<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.2 20190208//EN"  "JATS-archivearticle1-mathml3.dtd"><article article-type="research-article" dtd-version="1.2" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn pub-type="epub" publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">73055</article-id><article-id pub-id-type="doi">10.7554/eLife.73055</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Biochemistry and Chemical Biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Structural Biology and Molecular Biophysics</subject></subj-group></article-categories><title-group><article-title>Allosteric cooperation in β-lactam binding to a non-classical transpeptidase</article-title></title-group><contrib-group><contrib contrib-type="author" equal-contrib="yes" id="author-251005"><name><surname>Ahmad</surname><given-names>Nazia</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-268375"><name><surname>Dugad</surname><given-names>Sanmati</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-66718"><name><surname>Chauhan</surname><given-names>Varsha</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-268376"><name><surname>Ahmed</surname><given-names>Shubbir</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-251008"><name><surname>Sharma</surname><given-names>Kunal</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-251006"><name><surname>Kachhap</surname><given-names>Sangita</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-268377"><name><surname>Zaidi</surname><given-names>Rana</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-4446"><name><surname>Bishai</surname><given-names>William R</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-8734-4118</contrib-id><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-247226"><name><surname>Lamichhane</surname><given-names>Gyanu</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-2214-0114</contrib-id><email>gyanu@jhu.edu</email><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund2"/><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf2"/></contrib><contrib contrib-type="author" corresp="yes" id="author-66541"><name><surname>Kumar</surname><given-names>Pankaj</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-9163-3273</contrib-id><email>pkumar10@jhmi.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con10"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03dwxvb85</institution-id><institution>Department of Biochemistry, School of Chemical and Life Sciences, Jamia Hamdard University</institution></institution-wrap><addr-line><named-content content-type="city">Delhi</named-content></addr-line><country>India</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00za53h95</institution-id><institution>Department of Infectious Diseases, Centre for Tuberculosis Research, Johns Hopkins University</institution></institution-wrap><addr-line><named-content content-type="city">Baltimore</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01qjqvr92</institution-id><institution>Translational Health Science and Technology Institute, NCR Biotech Science Cluster</institution></institution-wrap><addr-line><named-content content-type="city">Faridabad</named-content></addr-line><country>India</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01dr6c206</institution-id><institution>4Jerzy Haber Institute of Catalysis and Surface Chemistry, Polish Academy of Sciences</institution></institution-wrap><addr-line><named-content content-type="city">Niezapominajek</named-content></addr-line><country>Poland</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Dassama</surname><given-names>Laura</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00f54p054</institution-id><institution>Stanford University</institution></institution-wrap><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Boudker</surname><given-names>Olga</given-names></name><role>Senior Editor</role><aff><institution>Weill Cornell Medicine</institution><country>United States</country></aff></contrib></contrib-group><author-notes><fn fn-type="con" id="equal-contrib1"><label>†</label><p>These authors contributed equally to this work</p></fn></author-notes><pub-date date-type="publication" publication-format="electronic"><day>27</day><month>04</month><year>2022</year></pub-date><pub-date pub-type="collection"><year>2022</year></pub-date><volume>11</volume><elocation-id>e73055</elocation-id><history><date date-type="received" iso-8601-date="2021-08-14"><day>14</day><month>08</month><year>2021</year></date><date date-type="accepted" iso-8601-date="2022-04-26"><day>26</day><month>04</month><year>2022</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint at .</event-desc><date date-type="preprint" iso-8601-date="2021-09-06"><day>06</day><month>09</month><year>2021</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2021.09.06.459080"/></event></pub-history><permissions><copyright-statement>© 2022, Ahmad et al</copyright-statement><copyright-year>2022</copyright-year><copyright-holder>Ahmad et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-73055-v3.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-73055-figures-v3.pdf"/><abstract><p><sc>L,D</sc>-transpeptidase function predominates in atypical 3 → 3 transpeptide networking of peptidoglycan (PG) layer <italic>in Mycobacterium tuberculosis</italic>. Prior studies of <sc>L,D</sc>-transpeptidases have identified only the catalytic site that binds to peptide moiety of the PG substrate or β-lactam antibiotics. This insight was leveraged to develop mechanism of its activity and inhibition by β-lactams. Here, we report identification of an allosteric site at a distance of 21 Å from the catalytic site that binds the sugar moiety of PG substrates (hereafter referred to as the S-pocket). This site also binds a second β-lactam molecule and influences binding at the catalytic site. We provide evidence that two β-lactam molecules bind co-operatively to this enzyme, one non-covalently at the S-pocket and one covalently at the catalytic site. This dual β-lactam-binding phenomenon is previously unknown and is an observation that may offer novel approaches for the structure-based design of new drugs against <italic>M. tuberculosis</italic>.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd><italic>Mycobacterium tuberculosis</italic></kwd><kwd>β-lactam</kwd><kwd>peptidoglycan</kwd><kwd>L,D-transpeptidase</kwd><kwd>allostery</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>None</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001843</institution-id><institution>Science and Engineering Research Board</institution></institution-wrap></funding-source><award-id>CRG/2019/005079</award-id><principal-award-recipient><name><surname>Kumar</surname><given-names>Pankaj</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R33 AI111739</award-id><principal-award-recipient><name><surname>Lamichhane</surname><given-names>Gyanu</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution>Department of Biotechnology, Ministry of Science and Technology, India</institution></institution-wrap></funding-source><award-id>BT-RLF/Re-entry/68/2017</award-id><principal-award-recipient><name><surname>Kumar</surname><given-names>Pankaj</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01 AI155664</award-id><principal-award-recipient><name><surname>Lamichhane</surname><given-names>Gyanu</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Allosteric mechanism of dual β-lactam binding in L,D-transpeptidase from <italic>Mycobacterium tuberculosis</italic>.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Tuberculosis (TB), is a major threat to global health as it claims more human lives than any other bacterial infection (<xref ref-type="bibr" rid="bib4">Chakaya et al., 2021</xref>). The emergence of multi- and extensively drug-resistant strains of <italic>Mycobacterium tuberculosis (M.tb</italic>), the bacterium that causes TB, has further limited our capability to fight the disease. One major factor contributing to the emergence of drug-resistant TB is poor compliance with prolonged treatment regimens. While combinatorial drug therapy kills the majority of <italic>M.tb</italic> bacilli, a subset of the bacterial population, defined as ‘persisters’, tolerate TB drugs. This persister subset requires prolonged treatment for sterilization to occur (<xref ref-type="bibr" rid="bib16">Gideon and Flynn, 2011</xref>; <xref ref-type="bibr" rid="bib29">Lillebaek et al., 2002</xref>; <xref ref-type="bibr" rid="bib37">Peddireddy et al., 2017</xref>; <xref ref-type="bibr" rid="bib48">Wayne and Hayes, 1996</xref>). Mechanisms of persistence in <italic>M.tb are</italic> likely multifactorial, involving cell wall peptidoglycan (PG) remodelling, transporters or efflux pumps, and alternative energy sources (<xref ref-type="bibr" rid="bib21">Keren et al., 2011</xref>; <xref ref-type="bibr" rid="bib52">Zhang et al., 2012</xref>). Molecular understanding of these pathways may facilitate discovery of new therapeutics to overcome the current challenges posed by <italic>M.tb</italic> persistence and drug resistance.</p><p>PG is an essential component of the bacterial cell wall and constitutes the exoskeleton of bacterial cells. PG consist of long glycan chains composed of two different sugars <italic>N</italic>-acetyl muramic acid and <italic>N</italic>-acetylglucosamine that are crossed linked via stem peptide chains. The PG composition of <italic>M.tb</italic> in slowly replicating states is likely to be distinct from the one during active growth (<xref ref-type="bibr" rid="bib18">Gupta et al., 2010</xref>; <xref ref-type="bibr" rid="bib43">Schoonmaker et al., 2014</xref>; <xref ref-type="bibr" rid="bib49">Wietzerbin et al., 1974</xref>). In particular, a high percentage of peptide crosslinks in <italic>M.tb</italic> join the third amino acids (3–3 linkages) of the adjacent stem peptides instead of the classical 4–3 linkages, and these linkages are formed by transpeptidases (<xref ref-type="bibr" rid="bib45">Tolufashe et al., 2020</xref>). The 4–3 linkages, which were historically considered to predominate throughout bacterial growth and senescence, are generated by a well-known enzyme class, namely the <sc>D,D</sc>-transpeptidases (also known as penicillin-binding proteins) (<xref ref-type="bibr" rid="bib45">Tolufashe et al., 2020</xref>). The 3–3 linkages are generated by the more recently discovered enzyme class, the <sc>L,D</sc>-transpeptidases (<xref ref-type="bibr" rid="bib30">Mainardi et al., 2005</xref>).</p><p>Among the five <sc>L,D</sc>-transpeptidase paralogs of <italic>M.tb</italic>, Ldt<sub>Mt2</sub> plays an important role since an <italic>M.tb</italic> strain lacking the gene encoding this enzyme exhibits attenuation in virulence and exhibits enhanced susceptibility to β-lactam antibiotics (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>; <xref ref-type="bibr" rid="bib3">Brammer Basta et al., 2015</xref>; <xref ref-type="bibr" rid="bib10">Dubée et al., 2012</xref>; <xref ref-type="bibr" rid="bib18">Gupta et al., 2010</xref>; <xref ref-type="bibr" rid="bib27">Libreros-Zúñiga et al., 2019</xref>; <xref ref-type="bibr" rid="bib41">Sanders et al., 2014</xref>; <xref ref-type="bibr" rid="bib43">Schoonmaker et al., 2014</xref>). Additional reports have demonstrated altered and attenuated cellular physiology of <italic>M.tb</italic> in association with the loss of function of Ldt<sub>Mt1</sub> (<xref ref-type="bibr" rid="bib43">Schoonmaker et al., 2014</xref>) and Ldt<sub>Mt5</sub> (<xref ref-type="bibr" rid="bib3">Brammer Basta et al., 2015</xref>). The requirement of <sc>L,D</sc>-transpeptidases for virulence has suggested that they may comprise valuable drug targets, and indeed these enzymes are inhibited by the carbapenem subclass of β-lactam drugs (<xref ref-type="bibr" rid="bib30">Mainardi et al., 2005</xref>). Recent work further suggests the efficacy of these carbapenems against both dividing and non-dividing mycobacteria (<xref ref-type="bibr" rid="bib19">Hugonnet et al., 2009</xref>). To further evaluate the druggability of the <sc>L,D</sc>-transpeptidases class, several independent groups have described the crystal structures of this enzyme class bound to carbapenems such as meropenem, tebipenem, biapenem, and faropenem (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>; <xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>; <xref ref-type="bibr" rid="bib22">Kim et al., 2013</xref>; <xref ref-type="bibr" rid="bib26">Li et al., 2013</xref>; <xref ref-type="bibr" rid="bib44">Steiner et al., 2017</xref>). The biochemical mechanisms and kinetics of inhibition of <sc>L,D</sc>-transpeptidases by β-lactams have been documented (<xref ref-type="bibr" rid="bib6">Cordillot et al., 2013</xref>), and new experimental β-lactams that target <italic>M.tb</italic> <sc>L,D</sc>-transpeptidases have recently been described (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>; <xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>; <xref ref-type="bibr" rid="bib31">Martelli et al., 2021</xref>).</p><p>The <sc>L,D</sc>-transpeptidase class in <italic>M.tb</italic> is comprised of at least four substructural domains including two immunoglobulin-like domains (IgD1 and IgD2), a YkuD domain, and a C-terminal subdomain (CTSD). The YkuD domain is known to play a role in catalytic function and β-lactam binding (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>), while the roles of the other domains remain less certain. The YkuD domain has a highly conserved motif HXX14-17[S/T]HGChN containing three residues analogous to the catalytic triad of cysteine proteases: a cysteine, a histidine and a third residue (Cysteine 354, Histidine 336, and Serine 337 in Ldt<sub>Mt2</sub>) to catalyse the transpeptidation reaction (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>). This catalytic triad residues resides under a flap formed by a long loop. The flap can open and close to create two cavities (the inner and outer cavities), around a cysteine residue, that are connected by a narrow tunnel (<xref ref-type="bibr" rid="bib14">Fakhar et al., 2017</xref>). It is proposed that these cavities are binding sites for the acyl acceptor and acyl donor tetrapeptide stems (<sc>L</sc>-alanyl-<sc>D</sc>-Glutamyl-<italic>meso</italic>-diaminopimelyl-<sc>D</sc>-alanine) with the donor tetrapeptide binding to the outer cavity and the acceptor tetrapeptide to the inner cavity (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>). As the β-lactam class of drugs mimics the tetrapeptide stems of PG, several of the carbapenems have been found to bind both the inner and outer cavities to form covalent linkage with catalytic cysteine residue of the <sc>L,D</sc>-transpeptidases (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>; <xref ref-type="bibr" rid="bib22">Kim et al., 2013</xref>; <xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>).</p><p>Despite the significance of <sc>L,D</sc>-transpeptidases in <italic>M.tb</italic> cell physiology and TB disease, the structural and molecular details of how different chemical groups of the nascent PG structure interact with this enzyme class are not sufficiently understood. The disaccharide-tetrapeptide <italic>N-</italic>acetylglucosamine-<italic>N-</italic>acetylmuramic acid-L-alanyl-D-glutamyl-<italic>meso</italic>-diaminopimelyl-D-alanine is the substrate for <sc>L,D</sc>-transpeptidases (<xref ref-type="bibr" rid="bib6">Cordillot et al., 2013</xref>; <xref ref-type="bibr" rid="bib24">Lavollay et al., 2008</xref>) while the D,D-transpeptidases use the disaccharide-pentapeptide <italic>N-</italic>acetylglucosamine-<italic>N-</italic>acetylmuramic acid-L-alanyl-D-glutamyl-<italic>meso</italic>-diaminopimelyl-D-alanyl-D-alanine as their substrate (<xref ref-type="bibr" rid="bib45">Tolufashe et al., 2020</xref>). Interactions between the peptide subunits of these nascent PG substrates with their relevant enzymes have been described (<xref ref-type="bibr" rid="bib6">Cordillot et al., 2013</xref>; <xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>; <xref ref-type="bibr" rid="bib14">Fakhar et al., 2017</xref>; <xref ref-type="bibr" rid="bib24">Lavollay et al., 2008</xref>; <xref ref-type="bibr" rid="bib30">Mainardi et al., 2005</xref>), and it is generally assumed that the disaccharide component of the subunit interacts only with transglycosylases (<xref ref-type="bibr" rid="bib15">Fibriansah et al., 2012</xref>; <xref ref-type="bibr" rid="bib32">Mavrici et al., 2014</xref>) and thus are not relevant to the transpeptidases. However, evidence challenging this model is growing. Recent studies with the <italic>Bacillus subtilis</italic> <sc>L,D</sc>-transpeptidase Ldt<sub>Bs</sub> have suggested binding of the disaccharide component through a PG recognition domain, LysM, within Ldt<sub>Bs</sub> (<xref ref-type="bibr" rid="bib42">Schanda et al., 2014</xref>). However, the mechanism of PG recognition may be different in <italic>M.tb</italic> since this LysM domain is absent in its <sc>L,D</sc>-transpeptidases.</p><p>In the current study, we investigate the interaction of PG substrate and β-lactam with <sc>L,D</sc>-transpeptidase, Ldt<sub>Mt2</sub>. Based on our structural, biophysical, and biochemical data, we identify a new PG disaccharide moiety-binding pocket (named as S-pocket) at a distance of 21 Å from the catalytic site in Ldt<sub>Mt2</sub>. This new site recognizes β-lactams and modulates their binding and hydrolysis in the catalytic site. Our experimental and computational studies identify allosteric communications between catalytic site and S-pocket that has led to the finding that Ldt<sub>Mt2</sub> can recognize two β-lactams, one non-covalently at the S-pocket and one covalently at catalytic site. The crystallographic studies of Ldt<sub>Mt2</sub> with an experimental carbapenem drug further reveal the high-resolution details of allosteric alterations that span between the S-pocket and catalytic site during β-lactam binding. Identification of an allosteric cooperativity between the S-pocket and catalytic site also represents a valuable case to investigate recognition of natural substrates prior to 3–3 transpeptide reaction. The study also provides insights into inhibition by β-lactams and supports the context for structure-based design of anti-tubercular drugs.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>A pocket remote from the catalytic site of Ldt<sub>Mt2</sub> binds PG</title><p>The crystal structure of Ldt<sub>Mt2</sub> was solved at 1.57 Å resolution (<xref ref-type="table" rid="table1">Table 1</xref>). This high-resolution crystal structure is an improvement of our previous efforts (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>; <xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>) that enabled us to identify an electron density in a pocket between the IgD2-YkuD domains, and a glucose molecule could be modelled into the electron density at 1.0 sigma (<xref ref-type="fig" rid="fig1">Figure 1A</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). This glucose molecule is likely to be part of a PG disaccharide moiety originating from the <italic>E. coli</italic> cell lysate during Ldt<sub>Mt2</sub> purification. The sugar molecule is ensconced at the IgD2-YkuD domain interface in a pocket, which we referred to as the S-pocket, making several electrostatic interactions with residues R209, E207, E168, R371, Y330, and A171. Three residues M157, A171, and L391 stabilize the sugar through hydrophobic interactions. To provide additional evidence for the binding of PG substrates within the S-pocket, we performed ThermoFluor assays with <italic>N</italic>-acetylmuramyl-L-alanyl-D-isoglutamine hydrate, a precursor of PG. A higher molar concentration of <italic>N</italic>-acetylmuramyl-L-alanyl-D-isoglutamine gradually shifted the melting curve of Ldt<sub>Mt2</sub> indicative of saturable binding behaviour (<xref ref-type="fig" rid="fig1">Figure 1B, C</xref>, <xref ref-type="supplementary-material" rid="fig1sdata1">Figure 1—source data 1</xref>). R209E and E207A mutations in the S-pocket disrupted the binding of <italic>N</italic>-acetylmuramyl-L-alanyl-D-isoglutamine with Ldt<sub>Mt2</sub>. Y330F mutation also affected the binding of PG precursor. This was the order of magnitude of detrimental effect of mutations in the S-pocket on PG precursor binding: R209E ≥ E207A &gt; Y330. As the binding of PG precursor was in mM range, this indicated a weak binding with the S-pocket.</p><table-wrap id="table1" position="float"><label>Table 1.</label><caption><title>Data collection and refinement statistics.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom"/><th align="center" valign="bottom">Ldt<sub>Mt2</sub>–sugar</th><th align="center" valign="bottom">Ldt<sub>Mt2</sub>–T203</th></tr></thead><tbody><tr><td align="left" valign="bottom">Data collection</td><td align="center" valign="bottom"/><td align="center" valign="bottom"/></tr><tr><td align="left" valign="bottom">Wavelength (Å)</td><td align="center" valign="bottom">1.0</td><td align="center" valign="bottom">1.0</td></tr><tr><td align="left" valign="bottom">Resolution (Å)</td><td align="center" valign="bottom">29.73–1.58 (1.64–1.58)</td><td align="center" valign="bottom">30.0–1.7 (1.73–1.70)</td></tr><tr><td align="left" valign="bottom">Space group</td><td align="center" valign="bottom">P 1 21 1</td><td align="center" valign="bottom">P 1 21 1</td></tr><tr><td align="left" valign="bottom">Unit cell (Å)</td><td align="center" valign="bottom">60.906, 93.981, 75.539,<break/>90, 92.975, 90</td><td align="center" valign="bottom">60.799 94.278 75.707 90.00 93.14 90.00</td></tr><tr><td align="left" valign="bottom">Unique reflections<sup>a</sup></td><td align="center" valign="bottom">111,390</td><td align="center" valign="bottom">90,418</td></tr><tr><td align="left" valign="bottom">Multiplicity<sup>a</sup></td><td align="center" valign="bottom">4.3 (4.1)</td><td align="center" valign="bottom">5 (5)</td></tr><tr><td align="left" valign="bottom">Completeness<sup>a</sup></td><td align="center" valign="bottom">96.0 (98.6)</td><td align="center" valign="bottom">97.4 (95.9)</td></tr><tr><td align="left" valign="bottom"><italic>R</italic><sub>merge</sub><sup>a, b</sup></td><td align="center" valign="bottom">0.048 (0.55)</td><td align="center" valign="bottom">0.073 (0.74)</td></tr><tr><td align="left" valign="bottom">Overall <italic>I</italic>/<italic>σ</italic>(<italic>I</italic>)<sup>a</sup></td><td align="center" valign="bottom">20.37 (1.8)</td><td align="center" valign="bottom">23.7 (3.3)</td></tr><tr><td align="left" valign="bottom">Refinement</td><td align="center" valign="bottom"/><td align="center" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>R</italic><sub>work</sub> (%)<sup>c</sup></td><td align="center" valign="bottom">0.1662</td><td align="center" valign="bottom">0.1666</td></tr><tr><td align="left" valign="bottom"><italic>R</italic><sub>free</sub> (%)<sup>d</sup></td><td align="center" valign="bottom">0.1980</td><td align="center" valign="bottom">0.1853</td></tr><tr><td align="left" valign="bottom">r.m.s.d.</td><td align="center" valign="bottom"/><td align="center" valign="bottom"/></tr><tr><td align="left" valign="bottom">Bonds (Å)</td><td align="center" valign="bottom">0.009</td><td align="center" valign="bottom">0.009</td></tr><tr><td align="left" valign="bottom">Angles (°)</td><td align="center" valign="bottom">1.03</td><td align="center" valign="bottom">1.033</td></tr><tr><td align="left" valign="bottom">Average <italic>B</italic>-factor (Å<sup>2</sup>)</td><td align="center" valign="bottom"/><td align="center" valign="bottom"/></tr><tr><td align="left" valign="bottom">Protein</td><td align="center" valign="bottom">14.9</td><td align="center" valign="bottom">14.2</td></tr><tr><td align="left" valign="bottom">Active-site ligand</td><td align="center" valign="bottom">19.28</td><td align="center" valign="bottom">L01 = 25.71, T20 = 34.1</td></tr><tr><td align="left" valign="bottom">Ramachandaran</td><td align="center" valign="bottom"/><td align="center" valign="bottom"/></tr><tr><td align="left" valign="bottom">Favoured</td><td align="center" valign="bottom">98.28%</td><td align="center" valign="bottom">97.99%</td></tr><tr><td align="left" valign="bottom">Additional allowed</td><td align="center" valign="bottom">1.72%</td><td align="center" valign="bottom">2.01%</td></tr><tr><td align="left" valign="bottom">PDB ID</td><td align="center" valign="bottom">7F71</td><td align="center" valign="bottom">7F8P</td></tr></tbody></table><table-wrap-foot><fn><p>Values in parenthesis are for the highest resolution shell.</p></fn></table-wrap-foot></table-wrap><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Binding studies of peptidoglycan (PG) with Ldt<sub>Mt2</sub>.</title><p>(<bold>A</bold>) Crystal structure of Ldt<sub>Mt2</sub> in complex with one glucose molecule. The inset shows the 2Fo-Fc omit map (contoured at 1.0<italic>σ</italic>) of glucose (cyan colour) modelled into the S-pocket of Ldt<sub>Mt2</sub> in the crystal structure. (<bold>B</bold>) ThermoFluor assay for binding studies with the PG-precursor <italic>N</italic>-acetylmuramyl-L-alanyl-D-isoglutamine hydrate with wild-type Ldt<sub>Mt2</sub>, R209E, E207A, and Y330F mutants. A change in melting temperature (∆<italic>T</italic><sub>m</sub>) at <italic>y</italic>-axis was plotted against the ligand concentrations at <italic>x</italic>-axis in GraphPad Prism software. (<bold>C</bold>) Differential fluorescence (−d<italic>F</italic>/d<italic>T</italic>) graphs of ThermoFluor assay for Ldt<sub>Mt2</sub> and mutants. The dotted line indicates the <italic>T</italic><sub>m</sub>, and a red arrow indicates the direction of thermal shift. A chemical structure above the ThermoFluor assay graph is <italic>N</italic>-acetylmuramyl-L-alanyl-D-isoglutamine hydrate. (<bold>D</bold>) Superposition of Ldt<sub>Mt2</sub> (green) with PG-bound Ldt<sub>Bs</sub>, the <italic>Bacillus subtilis</italic> <sc>L,D</sc>-transpeptidase (PDB ID: 2MTZ) (pink). YkuD domain of Ldt<sub>Mt2</sub> was superposed with catalytic domain of ldt<sub>BS</sub> with an RMSD of 1.46 Å. PG chain is shown in cyan colour. (<bold>E</bold>) Modelling of PG (cyan colour) into the Ldt<sub>Mt2</sub> (green). Electrostatic potential (negative in red, positive in blue) highlights the acidic and positively charge surface and binding of PG chain in <sc>L,D</sc>-transpeptidases Ldt<sub>BS</sub> and Ldt<sub>Mt2</sub>.