">Figure 3</xref>.</title><p>Fusion blocked by deletion of the C-terminal five layers of any Q-SNARE domain is restored by Sec17 and Sec18. (<bold>A</bold>) Ypt7/R- and Ypt7/QaQb, (<bold>B</bold>) Ypt7/R- and Ypt7/QaQc-tm, and (<bold>C</bold>) Ypt7/R- and Ypt7/QbQc-tm. The experiment in <xref ref-type="fig" rid="fig3">Figure 3</xref> was repeated in triplicate; mean values and standard deviations for fusion after 30 min are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig3-figsupp1-v2.tif"/></fig></fig-group><p>Fusion assays were also performed with Ypt7/R proteoliposomes and each of the three Ypt7/single-anchored Q-SNARE proteoliposomes in the presence of HOPS and the other two soluble Q-SNAREs (<xref ref-type="fig" rid="fig4">Figure 4</xref>). With membrane-anchored Qa and with sQb and Qc having complete SNARE domains, there was HOPS-dependent fusion without further addition (<xref ref-type="fig" rid="fig4">Figure 4A</xref>, black line), though Sec17 and Sec18 with AMP-PNP, ATPγS, or ATP did stimulate (compare black curves, A–D). Deletion of the +4 to +8 layers from either soluble Qb or Qc abolished fusion (<xref ref-type="fig" rid="fig4">Figure 4A</xref>), which was restored by Sec17 and Sec18 with either AMP-PNP, ATPγS, or ATP (B–D, red and blue curves). There was no fusion when both soluble Q-SNAREs had truncated SNARE domains (<xref ref-type="fig" rid="fig4">Figure 4A</xref>, orange), but, strikingly, the fusion was partially restored by Sec17 and Sec18 with ATP (<xref ref-type="fig" rid="fig4">Figure 4D</xref>, orange) and more fully restored when the adenine nucleotide was resistant to hydrolysis (<xref ref-type="fig" rid="fig4">Figure 4</xref>, B and C, orange). With two Q-SNAREs lacking the C-terminal portion of their SNARE domains, the apolar amino acyl residues of the remaining two SNAREs would not be as effectively shielded from water if they continued zippering together. Fusion could not be restored by Sec17 and Sec18 if either soluble SNARE was omitted instead of truncated (green and purple). This fusion with sQb3Δ and Qc3Δ occurs in stages, initially sensitive to antibody to either the HOPS SM subunit Vps33 or Sec18, then acquiring resistance to Vps33 antibody while remaining sensitive to the Sec18 ligand (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>). When only the Qb-SNARE was membrane anchored, there was little fusion without Sec17 and Sec18 (<xref ref-type="fig" rid="fig4">Figure 4E</xref>, black curve). When the SNARE domain of sQa or Qc had been truncated, fusion was strictly dependent on non-hydrolyzable ATP analogs, and little fusion was seen with dual SNARE domain truncation. Similar patterns were seen with anchored Qc (<xref ref-type="fig" rid="fig4">Figure 4</xref>, I–L). We term the fusion induced by Sec17 and Sec18 in the presence of 3Δ SNARE domain truncations ‘zippering bypass fusion’.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Fusion with single membrane-anchored Q-SNAREs.</title><p>(<bold>A–D</bold>) Fusion incubations, as described in 'Materials and methods', had Ypt7/R and Ypt7/Qa proteoliposomes (1:8000 Ypt7-TM:lipid molar ratio, 1:16,000 SNARE:lipid molar ratio), 50 nM HOPS, 2 μM sQb or sQb3Δ, 2 μM Qc or Qc3Δ, and, where indicated, 600 nM Sec17, 300 nM Sec18, and 1 mM ATP, AMP-PNP, or ATPγS. (<bold>E–H</bold>) Fusion incubations as for (<bold>A</bold>), but with Ypt7/Qb proteoliposomes and 2 μM sQa or sQa3Δ, 2 μM Qc or Qc3Δ and Sec17, Sec18, and adenine nucleotide as indicated. (<bold>I–L</bold>) Fusion incubations as for (<bold>A</bold>), but with Ypt7/Qc-tm proteoliposomes and 2 μM sQa or sQa3Δ, 2 μM Qb or sQb3Δ and Sec17, Sec18, and adenine nucleotide as indicated. Mean and standard deviations from more than three independent experiments are shown in <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>.</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Source data file (Excel) for <xref ref-type="fig" rid="fig4">Figure 4A–L</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-67578-fig4-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Statistics data for <xref ref-type="fig" rid="fig4">Figure 4</xref>.</title><p>Fusion between Ypt7/R and (<bold>A–D</bold>) Ypt/Qa, (<bold>E–H</bold>) Ypt7/Qb, or (<bold>I–L</bold>) Ypt7/Qc-tm proteoliposomes. Fusion assays are described in <xref ref-type="fig" rid="fig4">Figure 4</xref>, repeated more than three times. Mean values and standard deviations for fusion after 20 min are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig4-figsupp1-v2.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Selective inhibitors reveal successive fusion intermediates.</title><p>Ypt7/R and Ypt7/Qa proteoliposomes were co-incubated in the presence of HOPS and other fusion proteins or inhibitors, allowing resolution of an early, HOPS-dependent reaction stage from late, Sec18-dependent fusion. Incubations were in sets of three, with either of the three antibody preparations. When HOPS, Ypt7/R and Ypt7/Qa proteoliposomes were mixed with sQb3Δ, Qc3Δ, Sec17, Sec18, and ATPγS plus control IgG or specific antibody from the start of the incubation, fusion was blocked by affinity-purified antibody to either Sec18 (<xref ref-type="bibr" rid="bib16">Haas and Wickner, 1996</xref>) or Vps33 (<xref ref-type="bibr" rid="bib41">Seals et al., 2000</xref>), the SM subunit of HOPS (A, Set 1). In each set, any of these components not present in the initial incubation was added after 30 min. When the proteoliposomes were incubated for 29 min with HOPS, sQb3Δ, and Qc3Δ prior to antibody addition, followed by Sec17, Sec18, and ATPγS 1 min later, the restored fusion remained sensitive to each affinity-purified antibody (Set 2). If, however, the initial 29 min incubation also bore Qc3Δ, alone (Set 4) or in combination with other proteins (Sets 5–8), the restored fusion had acquired resistance to antibody to Vps33 prior to addition of the missing fusion proteins. Incubation with sQb3Δ did not confer resistance to anti-Vps33 (Set 3). Sec17 and Sec18 are not needed to form a reaction intermediate, which is resistant to antibody to Vps33 (Set 4). In contrast, when fusion reactions were blocked by the single omission of either sQb3Δ (Set 5) or Qc3Δ (Set 3), any intermediates that formed were not resistant to antibody to Sec18. A very partial resistance was seen when all the four SNAREs were present during the initial 29 min incubation (Sets 7 and 8). The specificity of inhibition by antibody to Sec18 was confirmed by its failure to inhibit Sec18-independent fusion with full-length sQb and Qc (<bold>B and C</bold>), but there was complete inhibition of Sec18-dependent fusion reactions with sQb3Δ and Qc3Δ (D and E, red). Sec18 thus acts late in the fusion pathway, as incubations of the proteoliposomes with HOPS and Qc3Δ, which confer fusion-resistance to antibody to Vps33 (Set 4), remain sensitive to antibody to Sec18. (<bold>A</bold>) Proteoliposomes with Ypt7/R and proteoliposomes with Ypt7/Qa (1:8000 Ypt7-TM:lipid molar ratio, 1:16,000 SNARE:lipid molar ratio) were mixed with 50 nM HOPS at t = 0. At either t = 0 or at t = 30, indicated subsets of 2 μM sQb3Δ, 2 μM Qc3Δ, 400 nM Sec17, 300 nM Sec18, and 1 mM ATPγS were added to the incubations. To block Sec18 or Vps33, affinity-purified antibody (1 μg) to each was added at t = 0 (sample 1) or at t = 29 (samples 2–8). As a control, 1 μg IgG was added to separate samples as indicated. The average and standard deviations of fusion 10 min after addition of any missing components are shown from three independent experiments. (<bold>B–E</bold>) Sec18 antibody or control IgG inhibition experiments were performed with Ypt7/R and Ypt7/Qa proteoliposomes with 50 nM HOPS, 2 μM sQb and 2 μM Qc (black curves) or 2 μM sQb3Δ and 2 μM Qc3Δ (red curves), 1 μg IgG (filled circles) or αSec18 (open circles), and without (<bold>B and C</bold>) or with (<bold>D and E</bold>) 400 nM Sec17, 300 nM Sec18, and 1 mM ATPγS as indicated. Kinetics shown are representative of four experiments. Mean and standard deviations from four independent experiments are shown. (<bold>F–M</bold>) Representative experiments from (A), Sets 1–8, are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig4-figsupp2-v2.tif"/></fig></fig-group><p>To explore the capacity of Sec17 and Sec18 to compensate for partial SNARE zippering, we assayed the fusion of Ypt7/R and Ypt7/Qa proteoliposomes with sQb3Δ, Qc3Δ, and HOPS, using various concentrations of wild-type or mutant Sec17, and with or without Sec18 and ATPγS (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Without Sec17, fusion is not supported by Sec18 (A and B, blue curves). Limited fusion is possible with 1 or 2 μM wild-type Sec17 alone (A, black and red), but Sec18 allows faster fusion and with less Sec17 (A and B; tan). Fusion requires the apolar loop near the N-terminus of Sec17, as the F21S,M22S mutation (FSMS) blocks fusion entirely (C and D). The K159E,K163E mutation (KEKE) diminishes Sec17:SNARE association (<xref ref-type="bibr" rid="bib27">Marz et al., 2003</xref>). The KEKE mutation prevents fusion without Sec18 (E), but a slow and limited fusion with KEKE-Sec17 is restored by Sec18 (F). The C-terminal L291A,L292A mutation of Sec17 (LALA), which interferes with its cooperation with Sec18 for SNARE complex disassembly (<xref ref-type="bibr" rid="bib3">Barnard et al., 1997</xref>; <xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>; <xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>), diminishes zippering bypass fusion (A vs. G, red curves), and a limited fusion is restored through the addition of Sec18 (H). These data suggest that Sec17 action directly requires its apolar loop domain, since the loss of this apolar region is not bypassed by Sec18. Sec18 may stimulate fusion by modulating the conformation of Sec17 associations with <italic>trans</italic>-SNARE complexes, but Sec18 is not simply promoting Sec17 binding, since it is still needed for fusion when Sec17 is joined to an integral N-terminal membrane anchor (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>). Basic residues in the +3 to +8 layers near the C-terminus of the R and Qa SNARE domains are near acidic residues on the interior of the Sec17 assembly (<xref ref-type="fig" rid="fig5">Figure 5I</xref>). To determine whether Sec17 might rely on these ionic interactions to support fusion, we converted these acidic residues of Sec17 to alanine or serine, creating the mutant Sec17-E34S,E35S,D38S,E73A,D74A,E75A (termed Sec17 6 Acidic to Neutral or Sec17-6AtoN), but this mutant Sec17 still supports fusion (<xref ref-type="fig" rid="fig5">Figure 5</xref>, J and K). Interestingly, mutation of acidic residues of αSNAP near the C-terminal end of the neuronal SNARE complex also only had a modest effect on disassembly activity of NSF/αSNAP (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>).</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Role of each domain of Sec17 in zippering bypass fusion.</title><p>(<bold>A-H, J, K</bold>) Fusion between Ypt7/R and Ypt7/Qa proteoliposomes (1:8000 Ypt7-TM:lipid and 1:16,000 SNARE/lipid molar ratios) was assayed with 50 nM HOPS, 2 μM sQb3Δ, 2 μM Qc3Δ, the indicated concentration of wild-type or mutant Sec17, and with or without 250 nM Sec18 and 1 mM ATPγS. (<bold>I</bold>) Ionic interactions between Sec17s and vacuolar SNAREs in the +4 to +8 layers in the model of the Sec18/Sec17/vacuolar SNARE complex (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Colors: cyan: R; magenta: Qa; yellow: Qb; salmon: Qc; gray, orange, green, slate: Sec17; red: oxygen atoms; blue: nitrogen atoms. Cartoon representations are shown along with side chains shown as thin lines. Thick lines (sticks) are interacting glutamate and aspartate (acidic) residues on the surface of Sec17 (aminoacyl residues 34, 35, 38, 73, 74, 75) that interact with the vacuolar SNARE complex lysine and arginine basic residues in each of the four SNAREs. Mean and standard deviations from four independent experiments are shown in <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>.</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Source data file (Excel) for <xref ref-type="fig" rid="fig5">Figure 5A–H,J and K</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-67578-fig5-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig5-v2.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Mean and standard deviations of fusion after 60 min from four independent assays as in <xref ref-type="fig" rid="fig5">Figure 5</xref> are shown.</title></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig5-figsupp1-v2.tif"/></fig><fig id="fig5s2" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 2.</label><caption><title>Sec18 does not simply promote fusion by contributing to the affinity of Sec17 for membranes that bear SNARE complexes.</title><p>We prepared proteoliposomes with Ypt7, with R or Qa, and with either no Sec17, with an equimolar (to SNAREs) TM-Sec17 that bears an N-terminal hydrophobic transmembrane anchor domain derived from Qb, or with TM-Sec17-F21S,M22S (TM-FSMS hereafter). In the presence of HOPS, sQb3Δ, and Qc3Δ, membrane-anchored Sec17 supported zippering bypass fusion, which was strictly Sec18-dependent (<bold>A–C</bold>, no Sec18; <bold>D–F</bold>, with Sec18 and ATPγS). TM-Sec17 on both sets of proteoliposomes supported fusion (<bold>D</bold> and <bold>G</bold>, black), but fusion was not seen in the absence of TM-Sec17 (<bold>D</bold> and <bold>G</bold>, red), and only limited fusion was seen with TM-Sec17-FSMS (<bold>D</bold> and <bold>G</bold>, blue). Fusion was greatly diminished if TM-Sec17 or TM-Sec17-FSMS was only present on one of the fusion partner proteoliposomes (<bold>E and H</bold>), but there was substantial fusion if one of the proteoliposomes had TM-Sec17 and one had TM-Sec17-FSMS (<bold>F and I</bold>). The simplest model is that several Sec17 molecules are required to form the Sec17 assembly around the SNAREs but that the hydrophobic Sec17 N-domain loop is only necessary on one membrane for fusion. AMP-PNP functioned as well as ATPγS (compare <bold>G–I</bold> to <bold>D–F</bold>), but hydrolyzable ATP completely blocked fusion with membrane-anchored TM-Sec17 (<bold>J–L</bold>), similar to the lower activity of hydrolyzable ATP with wild-type Sec17 (<xref ref-type="fig" rid="fig4">Figure 4</xref>), reflecting the proofreading activity of Sec17/Sec18. (<bold>M</bold>) Statistics data for (<bold>A–L</bold>). Fusion reactions had the indicated proteoliposomes, 50 nM HOPS, 2 μM each of sQb3Δ and Qc3Δ, and either Sec18 buffer (black), 1 mM ATPγS and Sec18 (red), 1 mM AMP-PNP and Sec18 (blue), or 1 mM ATP and Sec18 (orange). Experiments were repeated in quadruplicate; mean values and standard deviations for fusion after 60 min are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig5-figsupp2-v2.tif"/></fig></fig-group></sec><sec id="s2-4"><title>Fusion despite triply-crippled SNARE zippering</title><p>Since SNARE zippering is driven by the sequestration of apolar residues into the interior of the 4-SNARE bundle, we examined the effect of converting the apolar residues of the Qa SNARE domain +4 to +8 layers to Ala, Ser, or Gly. Fusion between Ypt7/R and Ypt7/Qa proteoliposomes in the presence of HOPS, sQb, and Qc, but without Sec17 or Sec18 (<xref ref-type="fig" rid="fig6">Figure 6A</xref>, black curve), was diminished by replacing each of the +4 to +8 layer apolar residues of Qa with Ala (<xref ref-type="fig" rid="fig6">Figure 6A</xref>, green curve) and was abolished when they were replaced by Ser (red curve) or by Gly (blue curve). The persistence of some fusion with the Ala substitutions may reflect that two of the residues were already Ala, that Ala has the greatest propensity among the amino acids to form α-helices, Gly the least, and Ser is in-between (<xref ref-type="bibr" rid="bib35">Pace and Scholtz, 1998</xref>), and that alanine itself is the least hydrophilic of these three amino acids. When these same incubations were performed with Sec17, Sec18, and ATPγS, rapid and comparable fusion was seen in each case (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). When hydrolyzable ATP was used instead of ATPγS, there was little effect on the fusion kinetics with wild-type SNARE domain sequences (<xref ref-type="fig" rid="fig6">Figure 6</xref>, B vs. C, black curves). In contrast, hydrolyzable ATP led to fusion inhibition when SNARE packing stability was reduced by substitution of apolar residues by Ala, Ser, or Gly (<xref ref-type="fig" rid="fig6">Figure 6C</xref>). Though the apolar residues are not required for fusion aided by Sec17 and Sec18 (<xref ref-type="fig" rid="fig6">Figure 6B</xref>), they apparently stabilize the SNAREs against ATP-driven proofreading disassembly (<xref ref-type="fig" rid="fig6">Figure 6C</xref>). To triply weaken the completion of zippering, the same proteoliposomes with wild-type Qa or the Qa with +4 to +8 layers having small side-chain residues instead of apolar residues were incubated with HOPS, sQb3Δ, and Qc3Δ, either without Sec17 or Sec18 (<xref ref-type="fig" rid="fig6">Figure 6D</xref>) or with Sec17, Sec18, and ATPγS (<xref ref-type="fig" rid="fig6">Figure 6E</xref>) or ATP (<xref ref-type="fig" rid="fig6">Figure 6F</xref>). Fusion was optimally supported by Sec17, Sec18, and ATPγS (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). The independence of this fusion from energy derived by zippering is underscored by the similar fusion rates in all incubations with Sec17, Sec18, and ATPγS, whether with apolar or polar Qa +4 to +8 residues or with full-length or +4to +8-truncated sQb and Qc (<xref ref-type="fig" rid="fig6">Figure 6</xref>, B vs. E). With the Qb and Qc SNARE domains truncated, and the Qa lacking apolar inward-facing amino acyl side chains, little or no energy could be gained from the completion of R and mutant-Qa zippering. Thus, Sec17 acts in three ways: triggering a zippering-dependent SNARE conformational change in the presence of HOPS and full-length SNARE domains (<xref ref-type="fig" rid="fig2">Figure 2</xref>), acting with Sec18 to promote fusion independent of energy from zippering (<xref ref-type="fig" rid="fig6">Figure 6</xref>), and supporting the disassembly of post-fusion <italic>cis</italic>-SNARE complexes by Sec18.