</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>Raw data on ThermoFluor study of peptidoglycan (PG) substrate binding with wild-type and mutants.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-73055-fig1-data1-v3.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig1-v3.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>2Fo-Fc map of sugar bound into the S-pocket of Ldt<sub>Mt2</sub> in the crystal structure.</title><p>S-pocket is represented in surface. Sugar is shown in stick model in pink colour. 2Fo-Fc map is shown in blue colour and contoured at 1.0<italic>σ</italic>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig1-figsupp1-v3.tif"/></fig></fig-group><p>An atomic model of the <sc>L,D</sc>-transpeptidase from <italic>B. subtilis</italic> (Ldt<sub>BS</sub>) in complex with nascent PG chain was described earlier (PDB ID: 2MTZ) (<xref ref-type="bibr" rid="bib42">Schanda et al., 2014</xref>). As Ldt<sub>BS</sub> has a LysM domain that Ldt<sub>Mt2</sub> lacks, we superposed the catalytic domain of Ldt<sub>BS</sub> with YkuD domain of Ldt<sub>Mt2</sub> with an RMSD of 1.46 Å. Superposition of the structures of the Ldt<sub>Mt2</sub>–sugar complex with the Ldt<sub>BS</sub>–PG complex suggests that longer nascent PG chains thread across the S-pocket in between the IgD1-YkuD domains of Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig1">Figure 1D</xref>). In the Ldt<sub>BS</sub> structure, the acidic sugar moieties of PG chain bind in-between the LsyM domain and catalytic domain across a positively charged groove (<xref ref-type="fig" rid="fig1">Figure 1E</xref>). Based on the structural details of PG binding in Ldt<sub>BS</sub> (<xref ref-type="bibr" rid="bib42">Schanda et al., 2014</xref>) and Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig1">Figure 1A</xref>), a PG chain was computationally placed over a positively charged surface across the IgD2-YkuD domain interface encompassing the S-pocket. This computational modelling of a longer PG chain spatially aligns one of its tetrapeptide stem across an inner cavity of the catalytic site in YkuD domain in Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig1">Figure 1E</xref>), similar to reports of carbapenem and a PG-moiety binding in the same position (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>; <xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>; <xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>). This inner cavity of the catalytic site is proposed to bind the acceptor tetrapeptide stem, and the outer cavity to bind the donor tetrapeptide stem prior to their 3–3 transpeptide cross-linkage by Ldt<sub>Mt2</sub> (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>). Based on our crystal structure and modelling study, we propose that the S-pocket anchors the disaccharide moiety of one of the nascent PG chains prior to transpeptidation of tetrapeptide stems in the catalytic site.</p></sec><sec id="s2-2"><title>The S-pocket modulates β-lactam hydrolysis activity</title><p>Our crystal structure reveals that Ldt<sub>Mt2</sub> is composed of three distinct domains as shown in <xref ref-type="fig" rid="fig2">Figure 2A</xref>. As the S-pocket resides within the IgD2-YkuD domain interface, we investigated whether the S-pocket or different Ldt<sub>Mt2</sub> domains play contributing role in the enzyme’s catalytic function. Due to the lack of tractable enzymatic assays with native PG substrates for observing physiological catalytic activity, we choose nitrocefin, a chromogenic β-lactam, as a reporter substrate to assess the β-lactam hydrolysis activity (<xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>). To undertake this study, we expressed and purified fragments of Ldt<sub>Mt2</sub> corresponding to IgD1, IgD2, IgD1–IgD2, IgD2-YkuD, and YkuD domains. The full-length Ldt<sub>Mt2</sub> holoenzyme showed a <italic>V</italic><sub>max</sub> of 0.23 µM/min and <italic>K</italic><sub>m</sub> of 16.32 µM in the nitrocefin hydrolysis assay (<xref ref-type="table" rid="table2">Table 2</xref>). Deletion of the IgD1 domain assessed by the IgD2-YkuD domain fragment resulted in no effect on the β-lactam hydrolysis. However, deletion of IgD2 from the YkuD domain as assessed by the YkuD fragment alone led to a significant adverse effect on the nitrocefin hydrolysis activity with an increase in the Km value to 129 µM (an ~eightfold increase) and a decline in enzyme turn-over by ~tenfold (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, <xref ref-type="supplementary-material" rid="fig2sdata1">Figure 2—source data 1</xref>, and <xref ref-type="table" rid="table2">Table 2</xref>). This suggests an important role of S-pocket which is partly carried by the IgD2 domain in governing the catalytic activity of Ldt<sub>Mt2</sub> enzyme. We further evaluated the role of the S-pocket by generating site-directed mutations at residues R209, Y330, and E207 as they are situated within the S-pocket and interact with the sugar moiety (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). R209 makes part of IgD2 domain and Y330 residue comes from the YkuD domain into the S-pocket. Y330F mutation led to a decrease in the nitrocefin hydrolysis with a <italic>V</italic><sub>max</sub> 0.15 µM/min and K<sub>m</sub> of 11.12 µM. R209E mutant hydrolysed nitrocefin with a <italic>K</italic><sub>m</sub> 428 µM that is ~26-fold higher than wild-type, while its <italic>V</italic><sub>max</sub> remained almost the same as wild-type. A high <italic>K</italic><sub>m</sub> value is an indicator of weak binding of the substrate with the enzyme, and shows that the enzyme would need a greater number of substrate molecules to achieve a maximum rate of reaction. A E207A mutation also showed a decrease in the β-lactam hydrolysis activity as compared to wild-type (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). It is highly likely that the S-pocket has a role in modulating the catalytic activity of Ldt<sub>Mt2</sub> enzyme allosterically. We ruled out any impact of R209E mutation on the secondary structure content of Ldt<sub>Mt2</sub> enzyme using circular dichroism (CD) spectroscopy (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). The recorded difference in CD spectra is not significant to suggest any structural changes or problem in protein folding due to R209E mutation. In fact, an overall good overlapping CD spectrum of the wild-type and the R209E mutant suggests that the proteins maintain an overall similar folds. Moreover, the changes recorded in the CD spectra are gross overall changes in the structural element, so even if there are some minor changes in the CD spectra at 210 nm, it is difficult to correlate the region of change. Our biophysical ThermoFluor assay also suggests no major difference in the thermal melting of R209E and wild-type, indicating no major changes in overall fold of the protein (<xref ref-type="fig" rid="fig1">Figure 1C</xref>).</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Role of the S-pocket in β-lactam hydrolysis.</title><p>(<bold>A</bold>) The structure of Ldt<sub>Mt2</sub> with each domain highlighted: IgD1 (orange), IgD2 (blue), YkuD domain (green), and C-terminal subdomain (CTSD) (cyan). A red dotted line demarcates the 21 Å distance between the S-pocket and the catalytic site. (<bold>B</bold>) Chromogenic nitrocefin hydrolysis activity of truncated Ldt<sub>Mt2</sub> fragments corresponding to the IgD1, IgD2, IgD1–IgD2, YkuD, IgD2-YkuD domains, R209E, and Y330F mutants. (<bold>C</bold>) Circular dichroism (CD) spectra of wild-type and R209E mutant.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Raw data on nitrocefin hydrolysis assay.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-73055-fig2-data1-v3.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig2-v3.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Chromogenic nitrocefin hydrolysis activity of wild-type Ldt<sub>Mt2</sub> and E207A mutant.</title></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig2-figsupp1-v3.tif"/></fig></fig-group><table-wrap id="table2" position="float"><label>Table 2.</label><caption><title>Kinetic parameters of β-lactam hydrolysis by Ldt<sub>Mt2</sub> and mutant proteins.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Enzyme</th><th align="left" valign="bottom"><italic>V</italic><sub>max</sub> (µM/min)</th><th align="left" valign="bottom"><italic>K</italic><sub>m</sub> (µM)</th><th align="left" valign="bottom"><italic>K</italic><sub>cat</sub> (s<sup>−1</sup>)</th><th align="left" valign="bottom"><italic>K</italic><sub>cat</sub>/<italic>K</italic><sub>m</sub> (M<sup>−1</sup> s<sup>−1</sup>)</th></tr></thead><tbody><tr><td align="left" valign="bottom">Ldt<sub>Mt2</sub> (∆N55)</td><td align="char" char="plusmn" valign="bottom">0.23 ± 0.01</td><td align="char" char="plusmn" valign="bottom">16.32 ± 1.78</td><td align="char" char="hyphen" valign="bottom">7.7E−4</td><td align="char" char="." valign="bottom">47.18</td></tr><tr><td align="left" valign="bottom">IgD1</td><td align="left" valign="bottom">Ambiguous</td><td align="char" char="±" valign="bottom">   –</td><td align="left" valign="bottom">–</td><td align="left" valign="bottom">–</td></tr><tr><td align="left" valign="bottom">IgD2</td><td align="left" valign="bottom">Ambiguous</td><td align="char" char="±" valign="bottom">   –</td><td align="left" valign="bottom">–</td><td align="left" valign="bottom">–</td></tr><tr><td align="left" valign="bottom">IgD1–IgD2</td><td align="left" valign="bottom">Ambiguous</td><td align="char" char="±" valign="bottom">   –</td><td align="left" valign="bottom">–</td><td align="left" valign="bottom">–</td></tr><tr><td align="left" valign="bottom">IgD2-YkuD</td><td align="char" char="plusmn" valign="bottom">0.21 ± 0.01</td><td align="char" char="plusmn" valign="bottom">16.18 ± 2.24</td><td align="char" char="hyphen" valign="bottom">7.0E−4</td><td align="char" char="." valign="bottom">43.26</td></tr><tr><td align="left" valign="bottom">YkuD</td><td align="char" char="plusmn" valign="bottom">0.15 ± 0.02</td><td align="char" char="plusmn" valign="bottom">129.5 ± 41.80</td><td align="char" char="hyphen" valign="bottom">5.0E−4</td><td align="char" char="." valign="bottom">3.86</td></tr><tr><td align="left" valign="bottom">R209E</td><td align="char" char="plusmn" valign="bottom">0.25 ± 0.07</td><td align="char" char="plusmn" valign="bottom">428.40 ± 195.9</td><td align="char" char="hyphen" valign="bottom">8.3E−4</td><td align="char" char="." valign="bottom">1.90</td></tr><tr><td align="left" valign="bottom">Y330F</td><td align="char" char="plusmn" valign="bottom">0.15 ± 0.01</td><td align="char" char="plusmn" valign="bottom">11.12 ± 3.15</td><td align="char" char="hyphen" valign="bottom">5.0E−4</td><td align="char" char="." valign="bottom">44.96</td></tr><tr><td align="left" valign="bottom">S351A</td><td align="char" char="plusmn" valign="bottom">0.11 ± 0.02</td><td align="char" char="plusmn" valign="bottom">123.1 ± 56.7</td><td align="char" char="hyphen" valign="bottom">3.7E−4</td><td align="char" char="." valign="bottom">3.01</td></tr><tr><td align="left" valign="bottom">C354A</td><td align="left" valign="bottom">Ambiguous</td><td align="char" char="±" valign="bottom">   –</td><td align="left" valign="bottom">–</td><td align="left" valign="bottom">–</td></tr><tr><td align="left" valign="bottom">H352A</td><td align="char" char="plusmn" valign="bottom">0.10 ± 0.01</td><td align="char" char="plusmn" valign="bottom">21.14 ± 6.11</td><td align="char" char="hyphen" valign="bottom">3.3E−4</td><td align="char" char="." valign="bottom">15.61</td></tr><tr><td align="left" valign="bottom">H336N</td><td align="char" char="plusmn" valign="bottom">0.07 ± 0.01</td><td align="char" char="plusmn" valign="bottom">39.13 ± 17.92</td><td align="char" char="hyphen" valign="bottom">2.3E−4</td><td align="char" char="." valign="bottom">5.88</td></tr><tr><td align="left" valign="bottom">M303A</td><td align="char" char="plusmn" valign="bottom">0.14 ± 0.01</td><td align="char" char="plusmn" valign="bottom">11.71 ± 2.90</td><td align="char" char="hyphen" valign="bottom">4.7E−4</td><td align="char" char="." valign="bottom">40.14</td></tr><tr><td align="left" valign="bottom">S337A</td><td align="char" char="plusmn" valign="bottom">0.23 ± 0.01</td><td align="char" char="plusmn" valign="bottom">23.30 ± 2.51</td><td align="char" char="hyphen" valign="bottom">7.6E−4</td><td align="char" char="." valign="bottom">32.62</td></tr><tr><td align="left" valign="bottom">K282A</td><td align="char" char="plusmn" valign="bottom">0.16 ± 0.01</td><td align="char" char="plusmn" valign="bottom">12.06 ± 3.23</td><td align="char" char="hyphen" valign="bottom">5.3E−4</td><td align="char" char="." valign="bottom">43.94</td></tr></tbody></table></table-wrap></sec><sec id="s2-3"><title>The S-pocket cross-talks with the catalytic site to modulate β-lactam hydrolysis</title><p>To evaluate the effects of mutations in the S-pocket on catalytic site activity ~21 Å away, we ran molecular dynamic (MD) simulations of the Ldt<sub>Mt2</sub> wild-type and R209E mutant proteins. Changes in the structural features, before and after the R209E mutation were analyzed by calculating α-alpha RMSD (root mean square deviation) over the course of 200-ns simulation. These calculations were performed using <italic>GROMACS</italic> (<xref ref-type="bibr" rid="bib39">Pronk et al., 2013</xref>). While the mutant model exhibits slightly higher dynamics after 65 ns, the overall RMSD of the models ranged from 0 to 0.45 Å and showed stable conformation for the entire period. Both models show constant stability after 120 ns (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). After 200 ns of MD simulations, structural and conformational changes were observed in the catalytic center of YkuD domain including the catalytic triad residues C354, H336, and S337 and other residues in the catalytic site, namely, S351, M303, and W340. After the MD simulations in wild-type Ldt<sub>Mt2</sub>, H336-NE2 formed a hydrogen bond interaction with side chain hydroxyl group oxygen (OG) of S351 (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). A probably density graph calculated a close hydrogen bond distance between H336-NE2 and S351-OG (<xref ref-type="fig" rid="fig3">Figure 3B</xref>, <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>). A hydrogen bond interaction was also observed between H336-ND1 and backbone oxygen (O) of S337 (<xref ref-type="fig" rid="fig3">Figure 3A</xref>), and this interaction has been reported to be important for stabilizing the tautomer of H336 protonated at NE2 (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>).</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>S-pocket crosstalk with the catalytic site of Ldt<sub>Mt2</sub>.</title><p>(<bold>A</bold>) Superposition of molecular dynamic (MD) simulated structures of catalytic site of wild-type Ldt<sub>Mt2</sub> (146–408 residues, green) and the R209E mutant (146–408 residues, pink) at 150 ns trajectory along with a trajectory (cyan) at 0 ns. The inset shows a detailed view of the catalytic site of the wild-type protein and R209E mutant at 150 ns trajectory. (<bold>B</bold>) Dynamic distance analysis of key residue pairs vs. simulation time calculated from 200 ns of MD simulation run. A density function graph is also plotted. (<bold>C</bold>) Chromogenic nitrocefin hydrolysis activity of wild-type Ldt<sub>Mt2</sub> and different mutants with alterations in both the S-pocket and catalytic site.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Raw data on dynamic distance network analysis.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-73055-fig3-data1-v3.xlsx"/></supplementary-material></p><p><supplementary-material id="fig3sdata2"><label>Figure 3—source data 2.</label><caption><title>Raw data on nitrocefin hydrolysis assay.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-73055-fig3-data2-v3.xlsx"/></supplementary-material></p><p><supplementary-material id="fig3sdata3"><label>Figure 3—source data 3.</label><caption><title>Raw data on network analysis of wild-type Ldt<sub>Mt2</sub> and R209E mutant.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-73055-fig3-data3-v3.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig3-v3.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>RMSD graph of wild-type Ldt<sub>Mt2</sub> (blue) and R209 mutant (orange) over the duration of 200 ns of molecular dynamic (MD) simulations.</title></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig3-figsupp1-v3.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>An analysis of dynamics in-between the S-pocket and catalytic site in Ldt<sub>Mt2</sub>.</title><p>(<bold>A</bold>) Root mean square fluctuation (RMSF) graph of wild-type Ldt<sub>Mt2</sub> (blue) and R209 mutant (orange) over the duration of 200 ns of molecular dynamic (MD) simulations. (<bold>B</bold>) A density function graph of network analysis of dynamic distance between selected pair of amino acid residues in Ldt<sub>Mt2</sub>. (<bold>C</bold>) Structure of Ldt<sub>Mt2</sub> (green colour) with highlighted residue pairs (shown in stick model and pink colour) that undergo alterations in the dynamics subsequent upon mutation in R209 residue.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig3-figsupp2-v3.tif"/></fig><fig id="fig3s3" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 3.</label><caption><title>Network analysis of Ldt<sub>Mt2</sub> dynamics.</title><p>(<bold>A</bold>) Plotted correlation map showing a coupling of dynamic motions between residues. Highlighted white boxes show positive correlation (&gt;0 value) of R209 residue with other residues from the S-pocket and catalytic site. (<bold>B</bold>) Graph of centrality measure vs. each amino acid residue. The higher the centrality values, the more likely is the residue (node) important for the three-dimensional fold of the protein and network of interactions. (<bold>C, D</bold>) Network paths computed in cytoscape from the simulation of wild-type and R209E mutant protein from 209 residue towards catalytic site residues. Red arrows indicate edges with &gt;6 threshold of betweenness. (<bold>E</bold>) Structure of Ldt<sub>Mt2</sub> representing the flow of network of allosteric communications from the S-pocket to catalytic site.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig3-figsupp3-v3.tif"/></fig></fig-group><p>When we assessed the MD simulated structure of the R209E mutant, we found that imidazole ring of H336 was flipped that led to a disruption of hydrogen bond interaction between H336-ND1 and backbone oxygen (O) of S337 (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). A probably density graph also revealed no hydrogen bond interaction between H336-ND1 and S337-O in R209E mutant (<xref ref-type="fig" rid="fig3">Figure 3B</xref>, <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>). In addition, no hydrogen bond interaction was found between H336-NE2 and the hydroxyl group oxygen (OG) of the S351 residue and a probably density graph calculated between H336-NE2 and S351-OG pair also computed an increase in their distance during 200 ns of simulations (<xref ref-type="fig" rid="fig3">Figure 3B</xref>, <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>). Another W340 residue that resides outside the catalytic pocket comes closer to M303 and H336 through hydrophobic interactions to block the outer pocket of catalytic core. A close distance between W340-Çα and M303-Çα was also confirmed by probably density graph calculated along 200 ns of MD simulations (<xref ref-type="fig" rid="fig3">Figure 3B</xref>, <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>). Such blockage of outer catalytic pocket by W340 would also hinder the dynamics of the YkuD flap, which has been reported to be important in β-lactam binding (<xref ref-type="bibr" rid="bib14">Fakhar et al., 2017</xref>).</p><p>We further computed the root mean square fluctuation (RMSF) of wild-type and R209E mutant at 200 ns MD simulations to predict areas of major fluctuations in the structure of Ldt<sub>Mt2</sub> and an impact of R209E mutation (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2A</xref>). Notably, R209E mutation led to these major changes in the fluctuations in Ldt<sub>Mt2</sub>: (1) an increase in the fluctuations of a loop that interacts with S351 residue, (2) a decrease in the fluctuations of YkuD flap, and (3) a decrease in the fluctuations in the catalytic center. We further delved into the structural changes that were propagating between the S-pocket and catalytic center through the fluctuating regions. We selected a number of residue pairs in the fluctuating regions that were most impacted by R209E mutation (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2B</xref>). A dynamic distance and probability density graph of Y330-OH/D393-OD1 (a residue pair in S-pocket) computed a decrease in their dynamic distance subsequent upon R209E mutation, and this was an indication of a tighter junction between the YkuD domain and S-pocket. A Y292-OH/A288-N pair at the interface with S-pocket in the YkuD domain also became more closer with a hydrogen bond distance to tightly hold a loop that extended towards the catalytic site. A residue K282 in the loop made hydrogen bond interaction with the backbone oxygen (O) of catalytic site residue S351, however, R209E mutation led to an increase in their dynamic distance. This increase in the dynamic distance of S351-O/K282-N pair could impact catalysis, as S351 was found important for stabilizing H336-NE2 in the catalytic center (<xref ref-type="fig" rid="fig3">Figure 3A, B</xref>). And indeed, a K282A mutation led to a decrease in the enzymatic activity with a <italic>V</italic><sub>max</sub> 0.16 µM/min and <italic>K</italic><sub>m</sub> ~ 12 µM (<xref ref-type="table" rid="table2">Table 2</xref>). R209E mutation also led to the structural changes into the YkuD flap; H300 made more close interactions with D321-OD1 and D323-OD1 to render the flap less dynamic and fluctuating, as evident in the RMSF graph. Another pair of residues, D304-OD1/S306-OG, became more closer with a hydrogen bond distance to impact the YkuD flap fluctuations and dynamics in R209E mutant. A decrease in the fluctuations of YkuD flap also impacted the dynamic distance of Y308 residue with Q327 in R209E mutant, as Y308 resided on the tip of YkuD flap. In wild-type, dynamic distance of Y308-Q327 pair was found multiphasic that was an indication of movements of YkuD flap over the catalytic site, however, this dynamic distance became monophasic subsequent upon R209E mutation. These findings suggest that R209E mutation impacts the fluctuations and dynamics of YkuD flap over the catalytic site. Based on the dynamic distance analysis, we propose two major allosteric modulations in Ldt<sub>Mt2</sub> that can be regulated by S-pocket: (1) modulation of S351 residue via K282 to stabilize H336-NE2 in the catalytic site; (2) modulation of YkuD flap dynamics via Y330, Q327, D304, S306, and H330 to impact the catalysis. We suggest that R209E mutation in the S-pocket impacts both of these allosteric modulations to slow down the catalysis, as seen in nitrocefin hydrolysis assay (<xref ref-type="fig" rid="fig2">Figure 2B</xref>).</p><p>To identify the functional relevance of dynamic distance that were computed in wild-type and R209E mutant, we performed in vitro β-lactam hydrolysis activity with site-directed mutants of the catalytic triad residues C354, H336, and S337, and other important residues namely M303 and S351 that were highlighted in MD simulations. Mutation of catalytic triad residue S337 to alanine did not disrupt the β-lactam hydrolysis activity and this is expected as a S337A mutation should not disrupt the hydrogen bond interaction between H336-ND1 and backbone oxygen of alanine residue. The S337 residue has been reported as an important part of catalytic triad (C354-H336-S337) in Ldt<sub>Mt2</sub> (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>). In <sc>L,D</sc>-transpeptidase from <italic>B. subtilis</italic>, cysteine–histidine–glycine makes a catalytic triad where serine (in Ldt<sub>Mt2</sub>) corresponds to glycine (in Ldt<sub>BS</sub>) (<xref ref-type="bibr" rid="bib25">Lecoq et al., 2012</xref>). A hydrogen bond interaction with H336-ND1 should remain conserved even if S337 is replaced by alanine or glycine. Mutation of C354 to alanine and H336 to asparagine disrupted β-lactam hydrolysis as expected. Additionally, mutation of the S351 residue to alanine disrupted β-lactam hydrolysis activity, almost to the same degree as seen in the H336N mutant, with a ~15-fold decrease in enzyme turn-over (<xref ref-type="table" rid="table2">Table 2</xref>). In MD simulation runs with the wild-type structure, the S351 sidechain hydroxyl group forms hydrogen bond interaction with H336-NE2, and this hydrogen bond interaction is absent in the R209E mutant structure (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). H336 is important for deprotonating the C354 sulphur to allow nucleophilic attack on carbonyl group of β-lactam ring (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>). We suggest that, in addition to C354-H336-S337 catalytic triad, S351 residue may also form an important part of catalytic center to stabilize H336 during β-lactam binding and hydrolysis in Ldt<sub>Mt2</sub>.