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Sec17, Sec18, and ATPγS restore fusion to Ypt7/R and Ypt7/Qa proteoliposomes, which were triply-crippled from completion of SNARE domain zippering by deletion of the +4 to +8 layers of the sQb and Qc SNAREs and by substitution of the apolar residues of the +4 to +8 layers of Qa, substituting Ala, Ser, or Gly for L238, M242, A245, L249, and A252.</title><p>Fusion incubations ('Materials and methods') had (<bold>A–C</bold>) Ypt7/R and Ypt7/Qa (w.t. (black), Gly mutant (blue), Ser mutant (red), or Ala mutant (green)) proteoliposomes (1:8000 Ypt7-TM:lipid molar ratio, 1:16,000 SNARE:lipid molar ratio), 50 nM HOPS, 2 μM sQb (w.t.), and 2 μM Qc (w.t.) (<bold>A–C</bold>) or (<bold>D–F</bold>) 2 μM Qc3Δ and 2 μM sQb3Δ. Sec17 and Sec18 buffers (<bold>A and D</bold>) or 600 nM Sec17, 300 nM Sec18, and 1 mM ATPγS (<bold>B and E</bold>) or ATP (<bold>C and F</bold>) were also present. Kinetics shown are representative of four experiments. Mean and standard deviations from four independent experiments are shown in <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>.</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>Source data file (Excel) for <xref ref-type="fig" rid="fig6">Figure 6A–F</xref>.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-67578-fig6-data1-v2.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig6-v2.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Fusion assays between Ypt7/R- and Ypt7/Qa with Qa w.t. (black), Qa 5Ala mutant (green), Qa 5Gly mutant (blue), or Qa 5Ser mutant (red) as described in <xref ref-type="fig" rid="fig6">Figure 6</xref>.</title><p>(<bold>A–C</bold>) Fusion with 2 μM sQb and 2 μM Qc. (<bold>D–F</bold>) Fusion with 2 μM sQb3Δ and 2 μM Qc3Δ. Experiments were repeated in quadruplicate; mean values and standard deviations for fusion after 30 min are shown.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig6-figsupp1-v2.tif"/></fig></fig-group></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>The catalytic roles of fusion proteins have been gleaned from functional reconstitution studies. These studies initially showed that the zippering of concentrated SNAREs can drive slow fusion (<xref ref-type="bibr" rid="bib58">Weber et al., 1998</xref>; <xref ref-type="bibr" rid="bib14">Fukuda et al., 2000</xref>). As proteoliposome SNARE levels were lowered toward physiological levels, reconstituted vacuolar and neuronal fusion reactions required additional factors (<xref ref-type="bibr" rid="bib69">Zick and Wickner, 2016</xref>; <xref ref-type="bibr" rid="bib50">Stepien and Rizo, 2021</xref>). In addition to SNAREs, reconstituted neuronal fusion requires Munc18, Munc13, calcium, NSF, and αSNAP (<xref ref-type="bibr" rid="bib25">Ma et al., 2013</xref>; <xref ref-type="bibr" rid="bib23">Lai et al., 2017</xref>) while reconstituted vacuole fusion needs HOPS (<xref ref-type="bibr" rid="bib51">Stroupe et al., 2006</xref>), the Rab Ypt7 (<xref ref-type="bibr" rid="bib52">Stroupe et al., 2009</xref>; <xref ref-type="bibr" rid="bib32">Ohya et al., 2009</xref>), and specific lipid head-group composition and fatty acyl fluidity (<xref ref-type="bibr" rid="bib69">Zick and Wickner, 2016</xref>). HOPS and other SM proteins catalyze SNARE assembly (<xref ref-type="bibr" rid="bib2">Baker et al., 2015</xref>; <xref ref-type="bibr" rid="bib34">Orr et al., 2017</xref>; <xref ref-type="bibr" rid="bib21">Jiao et al., 2018</xref>), regulated by an activated Rab (<xref ref-type="bibr" rid="bib69">Zick and Wickner, 2016</xref>; <xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>), and may confer resistance to Sec17/αSNAP- and Sec18/NSF-mediated <italic>trans</italic>-SNARE disassembly (<xref ref-type="bibr" rid="bib62">Xu et al., 2010</xref>; <xref ref-type="bibr" rid="bib22">Jun and Wickner, 2019</xref>). Sec17/αSNAP and Sec18/NSF stimulate fusion with HOPS and wild-type SNAREs (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>).</p><p>Fusion can be supported by either complete 4-SNARE zippering without Sec17 or Sec18, or by Sec17 and Sec18 association with only partially zippered SNAREs, but the most rapid fusion requires both (<xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>). While Sec17 and Sec18 are known to bypass the fusion blockade by Qc C-terminal truncation alone (<xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>; <xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>), the generality of this bypass with respect to any one Q-SNARE or even two Q-SNAREs (<xref ref-type="fig" rid="fig3">Figures 3</xref> and <xref ref-type="fig" rid="fig4">4</xref>) shows that it is not specific to Qc alone. Moreover, when zippering with full-length SNARE domains is weakened by the substitution of small amino acyl residues for large apolar residues in the +4 to +8 layers of Qa, Sec17 and Sec18 will also restore fusion (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref>). Strikingly, Sec17 and Sec18 drive fusion despite a triple blockade to complete zippering, namely the absence of two C-terminal Q-SNARE domains and the lack of apolarity in the third (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). In the NSF/αSNAP/SNARE complex, the 4-SNAREs wrap around each other in a left-handed super helix, and the Sec17s wrap around them in a right-handed fashion, yet they form a specific structure (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>; <xref ref-type="bibr" rid="bib59">White et al., 2018</xref>). It seems unlikely that residues from one or more Sec17 could substitute for the missing residues when two heptads are removed from the C-termini of one or even two Q-SNAREs and the bulky apolar residues are removed from the third.</p><p>From the earliest reconstitutions of HOPS-dependent fusion (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>) and in subsequent studies (e.g., <xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>), Sec17 and Sec18 gave strong stimulation. In contrast, Sec17 and Sec18 inhibit SNARE-only fusion, or fusion with non-physiological tethers (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib68">Zick and Wickner, 2014</xref>; <xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>; <xref ref-type="bibr" rid="bib47">Song and Wickner, 2019</xref>). HOPS not only binds each SNARE, but also has direct affinity for Sec17 (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>). In model studies with <italic>cis</italic>-SNARE complexes, HOPS is necessary for Sec17 to enhance zippering per se (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). HOPS:Sec17 binding may underlie their synergy for fusion, but further studies are needed to test this idea.</p><p>Earlier studies and our current work suggest a working model of vacuole membrane fusion, encompassing findings here and elsewhere (<xref ref-type="fig" rid="fig7">Figure 7</xref>). HOPS exploits the affinity of its Vps39 and Vps41 subunits for the Rab Ypt7 (<xref ref-type="bibr" rid="bib4">Brett et al., 2008</xref>) on each fusion partner membrane (<xref ref-type="fig" rid="fig7">Figure 7A</xref>) to mediate (Step 1) tethering (<xref ref-type="bibr" rid="bib18">Hickey and Wickner, 2010</xref>). Tethered membranes (<xref ref-type="fig" rid="fig7">Figure 7B</xref>) are a prerequisite for SNARE assembly in an active conformation, likely a common N to C SNARE domain orientation (<xref ref-type="bibr" rid="bib47">Song and Wickner, 2019</xref>). HOPS has direct affinity for each of the four vacuolar SNAREs (<xref ref-type="bibr" rid="bib45">Song et al., 2020</xref>) and is allosterically activated by vacuolar lipids and Ypt7:GTP (<xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>) as a catalyst of SNARE assembly (Step 2). SNAREs begin to zipper (<xref ref-type="fig" rid="fig7">Figure 7C</xref>) from the N- toward the C-terminal end of their SNARE domain. When any one Q-SNARE is omitted, fusion intermediates assemble, which undergo very rapid fusion when the missing Q-SNARE is supplied (<xref ref-type="bibr" rid="bib45">Song et al., 2020</xref>), suggesting that fusion without Sec17/Sec18 is rate-limited by the completion of SNARE zippering and/or the spontaneous release of bulky HOPS. Sec17 has direct affinity for SNAREs (<xref ref-type="bibr" rid="bib43">Söllner et al., 1993</xref>), HOPS (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>), lipids (<xref ref-type="bibr" rid="bib8">Clary et al., 1990</xref>; <xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>), and Sec18 (<xref ref-type="bibr" rid="bib43">Söllner et al., 1993</xref>). Sec17 displaces HOPS from the SNAREs (<xref ref-type="fig" rid="fig7">Figure 7</xref>, Step 3), as shown by earlier studies: (1) vacuolar SNAREs are found in complex with Sec17 or HOPS, but not with both, and Sec17 can displace HOPS from SNAREs (<xref ref-type="bibr" rid="bib9">Collins et al., 2005</xref>); (2) when vacuolar HOPS-dependent reconstituted fusion is arrested by Qc3Δ, HOPS is bound to the incompletely zippered SNARE complex until it is displaced by Sec17 (<xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>); and (3) <italic>trans</italic>-SNARE complexes, which assemble between isolated vacuoles, are largely associated with Sec17 (<xref ref-type="bibr" rid="bib62">Xu et al., 2010</xref>). The Sec17 association with partially zippered <italic>trans</italic>-SNARE complex (<xref ref-type="fig" rid="fig7">Figure 7D</xref>) promotes a conformational change (<xref ref-type="fig" rid="fig2">Figure 2</xref>) leading to complete zippering. The Sec17: 4-SNARE complex will bind Sec18 (Step 4) through its affinities for both SNAREs (<xref ref-type="bibr" rid="bib66">Zick et al., 2015</xref>) and for Sec17. Sec18 regulates, in some unknown fashion, the Sec17/αSNAP assembly into an oligomeric structure surrounding the SNARE complex intermediate (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>), a <italic>trans</italic>-anchored Sec18/Sec17/SNARE pre-fusion complex (<xref ref-type="fig" rid="fig7">Figure 7E</xref>). Some ATP hydrolysis-dependent disassembly can occur, which may represent proofreading of incorrect and unstable <italic>trans</italic>-SNARE complexes (<xref ref-type="bibr" rid="bib7">Choi et al., 2018</xref>). Sec17 oligomerization may also be stabilized or guided by the insertion of its N-terminal loop into the membranes. While SNAREs can slowly complete zippering and support fusion without Sec17 or Sec18 (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>), and slow fusion can occur with Sec17 and Sec18 when sQb and Qc lack the C-terminal portion of their zippering domain (<xref ref-type="fig" rid="fig4">Figure 4D</xref>), optimal fusion requires four complete SNARE domains, Sec17/αSNAP, and Sec18/NSF. The energy for fusion (Step 5) derives from multiple sources: the completion of SNARE zippering, the binding energies which create the Sec17 structure surrounding the SNAREs, and the energy of bilayer distortion through Sec17 apolar loop insertion. <italic>Cis</italic>-SNARE complexes (<xref ref-type="fig" rid="fig7">Figure 7F</xref>) formed by fusion (<xref ref-type="bibr" rid="bib43">Söllner et al., 1993</xref>; <xref ref-type="bibr" rid="bib28">Mayer et al., 1996</xref>) are disassembled by Sec17, Sec18, and ATP (Step 6), freeing SNAREs from each other (<xref ref-type="fig" rid="fig7">Figure 7A</xref>) for later assembly in <italic>trans</italic>. Each of these components – the four SNAREs, the Rab Ypt7, HOPS, Sec17, and Sec18 – is part of this ordered pathway of associations and disassembly, constituting a holoenzyme for vacuole membrane fusion.</p><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Current working model.</title><p>Catalyzed tethering and SNARE assembly (<bold>A–C</bold>) is followed by HOPS displacement by Sec17 (<bold>C and D</bold>) and further assembly of Sec17 and Sec18 on the partially zippered SNARE complex, promoting completion of zippering and apolar Sec17 loop insertion (<bold>D–F</bold>), both of which promote fusion. See text for discussion.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-67578-fig7-v2.tif"/></fig><p>Our current studies reveal a general capacity of Sec17/αSNAP and Sec18/NSF to support fusion, even when little or no energy would be derived from completion of zippering. Sec17 provides a cage-like environment (<xref ref-type="bibr" rid="bib5">Chakraborty et al., 2010</xref>), albeit with side fenestrations (<xref ref-type="bibr" rid="bib39">Schwartz et al., 2017</xref>), which may favor SNARE zippering or, where zippering is blocked, allow the remaining SNARE domains to attain positions and conformations that approximate zippering. The apolar N-domains of the four Sec17s are clearly essential for fusion (<xref ref-type="fig" rid="fig5">Figure 5</xref> and <xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>), whether through positioning the Sec17s, facilitating their assembly, or directly inserting as a ‘membrane wedge’ and thereby contributing to bilayer disruption at the fusion site. The continued need for this apolar loop when Sec17 is integrally membrane-anchored (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2</xref>) shows that it does not simply contribute to Sec17 membrane association. Elements of ‘Sec17 cage’ and ‘membrane wedge’ action are not mutually exclusive. Further work will be needed to determine the relative energies of Sec17 and Sec18 binding to the assembling 4-SNARE <italic>trans</italic>-complex, each of the four Sec17s inserting its apolar loops into the membrane, Sec17 forming lateral associations with other Sec17 molecules in the cage around the SNAREs, and complete SNARE zippering, as each of these helps to achieve the bilayer distortions of fusion.