</p></sec><sec id="s2-4"><title>S-pocket cross-talks with catalytic site through an allosteric communication pathway</title><p>We further delved into the pathways of communication signals that propagate between the S-pocket and catalytic site. Network analysis was performed using correlation map, shortest distance paths and centrality analysis between the amino acids of Ldt<sub>Mt2</sub> enzyme (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref> and <xref ref-type="supplementary-material" rid="fig3sdata3">Figure 3—source data 3</xref>). A degree of coupled motion in the Ldt<sub>Mt2</sub> was measured by normalizing the cross-correlation matrix of atomic fluctuations over the length of 200-ns simulations. There is a coupling observed between R209 amino acid and distant catalytic site residues showed as white boxes (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3A</xref>). Degree of nodes as centrality were calculated through which the major traffic of communication signals propagates over the length of 200-ns simulations (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3B</xref>). This highlighted a number of important residues (nodes here) in the S-pocket (namely R209, Y330, and Q327), YkuD flap (namely I301, D304, S305, D321, V322, Y308, Y318, and M303) and the catalytic center (namely H337, C354, L355, S351, S337, and W340) with high degree of centrality.</p><p>Furthermore, an examination of edge betweenness centrality revealed shortest paths through which the communication signals propagate (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3C</xref>). One shortest communication path with high edge-betweenness (&gt;6 threshold) is R209 &gt; Y330 &gt; I328 &gt; L355 that starts at S-pocket and ends at the catalytic center. Other shortest paths from R209 via Y330 also pass communication signals directly through the YkuD flap to reach the catalytic site. A single arginine 209 to glutamate mutation increases the path length of communication between the S-pocket and catalytic site (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3D</xref>), indicating the key role of R209 residue in conservation of the shortest pathways. Residues that greatly affect the path length upon mutation have been hypothesized to be important for the allosteric communication (<xref ref-type="bibr" rid="bib8">del Sol et al., 2006</xref>).</p><p>Based on the network analysis, we suggest two major allosteric communication pathways that emanate from the S-pocket: (1) direct-allosteric communication pathway to impact the dynamic motion of the catalytic center; (2) indirect-allosteric communication via the YkuD flap (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3E</xref>). Direct-allosteric communication emanates through R209 &gt; Y330 &gt; I328 &gt; L355 to impact the dynamic motion of H336 residue. I328 interacts with L355 through the hydrophobic interactions. L355 backbone oxygen makes hydrogen bond interaction with H336-NE2. As H336 forms an important part of catalytic triad (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>), any alteration in the direct-allosteric communication pathway via I328/L355 nodes may impact the catalysis. An indirect-allosteric communication from the S-pocket via YkuD flap involves a number of residues, but role of M303 seems to be most important one as per the network analysis. M303 is the node from where multidirectional communications flow towards catalytic residue H336 and YkuD flap residues Y318, D321, and V322. M303 makes hydrophobic interactions with Y308, Y318, and V322 and these multiple interactions may have a paramount impact on YkuD dynamics and catalytic residue H336 that is stabilized through hydrophobic interaction by V322. We confirmed the importance of M303 residue by site-directed mutagenesis that made a detrimental impact on β-lactam hydrolysis activity by decreasing the <italic>V</italic><sub>max</sub> to 0.14 µM/min and <italic>K</italic><sub>m</sub> to 11.7 µM (<xref ref-type="fig" rid="fig3">Figure 3C</xref> and <xref ref-type="table" rid="table2">Table 2</xref>). This is an eye-opening observation that several hydrophobic core nodes relay communications signals to the catalytic center that may couple with catalytically permissive environment. A most remarkable observation in the network analysis is the convergence of most of the communications signals at W340 residue and at H336. A dynamic distance and probability density graph analysis also computed a major dynamic change in W340 residue upon R209E mutation (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>) and that may impact the catalytic process. A single R209E mutation disrupts the convergence of communication signals to W340 (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3D</xref>) and also its dynamic distance with M303 and H336 residues (<xref ref-type="fig" rid="fig3">Figure 3A, B</xref>).</p></sec><sec id="s2-5"><title>Both the S-pocket and catalytic site participate in β-lactam recognition cooperatively</title><p>Among β-lactams, the penicillin and cephalosporin subclasses are readily hydrolysed by Ldt<sub>Mt2</sub>, while the carbapenem subclass inhibits Ldt<sub>Mt2</sub> by irreversible acylation of C354 residue in the active site. In the current study, we used the carbapenem molecule, biapenem, to evaluate acylation of Ldt<sub>Mt2</sub> that could be influenced by a relay of of allosteric communications between the S-pocket and catalytic site, as depicted in <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3E</xref>. The rate of acylation by biapenem was measured by monitoring a decrease in biapenem absorbance at 292 nm wavelength. A single R209E mutation in the S-pocket completely disrupted biapenem-mediated acylation of the Ldt<sub>Mt2</sub> enzyme (<xref ref-type="fig" rid="fig4">Figure 4A, B</xref>, <xref ref-type="supplementary-material" rid="fig4sdata1">Figure 4—source data 1</xref>). Mutation of catalytic residues C354, H336, and S351 also abrogated acylation with biapenem. These findings suggest that both the S-pocket and the catalytic center play important roles in driving acylation of the C354 catalytic residue by biapenem.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Role of the S-pocket and catalytic site in recognizing biapenem.</title><p>(<bold>A</bold>) Acylation activity of biapenem with Ldt<sub>Mt2</sub> and mutants R209E, H336N, S351A, H352N, and C354A was monitored at 292 nm wavelength using UV–visible spectrophotometry. Maximum absorbance spectra of biapenem were found at 292 nm that was used to monitor decrease in biapenem concentration upon acylation with the Ldt<sub>Mt2</sub>. The chemical structure of biapenem is shown above the biapenem acylation graph. (<bold>B</bold>) Rate of acylation of 50 µM biapenem per second with Ldt<sub>Mt2</sub> and mutants. (<bold>C</bold>) ThermoFluor assays for binding of biapenem with Ldt<sub>Mt2</sub> and mutants R209E, E207A, Y330F, S351A, H336N, and C354A mutants. A change in melting temperature (∆<italic>T</italic><sub>m</sub>) was plotted at <italic>y</italic>-axis verses the ligand concentrations at <italic>x</italic>-axis in GraphPad Prism software. (<bold>D</bold>) Differential fluorescence (−d<italic>F</italic>/d<italic>T</italic>) graphs of ThetrmoFluor assay for Ldt<sub>Mt2</sub> and mutants. The dotted line indicates the <italic>T</italic><sub>m</sub>, and a red arrow indicates the direction of thermal shift. (<bold>E</bold>) Molecular dynamic (MD) simulations of Ldt<sub>Mt2</sub> in complex with biapenem. Ldt<sub>Mt2</sub> is represented in cartoon with green colour at 0 ns and cyan colour after running the MD simulations at 40 ns, and biapenem is represented in stick model with pink colour. The red arrow indicates the movement of biapenem to a second position revealed by the MD simulations after 40 ns trajectory.</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Raw data for biapenem acylation assay.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-73055-fig4-data1-v3.xlsx"/></supplementary-material></p><p><supplementary-material id="fig4sdata2"><label>Figure 4—source data 2.</label><caption><title>Raw data from ThermoFluor assay for biapenem binding with wild-type and mutants.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-73055-fig4-data2-v3.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig4-v3.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Molecular dynamic (MD) trajectory of biapenem bound in S-pocket alone in Ldt<sub>Mt2</sub>–Bia<sup>S</sup> structure.</title><p>A red arrow indicates the direction of movement of biapenem during an overall 75 ns of MD simulation. Ldt<sub>Mt2</sub> is represented in cartoon in green colour and biapenem in various trajectories is represented in stick model.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig4-figsupp1-v3.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Molecular dynamic trajectory of biapenem bound in catalytic site alone in Ldt<sub>Mt2</sub>–Bia<sup>C</sup> structure.</title><p>Ldt<sub>Mt2</sub> is represented in cartoon in green colour and biapenem in various trajectories is represented in stick model.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig4-figsupp2-v3.tif"/></fig><fig id="fig4s3" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 3.</label><caption><title>Molecular dynamic trajectory of dual biapenem bound in both S-pocket and catalytic site in Ldt<sub>Mt2</sub>–Bia<sup>S-C</sup> structure.</title><p>(<bold>A</bold>) Snapshots of biapenem from both S-pocket and catalytic site. (<bold>B</bold>) Snapshots of biapenem from catalytic site. Ldt<sub>Mt2</sub> is represented in cartoon in green colour and biapenem in various trajectories is represented in stick model.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig4-figsupp3-v3.tif"/></fig></fig-group><p>To further understand the role of the S-pocket and catalytic site in biapenem binding to Ldt<sub>Mt2</sub>, we performed ThermoFluor assays. Different amounts of biapenem (0–400 µM) were titrated into 5.0 µM of Ldt<sub>Mt2</sub> enzyme, and thermal shifts were measured at different drug concentrations (<xref ref-type="fig" rid="fig4">Figure 4C, D</xref>, <xref ref-type="supplementary-material" rid="fig4sdata2">Figure 4—source data 2</xref>). These studies revealed interesting observations: (1) increasing concentrations of biapenem led to a gradual change in melting temperature of Ldt<sub>Mt2</sub> until it was fully saturated, and (2) biapenem binding decreased the melting temperature of protein. In the first observation, we found that Ldt<sub>Mt2</sub>–biapenem binding could be saturated only by enzyme:drug ratios as high as 1:80. This strongly suggests that biapenem saturates a surface of Ldt<sub>Mt2</sub> through reversible, non-covalent interactions, as the covalent interactions have to be with a 1:1 molar ratio with rapid turn-over (in fractions of a second, see <xref ref-type="fig" rid="fig4">Figure 4B</xref>) and non-reversible. Beyond to its well-known covalent binding at the catalytic site (<xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>), these findings are consistent with non-covalent, saturable binding of biapenem to a second surface on Ldt<sub>Mt2</sub>. From the second observation, we conclude that biapenem binding destabilizes the protein possibly through structural changes. This structural destabilization may supersede the well-known structural changes in the YkuD flap at the catalytic site that are known to occur during β-lactam binding and covalent reaction with the S<inline-formula><mml:math id="inf1"><mml:mstyle displaystyle="true" scriptlevel="0"><mml:mrow><mml:msup><mml:mi/><mml:mrow><mml:mi mathvariant="normal">Υ</mml:mi></mml:mrow></mml:msup></mml:mrow></mml:mstyle></mml:math></inline-formula> atom of C354 (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>; <xref ref-type="bibr" rid="bib14">Fakhar et al., 2017</xref>; <xref ref-type="bibr" rid="bib22">Kim et al., 2013</xref>).</p><p>As the S-pocket mutant R209E exhibited diminished β-lactam hydrolysis (<xref ref-type="fig" rid="fig3">Figure 3C</xref>) and acylation by biapenem (<xref ref-type="fig" rid="fig4">Figure 4A, B</xref>), we further analyzed the consequence of mutations in the S-pocket on the physical binding of biapenem. In contrast to a gradual decrease in the thermal stability displayed by wild-type Ldt<sub>Mt2</sub> upon biapenem binding, the R209E mutant showed only a subtle change in Tm, and the saturating property of biapenem was virtually absent even at the highest concentration of 400 µM (<xref ref-type="fig" rid="fig4">Figure 4C, D</xref>, <xref ref-type="supplementary-material" rid="fig4sdata2">Figure 4—source data 2</xref>). E207A and Y330F mutations also showed detrimental effect on saturable behaviour of biapenem. This was the order of magnitude of detrimental effect of mutations in the S-pocket on reversible biapenem binding: R209E &gt; E207A &gt; Y330. We conclude that the mutations in the S-pocket hindered both non-covalent (as seen in <xref ref-type="fig" rid="fig4">Figure 4C</xref>) as well as covalent interactions with biapenem (as seen in <xref ref-type="fig" rid="fig4">Figure 4A, B</xref>). Additionally, as biapenem binds negligibly to the R209E mutant in contrast to wild-type Ldt<sub>Mt2</sub>, we did not observe decreases in the melting temperature of the R209E mutant with added biapenem as would be anticipated via structural changes in the YkuD flap (<xref ref-type="bibr" rid="bib14">Fakhar et al., 2017</xref>). This is further illustrated by our MD simulation results wherein the R209E mutation brings W340 residue closer to the YkuD flap residue M303 and active-site core residue H336 to block access to the outer pocket of the catalytic site (<xref ref-type="fig" rid="fig3">Figure 3A</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). These R209E mutation-driven structural changes in the catalytic site and YkuD flap likely account for the inability of biapenem to bind to the R209E mutant of Ldt<sub>Mt2</sub>.</p><p>We further tested the hypothesis that the catalytic site also demonstrates an interplay with the S-pocket to indirectly influence non-covalent binding of biapenem. Binding studies of biapenem were performed with catalytic mutants C354A, H336N, and S351A using ThermoFluor assays (<xref ref-type="fig" rid="fig4">Figure 4C, D</xref>, <xref ref-type="supplementary-material" rid="fig4sdata2">Figure 4—source data 2</xref>). Varying concentrations of biapenem (0–400 µM) with the catalytic site mutants did not induce any further significant thermal shift, indicative of negligible or insignificant physical binding of biapenem. Acylation with biapenem at the catalytic site was also diminished upon C354A, H336N, and S351A mutation in Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). These experimental observations indicate that mutations in catalytic site disrupt both non-covalent as well as covalent binding of biapenem to Ldt<sub>Mt2</sub>.</p><p>From the experimental results with the wild-type, S-pocket mutants and catalytic site mutants (<xref ref-type="fig" rid="fig4">Figure 4</xref>), we conclude that biapenem has two modes of binding: (1) covalent binding and (2) saturable, non-covalent binding. As covalent binding is well known at the catalytic site, saturable reversible binding seems to be at the S-pocket. In both of the biapenem-binding modes, our data suggest a cooperative role between S-pocket and the catalytic site, as mutations in any of the sites disrupt the binding (<xref ref-type="fig" rid="fig4">Figure 4A, C</xref>). Towards identifying the structural basis of cooperativity, we performed docking and MD simulation studies of biapenem with Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). A Ldt<sub>Mt2</sub> crystal structure (PDB ID: 5DU7) that has the catalytic site within the YkuD flap in closed conformation was chosen for docking with biapenem as this structure will not allow the drug binding in the catalytic pocket. A grid was assigned for docking within a 60 Å radius of the catalytic site residue C354. This blind docking around the catalytic site was performed to rule out any biasness in docking results influenced by the experimental data. We found that biapenem docked well within the S-pocket through its pyrazolo[1,2<italic>a</italic>][1,2,4]triazolium R3 group with a docking score of −6.3 kcal/mol.</p><p>Next, MD simulation experiments were further performed with Ldt<sub>Mt2</sub> structures having biapenem docked (1) alone in S-pocket, (2) alone in catalytic pocket, and (3) both in S-pocket and catalytic site. In the MD simulations with biapenem docked in S-pocket alone, the drug remained in the pocket for 9 ns of MD trajectory before exiting the pocket (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). Snapshots of different trajectories of biapenem in the S-pocket are shown in <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>. In MD simulations with biapenem docked in the catalytic pocket alone, the β-lactam core ring fluctuated more during 5–40 ns (<xref ref-type="fig" rid="fig4">Figure 4E</xref><bold>,</bold> <xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>).</p><p>However, when biapenem molecules were docked in both the S-pocket and catalytic site simultaneously, the pyrazolo[1,2<italic>a</italic>][1,2,4]triazolium R3 group of biapenem remained ensconced in S-pocket for 0–6 ns, made hydrophobic interactions with Y330 and L391 at 7–15 ns, and its pyrrolidine ring made additional π–π interactions with Y330 at 18–28 ns while remaining in the S-pocket, before finally moving out towards the YkuD flap of the catalytic site after 40 ns (<xref ref-type="fig" rid="fig4">Figure 4E</xref><bold>,</bold> <xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3A</xref>). In the catalytic site over the simulation interval, biapenem movement fluctuated less this time during 0–40 ns (see snapshots of biapenem trajectory in <xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3B</xref>). Thus, MD simulations suggest that biapenem binding across the S-pocket surface imposes stability in fluctuations of β-lactam movement in the catalytic site. These MD simulations together with our experimental data support a model in which two biapenem molecules are recognized cooperatively by both the S-pocket and the catalytic site, with non-covalent saturable binding and covalent binding to acylate C354, respectively.</p></sec><sec id="s2-6"><title>Binding patterns of various subclasses of β-lactams in the S-pocket</title><p>As Ldt<sub>Mt2</sub> binds various β-lactams with variable affinities (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>), we performed docking studies of various subclasses of β-lactams with the S-pocket. Ampicillin and oxacillin from the penicillin subclass, cefotaxime from the cephalosporin subclass, biapenem from carbapenem subclass and an experimental carbapenem drug, T203, developed by our group (<xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>), were chosen for the study. The different β-lactams showed binding with the S-pocket of Ldt<sub>Mt2</sub> with variable energy scores using Autodock (<xref ref-type="table" rid="table3">Table 3</xref>). Ampicillin docked into the S-pocket with a docking score of −7.1 kcal/mol with its R1 group tail 2-amino-2-phenylacetyl ensconced in the S-pocket through several electrostatic and hydrophobic interactions with the M157, E207, R209, R371, and Y330 residues (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). Another penicillin subclass member, oxacillin (a penicillinase-resistant penicillin), displayed the highest docking score of −8.3 kcal/mol through its R1 group 5-methyl-3-phenyl-1,2-oxazole-4-carbonyl binding in the S-pocket (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A</xref>). Cefotaxime docked to the S-pocket with a docking score of −7.8 kcal/mol through R1 group tail thiozol-4yl (<xref ref-type="fig" rid="fig5">Figure 5B</xref>), similar to the biapenem R3 group (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). The experimental carbapenem T203 docked to the S-pocket with the least −6.9 kcal/mol binding with its R3 group 2-isopropoxy-2-oxoethyl (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). The β-lactam ring moieties of all of these β-lactams were found to be free of any interactions with the S-pocket or surrounding residues, similar to biapenem. However, after 18–28 ns of MD simulation trajectory, the pyrrolidine ring of biapenem could make π–π interaction with Y330 (<xref ref-type="fig" rid="fig4">Figure 4E</xref>), and it is possible that similar late binding interactions may occur similarly with other β-lactams.</p><table-wrap id="table3" position="float"><label>Table 3.</label><caption><title>Docking score of Ldt<sub>Mt2</sub> with β-lactam compounds in kcal mol<sup>−1</sup> calculated by Autodock.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Drug</th><th align="left" valign="bottom">Binding energy (kcal/mol)</th></tr></thead><tbody><tr><td align="left" valign="bottom">Ampicillin</td><td align="char" char="." valign="bottom">−7.1</td></tr><tr><td align="left" valign="bottom">Oxacillin</td><td align="char" char="." valign="bottom">−8.3</td></tr><tr><td align="left" valign="bottom">Cefotaxime</td><td align="char" char="." valign="bottom">−7.8</td></tr><tr><td align="left" valign="bottom">Biapenem</td><td align="char" char="." valign="bottom">−6.3</td></tr><tr><td align="left" valign="bottom">T203</td><td align="char" char="." valign="bottom">−6.9</td></tr></tbody></table></table-wrap><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Binding of various subclasses of β-lactams to the S-pocket.</title><p>(<bold>A</bold>) Top: ampicillin (stick model in green) bound to the S-pocket (cyan) of Ldt<sub>Mt2</sub> through its R1 group side chain, 2-amino-2-phenylacetyl (red oval). Bottom: ThermoFluor assays for binding studies of ampicillin with wild-type Ldt<sub>Mt2</sub> and the R209E mutant. (<bold>B</bold>) Top: cefotaxime (stick model in green) bound to the S-pocket (cyan) of Ldt<sub>Mt2</sub> through its R1 group side chain, thiozol-4yl (red oval). Bottom: ThermoFluor assays for binding studies of cefotaxime with wild-type Ldt<sub>Mt2</sub> and the R209E mutant. (<bold>C</bold>) Top: the experimental carbapenem drug T203 (stick model in green) bound to the S-pocket (cyan) of Ldt<sub>Mt2</sub> through its R3 group side chain, 2-isopropoxy-2-oxoethyl (red circle). Bottom: ThermoFluor assays for binding studies of T203 drug with wild-type Ldt<sub>Mt2</sub> and the R209E mutant.</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Raw data from ThermoFluor assay for β-lactam binding with wild-type and mutants.</title></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife-73055-fig5-data1-v3.xlsx"/></supplementary-material></p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig5-v3.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Binding of oxacillin drug to the S-pocket.</title><p>(<bold>A</bold>) Oxacillin (stick model, red colour) bound into the S-pocket (green colour) of Ldt<sub>Mt2</sub> through R1 group side chain 5-methyl-3-phenyl-1,2-oxazole-4-carbonyl. 5-Methyl-3-phenyl-1,2-oxazole-4-carbonyl group is highlighted with red circle in the chemical structure of oxacillin. (<bold>B</bold>) ThermoFluor assay for binding studies of oxacillin with wild-type Ldt<sub>Mt2</sub>.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig5-figsupp1-v3.tif"/></fig></fig-group><p>ThermoFluor assays were also performed to investigate the binding behaviours of these additional ß-lactam class members with Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig5">Figure 5</xref>, <xref ref-type="supplementary-material" rid="fig5sdata1">Figure 5—source data 1</xref>). Ampicillin, which has been reported to be readily hydrolysed by Ldt<sub>Mt2</sub> (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>), showed a saturable binding behaviour (<xref ref-type="fig" rid="fig5">Figure 5A</xref>), but to a significantly lower degree than biapenem (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). Surprisingly, with ampicillin the R209E mutation in the S-pocket completely reversed the gradual thermal shift in Ldt<sub>Mt2</sub> towards a higher Tm indicative of an increase in structural stability in the setting of clearly saturable binding (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). We interpret this to be consistent with reversible acylation of the C354 residue by ampicillin in addition to S-pocket binding. In support of this, a reversible acylation of the <sc>L,D</sc>-transpeptidase (Ldt<sub>fm</sub> from <italic>E. coli</italic>) by β-lactams in the catalytic site has been reported recently (<xref ref-type="bibr" rid="bib11">Edoo et al., 2017</xref>; <xref ref-type="bibr" rid="bib51">Zandi and Townsend, 2021</xref>). Oxacillin also showed a saturable binding with Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1B</xref>). With cefotaxime, the R209E mutation in the S-pocket strongly diminished saturable binding. And lastly, binding of experimental carbapenem drug T203 displayed a large saturable thermal shift with Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig5">Figure 5C</xref>), similar to biapenem (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). We conclude that many β-lactams (despite being weak or strong inhibitors of Ltd<sub>Mt2</sub> activity) bind through the S-pocket with a saturable binding behaviour; however, the carbapenem subclass brings maximum thermal destabilization in protein structure due to non-hydrolysable covalent binding in catalytic site. Other classes of β-lactam drugs, specifically the penicillins and cephalosporins, are known to be readily hydrolysed by Ldt<sub>Mt2</sub> (<xref ref-type="bibr" rid="bib6">Cordillot et al., 2013</xref>; <xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>).</p></sec><sec id="s2-7"><title>Structural details of allosteric cooperation in dual β-lactam binding</title><p>To further understand the high-resolution details of structural changes may that occur in Ldt<sub>Mt2</sub> upon covalent binding with β-lactam, the crystal structure of Ldt<sub>Mt2</sub> was solved in complex with the experimental carbapenem drug T203 at a 1.7 Å resolution. Electron densities were observed in both the S-pocket and the outer cavity of catalytic pocket in the Ldt<sub>Mt2</sub>. <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A, B</xref> shows the Fo-Fc omit map (contoured at 3.0<italic>σ</italic>) in both S-pocket and catalytic site. Consistent with our docking results of T203 drug with Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig5">Figure 5C</xref>), the 2-oxoethyl side-chain of R3 group from T203 could be modelled into the electron density of the S-pocket. A second T203 drug was also modelled into the electron density map of the catalytic pocket. <xref ref-type="fig" rid="fig6">Figure 6A, B</xref> shows the 2Fo-Fc electron density map (contoured at 1.0<italic>σ</italic>) of T203 modelled in the S-pocket and catalytic site of the Ldt<sub>Mt2</sub> in the crystal structure.