</p><p>Our current studies further our understanding of how Sec17(αSNAP), Sec18 (NSF), and SNAREs cooperate to promote membrane fusion. Sec17 has multiple functions: (a) It supports Sec18 association with SNARE complexes for their ATP-driven disassembly for subsequent rounds of fusion (<xref ref-type="bibr" rid="bib55">Ungermann et al., 1998</xref>; <xref ref-type="bibr" rid="bib7">Choi et al., 2018</xref>). Sec17/αSNAP and Sec18/NSF are also part of a quality control system that, for vacuoles, includes HOPS (<xref ref-type="bibr" rid="bib49">Starai et al., 2008</xref>) and, in the neuronal system, includes Munc18 and Munc13 (<xref ref-type="bibr" rid="bib25">Ma et al., 2013</xref>; <xref ref-type="bibr" rid="bib23">Lai et al., 2017</xref>). These disassembly reactions require ATP hydrolysis and can be interrupted by the Sec17 LALA mutation. (b) Sec17 promotes a conformational change that leads to complete SNARE zippering. While neuronal SNAREs, which are properly assembled (i.e., involving the Munc18/Munc13 pathway), will fully zipper with a high energy yield, this may not be true for all non-neuronal SNAREs. (c) Sec17 promotes fusion even when SNARE zippering is incomplete. Sec17 uses the partially zippered SNAREs as a platform to bind to the fusion site and its apolar N-domain loop to trigger fusion. Sec18 also has multiple functions: (a) Sec18/NSF drives ATP-driven SNARE disassembly (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>), blocked by the Sec17 LALA mutation. (b) Sec18 supports Sec17 for direct promotion of fusion, built on a platform of partially zippered SNAREs. Note that the loading of SNARE N-terminal residues into the pore of the D1 ring of NSF does not require hydrolysis (<xref ref-type="bibr" rid="bib59">White et al., 2018</xref>), so initial assembly of the NSF/αSNAP/SNARE complex occurs in the absence of hydrolysis. This does not need ATP hydrolysis and is insensitive to the LALA mutation. Thirdly, SNAREs also have multiple functions: (a) They can completely zipper, thereby stressing the bilayer and triggering fusion (<xref ref-type="bibr" rid="bib58">Weber et al., 1998</xref>; <xref ref-type="bibr" rid="bib53">Sutton et al., 1998</xref>). As previously reported (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>), HOPS alone, without Sec17 or Sec18, will support slow SNARE-dependent fusion. (b) SNAREs support the assembly of a microdomain in which multiple fusion proteins and lipids become highly enriched (<xref ref-type="bibr" rid="bib13">Fratti et al., 2004</xref>). (c) As shown here, SNAREs form an essential platform for Sec17 and Sec18 to contribute to fusion independently of completion of zippering. With physiological levels of wild-type vacuolar SNAREs, rapid fusion requires Rab-activated HOPS, Sec17, Sec18, and ATP.</p><p>While intracellular fusion reactions share many requirements, such as for SNAREs and SM protein, there are major differences as well. Synaptic vesicle fusion and other calcium-dependent secretion systems require calcium, synaptotagmin, Munc13, and complexin, none of which have their obvious counterparts in calcium-independent systems. Vacuole and endosome fusion have their SM protein as an integral subunit of the tethering complex, which is not seen in other organelles. The similarities and differences in fusion pathways at each organelle will be clarified as each is more thoroughly studied.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th>Reagent type (species) or resource</th><th>Designation</th><th>Source or reference</th><th>Identifiers</th><th>Additional information</th></tr></thead><tbody><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Nyv1</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000004083</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vam3</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000005632</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vti1</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000004810</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vam7</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000003180</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Ypt7</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000004460</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Sec17</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000000146</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Sec18</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000000284</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vps33</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000004388</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vps39</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000002235</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vps41</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000002487</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vps16</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000005966</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vps11</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000004844</td><td/></tr><tr><td>Gene (<italic>Saccharomyces cerevisiae</italic>)</td><td>Vps18</td><td><italic>Saccharomyces</italic> Genome Database</td><td>SGD:S000004138</td><td/></tr><tr><td>Peptide, recombinant protein</td><td>GST-R (Nyv1)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/18650938/">18650938</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>GST-Qa (Vam3)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/18650938/">18650938</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>GST-Qb (Vti1)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/18650938/">18650938</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>His-R (Nyv1)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/22174414/">22174414</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>GST-sQa (soluble)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/28637767/">28637767</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>MBP-sQb (soluble)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/24088569/">24088569</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>GST-Qb (Vti1)3Δ</td><td>This study</td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>GST-Qa (Vam3)3Δ</td><td>This study</td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Qc (Vam7)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/17699614/">17699614</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Qc (Vam7)-tm</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/23071309/">23071309</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Qc (Vam7) C208S, M250C</td><td>This study</td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Qc (Vam7) C208S, A316C</td><td>This study</td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>MBP-Cys-sQb (SNARE domain)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/28637767/">28637767</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>MBP-Cys-sQb (SNARE domain)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/28637767/">28637767</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Ypt7</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/24088569/">24088569</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Ypt7-TM</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/31235584/">31235584</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Sec17</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/19414611/">19414611</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Sec17 FSMS</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/28925353/">28925353</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Sec17 KEKE</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/28925353/">28925353</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>Sec17 LALA</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/19414611/">19414611</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>GST-Sec17 6AtoN</td><td>This study</td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>GST-Sec17-TM</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/28718762/">28718762</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>GST-Sec17-TM FSMS</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/28718762/">28718762</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>TEV protease</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/18007597/">18007597</ext-link></td><td/><td>Purified from <italic>E. coli</italic>.</td></tr><tr><td>Peptide, recombinant protein</td><td>HOPS</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/18385512/">18385512</ext-link></td><td/><td>Purified from <italic>Saccharomyces cerevisiae</italic>.</td></tr><tr><td>Antibody</td><td>Anti-Vam3 (rabbit polyclonal)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/12566429/">12566429</ext-link></td><td>Wickner lab stock</td><td>WB: 1:2000</td></tr><tr><td>Antibody</td><td>Anti-Nyv1 (rabbit polyclonal)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/10385523/">10385523</ext-link></td><td>Wickner lab stock</td><td>WB: 0.65 μg/ml</td></tr><tr><td>Antibody</td><td>Anti-Vti1 (rabbit polyclonal)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/18007597/">18007597</ext-link></td><td>Wickner lab stock</td><td>WB: 0.47 μg/ml</td></tr><tr><td>Antibody</td><td>Anti-Vam7 (rabbit polyclonal)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/14734531/">14734531</ext-link></td><td>Wickner lab stock</td><td>WB: 0.1 μg/ml</td></tr><tr><td>Antibody</td><td>Anti-Vps16 (rabbit polyclonal)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/18007597/">18007597</ext-link></td><td>Wickner lab stock</td><td>WB: 1 μg/ml</td></tr><tr><td>Antibody</td><td>Anti-Vps33 (rabbit polyclonal)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/10944212/">10944212</ext-link></td><td>Wickner lab stock</td><td>Inhibition assay: 1 μg</td></tr><tr><td>Antibody</td><td>Anti-Sec18 (rabbit polyclonal)</td><td>PMID:<ext-link ext-link-type="uri" xlink:href="https://pubmed.ncbi.nlm.nih.gov/11483507/">11483507</ext-link></td><td>Wickner lab stock</td><td>Inhibition assay: 1 μg</td></tr><tr><td>Chemical compound, drug</td><td>Cy5-derivatized streptavidin</td><td>SeraCare Life Sciences</td><td>5270–0023</td><td/></tr><tr><td>Chemical compound, drug</td><td>Biotinylated PhycoE</td><td>Thermo Fisher Scientific</td><td>p811</td><td/></tr><tr><td>Chemical compound, drug</td><td>Streptavidin</td><td>Thermo Fisher Scientific</td><td>434302</td><td/></tr><tr><td>Chemical compound, drug</td><td>1,2-dilinoleoyl-sn-glycero-3-phosphocholine</td><td>Avanti polar lipids</td><td>850385</td><td/></tr><tr><td>Chemical compound, drug</td><td>1,2-dilinoleoyl-sn-glycero-3-phospho-L-serine</td><td>Avanti polar lipids</td><td>840040</td><td/></tr><tr><td>Chemical compound, drug</td><td>1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine</td><td>Avanti polar lipids</td><td>850755</td><td/></tr><tr><td>Chemical compound, drug</td><td>1,2-dilinoleoyl-sn-glycero-3-phosphate</td><td>Avanti polar lipids</td><td>840885</td><td/></tr><tr><td>Chemical compound, drug</td><td>L-α-phosphatidylinositol</td><td>Avanti polar lipids</td><td>840044</td><td/></tr><tr><td>Chemical compound, drug</td><td>1,2-dipalmitoyl-sn-glycerol</td><td>Avanti polar lipids</td><td>800816</td><td/></tr><tr><td>Chemical compound, drug</td><td>Ergosterol</td><td>Sigma</td><td>45480</td><td/></tr><tr><td>Chemical compound, drug</td><td>PI(3)P</td><td>Echelon Bioscience</td><td>P-3016</td><td/></tr><tr><td>Chemical compound, drug</td><td>Rhodamine DHPE</td><td>Invitrogen</td><td>L1392</td><td/></tr><tr><td>Chemical compound, drug</td><td>NBD-PE</td><td>Invitrogen</td><td>N360</td><td/></tr><tr><td>Chemical compound,drug</td><td>Marina-blue</td><td>Invitrogen</td><td>M12652</td><td/></tr><tr><td>Software and algorithms</td><td>UN-SCAN-IT</td><td>Silk Scientific</td><td/><td/></tr><tr><td>Chemical compound, drug</td><td>Alexa Fluor 568 C5-maleimide</td><td>Thermo Fisher Scientific</td><td>A20341</td><td/></tr><tr><td>Chemical compound, drug</td><td>Oregon Green 488 Maleimide</td><td>Thermo Fisher Scientific</td><td>O6034</td><td/></tr><tr><td>Chemical compound, drug</td><td>Oregon Green 488 Maleimide</td><td>Thermo Fisher Scientific</td><td>O6034</td><td/></tr><tr><td>Chemical compound, drug</td><td>Pierce TCEP-HCl</td><td>Thermo Fisher Scientific</td><td>20490</td><td/></tr><tr><td>Chemical compound, drug</td><td>L-cysteine</td><td>Sigma-Aldrich</td><td>30089</td><td/></tr></tbody></table></table-wrap><p>PI3P was from Echelon (Salt Lake City, Utah), ergosterol from Sigma (St. Louis, MO), fluorescent lipids from Thermo Fisher (Waltham, MA), and other lipids were from Avanti (Alabaster, AL). Biobeads SM2 were from BioRad, Cy5-Streptavidin from SeraCare (Milford, MA), biotinylated phycoerythrin from Invitrogen (Eugene, OR), and underivatized streptavidin from Thermo Fisher. Spectrapor six dialysis tubing (7.5 mm diameter, 25 kDa cutoff) was from Spectrum Labs (Las Vegas, NV). Octyl-b-D-glucopyranoside was purchased from Anatrace (Maumee, OH).</p><sec id="s4-1"><title>Mutant constructions</title><p>Sec17 with six acidic amino acids mutated to neutral residues, GST-Sec17 (E34S, E35S, D38S, E73A, D74A, E75A), was generated by PCR with Phusion high-fidelity DNA polymerase (NEB). The DNA fragment was cloned into BamHI- and SalI-digested pGST parallel1 vector (<xref ref-type="bibr" rid="bib42">Sheffield et al., 1999</xref>) with an In-Fusion kit (Takara Bio USA, Mountain View, CA). Using inverse PCR, pParallel1-GST-Sec17 mutant (E34S, E35S, and D38S) was amplified with Phusion high-fidelity DNA polymerase (NEB) from a GST-Sec17 construct. The amplified linear DNA was re-circularized with an In-fusion kit (Takara Bio USA). To generate Sec17 acidic to neutral mutants, pParallel1-GST-Sec17 mutant (E34S, E35S, and D38S) was amplified with a Sec17 E73A, D74A, and E75A mutant primer set using Phusion high-fidelity DNA polymerase (NEB) and re-circularized with an In-fusion kit (Takara Bio USA).</p><list list-type="simple"><list-item><p>For Sec17-E34S,E35S, D38S,</p></list-item><list-item><p>F: <named-content content-type="sequence">TCGTCGGCTGCTTCTCTTTGTGTCCAAGCAGCCAC</named-content></p></list-item><list-item><p>R: <named-content content-type="sequence">AGAAGCAGCCGACGAAAACTTGTATGAATCAGAAC</named-content></p></list-item><list-item><p>For Sec17 E73A, D74A, E75A,</p></list-item><list-item><p>F: <named-content content-type="sequence">GGTAATGCAGCCGCAGCAGGAAATACCTACGTAGA</named-content></p></list-item><list-item><p>R: <named-content content-type="sequence">TGCGGCTGCATTACCAGCCTTTTTCTGATAGTCAG</named-content></p></list-item></list><p>GST-sQa3Δ with amino acyl residues 1–235 and GST-sQb3Δ with amino acyl residues 1–160 were generated by PCR with Phusion high-fidelity DNA polymerase (NEB). DNA fragments were cloned into BamHI- and SalI-digested pGST parallel1 vector (<xref ref-type="bibr" rid="bib42">Sheffield et al., 1999</xref>) with an In-Fusion kit (Takara Bio USA).</p><list list-type="simple"><list-item><p>For GST-sQa3Δ,</p></list-item><list-item><p>F: <named-content content-type="sequence">AGGGCGCCATGGATCCGATGTCCTTTTTCGACATCGA</named-content></p></list-item><list-item><p>R: <named-content content-type="sequence">AGTTGAGCTCGTCGACTAGATATTCTCGTCTATGGTGG</named-content></p></list-item><list-item><p>For GST-sQb3Δ,</p></list-item><list-item><p>F: <named-content content-type="sequence">AGGGCGCCATGGATCCGATGAGTTCCCTATTAATA</named-content></p></list-item><list-item><p>R: <named-content content-type="sequence">AGTTGAGCTCGTCGACTACAAGGTCTGTCTTGCATTTT</named-content></p></list-item></list><p>To generate Qa with L238, M242, A245, L249, and A252 changed to Ala, Ser, or Gly, the pParallel1 GST vector with Qa lacking residues 228–257 was generated by inverse PCR with pParallel1 GST-Qa (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>) using Phusion high-fidelity DNA polymerase (NEB). The DNA duplex with mutations (Gly, Ser, or Ala) of the +4 to +8 heptad repeats was cloned into the amplified vector bearing Qa 1–227 with an In-fusion kit (Takara Bio USA, Mountain View, CA).</p><sec id="s4-1-1"><title>For inverse PCR of pParallel1 GST and Qa 1–227,</title><list list-type="simple"><list-item><p>F: <named-content content-type="sequence">GACCAGCATCAGAGGGACCG</named-content></p></list-item><list-item><p>R: <named-content content-type="sequence">GTCTATGGTGGTTACTTGTT</named-content></p></list-item></list></sec><sec id="s4-1-2"><title>For the Gly mutant of Qa,</title><list list-type="simple"><list-item><p>Sequence 1: <named-content content-type="sequence">GTAACCACCATAGACGAGAATATCTCGCATGGCCATGATAACGGCCAGAATGGCAACAAACAAGGCACCAGAGGCGACCAGCATCAGAGG</named-content></p></list-item><list-item><p>Sequence 2: <named-content content-type="sequence">CCTCTGATGCTGGTCGCCTCTGGTGCCTTGTTTGTTGCCATTCTGGCCGTTATCATGGCCATGCGAGATATTCTCGTCTATGGTGGTTAC</named-content></p></list-item></list></sec><sec id="s4-1-3"><title>For the Ser mutant of Qa,</title><list list-type="simple"><list-item><p>Sequence 1: <named-content content-type="sequence">GTAACCACCATAGACGAGAATATCTCGCATAGCCATGATAACAGCCAGAATAGCAACAAACAAAGCACCAGAAGCGACCAGCATCAGAGG</named-content></p></list-item><list-item><p>Sequence 2: <named-content content-type="sequence">CCTCTGATGCTGGTCGCTTCTGGTGCTTTGTTTGTTGCTATTCTGGCTGTTATCATGGCTATGCGAGATATTCTCGTCTATGGTGGTTAC</named-content></p></list-item></list></sec><sec id="s4-1-4"><title>For the Ala mutant of Qa,</title><list list-type="simple"><list-item><p>Sequence 1: <named-content content-type="sequence">GTAACCACCATAGACGAGAATATCTCGCATGCCCATGATAACGCCCAGAATGCCAACAAACAAGCCACCAGAGCCGACCAGCATCAGAGG</named-content></p></list-item><list-item><p>Sequence 2: <named-content content-type="sequence">CCTCTGATGCTGGTCGGCTCTGGTGGCTTGTTTGTTGGCATTCTGGGCGTTATCATGGGCATGCGAGATATTCTCGTCTATGGTGGTTAC</named-content></p></list-item></list><p>Vam7 mutants with cysteines inserted at the N- and C-termini of the SNARE domain were generated by inverse PCR with the Vam7 intein vector (<xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>) and Phusion high-fidelity DNA polymerase (NEB). First, the native cysteine was removed by mutating it to serine (C208S) using the mutant primer set below. Vam7 mutants with cysteines inserted near the N- and C-termini of the SNARE domain, M250C and A316C, respectively, were generated from the cysteine-lacking plasmid in the same fashion.