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Structural studies of Ldt<sub>Mt2</sub> with the experimental T203 carbapenem drug and allosteric conformation analyses.</title><p>(<bold>A</bold>) The 2Fo-Fc map (contoured at 1.0<italic>σ</italic>) of the T203-R3 group side chain, 2-isopropoxy-2-oxoethyl (pink), modelled in the S-pocket of Ldt<sub>Mt2</sub> in the crystal structure. (<bold>B</bold>) The 2Fo-Fc omit map (contoured at 1.0<italic>σ</italic>) of the full T203 structure (pink) modelled in the catalytic-site of Ldt<sub>Mt2</sub> where it acylates the C354 residue of Ldt<sub>Mt2</sub>. (<bold>C</bold>) Superposition of the Ldt<sub>Mt2</sub>–T203 complex (green) with C354A catalytic mutant structure (PDB ID: 3TX4, blue). The red arrows indicate movements in YkuD flap upon T203 drug binding. (<bold>D</bold>) Residues that have undergone allosteric alterations upon T203 drug binding are shown with stick models. Ldt<sub>Mt2</sub>–T203 complex residues are represented in green and the C354A catalytic mutant in blue.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig6-v3.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Crystal structure studies of binding of T203 drug in the S-pocket and catalytic site in Ldt<sub>Mt2</sub>.</title><p>(<bold>A</bold>) Fo-Fc omit map calculated in the S-pocket contoured at 3<italic>σ</italic>. (<bold>B</bold>) Fo-Fc omit map calculated in the catalytic site and contoured at 3.0<italic>σ</italic>. (<bold>C</bold>) T203 drug modelled into the S-pocket of Ldt<sub>Mt2</sub> in the crystal structure. T203 drug is represented in stick model with green colour. (<bold>D</bold>) T203 drug modelled into the outer cavity of catalytic site of Ldt<sub>Mt2</sub> in the crystal structure. Ldt<sub>Mt2</sub> is represented in surface and T203 drug is represented in stick model with pink colour. (<bold>E</bold>) Superposition of T203 drug from docking result (green colour) with T203 drug from crystal structure (pink colour).</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig6-figsupp1-v3.tif"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 2.</label><caption><title>RMSD graph of T203 (S-pocket) (red) and T203 (catalytic-pocket) (blue) over the duration of 50 ns of molecular dynamic (MD) simulations in Ldt<sub>Mt2</sub>–T203<sup>S-C</sup>.</title></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig6-figsupp2-v3.tif"/></fig></fig-group><p>In the S-pocket of Ldt<sub>Mt2</sub>, the 2-oxoethyl sidechain of T203 drug is stabilized through hydrophobic interactions with the A171, M157, P169, and L390 residues (<xref ref-type="fig" rid="fig6">Figure 6A</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1C</xref>). R371 makes an electrostatic interaction with the oxygen of the 2-oxoethyl moiety. No electron density was observed for the pyrrolidine ring of T203, while its carboxylic group fitted into an electron density making electrostatic interactions with backbone nitrogen of S296 and the guanidium side chain of R371. The modelling results of T203 into the electron density of the S-pocket were similar to the docking results of T203 drug that also has R3 group ensconced into the S-pocket with pyrrolidine ring remaining free of any interaction with Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig5">Figure 5C</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1E</xref>).</p><p>In the catalytic site, the T203 carbapenem interacts with the outer cavity (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1D</xref>) at a covalent distance from the S<inline-formula><mml:math id="inf2"><mml:mstyle displaystyle="true" scriptlevel="0"><mml:mrow><mml:msup><mml:mi/><mml:mrow><mml:mi mathvariant="normal">Υ</mml:mi></mml:mrow></mml:msup></mml:mrow></mml:mstyle></mml:math></inline-formula> atom of C354 (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). The carbonyl oxygen of T203 makes hydrogen bond interactions with the hydroxyl group of Y318. The electron density for the R1-hydroxy ethyl group was not found, similar to three other related experimental carbapenems T206, T208, and T210 (<xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>). The methyl group of the pyrrolidine ring makes hydrophobic interaction with the phenyl ring of Y318. The amino N4 of the pyrrolidine ring makes electrostatic interactions with NE2 of H336 and the backbone amide nitrogen of H352. The carboxyl group at C3 of the pyrrolidine ring makes hydrogen bond interactions with the side chains of W340 and N356. W340 also forms hydrophobic interactions with the 2-oxoethyl tail of T203.</p><p>We compared the structure of the Ldt<sub>Mt2</sub>–T203 complex with the C354A catalytic mutant structure (PDB ID: 3TX4) to seek alterations in conformation states of the enzyme around its catalytic site, YkuD flap, and S-pocket upon β-lactam binding. We chose the catalytic mutant structure of Ldt<sub>Mt2</sub> for structural comparison studies only because the wild-type enzyme usually binds ligands and/or substrates from its recombinant bacterial source during the purification steps (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>), including in the current study. We observed that binding of the T203 drug introduces unique allosteric alterations in the salt bridge and hydrogen bond interactions spanning the entire distance from the S-pocket to the YkuD flap of the catalytic site. Upon T203 drug binding, the YkuD flap bends slightly towards the S-pocket (<xref ref-type="fig" rid="fig6">Figure 6C</xref>). In the S-pocket, the M157 side chain moves closer to the drug by 1.5 Å to make a hydrophobic interaction with the 2-oxoethyl tail of T203 drug (<xref ref-type="fig" rid="fig6">Figure 6D</xref>). The R371 residue that was making salt bridge with E168 moves towards S296 through a hydrogen bond interaction and makes an additional ionic interaction with the carboxyl group of the T203 drug. The Q327 side chain that was previously producing a steric conflict with the carboxyl group of T203 drug moves away by a distance of 1.8 Å to make a water-mediated salt bridge with the hydroxyl group of Y308 that also moves down towards the S-pocket by a distance of 2.1 Å. The T203 drug binding induces an additional alteration in the YkuD flap by breaking the hydrogen bond interactions of H300 with D323 as well as D321 and also the interactions between D304 and S306. Breaking of these hydrogen bond interactions possibly relaxes the YkuD flap, enabling it to tilt towards the S-pocket mediated by new water-mediated salt bridge between Y308 and Q327. Alterations in the dynamics of YkuD flap were also observed in MD simulations subsequent upon R209E mutation in the S-pocket (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). Several of the allosteric changes observed in the crystal structure were matching with the dynamic distance analysis in MD simulation: (1) distance of H300 with D323 and D321 on YkuD flap, (2) distance of S306 with D304 on YkuD flap, and (3) distance of Y308 with Q327 (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2B</xref>). As these networks of interactions were disrupted by R209E mutation in the S-pocket (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>) or C354 mutation in the catalytic residue in the crystal structure (PDB ID: 3TX4), this suggests the pathway of allostery communication to be cooperative between S-pocket and catalytic site, and this is quite supported by the experimental data (<xref ref-type="fig" rid="fig3">Figures 3</xref> and <xref ref-type="fig" rid="fig4">4</xref>).</p><p>In the crystal structure study of Ldt<sub>Mt2</sub>–T203 complex, 2Fo-Fc map shows low occupancy at S-pocket (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). With low occupancy, the modelling of T203 drug could be biased in the S-pocket. To rule out any biasness and also further validate the cooperativity between the S-pocket and catalytic pocket in dual ß-lactam binding, MD were performed for (1) crystal structure of Ldt<sub>Mt2</sub> complexed with T203 drugs at both S-pocket and catalytic site (referred to as Ldt<sub>Mt2</sub>–T203<sup>S-C</sup>), and (2) crystal structure of Ldt<sub>Mt2</sub> complexed with T203 drug at S-pocket alone (referred to as Ldt<sub>Mt2</sub>–T203<sup>S</sup>, and this structure was prepared by removing T203 drug from the catalytic site in the crystal structure). It was observed that T203 drug in Ldt<sub>Mt2</sub>–T203<sup>S</sup> structure left from the S-pocket during the equilibration at 650 ps (<xref ref-type="video" rid="video1">Video 1</xref>). Production run for Ldt<sub>Mt2</sub>–T203<sup>S-C</sup> was performed for 50 ns (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>). During 50 ns of simulations, one T203 drug remained bound to S-pocket, while the other one remained covalently attached to C354 residue in catalytic site (<xref ref-type="video" rid="video2">Video 2</xref>). This indicates a cooperativity in-between these the two sites in β-lactam binding and this is in agreement with the MD studies of Ldt<sub>Mt2</sub> with biapenem drug (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). Mutational changes in the S-pocket or the catalytic pocket nullify all the allosteric communications that are otherwise important in cooperative binding of dual β-lactams. The consequences of these mutational changes were experimentally confirmed by β-lactam hydrolysis assays (<xref ref-type="fig" rid="fig2">Figures 2B</xref> and <xref ref-type="fig" rid="fig3">3C</xref>), acylation by biapenem (<xref ref-type="fig" rid="fig4">Figure 4A, B</xref>) and ThermoFluor assays (<xref ref-type="fig" rid="fig4">Figures 4</xref> and <xref ref-type="fig" rid="fig5">5</xref>) with different subclasses of β-lactams.</p><media id="video1" mime-subtype="mp4" mimetype="video" xlink:href="elife-73055-video1.mp4"><label>Video 1.</label><caption><title>Visualization of Ldt<sub>Mt2</sub>–T203<sup>S</sup> crystal structure in complex with T203 drug at S-pocket alone over the course of 1000 ps equilibration.</title><p>Residues in and around the catalytic and S-pocket residues are shown as solvent and transparent for proper visualization of the mechanism of the drug. Protein is shown in surface representation as diffused and grey. Cysteine is shown as stick model in yellow.</p></caption></media><media id="video2" mime-subtype="mp4" mimetype="video" xlink:href="elife-73055-video2.mp4"><label>Video 2.</label><caption><title>Visualization of Ldt<sub>Mt2</sub>-T203<sup>S-C</sup> crystal structure in complex with dual T203 molecules bound non-covalently at S-pocket and covalently at catalytic site over 50 ns molecular dynamic (MD) simulation run.</title><p>Protein and ligands are shown in similar representation as in <xref ref-type="video" rid="video1">Video 1</xref>.</p></caption></media></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>In addition to the role of <sc>L,D</sc>-transpeptidases in remodelling the PG in non-replicating <italic>M. tb</italic> (<xref ref-type="bibr" rid="bib24">Lavollay et al., 2008</xref>), this enzyme class is responsible for the resistance of <italic>M.tb</italic> to most β-lactam drugs, except carbapenems (<xref ref-type="bibr" rid="bib6">Cordillot et al., 2013</xref>; <xref ref-type="bibr" rid="bib18">Gupta et al., 2010</xref>). The molecular mechanisms and physiological function of <sc>L,D</sc>-transpeptidases and the basis for their genetic susceptibility to selective β-lactams remains incompletely understood. In this study we reveal important aspects of the physiological function of the <italic>M.tb</italic> <sc>L,D</sc>-transpeptidase enzyme, Ldt<sub>Mt2</sub>, identify a new PG disaccharide moiety-binding pocket (named the S-pocket), and describe the S-pocket’s role in allosteric modulation of the transpeptidase active site. Additionally, we observe that various β-lactams bind to the S-pocket through their tail regions to bring about allosteric changes which predispose the catalytic site for covalent inactivation by a second β-lactam. Based on our findings, we propose a model of dual β-lactam and/or dual PG substrate binding in the S-pocket and the catalytic site of Ldt<sub>Mt2</sub> and that is allosteric cooperative (<xref ref-type="fig" rid="fig7">Figure 7</xref>).</p><fig-group><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Model of dual β-lactam and/or dual peptidoglycan (PG) substrate binding in S-pocket and the catalytic site of Ldt<sub>Mt2</sub> enzyme that is allosteric cooperative.</title><p>Purple dotted arrows indicate pathways of allosteric communication and red arrow indicates movement of YkuD flap during β-lactam and/or PG binding. A small red line in the figure indicates a covalent bond between donor and acceptor stem peptides of PG chain or covalent bond between catalytic residue C354 and β-lactam. β-Lactam molecule indicated in the model is biapenem.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig7-v3.tif"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 1.</label><caption><title>S-pocket in different L,D-transpeptidases from Mycobacterium tuberculosis.</title><p>(<bold>A–D</bold>) Crystal structures of various LDTs, Ldt<sub>Mt1</sub> (PDB ID: 4JMN; orange colour), Ldt<sub>Mt2</sub> (PDB ID: 7F71; green colour), Ldt<sub>Mt3</sub> (PDB ID: 6D4K; cyan colour), and Ldt<sub>Mt5</sub> (PDB ID: 6D5A; pink colour). Highlighted residues in the crystal structures belong to S-pocket and catalytic site. (<bold>E</bold>) Superposition of various LDTs. Peptidoglycan (PG) sugar moiety bound across the S-pocket is shown in sphere model. (<bold>F</bold>) Superposition of the conserved residues in the S-pocket. PG sugar moiety is shown in stick model with blue colour.</p></caption><graphic mime-subtype="tiff" mimetype="image" xlink:href="elife-73055-fig7-figsupp1-v3.tif"/></fig></fig-group><p><italic>M.tb</italic> contains several paralogs of <sc>L,D</sc>-transpeptidases, namely Ldt<sub>Mt1</sub>, Ldt<sub>Mt2</sub>, Ldt<sub>Mt3</sub>, Ldt<sub>Mt4</sub>, and Ldt<sub>Mt5</sub> (<xref ref-type="bibr" rid="bib18">Gupta et al., 2010</xref>). Crystal structures of Ldt<sub>Mt1</sub> (<xref ref-type="bibr" rid="bib7">Correale et al., 2013</xref>), Ldt<sub>Mt2</sub> (<xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>), Ldt<sub>Mt3</sub> (<xref ref-type="bibr" rid="bib27">Libreros-Zúñiga et al., 2019</xref>), and Ldt<sub>Mt5</sub> (<xref ref-type="bibr" rid="bib3">Brammer Basta et al., 2015</xref>) have been solved and reported to date. All of these paralogs contain a pocket similar to the S-pocket found in Ldt<sub>Mt2</sub>. Corresponding to the R209 residue position in Ldt<sub>Mt2</sub> S-pocket, Ldt<sub>Mt1</sub> has R25, Ldt<sub>Mt3</sub> has Q66, and Ldt<sub>Mt5</sub> has H219, and each of these putative S-pocket amino acids have similar basic charge properties (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). Moreover, superposition of the crystal structure of these paralogs with Ldt<sub>Mt2</sub>–sugar complex places the PG sugar moiety within the S-pocket. We suggest a common S-pocket-mediated allosteric mechanism in all of the <sc>L,D</sc>-transpeptidases in <italic>M.tb</italic>; however, the rate of transpeptidation may differ depending upon structural differences in their respective YkuD flaps, S-pockets, and catalytic sites.</p><p>Based on our crystal structure and modelling studies, we propose that prior to the 3–3 transpeptidation between the donor and acceptor PG stem peptides, the acceptor PG sugar moiety chain is anchored across the IgD1-YkuD domains interface to the S-pocket of Ldt<sub>Mt2</sub>. PG sugar chain anchoring has been observed in <sc>L,D</sc>-transpeptidase of <italic>B. subtilis</italic> through a PG recognition domain LysM (<xref ref-type="bibr" rid="bib42">Schanda et al., 2014</xref>). The LysM domain binds a sugar moiety of the PG precursor, and the tetrapeptide branch (acceptor stem) contacts the catalytic cysteine residue through the inner cavity of the catalytic domain. Another PG-binding enzyme lysostaphin from <italic>Staphylococcus simulans</italic> has a PG anchoring domain, SH3b, while its catalytic domain cleaves PG stem cross-bridge (<xref ref-type="bibr" rid="bib34">Mitkowski et al., 2019</xref>). Upon anchoring of the PG sugar moiety chain within the S-pocket in Ldt<sub>Mt2</sub>, its acceptor stem peptide binds to the inner pocket of the enzyme’s catalytic domain, and the donor stem binds to the outer cavity close to the C354 residue, interactions that foster formation of the 3–3 transpeptide linkage (<xref ref-type="bibr" rid="bib2">Bianchet et al., 2017</xref>; <xref ref-type="bibr" rid="bib13">Erdemli et al., 2012</xref>; <xref ref-type="bibr" rid="bib14">Fakhar et al., 2017</xref>). We hypothesize that, prior to 3–3 transpeptide linkage, both S-pocket and catalytic site may work in cooperativity to facilitate synchronous binding of two PG substrates (donor and acceptor substrates); however, this requires experimental validation using nascent PG substrates that are beyond the scope of our study. Nevertheless, in support of our proposed model, we have tested our cooperativity hypothesis on ß-lactam binding and hydrolysis activity in Ldt<sub>Mt2</sub> and found results that support the model.</p><p>Ldt<sub>Mt2</sub> plays a major role in the resistance of <italic>M.tb</italic> to β-lactam class of drugs (<xref ref-type="bibr" rid="bib6">Cordillot et al., 2013</xref>; <xref ref-type="bibr" rid="bib10">Dubée et al., 2012</xref>; <xref ref-type="bibr" rid="bib18">Gupta et al., 2010</xref>; <xref ref-type="bibr" rid="bib24">Lavollay et al., 2008</xref>; <xref ref-type="bibr" rid="bib30">Mainardi et al., 2005</xref>). Among the β-lactam class of drugs, penicillins and cephalosporins are readily hydrolysed by this enzyme, while carbapenems are potent Ldt<sub>Mt2</sub> inhibitors (<xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>). Our findings reveal the role of both the S-pocket and the catalytic site in regulating β-lactam hydrolysis and inhibition by the carbapenem subclass. We demonstrate an allosteric cooperativity between the S-pocket and the catalytic site in the dual recognition of carbapenem drugs, with the former one binding the carbapenem drug non-covalently with a saturable binding and the latter one covalently through irreversible acylation of C354. A similar β-lactam-binding mechanism has been observed in penicillin-binding protein 2a (PBP2a) from <italic>Streptococcus aureus</italic> where one molecule of β-lactam occupies an allosteric site (with a saturable binding behaviour) 60 Å away culminating into the allosteric conformational changes in PBP2a with the opening of the active site and covalent binding with a β-lactam molecule (<xref ref-type="bibr" rid="bib36">Otero et al., 2013</xref>). During the β-lactam-binding process, Ldt<sub>Mt2</sub> occupies one molecule of β-lactam at a reversible binding site (the S-pocket) 21 Å away from the catalytic site, and this interaction stimulates allosteric conformational changes across the YkuD catalytic flap and catalytic site to drive acylation by a second ß-lactam molecule in the catalytic pocket. We find the role of catalytic site equally important in stimulating reversible binding of β-lactam in the S-pocket. Thus, there we observe bidirectional cooperativity between the S-pocket and the catalytic site in binding dual β-lactams, and the same mechanism may apply to dual PG substrate binding. The role of differential dynamics by the YkuD flap in β-lactam- and substrate binding by the catalytic site have been demonstrated earlier by MD simulations (<xref ref-type="bibr" rid="bib14">Fakhar et al., 2017</xref>); however, our study finds additional roles of YkuD flap in dual β-lactam binding in S-pocket and the catalytic site. Several allosteric alterations mediated by new water-mediated salt bridges or breakage of pre-existing ionic interactions contribute to the cumulative dynamics of the YkuD flap during dual β-lactam binding in Ldt<sub>Mt2</sub> (<xref ref-type="fig" rid="fig6">Figure 6</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). Also, through network analysis, we identify the pathways of allosteric communications that flow from the S-pocket via YkuD flap and directly to the catalytic site via a hydrophobic core to modulate the β-lactam binding (<xref ref-type="fig" rid="fig3">Figure 3C</xref> and <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>). The role of hydrophobic core residues in channelling allosteric communications to couple with catalysis has been observed in a β-lactam hydrolyzing class A β-lactamase (<xref ref-type="bibr" rid="bib35">Olehnovics et al., 2021</xref>). Our study has also led to identification of a new residue S351 in the catalytic site that can be modulated by allostery (<xref ref-type="fig" rid="fig3">Figure 3</xref>, <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). S351 can be an important part of the catalytic center in addition to the C354–H336–S337 catalytic triad. More investigational studies will be required in future to fully understand the role of S351 residue in catalytic function of Ldt<sub>Mt2</sub>.</p><p>We find that various β-lactams bind to the S-pocket of Ldt<sub>Mt2</sub> through their tail regions, either through their R1 or R3 groups. As we found the docking scores of ampicillin, oxacillin, and cefotaxime to be higher than those of carbapenems, biapenem, and T203, the interactions of these R1 or R3 groups with the S-pocket appears to play critical role in the initiation of S-pocket binding, irrespective of fate of β-lactams in catalytic site. This discovery of a novel mechanism of β-lactam binding in Ldt<sub>Mt2</sub> reveals important new parameters in the development of new β-lactams for <italic>M. tb</italic>, and highlights the importance of the respective R1 and R3 side chains to both occupy the S-pocket and modulate strong inhibition at the catalytic site. This study provides a high-resolution crystal structure of Ldt<sub>Mt2</sub> with an experimental carbapenem T203 that offers the basis for cooperative binding of dual β-lactams in the S-pocket and catalytic site (<xref ref-type="video" rid="video1">Videos 1</xref> and <xref ref-type="video" rid="video2">2</xref>). Insights gained from this analysis may guide the acquisition and/or the design and synthesis of new inhibitors.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Reagent type (species) or resource</th><th align="left" valign="bottom">Designation</th><th align="left" valign="bottom">Source or reference</th><th align="left" valign="bottom">Identifiers</th><th align="left" valign="bottom">Additional information</th></tr></thead><tbody><tr><td align="left" valign="bottom">Gene (<italic>Mycobacterium tuberculosis</italic>)</td><td align="left" valign="bottom">ldtB/LdtMt2</td><td align="left" valign="bottom">Uniprot</td><td align="left" valign="bottom">I6Y9J2</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Strain, strain background<break/>(<italic>Escherichia coli</italic>)</td><td align="left" valign="bottom">BL21 (DE3)</td><td align="left" valign="bottom">NEB</td><td align="left" valign="bottom">Catalog # C2526H</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Strain, strain background (<italic>Escherichia coli</italic>)</td><td align="left" valign="bottom">NEB 5-alpha competent</td><td align="left" valign="bottom">NEB</td><td align="left" valign="bottom">Catalog # C2987H</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">IgD1-F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">ATTGCCATATGAAGGCACGCCGTTCGCCGAC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">IgD1-R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CAATACTCGAGTTAGGTCTGGAAGGTCAGCTGGCG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">IgD2-F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">ATTGCCATATGACCTGACCATGCCCTACGTAT</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">IgD2-R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CAATACTCGAGTTAGCCGATGGTGAAGTGCGTCTG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">IgD1-IgD2-F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">ATTGCCATATGAAGGCACGCCGTTCGCCGATC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">IgD1-IgD2-R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CAATACTCGAGTTAGCCGATGGTGAAGTGCGTCTG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">YkuD-F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">ATTGCCATATGGGCGACGAGGTGATCGCGACC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">YkuD- R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CAATACTCGAGTTACGCCTTGGCGTTACCGGC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-E207A- F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CTGAATAACCGTGCAGTGCGTTGGCGCCCA</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-E207A- R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">TGGGCGCCAACGCACTGCACGGTTATTCAG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-R209A- F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">TGAATAACCGTGAAGTGGAATGGCGCCCAGAGCATT</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-R209E- R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">AATGCTCTGGGCGCCATTCCACTTCACGGTTATTCA</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-S337A- F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">GTGTCTTCGTGCACGCAGCGCCGTGGTCGG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-S37A- R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CCGACCACGGCGCTGCGTGCACGAAGACAC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-S351A- F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">GGCCACACCAACACCGCCCATGGCTGCCTGAAC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-S351A-R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">GTTCAGGCAGCCATGGGCGGTGTTGGTGTGGCC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-Y330F- F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CCACCCAGATCTCCTTTAGCGGTGTCTTCGTGC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-Y330F- R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">GCACGAAGACACCGCTAAAGGAGATCTGGGTGG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-H336N- F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CAGCGGTGTCTTCGTGAA<bold>C</bold>TCAGCGCCGTGGTC</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-H336N- R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">GACCACGGCGCTGAGTTCACGAAGACACCGCTG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-C354A- F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CAACACCAGCCATGGCGCGCTGAACGTCAGCCCGAG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-C354A- R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CTCGGGCTGACGTTCAGCGCGCCATGGCTGGTGTTG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-M303A- F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">GGTACAAGCACATCATCGCGGACTCGTCCACCTACG</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">Ldt<sub>Mt2</sub>-M303A- R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primer</td><td align="left" valign="bottom">CGTAGGTGGACGAGTCCGCGATGATGTGCTTGTACC</td></tr><tr><td align="left" valign="bottom">Commercial assay or kit</td><td align="left" valign="bottom">Q5 High-Fidelity DNA Polymerases</td><td align="left" valign="bottom">NEB</td><td align="left" valign="bottom">Catalog # M0491L</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Chemical compound, drug</td><td align="left" valign="bottom">SYPRO Orange</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="left" valign="bottom">Catalog # S6650</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Chemical compound, drug</td><td align="left" valign="bottom">Nitrocefin</td><td align="left" valign="bottom">Millipore-Sigma</td><td align="left" valign="bottom">Catalog #<break/>484400-5MG</td><td align="left" valign="bottom"/></tr></tbody></table></table-wrap><sec id="s4-1"><title>Cloning and site-directed mutagenesis</title><p>DNA sequences encoding Ldt<sub>Mt2</sub>-Δ42, Ldt<sub>Mt2</sub>-Δ55, IgD1 (50–145 aa residues), IgD2 (150–250 aa), IgD1–IgD2 (50–250 aa), and YkuD domain (250–408) and CTSD deletion mutant Ldt<sub>Mt2</sub> 42–384 were cloned in pET28a vector to express the protein with <italic>N</italic>-terminal His<sub>6</sub>-tag that is cleavable by Tobacco Etch Virus (TEV) protease. Single amino acid substitutions of Ldt<sub>Mt2</sub>-Δ55 were constructed by site-directed mutagenesis for the following mutations: E207A, R209E, Y330F, C354A, H352A, H336A, M303A, S337A, and S351A.