</p><list list-type="simple"><list-item><p>For Vam7-C208S,</p></list-item><list-item><p>F: <named-content content-type="sequence">GAAAGCGATGACATTGGTACAGCAAACATAGCTCA</named-content></p></list-item><list-item><p>R: <named-content content-type="sequence">CAATGTCATCGCTTTCCTTGAGCAAGGACCTCAAT</named-content></p></list-item><list-item><p>For Vam7-C208S,M250C (Qc with N-terminal cysteine),</p></list-item><list-item><p>F: <named-content content-type="sequence">GGGCAGTGTCAAATGGTGCGCGATCAAGAACAA</named-content></p></list-item><list-item><p>R: <named-content content-type="sequence">CCATTTGACACTGCCCCTGTTGCAAATCGTTAT</named-content></p></list-item><list-item><p>For Vam7-C208S,A316C (Qc with C-terminal cysteine),</p></list-item><list-item><p>F: <named-content content-type="sequence">CAACAGTTGTTGAATTCTCGAGCACCACCA</named-content></p></list-item><list-item><p>R: <named-content content-type="sequence">CAACAACTGTTGTTAAAATGTCTAGCCTTCTTGTTGGC</named-content></p></list-item></list></sec></sec><sec id="s4-2"><title>Protein isolation</title><p>HOPS and prenyl-Ypt7 (<xref ref-type="bibr" rid="bib67">Zick and Wickner, 2013</xref>), Ypt7-TM (<xref ref-type="bibr" rid="bib45">Song et al., 2020</xref>), Sec17 (<xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>), TM-anchored Sec17 and TM-anchored Sec17-F21SM22S (<xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>), Sec18 (<xref ref-type="bibr" rid="bib28">Mayer et al., 1996</xref>), wild-type vacuolar SNAREs and his6-R (<xref ref-type="bibr" rid="bib29">Mima et al., 2008</xref>; <xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>; <xref ref-type="bibr" rid="bib70">Zucchi and Zick, 2011</xref>; <xref ref-type="bibr" rid="bib20">Izawa et al., 2012</xref>), sQb (<xref ref-type="bibr" rid="bib67">Zick and Wickner, 2013</xref>) Qc-C208SM250C, Qc-C208SA316C, and Qc3Δ (<xref ref-type="bibr" rid="bib40">Schwartz and Merz, 2009</xref>) were purified as described. sQa, sQa3Δ, and sQb3Δ were purified by a modification of prior methods (<xref ref-type="bibr" rid="bib67">Zick and Wickner, 2013</xref>; <xref ref-type="bibr" rid="bib45">Song et al., 2020</xref>). pGST-Parallel1 with sQa, sQa3Δ, or sQb3Δ was transformed into Rosetta2 (DE3)-pLysS cells (EMD Millipore, Billerica, MA). Luria–Bertani (LB) broth (100 ml) containing 100 μg/ml ampicillin and 34 μg/ml chloramphenicol was inoculated with a single colony. After overnight incubation with shaking at 37°C, 40 ml portions of the preculture were added to two 6 l flasks, each with 3 l of LB medium, containing 100 μg/ml ampicillin and 34 μg/ml chloramphenicol and shaken (200 rpm) at 37°C to an OD600 of 0.8. Isopropyl β-D-1-thiogalactopyranoside was added to 0.5 mM. After 3 hr of continued shaking at 37°C, bacteria were harvested by centrifugation (5000 rpm, 5 min, 4°C). Cell pellets were resuspended in 60 ml of 20 mM HEPES-NaOH (pH 7.4), 200 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol (DTT), 200 mM phenylmethyl sulfonylfluoride, and 1 X protease inhibitor cocktail (<xref ref-type="bibr" rid="bib63">Xu and Wickner, 1996</xref>). Resuspended cells were passed twice through a French press at 900 psi. The cell lysate was centrifuged (4°C, 1 hr, 50,000 rpm, SW 60Ti rotor [Beckman Coulter, Brea, CA]). The supernatant was added to 20 ml of Glutathione Agarose 4B resin (Genesee Scientific, San Diego, CA), which had been equilibrated with wash buffer (20 mM HEPES-NaOH (pH 7.4), 200 mM NaCl, and 1 mM EDTA, 1 mM DTT) and nutated at 4°C for 2 hr. The suspended resin was poured into a 2.5-cm-diameter column, drained, and washed with 100 ml wash buffer. The GST-tagged protein was eluted with 20 mM HEPES-NaOH (pH 7.4), 200 mM NaCl, 1 mM EDTA, 1 mM DTT, 5% glycerol, and 20 mM glutathione, and the GST tag removed by TEV protease.</p></sec><sec id="s4-3"><title>Proteoliposome fusion</title><p>Proteoliposomes were prepared by detergent dialysis from β-octylglucoside-mixed micelles for fusion assays (<xref ref-type="bibr" rid="bib44">Song et al., 2017</xref>; <xref ref-type="bibr" rid="bib47">Song and Wickner, 2019</xref>) and SNARE assembly assays (<xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>) as described. Briefly, for the fusion assay, proteoliposomes (1 mM lipid) were prepared with membrane-bound Ypt7 and R at 1:8000 and 1:16,000 molar ratios to lipid, respectively, and with lumenal biotin-phycoerythrin. Proteoliposomes were also prepared with membrane-bound Ypt7 and the indicated Q-SNAREs at 1:8000 and 1:16,000 molar ratios to lipid, respectively, plus lumenal Cy5-streptavidin. These were incubated separately for 10 min at 27°C with 1 μM GTP and 1 mM EDTA, and then MgCl<sub>2</sub> was added to 2 mM. After prewarming (27°C for 10 min) the separately GTP-exchanged proteoliposomes in a 384-well plate, fusion reactions were initiated by mixing 5 μl of each proteoliposome preparation and supplementing with other fusion factors in volumes summing to 10 μl, continuing incubation at 27°C in a Spectramax fluorescent plate reader. Fusion incubations (20 μl) in RB150 (20 mM HEPES/NaOH, pH 7.4, 150 mM NaCl, 10% glycerol) had proteoliposomes (0.5 mM total lipid concentration), 50 nM HOPS, the indicated concentrations of sSNAREs, 400 or 600 nM Sec17, 300 nM Sec18, 1 mM ATP or its analogs, and 3 mM MgCl<sub>2</sub>, as modified in each figure legend.</p></sec><sec id="s4-4"><title>SNARE assembly assay</title><p>Assays were performed as described previously (<xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>) with one addendum. In brief, reactions (20 µl) were performed at 27°C in a SpectraMax Gemini XPS (Molecular Devices) plate reader. Standard reactions include HOPS (160 nM), proteoliposomes (0.5 mM lipid, with SNARE and Ypt7 at a molar ratio of either 1:2000 or 1:4000 for Ypt7/R proteoliposomes and Ypt7/RQa proteoliposomes, respectively), and fluorescently labeled Qb and Qc (1 µM), and sQa (1 µM) as necessary. These were incubated for 60 min, and then Sec17 was added to 500 nM. Three fluorescence channels were read simultaneously at intervals of 30 s: the donor channel Oregon Green 488 from Qc (excitation [ex]: 497 nm; emission [em]: 527 nm; cutoff [c/o]: 515 nm), the acceptor channel Alexa Fluor 568 from Qb (ex: 568 nm; em: 605 nm; c/o: 590 nm), and the FRET channel (ex: 490 nm; em: 615 nm; c/o: 590 nm). For each time point, the bleed through-corrected FRET signal was obtained by subtracting the background signals coming from the donor and acceptor channels from the signal in the FRET channel as detailed in <xref ref-type="bibr" rid="bib54">Torng et al., 2020</xref>. This was further corrected by dividing by the geometric mean of the donor and acceptor signals. The final corrected signal, reported as ‘Average FRET efficiency,’ is a combined measure of the proportion of fluorescent SNAREs undergoing FRET and their average FRET efficiency.</p></sec><sec id="s4-5"><title>Molecular models</title><p>MODELLER (<xref ref-type="bibr" rid="bib57">Webb and Sali, 2016</xref>) was used to create individual homology models of the vacuolar SNARE complex (Nyv1, Vam3, Vti1, Vam7), and of Sec18 starting from the coordinates of synaptobrevin-2, SNAP-25, syntaxin-1A, and NSF in the cryo-EM structure of the neuronal NSF/αSNAP/SNARE complex (PDB ID 3J96) (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>). For Sec18, the linker between the N and D1 domains was deleted from the generated homology model since there was no information about these linkers in this structure (PDB ID 3J96) of the neuronal 20S complex.</p><p>The MODELLER protocol consisted of an alignment step (python script file align.py) and a modeling step (python script file modeler-input.py). The script files are shown here for synaptobrevin (nyv1):</p><sec id="s4-5-1"><title>align.py</title><list list-type="simple"><list-item><p>from modeller import *</p></list-item><list-item><p>env = environ()</p></list-item><list-item><p>aln = alignment(env)</p></list-item><list-item><p>mdl = model(env, file='sb.pdb', model_segment=('FIRST:K','LAST:K'))</p></list-item><list-item><p>aln.append_model(mdl, align_codes='sbK', atom_files='sb.pdb')</p></list-item><list-item><p>aln.append(file='target_sequence.pir', align_codes='nyv1')</p></list-item><list-item><p>aln.salign(local_alignment = True, rr_file='${LIB}/blosum62.sim.mat',</p></list-item><list-item><p>gap_penalties_1d=(−600,–600),</p></list-item><list-item><p>output='',</p></list-item><list-item><p>align_block = 15, # no. of seqs. in first MSA</p></list-item><list-item><p>align_what='PROFILE',</p></list-item><list-item><p>alignment_type='PAIRWISE',</p></list-item><list-item><p>comparison_type='PSSM', # or 'MAT' (Caution: Method NOT benchmarked# for 'MAT')</p></list-item><list-item><p>similarity_flag = True, # The score matrix is not rescaled</p></list-item><list-item><p>substitution = True, # The BLOSUM62 substitution values are</p></list-item><list-item><p># multiplied to the corr. coef.</p></list-item><list-item><p>#write_weights = True,</p></list-item><list-item><p>#output_weights_file='test.mtx', # optional, to write weight matrix</p></list-item><list-item><p>smooth_prof_weight = 10.0) # For mixing data with priors</p></list-item><list-item><p>aln.edit(edit_align_codes='nyv1', base_align_codes='rest',min_base_entries = 1, overhang = 0)</p></list-item><list-item><p>aln.write(file='nyv1.ali', alignment_format='PIR')</p></list-item><list-item><p>aln.write(file='nyv1.pap', alignment_format='PAP')</p></list-item></list></sec><sec id="s4-5-2"><title>modeler-input.py</title><list list-type="simple"><list-item><p>from modeller import *</p></list-item><list-item><p>from modeller.automodel import *</p></list-item><list-item><p>env = environ()</p></list-item><list-item><p>a = automodel(env, alnfile='nyv1.ali', knowns='sbK', sequence='nyv1', assess_methods=(assess.DOPE, assess.GA341))</p></list-item><list-item><p>a.very_fast()</p></list-item><list-item><p>a.starting_model = 1</p></list-item><list-item><p>a.ending_model = 1</p></list-item><list-item><p>a.make()</p></list-item></list><p>The homology models of Nyv1, Vam3, Vti1, Vam7, and Sec18, together with the crystal structure of Sec17 (PDB ID 1QQE) (<xref ref-type="bibr" rid="bib36">Rice and Brunger, 1999</xref>), were fit into the cryo-EM structure of the neuronal NSF/αSNAP/SNARE complex (PDB ID 3J96) (<xref ref-type="bibr" rid="bib65">Zhao et al., 2015</xref>). The fit was performed by using the ‘align’ feature of PyMol to individually superimpose the coordinates of the vacuolar proteins with the corresponding coordinates of the neuronal proteins in the structure of the neuronal NSF/αSNAP/SNARE complex.</p></sec></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Gustav Lienhard, Charles Barlowe, Frederick Hughson, Michael Zick, Christian Ungermann, Jose Rizo, and Randy Schekman for insightful suggestions. This work was supported by grants R35GM118037 (to WW) and R37MH63105 (to ATB) from the NIH.</p></ack><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf2"><p>Reviewing editor, <italic>eLife</italic></p></fn><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Software, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Data curation, Software, Formal analysis, Investigation, Visualization, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con4"><p>Conceptualization, Resources, Data curation, Software, Formal analysis, Funding acquisition, Visualization, Project administration, Writing - review and editing</p></fn><fn fn-type="con" id="con5"><p>Conceptualization, Resources, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="pdf" mimetype="application" xlink:href="elife-67578-transrepform-v2.pdf"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>All data generated or analyzed during this study are included in the manuscript and supporting files. Source data files have been provided for Figures 1, 2, 3 4, 5, and 6.</p><p>The following previously published datasets were used:</p><p><element-citation id="dataset1" publication-type="data" specific-use="references"><person-group person-group-type="author"><name><surname>Zhao</surname><given-names>M</given-names></name><name><surname>Wu</surname><given-names>S</given-names></name><name><surname>Cheng</surname><given-names>Y</given-names></name><name><surname>Brunger</surname><given-names>AT</given-names></name></person-group><year iso-8601-date="2015">2015</year><data-title>Structure of 20S supercomplex determined by single particle cryoelectron microscopy (State I)</data-title><source>RCSB Protein Data Bank</source><pub-id assigning-authority="RCSB" pub-id-type="accession" xlink:href="https://www.rcsb.org/structure/3j96">3J96</pub-id></element-citation></p><p><element-citation id="dataset2" publication-type="data" specific-use="references"><person-group person-group-type="author"><name><surname>Rice</surname><given-names>LM</given-names></name><name><surname>Brunger</surname><given-names>AT</given-names></name></person-group><year iso-8601-date="1999">1999</year><data-title>CRYSTAL STRUCTURE OF THE VESICULAR TRANSPORT PROTEIN SEC17</data-title><source>RCSB Protein Data Bank</source><pub-id assigning-authority="RCSB" pub-id-type="accession" xlink:href="https://www.rcsb.org/structure/1QQE">1QQE</pub-id></element-citation></p></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aeffner</surname> <given-names>S</given-names></name><name><surname>Reusch</surname> <given-names>T</given-names></name><name><surname>Weinhausen</surname> <given-names>B</given-names></name><name><surname>Salditt</surname> <given-names>T</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Energetics of stalk intermediates in membrane fusion are controlled by lipid composition</article-title><source>PNAS</source><volume>109</volume><fpage>E1609</fpage><lpage>E1618</lpage><pub-id pub-id-type="doi">10.1073/pnas.1119442109</pub-id><pub-id pub-id-type="pmid">22589300</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Baker</surname> <given-names>RW</given-names></name><name><surname>Jeffrey</surname> <given-names>PD</given-names></name><name><surname>Zick</surname> <given-names>M</given-names></name><name><surname>Phillips</surname> <given-names>BP</given-names></name><name><surname>Wickner</surname> <given-names>WT</given-names></name><name><surname>Hughson</surname> <given-names>FM</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>A direct role for the Sec1/Munc18-family protein Vps33 as a template for SNARE assembly</article-title><source>Science</source><volume>349</volume><fpage>1111</fpage><lpage>1114</lpage><pub-id pub-id-type="doi">10.1126/science.aac7906</pub-id><pub-id pub-id-type="pmid">26339030</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barnard</surname> <given-names>RJ</given-names></name><name><surname>Morgan</surname> <given-names>A</given-names></name><name><surname>Burgoyne</surname> <given-names>RD</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>Stimulation of NSF ATPase activity by alpha-SNAP is required for SNARE complex disassembly and exocytosis</article-title><source>Journal of Cell Biology</source><volume>139</volume><fpage>875</fpage><lpage>883</lpage><pub-id pub-id-type="doi">10.1083/jcb.139.4.875</pub-id><pub-id pub-id-type="pmid">9362506</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brett</surname> <given-names>CL</given-names></name><name><surname>Plemel</surname> <given-names>RL</given-names></name><name><surname>Lobingier</surname> <given-names>BT</given-names></name><name><surname>Lobinger</surname> <given-names>BT</given-names></name><name><surname>Vignali</surname> <given-names>M</given-names></name><name><surname>Fields</surname> <given-names>S</given-names></name><name><surname>Merz</surname> <given-names>AJ</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Efficient termination of vacuolar rab GTPase signaling requires coordinated action by a GAP and a protein kinase</article-title><source>Journal of Cell Biology</source><volume>182</volume><fpage>1141</fpage><lpage>1151</lpage><pub-id pub-id-type="doi">10.1083/jcb.200801001</pub-id><pub-id pub-id-type="pmid">18809726</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chakraborty</surname> <given-names>K</given-names></name><name><surname>Chatila</surname> <given-names>M</given-names></name><name><surname>Sinha</surname> <given-names>J</given-names></name><name><surname>Shi</surname> <given-names>Q</given-names></name><name><surname>Poschner</surname> <given-names>BC</given-names></name><name><surname>Sikor</surname> <given-names>M</given-names></name><name><surname>Jiang</surname> <given-names>G</given-names></name><name><surname>Lamb</surname> <given-names>DC</given-names></name><name><surname>Hartl</surname> <given-names>FU</given-names></name><name><surname>Hayer-Hartl</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Chaperonin-catalyzed rescue of kinetically trapped states in protein folding</article-title><source>Cell</source><volume>142</volume><fpage>112</fpage><lpage>122</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2010.05.027</pub-id><pub-id pub-id-type="pmid">20603018</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cheever</surname> <given-names>ML</given-names></name><name><surname>Sato</surname> <given-names>TK</given-names></name><name><surname>de Beer</surname> <given-names>T</given-names></name><name><surname>Kutateladze</surname> <given-names>TG</given-names></name><name><surname>Emr</surname> <given-names>SD</given-names></name><name><surname>Overduin</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Phox domain interaction with PtdIns(3)P targets the Vam7 t-SNARE to vacuole membranes</article-title><source>Nature Cell Biology</source><volume>3</volume><fpage>613</fpage><lpage>618</lpage><pub-id pub-id-type="doi">10.1038/35083000</pub-id><pub-id pub-id-type="pmid">11433291</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Choi</surname> <given-names>UB</given-names></name><name><surname>Zhao</surname> <given-names>M</given-names></name><name><surname>White</surname> <given-names>KI</given-names></name><name><surname>Pfuetzner</surname> <given-names>RA</given-names></name><name><surname>Esquivies</surname> <given-names>L</given-names></name><name><surname>Zhou</surname> <given-names>Q</given-names></name><name><surname>Brunger</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>NSF-mediated disassembly of on- and off-pathway SNARE complexes and inhibition by complexin</article-title><source>eLife</source><volume>7</volume><elocation-id>e36497</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.36497</pub-id><pub-id pub-id-type="pmid">29985126</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Clary</surname> <given-names>DO</given-names></name><name><surname>Griff</surname> <given-names>IC</given-names></name><name><surname>Rothman</surname> <given-names>JE</given-names></name></person-group><year iso-8601-date="1990">1990</year><article-title>SNAPs, a family of NSF attachment proteins involved in intracellular membrane fusion in animals and yeast</article-title><source>Cell</source><volume>61</volume><fpage>709</fpage><lpage>721</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(90)90482-T</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Collins</surname> <given-names>KM</given-names></name><name><surname>Thorngren</surname> <given-names>NL</given-names></name><name><surname>Fratti</surname> <given-names>RA</given-names></name><name><surname>Wickner</surname> <given-names>WT</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Sec17p and HOPS, in distinct SNARE complexes, mediate SNARE complex disruption or assembly for fusion</article-title><source>The EMBO Journal</source><volume>24</volume><fpage>1775</fpage><lpage>1786</lpage><pub-id pub-id-type="doi">10.1038/sj.emboj.7600658</pub-id><pub-id pub-id-type="pmid">15889152</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fasshauer</surname> <given-names>D</given-names></name><name><surname>Bruns</surname> <given-names>D</given-names></name><name><surname>Shen</surname> <given-names>B</given-names></name><name><surname>Jahn</surname> <given-names>R</given-names></name><name><surname>Brünger</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>A structural change occurs upon binding of syntaxin to SNAP-25</article-title><source>Journal of Biological Chemistry</source><volume>272</volume><fpage>4582</fpage><lpage>4590</lpage><pub-id pub-id-type="doi">10.1074/jbc.272.7.4582</pub-id><pub-id pub-id-type="pmid">9020186</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fasshauer</surname> <given-names>D</given-names></name><name><surname>Sutton</surname> <given-names>RB</given-names></name><name><surname>Brunger</surname> <given-names>AT</given-names></name><name><surname>Jahn</surname> <given-names>R</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Conserved structural features of the synaptic fusion complex: snare proteins reclassified as Q- and R-SNAREs</article-title><source>PNAS</source><volume>95</volume><fpage>15781</fpage><lpage>15786</lpage><pub-id pub-id-type="doi">10.1073/pnas.95.26.15781</pub-id><pub-id pub-id-type="pmid">9861047</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fiebig</surname> <given-names>KM</given-names></name><name><surname>Rice</surname> <given-names>LM</given-names></name><name><surname>Pollock</surname> <given-names>E</given-names></name><name><surname>Brunger</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Folding intermediates of SNARE complex assembly</article-title><source>Nature Structural Biology</source><volume>6</volume><fpage>117</fpage><lpage>123</lpage><pub-id pub-id-type="doi">10.1038/5803</pub-id><pub-id pub-id-type="pmid">10048921</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fratti</surname> <given-names>RA</given-names></name><name><surname>Jun</surname> <given-names>Y</given-names></name><name><surname>Merz</surname> <given-names>AJ</given-names></name><name><surname>Margolis</surname> <given-names>N</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Interdependent assembly of specific regulatory lipids and membrane fusion proteins into the vertex ring domain of docked vacuoles</article-title><source>Journal of Cell Biology</source><volume>167</volume><fpage>1087</fpage><lpage>1098</lpage><pub-id pub-id-type="doi">10.1083/jcb.200409068</pub-id><pub-id pub-id-type="pmid">15611334</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fukuda</surname> <given-names>R</given-names></name><name><surname>McNew</surname> <given-names>JA</given-names></name><name><surname>Weber</surname> <given-names>T</given-names></name><name><surname>Parlati</surname> <given-names>F</given-names></name><name><surname>Engel</surname> <given-names>T</given-names></name><name><surname>Nickel</surname> <given-names>W</given-names></name><name><surname>Rothman</surname> <given-names>JE</given-names></name><name><surname>Söllner</surname> <given-names>TH</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Functional architecture of an intracellular membrane t-SNARE</article-title><source>Nature</source><volume>407</volume><fpage>198</fpage><lpage>202</lpage><pub-id pub-id-type="doi">10.1038/35025084</pub-id><pub-id pub-id-type="pmid">11001059</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gao</surname> <given-names>Y</given-names></name><name><surname>Zorman</surname> <given-names>S</given-names></name><name><surname>Gundersen</surname> <given-names>G</given-names></name><name><surname>Xi</surname> <given-names>Z</given-names></name><name><surname>Ma</surname> <given-names>L</given-names></name><name><surname>Sirinakis</surname> <given-names>G</given-names></name><name><surname>Rothman</surname> <given-names>JE</given-names></name><name><surname>Zhang</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Single reconstituted neuronal SNARE complexes zipper in three distinct stages</article-title><source>Science</source><volume>337</volume><fpage>1340</fpage><lpage>1343</lpage><pub-id pub-id-type="doi">10.1126/science.1224492</pub-id><pub-id pub-id-type="pmid">22903523</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Haas</surname> <given-names>A</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Homotypic vacuole fusion requires Sec17p (yeast alpha-SNAP) and Sec18p (yeast NSF)</article-title><source>The EMBO Journal</source><volume>15</volume><fpage>3296</fpage><lpage>3305</lpage><pub-id pub-id-type="doi">10.1002/j.1460-2075.1996.tb00694.x</pub-id><pub-id pub-id-type="pmid">8670830</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hazzard</surname> <given-names>J</given-names></name><name><surname>Südhof</surname> <given-names>TC</given-names></name><name><surname>Rizo</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>NMR analysis of the structure of synaptobrevin and of its interaction with syntaxin</article-title><source>Journal of Biomolecular NMR</source><volume>14</volume><fpage>203</fpage><lpage>207</lpage><pub-id pub-id-type="doi">10.1023/a:1008382027065</pub-id><pub-id pub-id-type="pmid">10481273</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hickey</surname> <given-names>CM</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>HOPS initiates vacuole docking by tethering membranes before <italic>trans</italic>-SNARE complex assembly</article-title><source>Molecular Biology of the Cell</source><volume>21</volume><fpage>2297</fpage><lpage>2305</lpage><pub-id pub-id-type="doi">10.1091/mbc.e10-01-0044</pub-id><pub-id pub-id-type="pmid">20462954</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ho</surname> <given-names>B</given-names></name><name><surname>Baryshnikova</surname> <given-names>A</given-names></name><name><surname>Brown</surname> <given-names>GW</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Unification of protein abundance datasets yields a quantitative <italic>Saccharomyces cerevisiae</italic> proteome</article-title><source>Cell Systems</source><volume>6</volume><fpage>192</fpage><lpage>205</lpage><pub-id pub-id-type="doi">10.1016/j.cels.2017.12.004</pub-id><pub-id pub-id-type="pmid">29361465</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Izawa</surname> <given-names>R</given-names></name><name><surname>Onoue</surname> <given-names>T</given-names></name><name><surname>Furukawa</surname> <given-names>N</given-names></name><name><surname>Mima</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Distinct contributions of vacuolar qabc- and R-SNARE proteins to membrane fusion specificity</article-title><source>Journal of Biological Chemistry</source><volume>287</volume><fpage>3445</fpage><lpage>3453</lpage><pub-id pub-id-type="doi">10.1074/jbc.M111.307439</pub-id><pub-id pub-id-type="pmid">22174414</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jiao</surname> <given-names>J</given-names></name><name><surname>He</surname> <given-names>M</given-names></name><name><surname>Port</surname> <given-names>SA</given-names></name><name><surname>Baker</surname> <given-names>RW</given-names></name><name><surname>Xu</surname> <given-names>Y</given-names></name><name><surname>Qu</surname> <given-names>H</given-names></name><name><surname>Xiong</surname> <given-names>Y</given-names></name><name><surname>Wang</surname> <given-names>Y</given-names></name><name><surname>Jin</surname> <given-names>H</given-names></name><name><surname>Eisemann</surname> <given-names>TJ</given-names></name><name><surname>Hughson</surname> <given-names>FM</given-names></name><name><surname>Zhang</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Munc18-1 catalyzes neuronal SNARE assembly by templating SNARE association</article-title><source>eLife</source><volume>7</volume><elocation-id>e41771</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.41771</pub-id><pub-id pub-id-type="pmid">30540253</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jun</surname> <given-names>Y</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Sec17 (α-SNAP) and Sec18 (NSF) restrict membrane fusion to R-SNAREs, Q-SNAREs, and SM proteins from identical compartments</article-title><source>PNAS</source><volume>116</volume><fpage>23573</fpage><lpage>23581</lpage><pub-id pub-id-type="doi">10.1073/pnas.1913985116</pub-id><pub-id pub-id-type="pmid">31685636</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lai</surname> <given-names>Y</given-names></name><name><surname>Choi</surname> <given-names>UB</given-names></name><name><surname>Leitz</surname> <given-names>J</given-names></name><name><surname>Rhee</surname> <given-names>HJ</given-names></name><name><surname>Lee</surname> <given-names>C</given-names></name><name><surname>Altas</surname> <given-names>B</given-names></name><name><surname>Zhao</surname> <given-names>M</given-names></name><name><surname>Pfuetzner</surname> <given-names>RA</given-names></name><name><surname>Wang</surname> <given-names>AL</given-names></name><name><surname>Brose</surname> <given-names>N</given-names></name><name><surname>Rhee</surname> <given-names>J</given-names></name><name><surname>Brunger</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Molecular mechanisms of synaptic vesicle priming by Munc13 and Munc18</article-title><source>Neuron</source><volume>95</volume><fpage>591</fpage><lpage>607</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2017.07.004</pub-id><pub-id pub-id-type="pmid">28772123</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname> <given-names>C</given-names></name><name><surname>Li</surname> <given-names>W</given-names></name><name><surname>Xu</surname> <given-names>Y</given-names></name><name><surname>Rizo</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Munc13 mediates the transition from the closed syntaxin-Munc18 complex to the SNARE complex</article-title><source>Nature Structural &amp; Molecular Biology</source><volume>18</volume><fpage>542</fpage><lpage>549</lpage><pub-id pub-id-type="doi">10.1038/nsmb.2047</pub-id><pub-id pub-id-type="pmid">21499244</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname> <given-names>C</given-names></name><name><surname>Su</surname> <given-names>L</given-names></name><name><surname>Seven</surname> <given-names>AB</given-names></name><name><surname>Xu</surname> <given-names>Y</given-names></name><name><surname>Rizo</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Reconstitution of the vital functions of Munc18 and Munc13 in neurotransmitter release</article-title><source>Science</source><volume>339</volume><fpage>421</fpage><lpage>425</lpage><pub-id pub-id-type="doi">10.1126/science.1230473</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname> <given-names>L</given-names></name><name><surname>Kang</surname> <given-names>Y</given-names></name><name><surname>Jiao</surname> <given-names>J</given-names></name><name><surname>Rebane</surname> <given-names>AA</given-names></name><name><surname>Cha</surname> <given-names>HK</given-names></name><name><surname>Xi</surname> <given-names>Z</given-names></name><name><surname>Qu</surname> <given-names>H</given-names></name><name><surname>Zhang</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>α-SNAP enhances SNARE zippering by stabilizing the SNARE Four-Helix bundle</article-title><source>Cell Reports</source><volume>15</volume><fpage>531</fpage><lpage>539</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2016.03.050</pub-id><pub-id pub-id-type="pmid">27068468</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Marz</surname> <given-names>KE</given-names></name><name><surname>Lauer</surname> <given-names>JM</given-names></name><name><surname>Hanson</surname> <given-names>PI</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Defining the SNARE complex binding surface of alpha-SNAP: implications for SNARE complex disassembly</article-title><source>The Journal of Biological Chemistry</source><volume>278</volume><fpage>27000</fpage><lpage>27008</lpage><pub-id pub-id-type="doi">10.1074/jbc.M302003200</pub-id><pub-id pub-id-type="pmid">12730228</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mayer</surname> <given-names>A</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name><name><surname>Haas</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Sec18p (NSF)-driven release of Sec17p (alpha-SNAP) can precede docking and fusion of yeast vacuoles</article-title><source>Cell</source><volume>85</volume><fpage>83</fpage><lpage>94</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)81084-3</pub-id><pub-id pub-id-type="pmid">8620540</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mima</surname> <given-names>J</given-names></name><name><surname>Hickey</surname> <given-names>CM</given-names></name><name><surname>Xu</surname> <given-names>H</given-names></name><name><surname>Jun</surname> <given-names>Y</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Reconstituted