</p></sec><sec id="s4-2"><title>Protein expression and purification</title><p>Mutants and different fragments of Ldt<sub>Mt2</sub> were expressed and purified as reported earlier (<xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>). In detail, Ldt<sub>Mt2</sub>-ΔN55 was transformed in chemical competent <italic>E. coli</italic> BL21δɛ3 (NEB labs). A single colony of transformed cells was inoculated in 50 ml of Luria-Bertani (LB) media supplemented with ampicillin (100 µg/ml) before growing overnight (O/N) at 37°C in an incubator shaker. The O/N culture was used to inoculate secondary culture in LB media to grow at 37°C until the optical density at 600 nm reached ~0.6–0.8. At this stage, temperature was lowered to 16°C in the incubator shaker before inducing the protein expression with 0.5 mM of isopropyl-1-thio-β-galactoside. The secondary culture grown O/N. The culture was harvested and the cell pellet was resuspended in lysis buffer (50 mM Tris buffer pH 7.5, 400 mM NaCl, 10% glycerol, 1.0 mM dithiothreitol [DTT], and 1.0 mM phenylmethylsulfonyl fluoride [PMSF]). 0.5 mg/ml lysozyme was added into the resuspended cells to allow cell lysis at 4°C for 30 min. Resuspended cells were further lysed by ultrasonication at 4°C with a pulse rate of 15 s ON/OFF. Whole cell lysate was centrifuged at 10,000 × <italic>g</italic> for 45 min and the supernatant was loaded onto Ni-NTA column (Qiagen, Germany). The unbound protein was washed with washing buffer (50 mM Tris buffer pH 7.5, 400 mM NaCl, 10% glycerol, 1.0 mM DTT, 0.1 mM PMSF) and the protein was eluted with elution buffer (50 mM Tris buffer pH 8.0, 400 mM NaCl, 1.0 mM DTT, 0.1 mM PMSF, and 500 mM imidazole). The His<sub>6</sub>-tag of the protein was removed by TEV protease during overnight dialysis against the buffer 50 mM Tris pH 8.0, 150 mM NaCl, and 1.0 mM DTT at 4°C. The dialyzed protein was passed through Ni-NTA column and the His<sub>6</sub>-tag-removed protein was collected in flow-through. Protein was further purified using superdex 10/300 column on ÄKTA pure 25. The purified protein was concentrated to 20 mg/ml as measured by nanodrop at 280 nm wavelength. The purity of protein was checked by 12% sodium dodecyl sulphate–polyacrylamide gel electrophoresis. All other truncation and mutants of Ldt<sub>Mt2</sub> were also purified by same protocol as above, however their His<sub>6</sub>-tag was not removed.</p></sec><sec id="s4-3"><title>ThermoFluor assays</title><p>The proteins Ldt<sub>Mt2</sub>-Δ55, R209E, and S351A were with initial stocks of 11.5, 14.0, and 21 µM, respectively, in the 50 mM Tris buffer pH 8.0, 150 mM NaCl, 1 mM DTT. 5000× of SYPRO Orange (Invitrogen) was diluted to 50× in water. 5 µM of proteins and 3× of SYPRO Orange were pipetted into a 96-well PCR plate (BioRad, MicroAmp Fast 96-Well Reaction plate, 0.1 ml) with 50 µl total volume in the well. Fluorescence data were collected on BioRad StepOnePlus Real-Time PCR System using the software StepOne software v2.3. ROX (SYPRO Orange) was selected as a reporter dye and none for passive reference in the software. The temperature was held for 1 min per degree from 25 to 65°C. Melting temperature (<italic>T</italic><sub>m</sub>) and differential fluorescence (−d<italic>F</italic>/d<italic>T</italic>) values were calculated by fitting the data on Sigmoidal dose–response (variable slope) equation in GraphPad Prism software. Experiments were performed in biological triplicates.</p></sec><sec id="s4-4"><title>Nitrocefin hydrolysis assays</title><p>Nitrocefin (Calbiochem) with a range of 1–400 µM was used as a substrate for quantifying the rate of β-lactam hydrolysis by different ldt<sub>Mt2</sub> fragments and mutants. A 100 µl reaction mixture containing 5 μM enzyme in 25 mM HEPES (hydroxyethyl piperazineethanesulfonic acid)–MES (morpholinoethanesulfonic acid)–Tris-phosphate buffer, 300 mM NaCl, pH 6.0, was incubated at 25°C. Nitrocefin hydrolysis was measured at 496 nm on BioRad microplate reader and the absorbance data were converted to μM/minute using Beer’s Law (<italic>e</italic> = 20,500 M<sup>−1</sup> cm<sup>−1</sup> for hydrolysed nitrocefin; <italic>L</italic> = 0.5 cm). Nitrocefin hydrolysis assays were performed in experimental duplicates and rate constants, <italic>V</italic><sub>max</sub> and <italic>K</italic><sub>m</sub> were calculated by fitting the data on nonlinear regression curve with Michaelis–Menten equation.</p></sec><sec id="s4-5"><title>CD spectroscopy</title><p>Far-UV CD spectra were acquired on a Jasco-815 spectropolarimeter. Ldt<sub>Mt2</sub> and R209E mutant proteins with a concentration of 5.0 µM were used in the study. Cuvette of path length of 0.2 cm was used and spectra were collected from 260 to 190 nm at a rate of 100 nm/min and data pitch of 1 nm, with averaging of 10 scans for noise reduction. Contribution of the buffer to the spectra was electronically subtracted and <italic>θ</italic><sub>obs</sub> was plotted.</p></sec><sec id="s4-6"><title>Biapenem acylation assays</title><p>The acylation of biapenem with Ldt<sub>Mt2</sub> and mutants was determined by measuring the reduction in absorbance of biapenem at 292 nm wavelength using UV–visible spectrophotometry. A 100 µl reaction mixture containing 50 µM enzyme, 50 µM biapenem, 25 mM Tris buffer pH 7.5 was incubated at 15°C and endpoint absorbance was recorded at 30-s intervals for 8 min. Rate constant (<italic>K</italic>) of biapenem acylation was calculated by fitting the data on a nonlinear regression curve with one-phase decay. Experiment was performed in biological triplicates to calculate standard deviation and average values.</p></sec><sec id="s4-7"><title>Protein crystallization</title><p>Purified Ldt<sub>Mt2</sub> (fragment ΔN55) was crystallized with the same conditions has reported earlier (<xref ref-type="bibr" rid="bib23">Kumar et al., 2017</xref>). Crystals were grown by hanging drop vapor diffusion method in 20% 5000 MME and 200 mM ammonium sulphate condition. For Ldt<sub>Mt2</sub>–T203 complex, crystals were soaked with 2 mM of T203 drug overnight before being cryo-protected in 20% 5000 MME, 30% glycerol, and 120 mM ammonium sulphate before flash freezing in liquid nitrogen.</p></sec><sec id="s4-8"><title>Crystal diffraction, data collection, and structure determination</title><p>The crystals were diffracted at 100 K temperature at a wavelength of 1.0 Å on beamline 19-ID at the Advanced Photon Source (Argonne National Laboratory). The diffraction data were recorded on an ADSC Quantum 315r CCD detector and processed with the HKL3000 software (<xref ref-type="bibr" rid="bib33">Minor et al., 2006</xref>). The crystal structures of Ldt<sub>Mt2</sub>–sugar complex at a highest resolution of 1.58 Å and Ldt<sub>Mt2</sub>–T203 complex at 1.7 Å resolution were solved by molecular replacement method using <italic>PHENIX</italic> suite of program (<xref ref-type="bibr" rid="bib28">Liebschner et al., 2019</xref>) using the coordinates of Ldt<sub>Mt2</sub> (PDB ID: 5DU7) as a search model. The initial structures were subjected to crystallographic refinement with <italic>phenix.refine</italic> (<xref ref-type="bibr" rid="bib1">Afonine et al., 2012</xref>) from the <italic>PHENIX</italic> suite of programs. Structures were rebuilt with COOT (<xref ref-type="bibr" rid="bib12">Emsley and Cowtan, 2004</xref>) to fit the electron density map. Structure validation was done using Molprobity (<xref ref-type="bibr" rid="bib50">Williams et al., 2018</xref>). The <italic>R</italic> values of refined structures (<xref ref-type="table" rid="table1">Table 1</xref>) are well within the range of typical resolution. Omit maps for ligands in the structures were created from map coefficient using <italic>PHENIX</italic> suite of programs. Figures were prepared using PyMOL Molecular Graphics System, Version 2.4.0 Schrödinger, LLC.</p></sec><sec id="s4-9"><title>Docking studies</title><p>The structural model of Ldt<sub>Mt2</sub> was prepared in Autodock Tools 1.5.7 (<xref ref-type="bibr" rid="bib46">Trott and Olson, 2010</xref>) by adding hydrogen atoms, noBondOrder method and Gasteiger charges of −13.019. Ligands (namely ampicillin, cefotaxime, oxacillin, biapenem, and T203) were prepared having five rotatable bonds. A grid was assigned with a grid box size 60 Å × 60 Å × 60 Å and grid spacing 0.375 Å. Docking was performed using Genetic Algorithm with number of runs set to 100, a population size of 50, maximum number of evaluations on medium as 1,500,000 and all other default parameters on Autodock4 program.</p></sec><sec id="s4-10"><title>MD simulations setup</title><p>MD simulations were performed for (1) crystal structure of Ldt<sub>Mt2</sub> docked with biapenem only at S-pocket (Ldt<sub>Mt2</sub>–Bia<sup>S</sup>), (2) crystal structure of Ldt<sub>Mt2</sub> docked with Biapenem only at catalytic site (Ldt<sub>Mt2</sub>–Bia<sup>C</sup>), and (3) crystal structure of Ldt<sub>Mt2</sub> docked with biapenem at S-pocket and at catalytic site (Ldt<sub>Mt2</sub>–Bia<sup>S-C</sup>). Explicit water (TIP3P) MD simulations of Ldt<sub>Mt2</sub>–biapenem docked complexes were carried out with AMBER16 employing <italic>ff03</italic> forcefield (<xref ref-type="bibr" rid="bib9">Duan et al., 2003</xref>) and general AMBER forcefield (<italic>gaff</italic>) (<xref ref-type="bibr" rid="bib47">Wang et al., 2004</xref>) for protein and ligands, respectively. The Leap module of AMBER16 was used for setting up initial structures. To prevent any steric clashes between solute and solvent during MD simulation, all the solvated systems were initially minimized in two steps. First, minimization of solvent and ions was performed by applying 50 kcal/mol/Å<sup>2</sup> positional restraint on all the atoms of protein and ligand, followed by the second minimization of the whole system without any positional restrain. The system was then heated using Langevin dynamics from 10 to 300 K at NVT ensemble with the positional restraint of 5 kcal/mol/ Å<sup>2</sup> on the protein and ligands heavy atoms. Positional restraint was gradually released in the next two steps, that is, 3 kcal/mol/Å<sup>2</sup> in first step and then 1 kcal/mol/Å<sup>2</sup> in second step. Further, the system was equilibrated for 100 ps at NVT followed by 2400 ps at NPT ensemble. Finally, the production runs (Ldt<sub>Mt2</sub>–Bia<sup>S</sup> = 75 ns, Ldt<sub>Mt2</sub>–Bia<sup>C</sup> = 75 ns, and Ldt<sub>Mt2</sub>–Bia<sup>S-C</sup> = 75 ns) were carried out at NPT ensemble by integrating the Newtonian equation of motion at every 2 fs. Trajectories were analyzed using cpptraj module of AMBER16 (<xref ref-type="bibr" rid="bib40">Roe and Cheatham, 2013</xref>). Trajectories were analyzed by cpptraj module of AMBER16. Hydrogen bonds were calculated for the donor–acceptor distance cutoff of 3.5 Å and the donor–hydrogen–acceptor angle cutoff of 135°.</p><p>Additional MD simulations were performed with (1) Ldt<sub>Mt2</sub> (wild-type); (2) Ldt<sub>Mt2</sub>-R209E; (3) crystal structure Ldt<sub>Mt2</sub>–T203<sup>S-C</sup> with T203 drug in both S-pocket and catalytic site; and (4) crystal structure Ldt<sub>Mt2</sub>–T203<sup>S</sup> with T203 drug in S-pocket alone. IgD1 domain was cleaved from all four systems using BIOVIA’s Discovery Studio 2021 software (Dassault Systems). All MD simulations were performed with NAMD 2.14 software using CHARMM36 forcefield (<xref ref-type="bibr" rid="bib38">Phillips et al., 2020</xref>). Systems were first prepared using CHARMM program and then solvated in a water box of minimum distance 15 Å from any edge in VMD. Neutralization was performed by addition of Na<sup>+</sup> and Cl<sup>−</sup> ions. Stepwise energy minimization performed using the Steepest Descent algorithm for 500,000 steps. The system was heated from 0 to 300 K in 10 K/ps increments with the NAMD program (<xref ref-type="bibr" rid="bib38">Phillips et al., 2020</xref>). Velocities further were rescaled for the next 200 ps, followed by 2000 ps of unconstrained equilibration. Subsequently, the production runs of 200 ns each was performed for the Ldt<sub>Mt2</sub> wild-type and R209E mutant protein. Production run for the Ldt<sub>Mt2</sub>–T203<sup>S-C</sup> that is in complex with dual T203 drug was performed for 50 ns. Production was not performed for Ldt<sub>Mt2</sub>–T203<sup>S</sup> that in complex with T203 drug only at S-pocket, since T203 drug left the S-pocket during equlibration 2 at 650 ps. All simulations were performed in the NPT ensemble using the periodic boundary conditions. Water was represented by the TIP3P model. A 12 Å cutoff was used for nonbonded interactions and long-range electrostatic interactions were treated with the smooth PME method as implemented in NAMD. All bonds to hydrogen atoms were constrained allowing for a timestep of 2 fs. Analysis was performed using standard GROMACS (<xref ref-type="bibr" rid="bib39">Pronk et al., 2013</xref>), Visual Molecular Dynamics (VMD) tools (<xref ref-type="bibr" rid="bib20">Humphrey et al., 1996</xref>). Probability Density Graphs were plotted using R Programming in RStudio.</p></sec><sec id="s4-11"><title>Clustering of conformers and network construction</title><p>Clustering was performed for each simulation using gromos method from the GROMACS software and a representative structure from the largest cluster was considered to average the distance calculations and also to construct a network of amino acid residues. Network was calculated and constructed using the NAPS webs server (Network analysis of Protein Structures) (<xref ref-type="bibr" rid="bib5">Chakrabarty and Parekh, 2016</xref>) and visualized using Cytoscape. For network construction each amino acid was considered as a node in the network and an edge was constructed if the distance between a pair of atoms of the residue pair was within the lower threshold of 0 Å and upper threshold of 5 Å. All edges were considered unweighted (equally important). Degree of nodes, node betweenness, edge betweenness, clustering coefficients, closeness, eigen vector centrality, eccentricity, and average neighbour degree were computed as an estimate of centrality. Normalized covariance (correlation) of MD simulation was performed using CARMA (<xref ref-type="bibr" rid="bib17">Glykos, 2006</xref>). The degree of coupled motion in Ldt<sub>Mt2</sub> was measured by normalizing the cross-correlation matrix of atomic fluctuations over the length of the simulation.</p></sec></sec></body><back><sec id="s5" sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn><fn fn-type="COI-statement" id="conf2"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Methodology, Validation, Writing – original draft</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Methodology, Validation, Visualization, Writing – original draft</p></fn><fn fn-type="con" id="con3"><p>Methodology</p></fn><fn fn-type="con" id="con4"><p>Methodology</p></fn><fn fn-type="con" id="con5"><p>Methodology</p></fn><fn fn-type="con" id="con6"><p>Methodology</p></fn><fn fn-type="con" id="con7"><p>Resources, Supervision</p></fn><fn fn-type="con" id="con8"><p>Methodology, Writing – original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con9"><p>Conceptualization, Funding acquisition, Investigation, Methodology, Resources, Supervision, Validation, Writing – original draft</p></fn><fn fn-type="con" id="con10"><p>Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Supervision, Validation, Writing – original draft, Writing - review and editing</p></fn></fn-group></sec><sec id="s6" sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="transrepform"><label>Transparent reporting form</label><media mime-subtype="pdf" mimetype="application" xlink:href="elife-73055-transrepform1-v3.pdf"/></supplementary-material></sec><sec id="s7" sec-type="data-availability"><title>Data availability</title><p>Diffraction data have been deposited in PDB under the accession code 7F71, 7F8P.</p><p>The following datasets were generated:</p><p><element-citation id="dataset1" publication-type="data" specific-use="isSupplementedBy"><person-group person-group-type="author"><name><surname>Kumar</surname><given-names>P</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2021">2021</year><data-title>Crystal structure of the Mycobacterium tuberculosis L,D-transpeptidase-2 (LdtMt2) with peptidoglycan sugar moiety and glutamate</data-title><source>RCSB Protein Data Bank</source><pub-id pub-id-type="accession" xlink:href="https://www.rcsb.org/structure/unreleased/7F71">7F71</pub-id></element-citation></p><p><element-citation id="dataset2" publication-type="data" specific-use="isSupplementedBy"><person-group person-group-type="author"><name><surname>Kumar</surname><given-names>P</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2021">2021</year><data-title>Crystal structure of the Mycobacterium tuberculosis L,D-transpeptidase-2 (LdtMt2) with new carbapenem drug T203</data-title><source>RCSB Protein Data Bank</source><pub-id pub-id-type="accession" xlink:href="https://www.rcsb.org/structure/unreleased/7F8P">7F8P</pub-id></element-citation></p></sec><ack id="ack"><title>Acknowledgements</title><p>T203, an experimental carbapenem, was a kind gift from Dr. Joel S Freundlich at Rutgers University Medical School. We are grateful to Prof Tomasz Borowski at Jerzy Haber Institute of Catalysis and Surface Chemistry, Prof Craig Townsend and Dr. C Korin Bullen at Johns Hopkins University. Experimental support from Pallavi Juneja at Jamia Hamdard in media and reagent preparation is highly appreciated. We thank personnel at Argonne National Laboratory for data collection of protein crystals. This research was supported in part by PL-Grid Infrastructure. Computations were performed at Academic Computer Centre Cyfronet AGH. A part of this research was also conducted using computational resources (and/or scientific computing services) at the Maryland Advanced Research Computing Center (MARCC).</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Afonine</surname><given-names>PV</given-names></name><name><surname>Grosse-Kunstleve</surname><given-names>RW</given-names></name><name><surname>Echols</surname><given-names>N</given-names></name><name><surname>Headd</surname><given-names>JJ</given-names></name><name><surname>Moriarty</surname><given-names>NW</given-names></name><name><surname>Mustyakimov</surname><given-names>M</given-names></name><name><surname>Terwilliger</surname><given-names>TC</given-names></name><name><surname>Urzhumtsev</surname><given-names>A</given-names></name><name><surname>Zwart</surname><given-names>PH</given-names></name><name><surname>Adams</surname><given-names>PD</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Towards automated crystallographic structure refinement with phenix.refine</article-title><source>Acta Crystallographica. Section D, Biological Crystallography</source><volume>68</volume><fpage>352</fpage><lpage>367</lpage><pub-id pub-id-type="doi">10.1107/S0907444912001308</pub-id><pub-id pub-id-type="pmid">22505256</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bianchet</surname><given-names>MA</given-names></name><name><surname>Pan</surname><given-names>YH</given-names></name><name><surname>Basta</surname><given-names>LAB</given-names></name><name><surname>Saavedra</surname><given-names>H</given-names></name><name><surname>Lloyd</surname><given-names>EP</given-names></name><name><surname>Kumar</surname><given-names>P</given-names></name><name><surname>Mattoo</surname><given-names>R</given-names></name><name><surname>Townsend</surname><given-names>CA</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Structural insight into the inactivation of Mycobacterium tuberculosis non-classical transpeptidase Ldt<sub>Mt2</sub> by biapenem and tebipenem</article-title><source>BMC Biochemistry</source><volume>18</volume><elocation-id>8</elocation-id><pub-id pub-id-type="doi">10.1186/s12858-017-0082-4</pub-id><pub-id pub-id-type="pmid">28545389</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brammer Basta</surname><given-names>LA</given-names></name><name><surname>Ghosh</surname><given-names>A</given-names></name><name><surname>Pan</surname><given-names>Y</given-names></name><name><surname>Jakoncic</surname><given-names>J</given-names></name><name><surname>Lloyd</surname><given-names>EP</given-names></name><name><surname>Townsend</surname><given-names>CA</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name><name><surname>Bianchet</surname><given-names>MA</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Loss of a Functionally and Structurally Distinct ld-Transpeptidase, LdtMt5, Compromises Cell Wall Integrity in Mycobacterium tuberculosis</article-title><source>The Journal of Biological Chemistry</source><volume>290</volume><fpage>25670</fpage><lpage>25685</lpage><pub-id pub-id-type="doi">10.1074/jbc.M115.660753</pub-id><pub-id pub-id-type="pmid">26304120</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chakaya</surname><given-names>J</given-names></name><name><surname>Khan</surname><given-names>M</given-names></name><name><surname>Ntoumi</surname><given-names>F</given-names></name><name><surname>Aklillu</surname><given-names>E</given-names></name><name><surname>Fatima</surname><given-names>R</given-names></name><name><surname>Mwaba</surname><given-names>P</given-names></name><name><surname>Kapata</surname><given-names>N</given-names></name><name><surname>Mfinanga</surname><given-names>S</given-names></name><name><surname>Hasnain</surname><given-names>SE</given-names></name><name><surname>Katoto</surname><given-names>PDMC</given-names></name><name><surname>Bulabula</surname><given-names>ANH</given-names></name><name><surname>Sam-Agudu</surname><given-names>NA</given-names></name><name><surname>Nachega</surname><given-names>JB</given-names></name><name><surname>Tiberi</surname><given-names>S</given-names></name><name><surname>McHugh</surname><given-names>TD</given-names></name><name><surname>Abubakar</surname><given-names>I</given-names></name><name><surname>Zumla</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Global Tuberculosis Report 2020 - Reflections on the Global TB burden, treatment and prevention efforts</article-title><source>International Journal of Infectious Diseases</source><volume>113 Suppl 1</volume><fpage>S7</fpage><lpage>S12</lpage><pub-id pub-id-type="doi">10.1016/j.ijid.2021.02.107</pub-id><pub-id pub-id-type="pmid">33716195</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chakrabarty</surname><given-names>B</given-names></name><name><surname>Parekh</surname><given-names>N</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>NAPS: Network Analysis of Protein Structures</article-title><source>Nucleic Acids Research</source><volume>44</volume><fpage>W375</fpage><lpage>W382</lpage><pub-id pub-id-type="doi">10.1093/nar/gkw383</pub-id><pub-id pub-id-type="pmid">27151201</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cordillot</surname><given-names>M</given-names></name><name><surname>Dubée</surname><given-names>V</given-names></name><name><surname>Triboulet</surname><given-names>S</given-names></name><name><surname>Dubost</surname><given-names>L</given-names></name><name><surname>Marie</surname><given-names>A</given-names></name><name><surname>Hugonnet</surname><given-names>J-E</given-names></name><name><surname>Arthur</surname><given-names>M</given-names></name><name><surname>Mainardi</surname><given-names>J-L</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>In vitro cross-linking of Mycobacterium tuberculosis peptidoglycan by L,D-transpeptidases and inactivation of these enzymes by carbapenems</article-title><source>Antimicrobial Agents and Chemotherapy</source><volume>57</volume><fpage>5940</fpage><lpage>5945</lpage><pub-id pub-id-type="doi">10.1128/AAC.01663-13</pub-id><pub-id