membrane fusion requires regulatory lipids, SNAREs and synergistic SNARE chaperones</article-title><source>The EMBO Journal</source><volume>27</volume><fpage>2031</fpage><lpage>2042</lpage><pub-id pub-id-type="doi">10.1038/emboj.2008.139</pub-id><pub-id pub-id-type="pmid">18650938</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Min</surname> <given-names>D</given-names></name><name><surname>Kim</surname> <given-names>K</given-names></name><name><surname>Hyeon</surname> <given-names>C</given-names></name><name><surname>Hoon Cho</surname> <given-names>Y</given-names></name><name><surname>Shin</surname> <given-names>Y-K</given-names></name><name><surname>Yoon</surname> <given-names>T-Y</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Mechanical unzipping and rezipping of a single SNARE complex reveals hysteresis as a force-generating mechanism</article-title><source>Nature Communications</source><volume>4</volume><elocation-id>ncomms2692</elocation-id><pub-id pub-id-type="doi">10.1038/ncomms2692</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nichols</surname> <given-names>BJ</given-names></name><name><surname>Ungermann</surname> <given-names>C</given-names></name><name><surname>Pelham</surname> <given-names>HR</given-names></name><name><surname>Wickner</surname> <given-names>WT</given-names></name><name><surname>Haas</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>Homotypic vacuolar fusion mediated by t- and v-SNAREs</article-title><source>Nature</source><volume>387</volume><fpage>199</fpage><lpage>202</lpage><pub-id pub-id-type="doi">10.1038/387199a0</pub-id><pub-id pub-id-type="pmid">9144293</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ohya</surname> <given-names>T</given-names></name><name><surname>Miaczynska</surname> <given-names>M</given-names></name><name><surname>Coskun</surname> <given-names>U</given-names></name><name><surname>Lommer</surname> <given-names>B</given-names></name><name><surname>Runge</surname> <given-names>A</given-names></name><name><surname>Drechsel</surname> <given-names>D</given-names></name><name><surname>Kalaidzidis</surname> <given-names>Y</given-names></name><name><surname>Zerial</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Reconstitution of rab- and SNARE-dependent membrane fusion by synthetic endosomes</article-title><source>Nature</source><volume>459</volume><fpage>1091</fpage><lpage>1097</lpage><pub-id pub-id-type="doi">10.1038/nature08107</pub-id><pub-id pub-id-type="pmid">19458617</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Orr</surname> <given-names>A</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name><name><surname>Rusin</surname> <given-names>SF</given-names></name><name><surname>Kettenbach</surname> <given-names>AN</given-names></name><name><surname>Zick</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Yeast vacuolar HOPS, regulated by its kinase, exploits affinities for acidic lipids and rab:gtp for membrane binding and to catalyze tethering and fusion</article-title><source>Molecular Biology of the Cell</source><volume>26</volume><fpage>305</fpage><lpage>315</lpage><pub-id pub-id-type="doi">10.1091/mbc.E14-08-1298</pub-id><pub-id pub-id-type="pmid">25411340</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Orr</surname> <given-names>A</given-names></name><name><surname>Song</surname> <given-names>H</given-names></name><name><surname>Rusin</surname> <given-names>SF</given-names></name><name><surname>Kettenbach</surname> <given-names>AN</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>HOPS catalyzes the interdependent assembly of each vacuolar SNARE into a SNARE complex</article-title><source>Molecular Biology of the Cell</source><volume>28</volume><fpage>975</fpage><lpage>983</lpage><pub-id pub-id-type="doi">10.1091/mbc.e16-10-0743</pub-id><pub-id pub-id-type="pmid">28148647</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pace</surname> <given-names>CN</given-names></name><name><surname>Scholtz</surname> <given-names>JM</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>A Helix propensity scale based on experimental studies of peptides and proteins</article-title><source>Biophysical Journal</source><volume>75</volume><fpage>422</fpage><lpage>427</lpage><pub-id pub-id-type="doi">10.1016/S0006-3495(98)77529-0</pub-id><pub-id pub-id-type="pmid">9649402</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rice</surname> <given-names>LM</given-names></name><name><surname>Brunger</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Crystal structure of the vesicular transport protein Sec17</article-title><source>Molecular Cell</source><volume>4</volume><fpage>85</fpage><lpage>95</lpage><pub-id pub-id-type="doi">10.1016/S1097-2765(00)80190-2</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Richmond</surname> <given-names>JE</given-names></name><name><surname>Weimer</surname> <given-names>RM</given-names></name><name><surname>Jorgensen</surname> <given-names>EM</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>An open form of syntaxin bypasses the requirement for UNC-13 in vesicle priming</article-title><source>Nature</source><volume>412</volume><fpage>338</fpage><lpage>341</lpage><pub-id pub-id-type="doi">10.1038/35085583</pub-id><pub-id pub-id-type="pmid">11460165</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ryu</surname> <given-names>JK</given-names></name><name><surname>Min</surname> <given-names>D</given-names></name><name><surname>Rah</surname> <given-names>SH</given-names></name><name><surname>Kim</surname> <given-names>SJ</given-names></name><name><surname>Park</surname> <given-names>Y</given-names></name><name><surname>Kim</surname> <given-names>H</given-names></name><name><surname>Hyeon</surname> <given-names>C</given-names></name><name><surname>Kim</surname> <given-names>HM</given-names></name><name><surname>Jahn</surname> <given-names>R</given-names></name><name><surname>Yoon</surname> <given-names>TY</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Spring-loaded unraveling of a single SNARE complex by NSF in one round of ATP turnover</article-title><source>Science</source><volume>347</volume><fpage>1485</fpage><lpage>1489</lpage><pub-id pub-id-type="doi">10.1126/science.aaa5267</pub-id><pub-id pub-id-type="pmid">25814585</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schwartz</surname> <given-names>ML</given-names></name><name><surname>Nickerson</surname> <given-names>DP</given-names></name><name><surname>Lobingier</surname> <given-names>BT</given-names></name><name><surname>Plemel</surname> <given-names>RL</given-names></name><name><surname>Duan</surname> <given-names>M</given-names></name><name><surname>Angers</surname> <given-names>CG</given-names></name><name><surname>Zick</surname> <given-names>M</given-names></name><name><surname>Merz</surname> <given-names>AJ</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Sec17 (α-SNAP) and an SM-tethering complex regulate the outcome of SNARE zippering in vitro and in vivo</article-title><source>eLife</source><volume>6</volume><elocation-id>e27396</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.27396</pub-id><pub-id pub-id-type="pmid">28925353</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schwartz</surname> <given-names>ML</given-names></name><name><surname>Merz</surname> <given-names>AJ</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Capture and release of partially zipped <italic>trans</italic>-SNARE complexes on intact organelles</article-title><source>Journal of Cell Biology</source><volume>185</volume><fpage>535</fpage><lpage>549</lpage><pub-id pub-id-type="doi">10.1083/jcb.200811082</pub-id><pub-id pub-id-type="pmid">19414611</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seals</surname> <given-names>DF</given-names></name><name><surname>Eitzen</surname> <given-names>G</given-names></name><name><surname>Margolis</surname> <given-names>N</given-names></name><name><surname>Wickner</surname> <given-names>WT</given-names></name><name><surname>Price</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>A ypt/Rab effector complex containing the Sec1 homolog Vps33p is required for homotypic vacuole fusion</article-title><source>PNAS</source><volume>97</volume><fpage>9402</fpage><lpage>9407</lpage><pub-id pub-id-type="doi">10.1073/pnas.97.17.9402</pub-id><pub-id pub-id-type="pmid">10944212</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sheffield</surname> <given-names>P</given-names></name><name><surname>Garrard</surname> <given-names>S</given-names></name><name><surname>Derewenda</surname> <given-names>Z</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Overcoming expression and purification problems of RhoGDI using a family of &quot;parallel&quot; expression vectors</article-title><source>Protein Expression and Purification</source><volume>15</volume><fpage>34</fpage><lpage>39</lpage><pub-id pub-id-type="doi">10.1006/prep.1998.1003</pub-id><pub-id pub-id-type="pmid">10024467</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Söllner</surname> <given-names>T</given-names></name><name><surname>Bennett</surname> <given-names>MK</given-names></name><name><surname>Whiteheart</surname> <given-names>SW</given-names></name><name><surname>Scheller</surname> <given-names>RH</given-names></name><name><surname>Rothman</surname> <given-names>JE</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion</article-title><source>Cell</source><volume>75</volume><fpage>409</fpage><lpage>418</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(93)90376-2</pub-id><pub-id pub-id-type="pmid">8221884</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Song</surname> <given-names>H</given-names></name><name><surname>Orr</surname> <given-names>A</given-names></name><name><surname>Duan</surname> <given-names>M</given-names></name><name><surname>Merz</surname> <given-names>AJ</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Sec17/Sec18 act twice, enhancing membrane fusion and then disassembling <italic>cis</italic>-SNARE complexes</article-title><source>eLife</source><volume>6</volume><elocation-id>e26646</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.26646</pub-id><pub-id pub-id-type="pmid">28718762</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Song</surname> <given-names>H</given-names></name><name><surname>Orr</surname> <given-names>AS</given-names></name><name><surname>Lee</surname> <given-names>M</given-names></name><name><surname>Harner</surname> <given-names>ME</given-names></name><name><surname>Wickner</surname> <given-names>WT</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>HOPS recognizes each SNARE, <italic>assembling ternary trans-complexes for rapid fusion upon engagement with the 4th SNARE</italic></article-title><source>eLife</source><volume>9</volume><elocation-id>e53559</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.53559</pub-id><pub-id pub-id-type="pmid">31961324</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Song</surname> <given-names>H</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A short region upstream of the yeast vacuolar Qa-SNARE heptad-repeats promotes membrane fusion through enhanced SNARE complex assembly</article-title><source>Molecular Biology of the Cell</source><volume>28</volume><fpage>2282</fpage><lpage>2289</lpage><pub-id pub-id-type="doi">10.1091/mbc.e17-04-0218</pub-id><pub-id pub-id-type="pmid">28637767</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Song</surname> <given-names>H</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Tethering guides fusion-competent <italic>trans</italic>-SNARE assembly</article-title><source>PNAS</source><volume>116</volume><fpage>13952</fpage><lpage>13957</lpage><pub-id pub-id-type="doi">10.1073/pnas.1907640116</pub-id><pub-id pub-id-type="pmid">31235584</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sørensen</surname> <given-names>JB</given-names></name><name><surname>Wiederhold</surname> <given-names>K</given-names></name><name><surname>Müller</surname> <given-names>EM</given-names></name><name><surname>Milosevic</surname> <given-names>I</given-names></name><name><surname>Nagy</surname> <given-names>G</given-names></name><name><surname>de Groot</surname> <given-names>BL</given-names></name><name><surname>Grubmüller</surname> <given-names>H</given-names></name><name><surname>Fasshauer</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Sequential N- to C-terminal SNARE complex assembly drives priming and fusion of secretory vesicles</article-title><source>The EMBO Journal</source><volume>25</volume><fpage>955</fpage><lpage>966</lpage><pub-id pub-id-type="doi">10.1038/sj.emboj.7601003</pub-id><pub-id pub-id-type="pmid">16498411</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Starai</surname> <given-names>VJ</given-names></name><name><surname>Hickey</surname> <given-names>CM</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>HOPS proofreads the <italic>trans</italic>-SNARE complex for yeast vacuole fusion</article-title><source>Molecular Biology of the Cell</source><volume>19</volume><fpage>2500</fpage><lpage>2508</lpage><pub-id pub-id-type="doi">10.1091/mbc.e08-01-0077</pub-id><pub-id pub-id-type="pmid">18385512</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stepien</surname> <given-names>KP</given-names></name><name><surname>Rizo</surname> <given-names>J</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Synaptotagmin-1-, Munc18-1-, and Munc13-1-dependent liposome fusion with a few neuronal SNAREs</article-title><source>PNAS</source><volume>118</volume><elocation-id>e2019314118</elocation-id><pub-id pub-id-type="doi">10.1073/pnas.2019314118</pub-id><pub-id pub-id-type="pmid">33468652</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stroupe</surname> <given-names>C</given-names></name><name><surname>Collins</surname> <given-names>KM</given-names></name><name><surname>Fratti</surname> <given-names>RA</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Purification of active HOPS complex reveals its affinities for phosphoinositides and the SNARE Vam7p</article-title><source>The EMBO Journal</source><volume>25</volume><fpage>1579</fpage><lpage>1589</lpage><pub-id pub-id-type="doi">10.1038/sj.emboj.7601051</pub-id><pub-id pub-id-type="pmid">16601699</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stroupe</surname> <given-names>C</given-names></name><name><surname>Hickey</surname> <given-names>CM</given-names></name><name><surname>Mima</surname> <given-names>J</given-names></name><name><surname>Burfeind</surname> <given-names>AS</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Minimal membrane docking requirements revealed by reconstitution of rab GTPase-dependent membrane fusion from purified components</article-title><source>PNAS</source><volume>106</volume><fpage>17626</fpage><lpage>17633</lpage><pub-id pub-id-type="doi">10.1073/pnas.0903801106</pub-id><pub-id pub-id-type="pmid">19826089</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sutton</surname> <given-names>RB</given-names></name><name><surname>Fasshauer</surname> <given-names>D</given-names></name><name><surname>Jahn</surname> <given-names>R</given-names></name><name><surname>Brunger</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Crystal structure of a SNARE complex involved in Synaptic exocytosis at 2.4 A resolution</article-title><source>Nature</source><volume>395</volume><fpage>347</fpage><lpage>353</lpage><pub-id pub-id-type="doi">10.1038/26412</pub-id><pub-id pub-id-type="pmid">9759724</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Torng</surname> <given-names>T</given-names></name><name><surname>Song</surname> <given-names>H</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Asymmetric rab activation of vacuolar HOPS to catalyze SNARE complex assembly</article-title><source>Molecular Biology of the Cell</source><volume>31</volume><fpage>1060</fpage><lpage>1068</lpage><pub-id pub-id-type="doi">10.1091/mbc.E20-01-0019</pub-id><pub-id pub-id-type="pmid">32160129</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ungermann</surname> <given-names>C</given-names></name><name><surname>Nichols</surname> <given-names>BJ</given-names></name><name><surname>Pelham</surname> <given-names>HR</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>A vacuolar v-t-SNARE complex, the predominant form in vivo and on isolated vacuoles, is disassembled and activated for docking and fusion</article-title><source>Journal of Cell Biology</source><volume>140</volume><fpage>61</fpage><lpage>69</lpage><pub-id