pub-id-type="pmid">24041897</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Correale</surname><given-names>S</given-names></name><name><surname>Ruggiero</surname><given-names>A</given-names></name><name><surname>Capparelli</surname><given-names>R</given-names></name><name><surname>Pedone</surname><given-names>E</given-names></name><name><surname>Berisio</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Structures of free and inhibited forms of the L,D-transpeptidase LdtMt1 from Mycobacterium tuberculosis</article-title><source>Acta Crystallographica. Section D, Biological Crystallography</source><volume>69</volume><fpage>1697</fpage><lpage>1706</lpage><pub-id pub-id-type="doi">10.1107/S0907444913013085</pub-id><pub-id pub-id-type="pmid">23999293</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>del Sol</surname><given-names>A</given-names></name><name><surname>Fujihashi</surname><given-names>H</given-names></name><name><surname>Amoros</surname><given-names>D</given-names></name><name><surname>Nussinov</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Residues crucial for maintaining short paths in network communication mediate signaling in proteins</article-title><source>Molecular Systems Biology</source><volume>2</volume><elocation-id>2006.0019</elocation-id><pub-id pub-id-type="doi">10.1038/msb4100063</pub-id><pub-id pub-id-type="pmid">16738564</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Duan</surname><given-names>Y</given-names></name><name><surname>Wu</surname><given-names>C</given-names></name><name><surname>Chowdhury</surname><given-names>S</given-names></name><name><surname>Lee</surname><given-names>MC</given-names></name><name><surname>Xiong</surname><given-names>G</given-names></name><name><surname>Zhang</surname><given-names>W</given-names></name><name><surname>Yang</surname><given-names>R</given-names></name><name><surname>Cieplak</surname><given-names>P</given-names></name><name><surname>Luo</surname><given-names>R</given-names></name><name><surname>Lee</surname><given-names>T</given-names></name><name><surname>Caldwell</surname><given-names>J</given-names></name><name><surname>Wang</surname><given-names>J</given-names></name><name><surname>Kollman</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>A point-charge force field for molecular mechanics simulations of proteins based on condensed-phase quantum mechanical calculations</article-title><source>Journal of Computational Chemistry</source><volume>24</volume><fpage>1999</fpage><lpage>2012</lpage><pub-id pub-id-type="doi">10.1002/jcc.10349</pub-id><pub-id pub-id-type="pmid">14531054</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dubée</surname><given-names>V</given-names></name><name><surname>Triboulet</surname><given-names>S</given-names></name><name><surname>Mainardi</surname><given-names>J-L</given-names></name><name><surname>Ethève-Quelquejeu</surname><given-names>M</given-names></name><name><surname>Gutmann</surname><given-names>L</given-names></name><name><surname>Marie</surname><given-names>A</given-names></name><name><surname>Dubost</surname><given-names>L</given-names></name><name><surname>Hugonnet</surname><given-names>J-E</given-names></name><name><surname>Arthur</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Inactivation of Mycobacterium tuberculosis l,d-transpeptidase LdtMt₁ by carbapenems and cephalosporins</article-title><source>Antimicrobial Agents and Chemotherapy</source><volume>56</volume><fpage>4189</fpage><lpage>4195</lpage><pub-id pub-id-type="doi">10.1128/AAC.00665-12</pub-id><pub-id pub-id-type="pmid">22615283</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edoo</surname><given-names>Z</given-names></name><name><surname>Arthur</surname><given-names>M</given-names></name><name><surname>Hugonnet</surname><given-names>JE</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Reversible inactivation of a peptidoglycan transpeptidase by a β-lactam antibiotic mediated by β-lactam-ring recyclization in the enzyme active site</article-title><source>Scientific Reports</source><volume>7</volume><elocation-id>9136</elocation-id><pub-id pub-id-type="doi">10.1038/s41598-017-09341-8</pub-id><pub-id pub-id-type="pmid">28831100</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Emsley</surname><given-names>P</given-names></name><name><surname>Cowtan</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Coot: model-building tools for molecular graphics</article-title><source>Acta Crystallographica. Section D, Biological Crystallography</source><volume>60</volume><fpage>2126</fpage><lpage>2132</lpage><pub-id pub-id-type="doi">10.1107/S0907444904019158</pub-id><pub-id pub-id-type="pmid">15572765</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Erdemli</surname><given-names>SB</given-names></name><name><surname>Gupta</surname><given-names>R</given-names></name><name><surname>Bishai</surname><given-names>WR</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name><name><surname>Amzel</surname><given-names>LM</given-names></name><name><surname>Bianchet</surname><given-names>MA</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Targeting the cell wall of Mycobacterium tuberculosis: structure and mechanism of L,D-transpeptidase 2</article-title><source>Structure (London, England)</source><volume>20</volume><fpage>2103</fpage><lpage>2115</lpage><pub-id pub-id-type="doi">10.1016/j.str.2012.09.016</pub-id><pub-id pub-id-type="pmid">23103390</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fakhar</surname><given-names>Z</given-names></name><name><surname>Govender</surname><given-names>T</given-names></name><name><surname>Maguire</surname><given-names>GEM</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name><name><surname>Walker</surname><given-names>RC</given-names></name><name><surname>Kruger</surname><given-names>HG</given-names></name><name><surname>Honarparvar</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Differential flap dynamics in l,d-transpeptidase2 from mycobacterium tuberculosis revealed by molecular dynamics</article-title><source>Molecular BioSystems</source><volume>13</volume><fpage>1223</fpage><lpage>1234</lpage><pub-id pub-id-type="doi">10.1039/c7mb00110j</pub-id><pub-id pub-id-type="pmid">28480928</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fibriansah</surname><given-names>G</given-names></name><name><surname>Gliubich</surname><given-names>FI</given-names></name><name><surname>Thunnissen</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>On the mechanism of peptidoglycan binding and cleavage by the endo-specific lytic transglycosylase MltE from <italic>Escherichia coli</italic></article-title><source>Biochemistry</source><volume>51</volume><fpage>9164</fpage><lpage>9177</lpage><pub-id pub-id-type="doi">10.1021/bi300900t</pub-id><pub-id pub-id-type="pmid">23075328</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gideon</surname><given-names>HP</given-names></name><name><surname>Flynn</surname><given-names>JL</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Latent tuberculosis: what the host “sees”?</article-title><source>Immunologic Research</source><volume>50</volume><fpage>202</fpage><lpage>212</lpage><pub-id pub-id-type="doi">10.1007/s12026-011-8229-7</pub-id><pub-id pub-id-type="pmid">21717066</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Glykos</surname><given-names>NM</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Software news and updates. Carma: a molecular dynamics analysis program</article-title><source>Journal of Computational Chemistry</source><volume>27</volume><fpage>1765</fpage><lpage>1768</lpage><pub-id pub-id-type="doi">10.1002/jcc.20482</pub-id><pub-id pub-id-type="pmid">16917862</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gupta</surname><given-names>R</given-names></name><name><surname>Lavollay</surname><given-names>M</given-names></name><name><surname>Mainardi</surname><given-names>JL</given-names></name><name><surname>Arthur</surname><given-names>M</given-names></name><name><surname>Bishai</surname><given-names>WR</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>The Mycobacterium tuberculosis protein LdtMt2 is a nonclassical transpeptidase required for virulence and resistance to amoxicillin</article-title><source>Nature Medicine</source><volume>16</volume><fpage>466</fpage><lpage>469</lpage><pub-id pub-id-type="doi">10.1038/nm.2120</pub-id><pub-id pub-id-type="pmid">20305661</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hugonnet</surname><given-names>JE</given-names></name><name><surname>Tremblay</surname><given-names>LW</given-names></name><name><surname>Boshoff</surname><given-names>HI</given-names></name><name><surname>Barry</surname><given-names>CE</given-names></name><name><surname>Blanchard</surname><given-names>JS</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Meropenem-clavulanate is effective against extensively drug-resistant Mycobacterium tuberculosis</article-title><source>Science (New York, N.Y.)</source><volume>323</volume><fpage>1215</fpage><lpage>1218</lpage><pub-id pub-id-type="doi">10.1126/science.1167498</pub-id><pub-id pub-id-type="pmid">19251630</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Humphrey</surname><given-names>W</given-names></name><name><surname>Dalke</surname><given-names>A</given-names></name><name><surname>Schulten</surname><given-names>K</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>VMD: visual molecular dynamics</article-title><source>Journal of Molecular Graphics</source><volume>14</volume><fpage>33</fpage><lpage>38</lpage><pub-id pub-id-type="doi">10.1016/0263-7855(96)00018-5</pub-id><pub-id pub-id-type="pmid">8744570</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Keren</surname><given-names>I</given-names></name><name><surname>Minami</surname><given-names>S</given-names></name><name><surname>Rubin</surname><given-names>E</given-names></name><name><surname>Lewis</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Characterization and transcriptome analysis of Mycobacterium tuberculosis persisters</article-title><source>MBio</source><volume>2</volume><elocation-id>e00100-11</elocation-id><pub-id pub-id-type="doi">10.1128/mBio.00100-11</pub-id><pub-id pub-id-type="pmid">21673191</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kim</surname><given-names>HS</given-names></name><name><surname>Kim</surname><given-names>J</given-names></name><name><surname>Im</surname><given-names>HN</given-names></name><name><surname>Yoon</surname><given-names>JY</given-names></name><name><surname>An</surname><given-names>DR</given-names></name><name><surname>Yoon</surname><given-names>HJ</given-names></name><name><surname>Kim</surname><given-names>JY</given-names></name><name><surname>Min</surname><given-names>HK</given-names></name><name><surname>Kim</surname><given-names>S-J</given-names></name><name><surname>Lee</surname><given-names>JY</given-names></name><name><surname>Han</surname><given-names>BW</given-names></name><name><surname>Suh</surname><given-names>SW</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Structural basis for the inhibition of Mycobacterium tuberculosis L,D-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains</article-title><source>Acta Crystallographica. Section D, Biological Crystallography</source><volume>69</volume><fpage>420</fpage><lpage>431</lpage><pub-id pub-id-type="doi">10.1107/S0907444912048998</pub-id><pub-id pub-id-type="pmid">23519417</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kumar</surname><given-names>P</given-names></name><name><surname>Kaushik</surname><given-names>A</given-names></name><name><surname>Lloyd</surname><given-names>EP</given-names></name><name><surname>Li</surname><given-names>S-G</given-names></name><name><surname>Mattoo</surname><given-names>R</given-names></name><name><surname>Ammerman</surname><given-names>NC</given-names></name><name><surname>Bell</surname><given-names>DT</given-names></name><name><surname>Perryman</surname><given-names>AL</given-names></name><name><surname>Zandi</surname><given-names>TA</given-names></name><name><surname>Ekins</surname><given-names>S</given-names></name><name><surname>Ginell</surname><given-names>SL</given-names></name><name><surname>Townsend</surname><given-names>CA</given-names></name><name><surname>Freundlich</surname><given-names>JS</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Non-classical transpeptidases yield insight into new antibacterials</article-title><source>Nature Chemical Biology</source><volume>13</volume><fpage>54</fpage><lpage>61</lpage><pub-id pub-id-type="doi">10.1038/nchembio.2237</pub-id><pub-id pub-id-type="pmid">27820797</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lavollay</surname><given-names>M</given-names></name><name><surname>Arthur</surname><given-names>M</given-names></name><name><surname>Fourgeaud</surname><given-names>M</given-names></name><name><surname>Dubost</surname><given-names>L</given-names></name><name><surname>Marie</surname><given-names>A</given-names></name><name><surname>Veziris</surname><given-names>N</given-names></name><name><surname>Blanot</surname><given-names>D</given-names></name><name><surname>Gutmann</surname><given-names>L</given-names></name><name><surname>Mainardi</surname><given-names>JL</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>The peptidoglycan of stationary-phase Mycobacterium tuberculosis predominantly contains cross-links generated by L,D-transpeptidation</article-title><source>Journal of Bacteriology</source><volume>190</volume><fpage>4360</fpage><lpage>4366</lpage><pub-id pub-id-type="doi">10.1128/JB.00239-08</pub-id><pub-id pub-id-type="pmid">18408028</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lecoq</surname><given-names>L</given-names></name><name><surname>Bougault</surname><given-names>C</given-names></name><name><surname>Hugonnet</surname><given-names>JE</given-names></name><name><surname>Veckerlé</surname><given-names>C</given-names></name><name><surname>Pessey</surname><given-names>O</given-names></name><name><surname>Arthur</surname><given-names>M</given-names></name><name><surname>Simorre</surname><given-names>JP</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Dynamics induced by β-lactam antibiotics in the active site of <italic>Bacillus subtilis</italic> L,D-transpeptidase</article-title><source>Structure (London, England)</source><volume>20</volume><fpage>850</fpage><lpage>861</lpage><pub-id pub-id-type="doi">10.1016/j.str.2012.03.015</pub-id><pub-id pub-id-type="pmid">22579252</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname><given-names>WJ</given-names></name><name><surname>Li</surname><given-names>DF</given-names></name><name><surname>Hu</surname><given-names>YL</given-names></name><name><surname>Zhang</surname><given-names>XE</given-names></name><name><surname>Bi</surname><given-names>LJ</given-names></name><name><surname>Wang</surname><given-names>DC</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Crystal structure of L,D-transpeptidase LdtMt2 in complex with meropenem reveals the mechanism of carbapenem against Mycobacterium tuberculosis</article-title><source>Cell Research</source><volume>23</volume><fpage>728</fpage><lpage>731</lpage><pub-id pub-id-type="doi">10.1038/cr.2013.53</pub-id><pub-id pub-id-type="pmid">23588382</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Libreros-Zúñiga</surname><given-names>GA</given-names></name><name><surname>Dos Santos Silva</surname><given-names>C</given-names></name><name><surname>Salgado Ferreira</surname><given-names>R</given-names></name><name><surname>Dias</surname><given-names>MVB</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Structural Basis for the Interaction and Processing of β-Lactam Antibiotics by l,d-Transpeptidase 3 (Ldt<sub>Mt3</sub>) from Mycobacterium tuberculosis</article-title><source>ACS Infectious Diseases</source><volume>5</volume><fpage>260</fpage><lpage>271</lpage><pub-id pub-id-type="doi">10.1021/acsinfecdis.8b00244</pub-id><pub-id pub-id-type="pmid">30556998</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liebschner</surname><given-names>D</given-names></name><name><surname>Afonine</surname><given-names>PV</given-names></name><name><surname>Baker</surname><given-names>ML</given-names></name><name><surname>Bunkóczi</surname><given-names>G</given-names></name><name><surname>Chen</surname><given-names>VB</given-names></name><name><surname>Croll</surname><given-names>TI</given-names></name><name><surname>Hintze</surname><given-names>B</given-names></name><name><surname>Hung</surname><given-names>LW</given-names></name><name><surname>Jain</surname><given-names>S</given-names></name><name><surname>McCoy</surname><given-names>AJ</given-names></name><name><surname>Moriarty</surname><given-names>NW</given-names></name><name><surname>Oeffner</surname><given-names>RD</given-names></name><name><surname>Poon</surname><given-names>BK</given-names></name><name><surname>Prisant</surname><given-names>MG</given-names></name><name><surname>Read</surname><given-names>RJ</given-names></name><name><surname>Richardson</surname><given-names>JS</given-names></name><name><surname>Richardson</surname><given-names>DC</given-names></name><name><surname>Sammito</surname><given-names>MD</given-names></name><name><surname>Sobolev</surname><given-names>OV</given-names></name><name><surname>Stockwell</surname><given-names>DH</given-names></name><name><surname>Terwilliger</surname><given-names>TC</given-names></name><name><surname>Urzhumtsev</surname><given-names>AG</given-names></name><name><surname>Videau</surname><given-names>LL</given-names></name><name><surname>Williams</surname><given-names>CJ</given-names></name><name><surname>Adams</surname><given-names>PD</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix</article-title><source>Acta Crystallographica. Section D, Structural Biology</source><volume>75</volume><fpage>861</fpage><lpage>877</lpage><pub-id pub-id-type="doi">10.1107/S2059798319011471</pub-id><pub-id pub-id-type="pmid">31588918</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lillebaek</surname><given-names>T</given-names></name><name><surname>Dirksen</surname><given-names>A</given-names></name><name><surname>Baess</surname><given-names>I</given-names></name><name><surname>Strunge</surname><given-names>B</given-names></name><name><surname>Thomsen</surname><given-names>VØ</given-names></name><name><surname>Andersen</surname><given-names>AB</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Molecular evidence of endogenous reactivation of Mycobacterium tuberculosis after 33 years of latent infection</article-title><source>The Journal of Infectious Diseases</source><volume>185</volume><fpage>401</fpage><lpage>404</lpage><pub-id pub-id-type="doi">10.1086/338342</pub-id><pub-id pub-id-type="pmid">11807725</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mainardi</surname><given-names>JL</given-names></name><name><surname>Fourgeaud</surname><given-names>M</given-names></name><name><surname>Hugonnet</surname><given-names>JE</given-names></name><name><surname>Dubost</surname><given-names>L</given-names></name><name><surname>Brouard</surname><given-names>JP</given-names></name><name><surname>Ouazzani</surname><given-names>J</given-names></name><name><surname>Rice</surname><given-names>LB</given-names></name><name><surname>Gutmann</surname><given-names>L</given-names></name><name><surname>Arthur</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>A novel peptidoglycan cross-linking enzyme for A beta-lactam-resistant transpeptidation pathway</article-title><source>The Journal of Biological Chemistry</source><volume>280</volume><fpage>38146</fpage><lpage>38152</lpage><pub-id pub-id-type="doi">10.1074/jbc.M507384200</pub-id><pub-id pub-id-type="pmid">16144833</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martelli</surname><given-names>G</given-names></name><name><surname>Pessatti</surname><given-names>TB</given-names></name><name><surname>Steiner</surname><given-names>EM</given-names></name><name><surname>Cirillo</surname><given-names>M</given-names></name><name><surname>Caso</surname><given-names>C</given-names></name><name><surname>Bisognin</surname><given-names>F</given-names></name><name><surname>Landreh</surname><given-names>M</given-names></name><name><surname>Monte</surname><given-names>PD</given-names></name><name><surname>Giacomini</surname><given-names>D</given-names></name><name><surname>Schnell</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>N-Thio-β-lactams targeting L,D-transpeptidase-2, with activity against drug-resistant strains of Mycobacterium tuberculosis</article-title><source>Cell Chemical Biology</source><volume>28</volume><fpage>1321</fpage><lpage>1332</lpage><pub-id pub-id-type="doi">10.1016/j.chembiol.2021.03.008</pub-id><pub-id pub-id-type="pmid">33826941</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mavrici</surname><given-names>D</given-names></name><name><surname>Prigozhin</surname><given-names>DM</given-names></name><name><surname>Alber</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Mycobacterium tuberculosis RpfE crystal structure reveals a positively charged catalytic cleft</article-title><source>Protein Science</source><volume>23</volume><fpage>481</fpage><lpage>487</lpage><pub-id pub-id-type="doi">10.1002/pro.2431</pub-id><pub-id pub-id-type="pmid">24452911</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Minor</surname><given-names>W</given-names></name><name><surname>Cymborowski</surname><given-names>M</given-names></name><name><surname>Otwinowski</surname><given-names>Z</given-names></name><name><surname>Chruszcz</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes</article-title><source>Acta Crystallographica. Section D, Biological Crystallography</source><volume>62</volume><fpage>859</fpage><lpage>866</lpage><pub-id pub-id-type="doi">10.1107/S0907444906019949</pub-id><pub-id pub-id-type="pmid">16855301</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mitkowski</surname><given-names>P</given-names></name><name><surname>Jagielska</surname><given-names>E</given-names></name><name><surname>Nowak</surname><given-names>E</given-names></name><name><surname>Bujnicki</surname><given-names>JM</given-names></name><name><surname>Stefaniak</surname><given-names>F</given-names></name><name><surname>Niedziałek</surname><given-names>D</given-names></name><name><surname>Bochtler</surname><given-names>M</given-names></name><name><surname>Sabała</surname><given-names>I</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Structural bases of peptidoglycan recognition by lysostaphin SH3b domain</article-title><source>Scientific Reports</source><volume>9</volume><elocation-id>5965</elocation-id><pub-id pub-id-type="doi">10.1038/s41598-019-42435-z</pub-id><pub-id pub-id-type="pmid">30979923</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Olehnovics</surname><given-names>E</given-names></name><name><surname>Yin</surname><given-names>J</given-names></name><name><surname>Pérez</surname><given-names>A</given-names></name><name><surname>De Fabritiis</surname><given-names>G</given-names></name><name><surname>Bonomo</surname><given-names>RA</given-names></name><name><surname>Bhowmik</surname><given-names>D</given-names></name><name><surname>Haider</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>The Role of Hydrophobic Nodes in the Dynamics of Class A β-Lactamases</article-title><source>Frontiers in Microbiology</source><volume>12</volume><elocation-id>720991</elocation-id><pub-id pub-id-type="doi">10.3389/fmicb.2021.720991</pub-id><pub-id pub-id-type="pmid">34621251</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Otero</surname><given-names>LH</given-names></name><name><surname>Rojas-Altuve</surname><given-names>A</given-names></name><name><surname>Llarrull</surname><given-names>LI</given-names></name><name><surname>Carrasco-López</surname><given-names>C</given-names></name><name><surname>Kumarasiri</surname><given-names>M</given-names></name><name><surname>Lastochkin</surname><given-names>E</given-names></name><name><surname>Fishovitz</surname><given-names>J</given-names></name><name><surname>Dawley</surname><given-names>M</given-names></name><name><surname>Hesek</surname><given-names>D</given-names></name><name><surname>Lee</surname><given-names>M</given-names></name><name><surname>Johnson</surname><given-names>JW</given-names></name><name><surname>Fisher</surname><given-names>JF</given-names></name><name><surname>Chang</surname><given-names>M</given-names></name><name><surname>Mobashery</surname><given-names>S</given-names></name><name><surname>Hermoso</surname><given-names>JA</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>How allosteric control of <italic>Staphylococcus aureus</italic> penicillin binding protein 2a enables methicillin resistance and physiological function</article-title><source>PNAS</source><volume>110</volume><fpage>16808</fpage><lpage>16813</lpage><pub-id pub-id-type="doi">10.1073/pnas.1300118110</pub-id><pub-id pub-id-type="pmid">24085846</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peddireddy</surname><given-names>V</given-names></name><name><surname>Doddam</surname><given-names>SN</given-names></name><name><surname>Ahmed</surname><given-names>N</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Mycobacterial Dormancy Systems and Host Responses in Tuberculosis</article-title><source>Frontiers in Immunology</source><volume>8</volume><elocation-id>84</elocation-id><pub-id pub-id-type="doi">10.3389/fimmu.2017.00084</pub-id><pub-id pub-id-type="pmid">28261197</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Phillips</surname><given-names>JC</given-names></name><name><surname>Hardy</surname><given-names>DJ</given-names></name><name><surname>Maia</surname><given-names>JDC</given-names></name><name><surname>Stone</surname><given-names>JE</given-names></name><name><surname>Ribeiro</surname><given-names>JV</given-names></name><name><surname>Bernardi</surname><given-names>RC</given-names></name><name><surname>Buch</surname><given-names>R</given-names></name><name><surname>Fiorin</surname><given-names>G</given-names></name><name><surname>Hénin</surname><given-names>J</given-names></name><name><surname>Jiang</surname><given-names>W</given-names></name><name><surname>McGreevy</surname><given-names>R</given-names></name><name><surname>Melo</surname><given-names>MCR</given-names></name><name><surname>Radak</surname><given-names>BK</given-names></name><name><surname>Skeel</surname><given-names>RD</given-names></name><name><surname>Singharoy</surname><given-names>A</given-names></name><name><surname>Wang</surname><given-names>Y</given-names></name><name><surname>Roux</surname><given-names>B</given-names></name><name><surname>Aksimentiev</surname><given-names>A</given-names></name><name><surname>Luthey-Schulten</surname><given-names>Z</given-names></name><name><surname>Kalé</surname><given-names>LV</given-names></name><name><surname>Schulten</surname><given-names>K</given-names></name><name><surname>Chipot</surname><given-names>C</given-names></name><name><surname>Tajkhorshid</surname><given-names>E</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Scalable