pub-id-type="doi">10.1083/jcb.140.1.61</pub-id><pub-id pub-id-type="pmid">9425154</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wada</surname> <given-names>Y</given-names></name><name><surname>Ohsumi</surname> <given-names>Y</given-names></name><name><surname>Anraku</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Genes for directing vacuolar morphogenesis in <italic>Saccharomyces cerevisiae</italic>. I. isolation and characterization of two classes of <italic>vam</italic> mutants</article-title><source>Journal of Biological Chemistry</source><volume>267</volume><fpage>18665</fpage><lpage>18670</lpage><pub-id pub-id-type="doi">10.1016/S0021-9258(19)37012-7</pub-id><pub-id pub-id-type="pmid">1526998</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Webb</surname> <given-names>B</given-names></name><name><surname>Sali</surname> <given-names>A</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Comparative protein structure modeling using MODELLER</article-title><source>Current Protocols in Bioinformatics</source><volume>54</volume><fpage>139</fpage><lpage>148</lpage><pub-id pub-id-type="doi">10.1002/cpbi.3</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Weber</surname> <given-names>T</given-names></name><name><surname>Zemelman</surname> <given-names>BV</given-names></name><name><surname>McNew</surname> <given-names>JA</given-names></name><name><surname>Westermann</surname> <given-names>B</given-names></name><name><surname>Gmachl</surname> <given-names>M</given-names></name><name><surname>Parlati</surname> <given-names>F</given-names></name><name><surname>Söllner</surname> <given-names>TH</given-names></name><name><surname>Rothman</surname> <given-names>JE</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>SNAREpins: minimal machinery for membrane fusion</article-title><source>Cell</source><volume>92</volume><fpage>759</fpage><lpage>772</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)81404-X</pub-id><pub-id pub-id-type="pmid">9529252</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>White</surname> <given-names>KI</given-names></name><name><surname>Zhao</surname> <given-names>M</given-names></name><name><surname>Choi</surname> <given-names>UB</given-names></name><name><surname>Pfuetzner</surname> <given-names>RA</given-names></name><name><surname>Brunger</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Structural principles of SNARE complex recognition by the AAA+ protein NSF</article-title><source>eLife</source><volume>7</volume><elocation-id>e38888</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.38888</pub-id><pub-id pub-id-type="pmid">30198481</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Membrane fusion: five lipids, four SNAREs, three chaperones, two nucleotides, and a rab, all dancing in a ring on yeast vacuoles</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>26</volume><fpage>115</fpage><lpage>136</lpage><pub-id pub-id-type="doi">10.1146/annurev-cellbio-100109-104131</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Winter</surname> <given-names>U</given-names></name><name><surname>Chen</surname> <given-names>X</given-names></name><name><surname>Fasshauer</surname> <given-names>D</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>A conserved membrane attachment site in alpha-SNAP facilitates N-ethylmaleimide-sensitive factor (NSF)-driven SNARE complex disassembly</article-title><source>Journal of Biological Chemistry</source><volume>284</volume><fpage>31817</fpage><lpage>31826</lpage><pub-id pub-id-type="doi">10.1074/jbc.M109.045286</pub-id><pub-id pub-id-type="pmid">19762473</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname> <given-names>H</given-names></name><name><surname>Jun</surname> <given-names>Y</given-names></name><name><surname>Thompson</surname> <given-names>J</given-names></name><name><surname>Yates</surname> <given-names>J</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>HOPS prevents the disassembly of <italic>trans</italic>-SNARE complexes by Sec17p/Sec18p during membrane fusion</article-title><source>The EMBO Journal</source><volume>29</volume><fpage>1948</fpage><lpage>1960</lpage><pub-id pub-id-type="doi">10.1038/emboj.2010.97</pub-id><pub-id pub-id-type="pmid">20473271</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname> <given-names>Z</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Thioredoxin is required for vacuole inheritance in <italic>Saccharomyces cerevisiae</italic></article-title><source>Journal of Cell Biology</source><volume>132</volume><fpage>787</fpage><lpage>794</lpage><pub-id pub-id-type="doi">10.1083/jcb.132.5.787</pub-id><pub-id pub-id-type="pmid">8603912</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>Y</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Energetics, kinetics, and pathway of SNARE folding and assembly revealed by optical tweezers</article-title><source>Protein Science</source><volume>26</volume><fpage>1252</fpage><lpage>1265</lpage><pub-id pub-id-type="doi">10.1002/pro.3116</pub-id><pub-id pub-id-type="pmid">28097727</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhao</surname> <given-names>M</given-names></name><name><surname>Wu</surname> <given-names>S</given-names></name><name><surname>Zhou</surname> <given-names>Q</given-names></name><name><surname>Vivona</surname> <given-names>S</given-names></name><name><surname>Cipriano</surname> <given-names>DJ</given-names></name><name><surname>Cheng</surname> <given-names>Y</given-names></name><name><surname>Brunger</surname> <given-names>AT</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Mechanistic insights into the recycling machine of the SNARE complex</article-title><source>Nature</source><volume>518</volume><fpage>61</fpage><lpage>67</lpage><pub-id pub-id-type="doi">10.1038/nature14148</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zick</surname> <given-names>M</given-names></name><name><surname>Orr</surname> <given-names>A</given-names></name><name><surname>Schwartz</surname> <given-names>ML</given-names></name><name><surname>Merz</surname> <given-names>AJ</given-names></name><name><surname>Wickner</surname> <given-names>WT</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Sec17 can trigger fusion of <italic>trans</italic>-SNARE paired membranes without Sec18</article-title><source>PNAS</source><volume>112</volume><fpage>E2290</fpage><lpage>E2297</lpage><pub-id pub-id-type="doi">10.1073/pnas.1506409112</pub-id><pub-id pub-id-type="pmid">25902545</pub-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zick</surname> <given-names>M</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>The tethering complex HOPS catalyzes assembly of the soluble SNARE Vam7 into fusogenic <italic>trans</italic>-SNARE complexes</article-title><source>Molecular Biology of the Cell</source><volume>24</volume><fpage>3746</fpage><lpage>3753</lpage><pub-id pub-id-type="doi">10.1091/mbc.e13-07-0419</pub-id><pub-id pub-id-type="pmid">24088569</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zick</surname> <given-names>M</given-names></name><name><surname>Wickner</surname> <given-names>WT</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>A distinct tethering step is vital for vacuole membrane fusion</article-title><source>eLife</source><volume>3</volume><elocation-id>e03251</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.03251</pub-id><pub-id pub-id-type="pmid">25255215</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zick</surname> <given-names>M</given-names></name><name><surname>Wickner</surname> <given-names>W</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Improved reconstitution of yeast vacuole fusion with physiological SNARE concentrations reveals an asymmetric rab(GTP) requirement</article-title><source>Molecular Biology of the Cell</source><volume>27</volume><fpage>2590</fpage><lpage>2597</lpage><pub-id pub-id-type="doi">10.1091/mbc.e16-04-0230</pub-id><pub-id pub-id-type="pmid">27385334</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zucchi</surname> <given-names>PC</given-names></name><name><surname>Zick</surname> <given-names>M</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Membrane fusion catalyzed by a rab, SNAREs, and SNARE chaperones is accompanied by enhanced permeability to small molecules and by lysis</article-title><source>Molecular Biology of the Cell</source><volume>22</volume><fpage>4635</fpage><lpage>4646</lpage><pub-id pub-id-type="doi">10.1091/mbc.e11-08-0680</pub-id><pub-id pub-id-type="pmid">21976702</pub-id></element-citation></ref></ref-list></back><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.67578.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group><contrib contrib-type="editor"><name><surname>Rizo</surname><given-names>Josep</given-names></name><role>Reviewing Editor</role><aff><institution>University of Texas Southwestern Medical Center</institution><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Rizo</surname><given-names>Josep</given-names> </name><role>Reviewer</role><aff><institution>University of Texas Southwestern Medical Center</institution><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>Our editorial process produces two outputs: i) <ext-link ext-link-type="uri" xlink:href="https://sciety.org/articles/activity/10.1101/2021.02.16.431494">public reviews</ext-link> designed to be posted alongside <ext-link ext-link-type="uri" xlink:href="https://www.biorxiv.org/content/10.1101/2021.02.16.431494v1">the preprint</ext-link> for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.</p></boxed-text><p><bold>Acceptance summary:</bold></p><p>This is a very important paper that challenges the generally accepted dogma that full zippering of SNARE complexes is essential for intracellular membrane fusion. Previous work had already shown that C-terminal truncation of one SNARE arrested liposome fusion mediated by the yeast vacuolar SNARE complex and that Sec17/Sec18 could rescued fusion, but it was argued that such rescue could arise because Sec17/Sec18 restored C-terminal zippering. This paper now shows that Sec17/Sec18 rescue fusion even when three SNAREs are crippled -by truncation or mutation- to definitively prevent zippering, thus showing that Sec17/18 have a direct, positive role in membrane fusion.</p><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;Sec17/Sec18 can support membrane fusion without help from completion of SNARE zippering&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by Josep Rizo as Reviewing Editor and Vivek Malhotra as the Senior Editor.</p><p>The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this letter to help you prepare a revised submission.</p><p>Essential revisions:</p><p>1. The paper is difficult to read, particularly for non-experts in the field, and is very long, presenting the most dramatic results that support the main conclusion in Figure 10. The data in this figure are minimally dependent on the 51 data panels (97 including supplemental figures) preceding this figure. The reviewers wonder how many readers will make it that far and believe that a short, crisp manuscript would better convey the main message of the paper. One possibility is to reformat the paper to a Short Report including a small number of experiments. If the authors feel that such format is too constraining, they could keep the paper as a full Article but should strive to shorten it considerably. Note that some of the data are not necessary for the story and/or are not very compelling. For instance the FRET data of Figure 3, the HOPS/Sec17 binding data of Figure 4 and the studies with antibodies of Figure 9 could be part of a future paper devoted to more in depth mechanistic studies, and the titrations of Figure 7 could be included as supplementary material or could also be presented in such future study. In revising the manuscript, the authors should also consider the recommendations for the authors listed below. Note that these recommendations were extracted (unedited) from the separate reviews and some of them may be useful for a future paper(s) describing data that were removed from this manuscript.</p><p>2. The authors should discuss whether the mechanism underlying fusion in the in vitro assays presented in this paper could be operating in a cell under normal conditions or it only occurs when mutations are introduced into the SNAREs AND when Sec17/Sec18 are added above a threshold that might or might not be achieved in a cell (see point #1 of reviewer 3 below).</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>1. The authors should provide an explanation of why the observed FRET efficiency is so low even under the conditions under which SNARE complex assembly is most efficient and the donor and acceptor probes are expected to be very close. Is it due to low incorporation of the dyes on the proteins? It would be advisable to measure the FRET efficiency observed when the SNARE complex is assembled in solution, either with the proteins in the presence of detergent, or using only soluble SNARE domains. Does this lead to much more efficient FRET? If it does, why is SNARE complex formation on the liposomes much less efficient?</p><p>2. The concept of 'entropic cage' does not seem appropriate for the model that the authors are proposing, as favorable interactions at the C-terminus of the SNARE domains should be pretty much abolished by the mutations to Ser or Gly plus the truncations of two SNAREs. It seems very likely that any proximity between the C-termini of the two membrane-anchored SNAREs would arise from steric constraints caused by the bound Sec17 molecules rather than by entropic contributions. Perhaps the term 'steric cage' or simply 'cage' seem more appropriate.</p><p>3. Line 559: it seems likely that the persistence of fusion with the alanine mutations but not with the Ser mutations arises because there is still some hydrophobicity left, rather than because of higher helical propensity.</p><p>4. In lines 133-134, the authors state that αSNAP stabilizes SNARE complexes, citing Ma et al. 2016, but a more balanced view would be provided if the authors also cite another single molecule study that reached the opposite conclusion [Ryu et al., Science 347, 1485 (2015)].</p><p>5. The label 'No Sec17, Sec18 or ATP' at the top of Figure 8 is confusing, as there is Sec17 anchored on the liposomes in some of the experiments of the top panels.</p><p>6. Line 518: Qc3delta is not included in set 2 according to Figure 9.</p><p>7. Line 447: mM should be μM.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>1. In Figure 1C, I wonder what the point is of showing &quot;sticks&quot; in addition to &quot;cartoon&quot;. To me this makes the images look fuzzy, without adding any usable information.</p><p>2. In Figure 3, I'm not sure I understand why cis-SNARE complexes require Sec17 to complete the process of zippering? (And if they're not completely zippered, why does the stability of complex to exchange in the absence of Sec17 depend on the presence of the Qc-SNARE C-terminal layer residues [Figure 3F]?)</p><p>3. In Figure 3C, I was surprised that HOPS stimulation is independent of Ypt7. What do the authors make of this?</p><p>4. In Figure 7, is there evidence of cooperativity with respect to Sec17? Mightn't it be interesting to investigate this and perhaps determine a Hill coefficient?</p><p>5. Also in Figure 7, why does Sec18 still have a dramatic stimulatory effect (compare 1000 nM curves in panels G and H) when Sec17 contains the LALA mutation (which ought to prevent Sec18 binding)?</p><p>6. Figure 9A Set 4, indicating that Qc alone is sufficient to confer resistance to αVps33, would seem to be quite informative. Would it be interesting to repeat the experiment with Qb in place of Qc?</p><p>7. What might the partial resistance to αSec18 in Figure 9, Sets 8 and 9 mean?</p><p>8. The data in Figure 10 doesn't seem to agree with the data in Figure 10 —figure supplement 1.</p><p><italic>Reviewer #3 (Recommendations for the authors):</italic></p><p>1. It is striking that, in the presence of Sec17, Sec18, and HOPS, SNAREs are capable of driving efficient fusion even when several C-terminal layers are deleted. While the data are overall convincing, I am wondering if the Sec17-dependent activation is utilized in the cell with wild-type SNAREs. In other words, is such a mechanism also relevant beyond the engineered system described here? To answer this question, the authors would need to isolate Sec17 or Sec18 mutants that are only defective in stimulating fusion while remaining fully functional in cis-SNARE disassembly. Then they could test if such mutants are defective in driving fusion in vivo.