molecular dynamics on CPU and GPU architectures with NAMD</article-title><source>The Journal of Chemical Physics</source><volume>153</volume><elocation-id>044130</elocation-id><pub-id pub-id-type="doi">10.1063/5.0014475</pub-id><pub-id pub-id-type="pmid">32752662</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pronk</surname><given-names>S</given-names></name><name><surname>Páll</surname><given-names>S</given-names></name><name><surname>Schulz</surname><given-names>R</given-names></name><name><surname>Larsson</surname><given-names>P</given-names></name><name><surname>Bjelkmar</surname><given-names>P</given-names></name><name><surname>Apostolov</surname><given-names>R</given-names></name><name><surname>Shirts</surname><given-names>MR</given-names></name><name><surname>Smith</surname><given-names>JC</given-names></name><name><surname>Kasson</surname><given-names>PM</given-names></name><name><surname>van der Spoel</surname><given-names>D</given-names></name><name><surname>Hess</surname><given-names>B</given-names></name><name><surname>Lindahl</surname><given-names>E</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>GROMACS 4.5: a high-throughput and highly parallel open source molecular simulation toolkit</article-title><source>Bioinformatics (Oxford, England)</source><volume>29</volume><fpage>845</fpage><lpage>854</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btt055</pub-id><pub-id pub-id-type="pmid">23407358</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Roe</surname><given-names>DR</given-names></name><name><surname>Cheatham</surname><given-names>TE</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>PTRAJ and CPPTRAJ: Software for Processing and Analysis of Molecular Dynamics Trajectory Data</article-title><source>Journal of Chemical Theory and Computation</source><volume>9</volume><fpage>3084</fpage><lpage>3095</lpage><pub-id pub-id-type="doi">10.1021/ct400341p</pub-id><pub-id pub-id-type="pmid">26583988</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sanders</surname><given-names>AN</given-names></name><name><surname>Wright</surname><given-names>LF</given-names></name><name><surname>Pavelka</surname><given-names>MS</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Genetic characterization of mycobacterial L,D-transpeptidases</article-title><source>Microbiology (Reading, England)</source><volume>160</volume><fpage>1795</fpage><lpage>1806</lpage><pub-id pub-id-type="doi">10.1099/mic.0.078980-0</pub-id><pub-id pub-id-type="pmid">24855140</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schanda</surname><given-names>P</given-names></name><name><surname>Triboulet</surname><given-names>S</given-names></name><name><surname>Laguri</surname><given-names>C</given-names></name><name><surname>Bougault</surname><given-names>CM</given-names></name><name><surname>Ayala</surname><given-names>I</given-names></name><name><surname>Callon</surname><given-names>M</given-names></name><name><surname>Arthur</surname><given-names>M</given-names></name><name><surname>Simorre</surname><given-names>JP</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Atomic model of a cell-wall cross-linking enzyme in complex with an intact bacterial peptidoglycan</article-title><source>Journal of the American Chemical Society</source><volume>136</volume><fpage>17852</fpage><lpage>17860</lpage><pub-id pub-id-type="doi">10.1021/ja5105987</pub-id><pub-id pub-id-type="pmid">25429710</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schoonmaker</surname><given-names>MK</given-names></name><name><surname>Bishai</surname><given-names>WR</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Nonclassical transpeptidases of Mycobacterium tuberculosis alter cell size, morphology, the cytosolic matrix, protein localization, virulence, and resistance to β-lactams</article-title><source>Journal of Bacteriology</source><volume>196</volume><fpage>1394</fpage><lpage>1402</lpage><pub-id pub-id-type="doi">10.1128/JB.01396-13</pub-id><pub-id pub-id-type="pmid">24464457</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Steiner</surname><given-names>EM</given-names></name><name><surname>Schneider</surname><given-names>G</given-names></name><name><surname>Schnell</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Binding and processing of β-lactam antibiotics by the transpeptidase Ldt<sub>Mt2</sub> from Mycobacterium tuberculosis</article-title><source>The FEBS Journal</source><volume>284</volume><fpage>725</fpage><lpage>741</lpage><pub-id pub-id-type="doi">10.1111/febs.14010</pub-id><pub-id pub-id-type="pmid">28075068</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tolufashe</surname><given-names>GF</given-names></name><name><surname>Sabe</surname><given-names>VT</given-names></name><name><surname>Ibeji</surname><given-names>CU</given-names></name><name><surname>Ntombela</surname><given-names>T</given-names></name><name><surname>Govender</surname><given-names>T</given-names></name><name><surname>Maguire</surname><given-names>GEM</given-names></name><name><surname>Kruger</surname><given-names>HG</given-names></name><name><surname>Lamichhane</surname><given-names>G</given-names></name><name><surname>Honarparvar</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Structure and Function of L,D- and D,D-Transpeptidase Family Enzymes from Mycobacterium tuberculosis</article-title><source>Current Medicinal Chemistry</source><volume>27</volume><fpage>3250</fpage><lpage>3267</lpage><pub-id pub-id-type="doi">10.2174/0929867326666181203150231</pub-id><pub-id pub-id-type="pmid">30501595</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Trott</surname><given-names>O</given-names></name><name><surname>Olson</surname><given-names>AJ</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading</article-title><source>Journal of Computational Chemistry</source><volume>31</volume><fpage>455</fpage><lpage>461</lpage><pub-id pub-id-type="doi">10.1002/jcc.21334</pub-id><pub-id pub-id-type="pmid">19499576</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>J</given-names></name><name><surname>Wolf</surname><given-names>RM</given-names></name><name><surname>Caldwell</surname><given-names>JW</given-names></name><name><surname>Kollman</surname><given-names>PA</given-names></name><name><surname>Case</surname><given-names>DA</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Development and testing of a general amber force field</article-title><source>Journal of Computational Chemistry</source><volume>25</volume><fpage>1157</fpage><lpage>1174</lpage><pub-id pub-id-type="doi">10.1002/jcc.20035</pub-id><pub-id pub-id-type="pmid">15116359</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wayne</surname><given-names>LG</given-names></name><name><surname>Hayes</surname><given-names>LG</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence</article-title><source>Infection and Immunity</source><volume>64</volume><fpage>2062</fpage><lpage>2069</lpage><pub-id pub-id-type="doi">10.1128/iai.64.6.2062-2069.1996</pub-id><pub-id pub-id-type="pmid">8675308</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wietzerbin</surname><given-names>J</given-names></name><name><surname>Das</surname><given-names>BC</given-names></name><name><surname>Petit</surname><given-names>JF</given-names></name><name><surname>Lederer</surname><given-names>E</given-names></name><name><surname>Leyh-Bouille</surname><given-names>M</given-names></name><name><surname>Ghuysen</surname><given-names>JM</given-names></name></person-group><year iso-8601-date="1974">1974</year><article-title>Occurrence of D-alanyl-(D)-meso-diaminopimelic acid and meso-diaminopimelyl-meso-diaminopimelic acid interpeptide linkages in the peptidoglycan of Mycobacteria</article-title><source>Biochemistry</source><volume>13</volume><fpage>3471</fpage><lpage>3476</lpage><pub-id pub-id-type="doi">10.1021/bi00714a008</pub-id><pub-id pub-id-type="pmid">4210702</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Williams</surname><given-names>CJ</given-names></name><name><surname>Headd</surname><given-names>JJ</given-names></name><name><surname>Moriarty</surname><given-names>NW</given-names></name><name><surname>Prisant</surname><given-names>MG</given-names></name><name><surname>Videau</surname><given-names>LL</given-names></name><name><surname>Deis</surname><given-names>LN</given-names></name><name><surname>Verma</surname><given-names>V</given-names></name><name><surname>Keedy</surname><given-names>DA</given-names></name><name><surname>Hintze</surname><given-names>BJ</given-names></name><name><surname>Chen</surname><given-names>VB</given-names></name><name><surname>Jain</surname><given-names>S</given-names></name><name><surname>Lewis</surname><given-names>SM</given-names></name><name><surname>Arendall</surname><given-names>WB</given-names></name><name><surname>Snoeyink</surname><given-names>J</given-names></name><name><surname>Adams</surname><given-names>PD</given-names></name><name><surname>Lovell</surname><given-names>SC</given-names></name><name><surname>Richardson</surname><given-names>JS</given-names></name><name><surname>Richardson</surname><given-names>DC</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>MolProbity: More and better reference data for improved all-atom structure validation</article-title><source>Protein Science</source><volume>27</volume><fpage>293</fpage><lpage>315</lpage><pub-id pub-id-type="doi">10.1002/pro.3330</pub-id><pub-id pub-id-type="pmid">29067766</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zandi</surname><given-names>TA</given-names></name><name><surname>Townsend</surname><given-names>CA</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Competing off-loading mechanisms of meropenem from an l,d-transpeptidase reduce antibiotic effectiveness</article-title><source>PNAS</source><volume>118</volume><elocation-id>e2008610118</elocation-id><pub-id pub-id-type="doi">10.1073/pnas.2008610118</pub-id><pub-id pub-id-type="pmid">34187885</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Yew</surname><given-names>WW</given-names></name><name><surname>Barer</surname><given-names>MR</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Targeting persisters for tuberculosis control</article-title><source>Antimicrobial Agents and Chemotherapy</source><volume>56</volume><fpage>2223</fpage><lpage>2230</lpage><pub-id pub-id-type="doi">10.1128/AAC.06288-11</pub-id><pub-id pub-id-type="pmid">22391538</pub-id></element-citation></ref></ref-list></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.73055.sa0</article-id><title-group><article-title>Editor's evaluation</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Dassama</surname><given-names>Laura</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00f54p054</institution-id><institution>Stanford University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><related-object id="sa0ro1" link-type="continued-by" object-id="10.1101/2021.09.06.459080" object-id-type="id" xlink:href="https://sciety.org/articles/activity/10.1101/2021.09.06.459080"/></front-stub><body><p>This manuscript reports high-resolution crystallographic structures of the L,D-transpeptidase from <italic>Mycobacterium tuberculosis</italic>, which was obtained with ligands (a sugar molecule and a β-lactam). A surprising finding is that the enzyme contains a ligand-binding site located greater than 20 Å away from the catalytic site. The authors used mutagenesis studies and computational analyses to support an allosteric role for the new ligand site (S-pocket). This site could potentially permit the inhibition of L,D-transpeptidases.</p></body></sub-article><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.73055.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Dassama</surname><given-names>Laura</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00f54p054</institution-id><institution>Stanford University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Haider</surname><given-names>Shozeb</given-names></name><role>Reviewer</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02jx3x895</institution-id><institution>University College London</institution></institution-wrap><country>United Kingdom</country></aff></contrib></contrib-group></front-stub><body><boxed-text id="sa2-box1"><p>Our editorial process produces two outputs: i) <ext-link ext-link-type="uri" xlink:href="https://sciety.org/articles/activity/10.1101/2021.09.06.459080">public reviews</ext-link> designed to be posted alongside <ext-link ext-link-type="uri" xlink:href="https://www.biorxiv.org/content/10.1101/2021.09.06.459080v1">the preprint</ext-link> for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.</p></boxed-text><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;Allosteric cooperation in ß-lactam binding to a non-classical transpeptidase&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Olga Boudker as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Shozeb Haider (Reviewer #1).</p><p>The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.</p><p>Essential revisions:</p><p>1) Please include details of the molecular dynamics simulations so that reviewers can assess their rigor. 2 reviewers mentioned that the 100 ns trajectories used in the simulations might not be sufficient to reveal real conformational dynamics. Please address by increasing the trajectories.</p><p>2) Please provide parameters used for the docking studies.</p><p>3) Please present binding data for β-lactam binding to the S-pocket in protein with active-site mutations.</p><p>4) Please provide additional data investigating the importance of other residues (E168, R371, Y330 and A171, M157 and L391) in the S-pocket to bolster the data with R209.</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>The structures of LdtMt2 have been published before, both as apo and in complex with a β-lactam molecule. The current structures report on a novel allosteric site that was not previously described.</p><p>Figure 2A should be moved to Figure 1.</p><p>The structures in Figure 1C (purple and green) that are superimposed do not look superimposed. No quantitative measure (RMSD) is provided. What parts of the structure were superimposed? Perhaps a sequence alignment between LdtBS and LdtMt2 might explain this better. Further qualitative analysis of the inner cavity should be carried out. The electrostatic surface should be shown for both proteins and how the corresponding electrostatic surface of the PG complements it should be illustrated.</p><p>Dynamic distances between important residues (H336-C354, H336-S351, H336-S337, etc.) over the course of the simulation should be plotted to support the claims that the authors make.</p><p>One of the strengths of this paper is the finding that S351 and not S337 might form the catalytic triad. The authors should strengthen this by quantifying structural interactions that support mutagenesis experiments. A wealth of data is present in the MD simulations; they should use this to their advantage.</p><p>Since there are other structures of mutants of LdtMt2 present, why did the authors not try to crystallize R290E and other mutants? The structural findings would have been definitive in assessing the structural differences between the apo and ligand-bound states. A comment should be made in the discussion.</p><p>The manuscript relies heavily on MD simulations to structurally explain a number of experimental observations. The computational study is an essential part of the manuscript, yet it seems to be carried out like an afterthought. MD simulations analysis is poorly carried out. The details in the method section for both automated docking and MD simulations are poor and lack details to reproduce the study. For example, How were the ligands parameterized? No evidence has been provided which even remotely suggests that the simulated system has been equilibrated, let alone converged. How many simulations were run to confirm the observations were statistically significant? The interpretations of the results are equally perplexing. The tumbling of the ligand in the binding site is because the system has not equilibrated and should be omitted from being included in any interpretation (line 334-335). 100ns might be too short for the essential interactions to stabilize. If the authors think otherwise, they should support that with evidence. None of that has been included. MD simulation figures in the supplementary are poor and do not provide any information that strengthens the excellent biochemical analysis and mutagenesis experiments. The MD simulation figures in Supplementary are not even labeled appropriately.</p><p>Why have the dynamics of R209 not been discussed? If the allosteric signals are indeed emanating from this residue (or any in the allosteric pocket), then surely a direct link could be traced between R209 (or other residues) and the catalytic triad? A network analysis should be able to resolve this. Or some equivalent method that demonstrates this structural link.</p><p>Line 342/344/346: There is no Figure S4A or S4B. Just S4</p><p>Line 347-350: &quot;Thus, MD simulations suggest that biapenem binding across the S-pocket surface imposes stability in fluctuations of β-lactam movement in the catalytic site and the.-lactam ring carbonyl group maintains a close distance with the Sϒ atom of C354 that favor a nucleophilic attack&quot;</p><p>It might very well be that this is indeed the case. But without evidence from MD simulation, it seems like they are an over-interpretation of results.</p><p>The docking protocol was baffling. When the authors have a crystal structure with a ligand, then what was the reason they did not carry out a template-based docking? Surely, the β-lactam ring in T203 could have been used as a fixed focal point. Yet, they even dock T203. If the authors were trying to do a blind dock to confirm the binding mode of T203 (because of the poor electron density), then they should say so and also show the results of the dock, superimposed on the crystal structure. No such thing has been detailed in the method or discussion.</p><p>The authors mention that the electron density of T203 is poor. Therefore in addition to 2Fo-Fc maps, they should also include omit maps. This will only strengthen their claim of how they have modeled the ligand in the sites.</p><p>Line 449: What was this distance measured between? Which residues or atoms?</p><p>Line 452-453: &quot;Mutational changes in the S-pocket or the catalytic pocket nullifies all the allosteric communications that are otherwise important in the cooperative binding of dual ß-lactams.&quot; How is this structurally achieved between the two sites that are far apart? The authors should use network analysis to resolve this?</p><p>Line 471-472: There is surely a mechanism of allosteric communication, its just that the authors have not provided evidence for that. What the authors have shown is the end states in either the allosteric site or the catalytic site, but not how signals would be communicated upon ligand binding in the allosteric site to the catalytic site.</p><p>Line 479: Why have the properties (structural or sequence) have not been shown for the putative S-pocket. A close-up (structural superimposition of conserved residues) or sequence alignment should have been presented. Perhaps figures of electrostatic charge surface would convey the point the authors are trying to make. Figure 8 is the least informative as it currently stands.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>In this work, authors seek a better understanding of the L,D-transpeptidase class of enzymes. They investigate Ldt-Mt2, 1 of five L,D-transpeptidase paralogs rom <italic>Mycobacterium tuberculosis</italic>. First, they determine a crystal structure of LdtMt2 and are able to model density for glucose into a pocket between two domains YkuD and IgD2. This pocket is hereafter referred to as the S-pocket. Authors use Thermofluor to provide support for glucose binding at that (using a peptidoglycan/PG precursor) site. Mutation of a residue in the S-pocket: R209E disrupts the binding of the precursor. By deleting selected domains, authors are able to show that both domains YkuD and IgD2 are necessary for hydrolysis activity, supporting a role for the S-pocket in governing catalytic activity. MD simulations were used to investigate the influence of S-pocket mutations on dynamics at the active site (21 angstroms away). Distinct fluctuations in active site residues were observed when the S-pocket mutation was introduced in the simulations. Upon mutation, these active site residues affected β-lactam hydrolysis, indicating that fluctuations observed in MD were functionally relevant.</p><p>The S-pocket mutation was shown to disrupt irreversible acetylation by an inhibitor (biapenem) at the active site. Thermoflour showed that biapenem likely binds Ldt-Mt at two sites, covalently at one and non-covalently at the other. Both the S-pocket mutation and an active site catalytic mutant hindered both binding events, supporting an interplay between the two sites. MD simulations and docking are used to further probe cooperativity between the two sites. When biapenem is bound at both sites, increased stability is observed in the molecule compared to when biapenem is bound to only one site.</p><p>Finally, authors dock other classes of β lactams into Ldt-Mt2 and observe similar binding modes for all. Thermoflour shows that the R209E mutation disrupts binding of these β lactams. A second crystal structure of Ldt-Mt2 is presented with T203 drug. T203 densities were modeled into the S-pcoket and catalytic site. Structural comparison to other LdtMt2 structures revealed alterations in both S-pocket and catalytic site regions. In summary, authors conclude that the S-pocket is an allosteric site that controls catalytic activity of Ldt-Mt2.</p><p>This study is potentially very exciting and very important, as the report of this allosteric site is novel and might be a prevailing mechanism across other L,D-transpeptidases.</p><p>There are two major issues that I believe should be addressed. (1) Because of the nature of the evidence presented to support the existence/role of the S-pocket (i.e. computational modeling, ligands modeled into electron density, a single disruptive mutation), it is my opinion that the authors have to provide an additional piece of data to support the existence of the S-pocket. (2) The computational studies presented, in my opinion, are not rigorous enough to support the claims that are made. My comments are provided in detail below.</p><p>1. After modeling glucose into the S-pocket, authors propose R209, E168, R371, Y330 and A171, M157 and L391 as residues interacting with the sugar. However only a single mutation (R209E) disrupts binding of the PG precursor. The identification of only a single mutation is strange, because for a bonafide binding site, there should be at least &gt; 1 residue which can disrupt binding. Because other mutations are not reported that disrupt binding at S-pocket, there is not strong evidence that the S-pocket is an actual site for binding ligands. This poses an important question: is it possible that R209E affects Ldt-Mt2 function by just disrupting the IgD2-YkuD domain interface and subsequently destabilizes the active site? To confirm that the S-pocket is actually a distinct site that binds ligand and allosterically regulates the active site, there needs to be evidence that R209E does not merely disrupt dimerization of the two domains. The majority of the case for the existence of this pocket hinges on functional studies with R209E, therefore this possibility should be ruled out.</p><p>2. Authors have extracted quite a bit of mechanistic detail from their simulations, including demonstrating cooperativity between the two sites. However authors should be cautious, because 100 ns trajectories are not long enough to give meaningful information about fluctuations or persistence of conformations. For a protein with 450 residues, my sense is that the trajectories are barely equilibrated at 100 ns. However RMSDs over the trajectory can be shown to give some indication of how overall structure is changing between 0 and 100 ns. This will help the authors determine whether the changes in active site residues that they report can be expected to persist over longer timescales. One suggestion to achieve longer trajectories: authors could truncate the complex to just the two domains of interest, which might allow increased simulation time to further support these claims.</p><p>This is a potentially exciting piece of work. To make this suitable for publication, authors must provide a little more evidence that the S-pocket is a site that binds ligand. For both ligands modeled into electron density, the observation of only small fragments of these ligands casts doubt on the veracity of their binding. Likewise, the identification of only a single mutation that disrupts S-pocket is not sufficient to support binding.</p><p>Additionally, for some of the claims being made using docking and MD simulations, particularly those of cooperativity and pocket cross-talk, authors have not demonstrated that their trajectories are long enough to extract these conclusions. Evidence should be provided to test equilibration and confirm that the key interactions/conformational changes presented here will persist in longer simulations. Alternatively, authors could add additional experimental validations to demonstrate cooperativity between the two sites.