</p><p>2. The authors stated that the presence of SNAP-25 linker interferes with the binding with the other two α-SNAP molecules. Does this mean the mechanism proposed in this work is specific to yeast vacuole fusion rather than a general principle?</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Sec17/Sec18 can support membrane fusion without help from completion of SNARE zippering&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Vivek Malhotra (Senior Editor), Josep Rizo as Reviewing Editor and one of the referees who reviewed the original version.</p><p>The manuscript has been improved but there are some remaining concerns that need to be addressed, as outlined below:</p><p>1. A key issue that needs to be clarified is why does the zippering of cis-SNARE complexes depend on Sec17 (Figure 2)? In these experiments, the R- and Qa-SNARE are embedded in the same liposomes, and the Qb- and Qc-SNAREs lack transmembrane domains. The failure of such complexes to fully zipper makes no sense unless something prevents such zippering and the natural culprit is HOPS. The authors should briefly discuss the mechanistic implications of these findings. For example, might HOPS have a proofreading function, in which it somehow prevents cis-SNARE complexes from fully zippering (but perhaps not trans-SNARE complexes)? In any case, the authors should clearly point out from the beginning of the description of the zippering experiments of Figure 2 that they involve cis-SNARE complexes. They should also explain the relevance of cis-SNARE zippering assays to a manuscript that otherwise deals with trans-SNARE zippering/fusion.</p><p>2. The use of lines and sticks in Figure 1C is visually uninterpretable and therefore unhelpful. The authors are advised to remove them although this is of course up to them.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.67578.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential revisions:</p><p>1. The paper is difficult to read, particularly for non-experts in the field, and is very long, presenting the most dramatic results that support the main conclusion in Figure 10. The data in this figure are minimally dependent on the 51 data panels (97 including supplemental figures) preceding this figure. The reviewers wonder how many readers will make it that far and believe that a short, crisp manuscript would better convey the main message of the paper. One possibility is to reformat the paper to a Short Report including a small number of experiments. If the authors feel that such format is too constraining, they could keep the paper as a full Article but should strive to shorten it considerably. Note that some of the data are not necessary for the story and/or are not very compelling. For instance the FRET data of Figure 3, the HOPS/Sec17 binding data of Figure 4 and the studies with antibodies of Figure 9 could be part of a future paper devoted to more in depth mechanistic studies, and the titrations of Figure 7 could be included as supplementary material or could also be presented in such future study. In revising the manuscript, the authors should also consider the recommendations for the authors listed below. Note that these recommendations were extracted (unedited) from the separate reviews and some of them may be useful for a future paper(s) describing data that were removed from this manuscript.</p></disp-quote><p>We have taken this seriously, and now have 5 data figures (Figures 2-6) instead of the 9 in the original submission. For this reason, and since the Introduction and Results are more succinct, the reader won't &quot;burn out&quot; before getting to the &quot;triply-crippled Q's&quot; Figure. The 5 data figures are essential to develop the system and show its characteristics, and the supplementary figures provide depth to our consideration of the Figures. For a paper which challenges a main shibboleth of the field, we feel it's important to develop the system fully, showing the full impact and ramifications of crippling even one Q, rather than just cherry-pick one culminating figure.</p><disp-quote content-type="editor-comment"><p>2. The authors should discuss whether the mechanism underlying fusion in the in vitro assays presented in this paper could be operating in a cell under normal conditions or it only occurs when mutations are introduced into the SNAREs AND when Sec17/Sec18 are added above a threshold that might or might not be achieved in a cell (see major point #1 of reviewer 3 below).</p><p>Reviewer #1 (Recommendations for the authors):</p><p>1. The authors should provide an explanation of why the observed FRET efficiency is so low even under the conditions under which SNARE complex assembly is most efficient and the donor and acceptor probes are expected to be very close. Is it due to low incorporation of the dyes on the proteins? It would be advisable to measure the FRET efficiency observed when the SNARE complex is assembled in solution, either with the proteins in the presence of detergent, or using only soluble SNARE domains. Does this lead to much more efficient FRET? If it does, why is SNARE complex formation on the liposomes much less efficient?</p></disp-quote><p>We emphasize that these are ensemble FRET experiments rather than single-molecule FRET experiments. The average FRET efficiency is modest because its denominator includes all the fluorescent Qb and Qc in a bulk reaction, even though only a small per cent enter HOPS-dependent SNARE complex. We note this now directly in the text.</p><disp-quote content-type="editor-comment"><p>2. The concept of 'entropic cage' does not seem appropriate for the model that the authors are proposing, as favorable interactions at the C-terminus of the SNARE domains should be pretty much abolished by the mutations to Ser or Gly plus the truncations of two SNAREs. It seems very likely that any proximity between the C-termini of the two membrane-anchored SNAREs would arise from steric constraints caused by the bound Sec17 molecules rather than by entropic contributions. Perhaps the term 'steric cage' or simply 'cage' seem more appropriate.</p></disp-quote><p>Thank you, we have removed this term and now describe our model in terms of an &quot;environment&quot; that Sec17 creates.</p><disp-quote content-type="editor-comment"><p>3. Line 559: it seems likely that the persistence of fusion with the alanine mutations but not with the Ser mutations arises because there is still some hydrophobicity left, rather than because of higher helical propensity.</p></disp-quote><p>A good point, which we have now added. Thanks.</p><disp-quote content-type="editor-comment"><p>4. In lines 133-134, the authors state that αSNAP stabilizes SNARE complexes, citing Ma et al. 2016, but a more balanced view would be provided if the authors also cite another single molecule study that reached the opposite conclusion [Ryu et al., Science 347, 1485 (2015)].</p></disp-quote><p>Thanks, we've now added this.</p><disp-quote content-type="editor-comment"><p>5. The label 'No Sec17, Sec18 or ATP' at the top of Figure 8 is confusing, as there is Sec17 anchored on the liposomes in some of the experiments of the top panels.</p></disp-quote><p>Thanks, our mistake! We have removed &quot;Sec17&quot; from these labels; as you note, what differentiates these rows of panels is the presence or absence of Sec18 and of ATP or its analogs.</p><disp-quote content-type="editor-comment"><p>6. Line 518: Qc3delta is not included in set 2 according to Figure 9.</p></disp-quote><p>Qc3delta is not included initially, but is added along with Sec17, Sec18, and ATPgammaS at 30min., 1min after the control IgG, anti-Vps33, or anti-Sec18 were added. Each of the 8 sets has all the same components, but differ in which are added from the start and which are only added after the antibodies; we've now emphasized this in the text.</p><disp-quote content-type="editor-comment"><p>7. Line 447: mM should be μM.</p></disp-quote><p>Thank you.</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>1. In Figure 1C, I wonder what the point is of showing &quot;sticks&quot; in addition to &quot;cartoon&quot;. To me this makes the images look fuzzy, without adding any usable information.</p></disp-quote><p>We included the sidechains to emphasize that these molecules are extensively interacting rather than just being near each other.</p><disp-quote content-type="editor-comment"><p>2. In Figure 3, I'm not sure I understand why cis-SNARE complexes require Sec17 to complete the process of zippering? (And if they're not completely zippered, why does the stability of complex to exchange in the absence of Sec17 depend on the presence of the Qc-SNARE C-terminal layer residues [Figure 3F]?)</p></disp-quote><p>Without Sec17, these complexes apparently don't zipper all the way most of the time; they are in a metastable partially-zippered state. Fusion without Sec17 is slow because zippering is slow/infrequent; adding Sec17 enhances zippering and enhances fusion. When Qc lacks the +4 to +8 layers, it's perhaps zippered even less, and is seen to be labile to exchange.</p><disp-quote content-type="editor-comment"><p>3. In Figure 3C, I was surprised that HOPS stimulation is independent of Ypt7. What do the authors make of this?</p></disp-quote><p>As we've noted in earlier papers (Stroupe et al., 2006), HOPS has direct affinity for SNAREs, and a strict requirement for Ypt7 is only seen at low SNARE levels (Zick and Wickner, 2016). The FRET signals of SNARE complexes, by the assay in Figure 2, would have been too low had we employed the very low SNARE levels which confer strict Ypt7-dependence.</p><disp-quote content-type="editor-comment"><p>4. In Figure 7, is there evidence of cooperativity with respect to Sec17? Mightn't it be interesting to investigate this and perhaps determine a Hill coefficient?</p></disp-quote><p>We agree, but a more detailed study will be needed to determine a Hill coefficient.</p><disp-quote content-type="editor-comment"><p>5. Also in Figure 7, why does Sec18 still have a dramatic stimulatory effect (compare 1000 nM curves in panels G and H) when Sec17 contains the LALA mutation (which ought to prevent Sec18 binding)?</p></disp-quote><p>The LALA mutant blocks Sec17 stimulation of Sec18-mediated 4-SNARE complex disassembly, but hasn't been shown to block all Sec17:Sec18 binding.</p><disp-quote content-type="editor-comment"><p>6. Figure 9A Set 4, indicating that Qc alone is sufficient to confer resistance to αVps33, would seem to be quite informative. Would it be interesting to repeat the experiment with Qb in place of Qc?</p></disp-quote><p>This is just what was done in Set 2.</p><disp-quote content-type="editor-comment"><p>7. What might the partial resistance to αSec18 in Figure 9, Sets 8 and 9 mean?</p></disp-quote><p>We can only speculate about the reasons. For example, the partial resistance would be consistent with HOPS:4-SNARE assembly creating a very favorable binding site for Sec18, so that the SNAREs binding Sec18 yields an antibody-resistant complex about as fast as other Sec18s are captured in solution and inactivated by their antibody. Perhaps when Sec18 is added from the start without Sec17, as in Set 6, it binds to non-functional SNARE subcomplexes.</p><disp-quote content-type="editor-comment"><p>8. The data in Figure 10 doesn't seem to agree with the data in Figure 10 —figure supplement 1.</p></disp-quote><p>We made a labeling error and have fixed it.</p><disp-quote content-type="editor-comment"><p>Reviewer #3 (Recommendations for the authors):</p><p>1. It is striking that, in the presence of Sec17, Sec18, and HOPS, SNAREs are capable of driving efficient fusion even when several C-terminal layers are deleted. While the data are overall convincing, I am wondering if the Sec17-dependent activation is utilized in the cell with wild-type SNAREs. In other words, is such a mechanism also relevant beyond the engineered system described here? To answer this question, the authors would need to isolate Sec17 or Sec18 mutants that are only defective in stimulating fusion while remaining fully functional in cis-SNARE disassembly. Then they could test if such mutants are defective in driving fusion in vivo.</p></disp-quote><p>This is one of our long-term plans! For now though, we do point out that Schwartz et al., (2017) showed that the vacuole fragmentation phenotype from Qc3delta is cured by Sec17 overexpression. We've also added to the text that our concentrations of Sec17 and Sec18 are in the same range as published in vivo concentrations; the intracellular concentrations of Sec17 and Sec18 are 150 to 1100nM and 250-760nM, respectively (Ho et al., 2018, now added to our references).</p><disp-quote content-type="editor-comment"><p>2. The authors stated that the presence of SNAP-25 linker interferes with the binding with the other two α-SNAP molecules. Does this mean the mechanism proposed in this work is specific to yeast vacuole fusion rather than a general principle?</p></disp-quote><p>A more thorough investigation of other fusion systems will be needed to evaluate the generality of Sec17/Sec18 direct promotion of fusion. Many other Qb and Qc SNAREs are not joined as in SNAP-25, but we don't know whether or not this will correlate with whether Sec17/Sec18 stimulate fusion.</p><p>We note that our model doesn't depend on the precise stoichiometry of Sec17:SNAREs. CryoEM structures of NSF/SNAP complexes suggest 2:1, 3:1, or 4: stoichiometries.</p><disp-quote content-type="editor-comment"><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>The manuscript has been improved but there are some remaining concerns that need to be addressed, as outlined below:</p><p>1. A key issue that needs to be clarified is why does the zippering of cis-SNARE complexes depend on Sec17 (Figure 2)? In these experiments, the R- and Qa-SNARE are embedded in the same liposomes, and the Qb- and Qc-SNAREs lack transmembrane domains. The failure of such complexes to fully zipper makes no sense unless something prevents such zippering and the natural culprit is HOPS. The authors should briefly discuss the mechanistic implications of these findings. For example, might HOPS have a proofreading function, in which it somehow prevents cis-SNARE complexes from fully zippering (but perhaps not trans-SNARE complexes)? In any case, the authors should clearly point out from the beginning of the description of the zippering experiments of Figure 2 that they involve cis-SNARE complexes. They should also explain the relevance of cis-SNARE zippering assays to a manuscript that otherwise deals with trans-SNARE zippering/fusion.</p></disp-quote><p>Why does zippering need Sec17? We agree that &quot;...the natural culprit is HOPS&quot;, and have added emphasis to this for clarity, now explicitly noting that &quot;… the enhanced FRET between the SNAREs in the presence of HOPS and Sec17 (bar 9 [of Figure 2]) is not seen without HOPS (bar 8) or Sec17 (bar 10).&quot; We hadn't stated this clearly enough before.</p><p>We now point out explicitly that the model we're examining in Figure 2 is of <italic>cis</italic>-SNARE complexes. We also more clearly cast the study in Figure 2 as one way to examine the interactions of HOPS, Sec17, and the SNAREs, a preamble to functional studies presented in the later figures. This is now pointed out both right before Figure 2 and in the Discussion.</p><p>We now more cautiously refer throughout to Sec17/HOPS induced conformational change in the SNAREs, reflected by altered FRET, rather than just &quot;zippering&quot;. We discuss why zippering is a reasonable, even likely, explanation for this conformational change.</p><p>We too yearn for a physical assay of the completion of zippering of SNAREs in trans, but this is not yet feasible: trans-SNARE complexes are far less abundant than cis-complexes, engaging no more than a few per cent of the SNAREs (Figure 2, Collins and Wickner, 2007). Furthermore, introducing two somewhat bulky fluorophores in the crowded environment at the C-termini of SNARE domains of trans-complex with HOPS, Sec17, and two tightly apposed membranes could well induce artifacts.</p><disp-quote content-type="editor-comment"><p>2. The use of lines and sticks in Figure 1C is visually uninterpretable and therefore unhelpful. The authors are advised to remove them although this is of course up to them.</p></disp-quote><p>We're removed the &quot;lines and sticks&quot; from Figure 1C, as requested.</p></body></sub-article></article>