</p><p><italic>Reviewer #3 (Recommendations for the authors):</italic></p><p>Abstract: the first sentence suggests that only <italic>M. tuberculosis</italic> has Ld transpeptidases, which is incorrect. Please edit this accordingly. The site termed 'S-pocket' on Line 42 is referred to as 'S-site' on line 45; please adopt a consistent terminology.</p><p>Introduction: although it is well-written, I do not think the summary of the paper (Lines 149-155) accurately reflect the results of the paper. In my view, the results on β-lactams and not peptidoglycan are the significant portion of the paper. Also, claims such as 'several interdisciplinary approaches' and 'explain the mechanism for the manifestation of activity of Ldtm2' are not completely supported, since the authors uncover an additional facet of the functioning of the enzyme. These sentences should be tempered.</p><p>Line 161: it is not clear whether the crystal structure at 1.57A is an improvement on previous efforts and whether this improved resolution is what enables the authors to discover the glucose binding in the S-pocket. The text should be re-written to make these points clear.</p><p>Figure 1B: comparable data for glucose would help the readers assess the strength of the conclusions regarding PG. In this panel, and in similar panels in other figures, it is not clear if the trend is significant. Could the authors show error bars for such figures, and perhaps include a plot of Tm vs. substrate concentration in the inset to highlight the trend better?</p><p>Figure 1D: the inner and outer cavity in the catalytic site that is discussed in the text is not labelled in the figure, and so it is hard to appreciate the location of the larger pentameric PG molecule. Furthermore, the authors could show Thermofluor data for a suitable point-mutant in the inner cavity to confirm their claims that the PG molecule can be located within the S-pocket and the inner cavity and complement the data in Figure 1B.</p><p>Lines 200-205: it is unclear what the phrases 'deletion of IgD2 from the YkUD domain as assessed from the YkuD domain alone' means. At Line 205, the S-pocket is described as being carried by the IgD2 domain but</p><p>Lines 271-273: while I do not disagree qualitatively with the descriptions, there is clearly a large shift in Tm at the lowest concentration of bioapenem, which is not reflected in the text.</p><p>Line 304: in contrast, the decreased stability of the S351A mutant has nothing to do with the biapenem binding – the statement describing this is misleading, Please revise this.</p><p>Figure 4B: based on the statements in the text, the effect of biapenem binding on melting structure is completely abroagated by the R209E and S351A mutations, yet the graphs show red arrows for the change in Tm. Please remove these if the trend is non-significant.</p><p>Figure 4C: given the content-rich format of <italic>eLife</italic>, the authors should provide animations of the simulations they describe, which would be far more informative than the snapshots presented.</p><p>Figure presentation: in many figures, the red arrow labels are hard to see. Please make the arrows bigger.</p><p>Figure 6 and last section of the Results: the motivation for studying in detail the molecule T203 is unclear. Is it because it has the most dramatic effects based on the results of Figure 5? The authors should cite relevant publications for this drug and include in the discussion how such a finding on an experimental carbapenem may be beneficial, as this is a strength of this manuscript.</p><p>Figures and figure legends: many methodological details e.g., the software used for the curve fitting can be moved to the Materials and methods and do not need to be repeated for every figure.</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Allosteric cooperation in ß-lactam binding to a non-classical transpeptidase&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Olga Boudker (Senior Editor) and a Reviewing Editor.</p><p>The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:</p><p>1) S-pocket: R209 continues to be the only residue with a significant impact on ligand binding/catalysis. Y330 was used as a second proxy for the S-site, but its effect is much more muted than R209 or E207. The data with E207A, while not comprehensive (e.g. nitrocefin hydrolysis), does support the S-site more than data with Y330F – please note this.</p><p>2) The CD spectra of wt vs R209A show some differences ~ 210 nm that could be explained by reduced β-sheet content in the spectrum of the variant protein. Such a change could indicate problems with the protein fold that might account for the differences in catalytic activity. Can the spectra be fit to determine whether this difference is meaningful? This will bolster the data suggesting that R209 forms part of an allosteric site.</p><p>3) Cooperativity between the catalytic site and the active site: there is no clear evidence that cabapenam binding occurs cooperatively. In the absence of a quantitative assessment of cooperativity, it might be best to state that this is a possibility rather than a phenomenon that has been determined.</p><p>4) The binding of T203 to the active site is clear, but the 2Fo-Fc map shows low occupancy at the S-site. Were greater concentrations of the drug used? IF so, do those data reveal improved occupancy at the S-site?</p><p>Additionally, the comments below were provided by a reviewer.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>Ahmad et al., have addressed my largest concern, going to extra steps to make sure that other S-pocket mutations disrupt small molecule binding. This portion of the manuscript is more convincing and the discovery of the S-pocket is quite novel.</p><p>While simulations have been increased, the authors still did not address the question of equilibration or show RMSDs over the length of the trajectory to show the feasibility of extracting mechanistic details from these simulations. However, the description of the conformational differences between wildtype and mutant Ldt-Mt2 is quite compelling.</p><p>Overall, concerns still remain about the computational work.</p><p>1. Authors mention that they have computed a dynamic network analysis for their MD trajectories. There is no explanation of what this analysis means or what information it provides. The method section is not instructive about the nature of this analysis, except to say that it was performed using VMD. It is also not my understanding that this method is used to calculate 'distances', as these can be calculated directly from the trajectory. To my knowledge, dynamic network analyses should minimally include discussions of one or more of the following: nodes and/or edges, suboptimal communication pathways, community structures, correlations, etc. If this detail about dynamic network analysis remains, there needs to be an explanation of what the approach is (explicit details in the Methods section), what information was generated for their trajectories and if possible, figures showing exactly what was extracted. As it stands now, all that is present are these distance plots and the density representations, which are informative but not dynamic networks. See https://doi.org/10.1073/pnas.0810961106 as a reference.</p><p>2. The docking study with biapenem is a weakness of this work. Because this part relies on docked and not crystal structures, the premise is tenuous to begin with. The fact that the small molecules fly out by 40 ns even in the best case is not reassuring that there is real binding. The most convincing way to use MD to make this point would be to use the crystal structure with the T203 at both sites as a starting point. My strong recommendation would be to remove this portion of the study or strengthen the work significantly by repeating the study with T203 and seeing whether the previously observed cooperativity persists.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.73055.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential revisions:</p><p>1) Please include details of the molecular dynamics simulations so that reviewers can assess their rigor. 2 reviewers mentioned that the 100 ns trajectories used in the simulations might not be sufficient to reveal real conformational dynamics. Please address by increasing the trajectories.</p></disp-quote><p>As per the suggestions, an additional 200 ns of MD simulations have been performed along with a dynamic network analysis of selected pair of catalytic site residues in the YkuD domain to consolidate the results with the experimental data. The details of the MD simulations have also been added in the Materials and methods.</p><p>– New Figure 3A contains a snapshot of trajectory at 200 ns for wild-type and mutant.</p><p>– New Figure 3B and Figure 3—figure supplement 1 show distance network analysis of selected pair of residues for 200 ns of MD simulations.</p><p>– We have also provided new Figure 3-source data 1 and Figure 3-source data 2 to support new Figure 3.</p><disp-quote content-type="editor-comment"><p>2) Please provide parameters used for the docking studies.</p></disp-quote><p>We have provided parameters that were used in the docking studies.</p><disp-quote content-type="editor-comment"><p>3) Please present binding data for β-lactam binding to the S-pocket in protein with active-site mutations.</p></disp-quote><p>Additional mutations have been performed in active-site residues as well as S-pocket to strengthen the data on f ß-lactam binding to the S-pocket.</p><p>– New Figure 4B along with source data 5 has been added that represent data on the rate of ß-lactam acylation (K<sub>obs</sub> [50µM]/s<sup>-1</sup>) with various S-pocket and active-site mutants.</p><p>– New Figure 4C shows a graph with change in melting temperature (∆Tm) verses increasing concentration of ß-lactam drug. The data represents ß-lactam binding studies with several S-pocket (R209E, E207A, Y330F) and active-site mutants (S351A, H336N and C354A). A new Figure 4 – source data 1 supports Figure 4C.</p><p>– New Figure 4D contains ThermoFluor data on differential fluorescence change (-dF/dT) verses ß-lactam drug concentrations. A new Figure 4 – source data 1 supports Figure 4D.</p><disp-quote content-type="editor-comment"><p>4) Please provide additional data investigating the importance of other residues (E168, R371, Y330 and A171, M157 and L391) in the S-pocket to bolster the data with R209.</p></disp-quote><p>To investigate the importance of S-pocket in PG-moiety binding, additional binding studies of N-Acetylmuramyl-L-alanyl-D-isoglutamine have been performed with S-pocket mutants E207A and Y330F to bolster data with R209E mutant.</p><p>– New Figure 1B shows a ThermoFluor data with change in melting temperature (∆Tm) verses increasing concentration of PG-moiety. Data represents PG-moiety binding studies with different S-pocket mutants (R209E, E207A, Y330F).</p><p>– New Figure 1C contains ThermoFluor data on differential fluorescence change (-dF/dT) verses PG-moiety concentrations. A new Figure 1 – source data 1 supports Figure 1C.</p><disp-quote content-type="editor-comment"><p>Reviewer #1 (Recommendations for the authors):</p><p>The structures of LdtMt2 have been published before, both as apo and in complex with a β-lactam molecule. The current structures report on a novel allosteric site that was not previously described.</p><p>Figure 2A should be moved to Figure 1.</p></disp-quote><p>We appreciate the suggestion from the reviewer on moving Figure 2A to Figure 1. However, Figure 2A supports the experimental data in Figure 2B. Both figure 2A and 2B can make it easy for the readers to review several domains in Ldt<sub>Mt2</sub> and correlate with experimental results on ß-lactam hydrolysis activity. We have also put one additional Figure 2C on Circular dichroism (CD) spectra of R209E mutant and Wild-type to rule out any major secondary structural changes that could impact the ß-lactam hydrolysis activity of the enzyme.</p><p>– New Figure 2B contains ß-lactam hydrolysis data for all truncated domains and mutations in S-pocket into one single figure. A new Figure 2 – source data 1 supports Figure 2B.</p><p>– New Figure 2C contains CD spectra of wild-type and R209E mutant.</p><disp-quote content-type="editor-comment"><p>The structures in Figure 1C (purple and green) that are superimposed do not look superimposed. No quantitative measure (RMSD) is provided. What parts of the structure were superimposed? Perhaps a sequence alignment between LdtBS and LdtMt2 might explain this better. Further qualitative analysis of the inner cavity should be carried out. The electrostatic surface should be shown for both proteins and how the corresponding electrostatic surface of the PG complements it should be illustrated.</p></disp-quote><p>With suggestion from the reviewer #1, we again superposed the catalytic domain of Ldt<sub>BS</sub> with YkuD domain of Ldt<sub>Mt2</sub> and these domains superposed with an RMSD of 1.46 Å. Ldt<sub>BS</sub> has a LysM domain that is missing in the Ldt<sub>Mt2</sub> structure. In the Ldt<sub>BS</sub> structure, the acidic sugar moieties of PG chain bind in-between the LsyM domain and catalytic domain across a positively charged groove. Based on the structural details of PG binding in Ldt<sub>BS</sub> (Schanda <italic>et al.</italic>, 2014) and Ldt<sub>Mt2</sub> (Figure 1A), a PG chain was computationally placed over a positively charged surface across the IgD2-YkuD domain interface encompassing the S-pocket. The positively charged electrostatic surface of Ldt<sub>BS</sub> and Ldt<sub>Mt2</sub> have been illustrated that binds PG chain.</p><p>– New Figure 1D shows superposition of catalytic domains of Ldt<sub>Mt2</sub> (green) and Ldt<sub>BS</sub> (pink)<sub>.</sub></p><p>– New Figure 1E shows the structures of Ldt<sub>BS</sub> and Ldt<sub>Mt2</sub> with their surface charge representation and with proper labeling of their domains to highlight the structural differences between them.</p><disp-quote content-type="editor-comment"><p>Dynamic distances between important residues (H336-C354, H336-S351, H336-S337, etc.) over the course of the simulation should be plotted to support the claims that the authors make.</p></disp-quote><p>An additional work on MD simulation at 200 ns has been performed. Network analysis has also been performed to search allosteric changes in Ldt<sub>Mt2</sub> that could emanate from the S-pocket (Figure 3, and Figure 3—figure supplement 1).</p><p>Addressed in response to essential revision# 1</p><disp-quote content-type="editor-comment"><p>One of the strengths of this paper is the finding that S351 and not S337 might form the catalytic triad. The authors should strengthen this by quantifying structural interactions that support mutagenesis experiments. A wealth of data is present in the MD simulations; they should use this to their advantage.</p></disp-quote><p>A new data on network analysis of MD at 200 ns has been added to further understand the role of S351 and its modulation by the allosteric network (Figure 3B and Figure 3—figure supplement 1).</p><p>Our experimental and MD results at 200 ns followed by network analysis have clearly demonstrated new findings on the role of S351 in the catalysis that can be influenced by S-pocket (Figure 3 and Figure 3—figure supplement 2). However, new investigations with 200 ns MD data suggest that S337 may not be replaced by S351 in the catalytic triad. Instead, S351 residue is a new residue we have identified that can stabilize the H336-NE1 through hydrogen bond interactions. We have changed our statement in the main-text about S351 role in the catalytic triad. We highlight the important role of S351 in the process of catalysis through interactions with H336-NE1 that can be modulated by allostery. Based on our current level of computational results, we do not think the replacement of S337 by S351 in the catalytic triad, rather, both of these residues seem to be important for the catalytic center, A deeper computational study will be required to investigate the roles of S337 and S351 in catalytic process. However, our results clearly demonstrate the role of S351 in interaction with H336 in the catalytic process and this information is very new and pave the way for more independent investigational studies in future.</p><p>Addressed in response to essential revision# 1</p><disp-quote content-type="editor-comment"><p>Since there are other structures of mutants of LdtMt2 present, why did the authors not try to crystallize R290E and other mutants? The structural findings would have been definitive in assessing the structural differences between the apo and ligand-bound states. A comment should be made in the discussion.</p></disp-quote><p>We had tried several attempts to crystallize R209E mutants but were unsuccessful.</p><p>Based on the new data on MD simulations and network analysis and the crystal structure with an experimental carbapenem drug T203, we have provided strong evidence on the existence of allosteric propagation between the S-pocket and catalytic site that regulates enzyme function (Figure 3 and Figure 3—figure supplement 1) and Figure 6D. MD data and the high-resolution crystal structure data are matching on allosteric propagation between S-pocket and catalytic site.</p><p>On the advice of the reviewer#, we have added a new comment in the discussion:</p><p>“This study provides a high-resolution crystal structure of Ldt<sub>Mt2</sub> with an experimental carbapenem T203 that can be the basis for understanding structure-activity relationship (SAR) data on ß-lactam binding in the S-pocket and catalytic site. Insights gained from this analysis may guide the acquisition and/or the design and synthesis of new inhibitors. Additional structural and computational studies of the S-pocket and catalytic mutants will be required to gain a more detailed understanding of the catalytic process and ß-lactam binding that can be modulated by the S-pocket”.</p><disp-quote content-type="editor-comment"><p>The manuscript relies heavily on MD simulations to structurally explain a number of experimental observations. The computational study is an essential part of the manuscript, yet it seems to be carried out like an afterthought. MD simulations analysis is poorly carried out. The details in the method section for both automated docking and MD simulations are poor and lack details to reproduce the study. For example, How were the ligands parameterized? No evidence has been provided which even remotely suggests that the simulated system has been equilibrated, let alone converged. How many simulations were run to confirm the observations were statistically significant? The interpretations of the results are equally perplexing. The tumbling of the ligand in the binding site is because the system has not equilibrated and should be omitted from being included in any interpretation (line 334-335). 100ns might be too short for the essential interactions to stabilize. If the authors think otherwise, they should support that with evidence. None of that has been included. MD simulation figures in the supplementary are poor and do not provide any information that strengthens the excellent biochemical analysis and mutagenesis experiments. The MD simulation figures in Supplementary are not even labeled appropriately.</p></disp-quote><p>Based on the advice, line 334-335 has been edited to avoid over-prediction with the current level of MD data on biapenem binding.</p><p>We have provided additional data as an alternative to represent S-pocket binding. Our experimental results with additional mutations in the catalytic site and S-pocket bolster the data on PG-substrate and ß-lactam binding in S-pocket. This additional mutational data clearly demonstrates the relationship between S-pocket and catalytic site during ß-lactam binding (Figure 1B and 1C; Figure 4C and D).</p><p>We have also provided a more detailed network analysis of MD results that matches with the results of crystal structure data on allosteric propagation (Figure 3B and Figure 3—figure supplement 1)</p><p>(Kindly see response to essential revision# 3 and essential revision# 4).</p><p>We have used MD simulation to further understand and illustrate biapenem binding in both S-pocket and catalytic site (Figure 4E). What have tied to convey through the MD simulations whether the binding of biapenem in S-pocket alone and/or the catalytic site would show any level of cooperativity to support our experimental results. A drug alone in the S-pocket or catalytic pocket is not able to stay for long and moves out within 40ns. However, simultaneous ß-lactam drug binding in both the S-pocket and catalytic pocket certainly delays the exit of biapenem from the S-pocket and stabilizes the drug in catalytic site. We have properly labelled the MD time in figure 4E to understand biapenem binding with MD simulation time. We have also properly labeled Figure 4—figure supplement 1; Figure 4—figure supplement 2 and Figure 4—figure supplement 3.</p><disp-quote content-type="editor-comment"><p>Why have the dynamics of R209 not been discussed? If the allosteric signals are indeed emanating from this residue (or any in the allosteric pocket), then surely a direct link could be traced between R209 (or other residues) and the catalytic triad? A network analysis should be able to resolve this. Or some equivalent method that demonstrates this structural link.</p></disp-quote><p>With advice from the reviewer, we have performed dynamic network analysis to identify allosteric changes that propagate between S-pocket and catalytic site (Figure 3B and Figure 3—figure supplement 1). We find that these allosteric changes that were computed in the network analysis of MD data match with the allosteric changes that were observed in the crystal structure (Figure 6D).</p><p>We have added new results on network analysis in the manuscript.</p><disp-quote content-type="editor-comment"><p>Line 342/344/346: There is no Figure S4A or S4B. Just S4</p></disp-quote><p>This was a typo. They were actually new Figure 4—figure supplement 3A and Figure 4—figure supplement 3B</p><disp-quote content-type="editor-comment"><p>Line 347-350: &quot;Thus, MD simulations suggest that biapenem binding across the S-pocket surface imposes stability in fluctuations of β-lactam movement in the catalytic site and the.-lactam ring carbonyl group maintains a close distance with the Sϒ atom of C354 that favor a nucleophilic attack&quot;</p><p>It might very well be that this is indeed the case. But without evidence from MD simulation, it seems like they are an over-interpretation of results.</p></disp-quote><p>Based on the advice, line 347-350 has been edited to avoid over-prediction with the current level of MD data on biapenem binding.</p><disp-quote content-type="editor-comment"><p>The docking protocol was baffling. When the authors have a crystal structure with a ligand, then what was the reason they did not carry out a template-based docking? Surely, the β-lactam ring in T203 could have been used as a fixed focal point. Yet, they even dock T203. If the authors were trying to do a blind dock to confirm the binding mode of T203 (because of the poor electron density), then they should say so and also show the results of the dock, superimposed on the crystal structure. No such thing has been detailed in the method or discussion.</p></disp-quote><p>Blind docking around the catalytic site (within 60 Å radius) was performed to rule out any biasness in docking results influenced by the experimental data. We have added the docking details in the Materials and methods.</p><p>Kindly see response to essential revision# 3.</p><p>The crystal structure of Ldt<sub>Mt2</sub> in complex with experimental carbapenem T203 was solved later after discovering the S-pocket and all docking studies with ß-lactams. We have added a new figure (Figure 6—figure supplement 1E) on the superposition of T203 drug from docking result (green colour) with T203 drug from crystal structure (pink colour).</p><disp-quote content-type="editor-comment"><p>The authors mention that the electron density of T203 is poor. Therefore in addition to 2Fo-Fc maps, they should also include omit maps. This will only strengthen their claim of how they have modeled the ligand in the sites.</p></disp-quote><p>Fo-Fc omit map in both S-pocket and catalytic pocket have been calculated and are shown in new Figure 6—figure supplement 1A and 1B.</p><disp-quote content-type="editor-comment"><p>Line 449: What was this distance measured between? Which residues or atoms?</p></disp-quote><p>Distance of catalytic residue C354 with several residues in the S-pocket was measured (R209E, P169, A171 and others) and an average came to ~21 Å distance.</p><disp-quote content-type="editor-comment"><p>Line 452-453: &quot;Mutational changes in the S-pocket or the catalytic pocket nullifies all the allosteric communications that are otherwise important in the cooperative binding of dual ß-lactams.&quot; How is this structurally achieved between the two sites that are far apart? The authors should use network analysis to resolve this?</p></disp-quote><p>A new data on network analysis (kindly see new Figure 3 and Figure3—figure supplement 1) and crystal structure with T203 (Figure 6) highlight the details of allosteric propagation and changes in the catalytic center.</p><p>Kindly see response to essential comment#1</p><disp-quote content-type="editor-comment"><p>Line 471-472: There is surely a mechanism of allosteric communication, its just that the authors have not provided evidence for that. What the authors have shown is the end states in either the allosteric site or the catalytic site, but not how signals would be communicated upon ligand binding in the allosteric site to the catalytic site.</p></disp-quote><p>We have provided new evidence on the network of allosteric propagation in ldt<sub>Mt2</sub> by analyzing MD data at 200 ns (Figure 3B and Figure 3—figure supplement 1). These results match with the allosteric changes observed in the crystal structure with T203 drug (Figure 6D).</p><p>We have added a new paragraph on network analysis in the result section.</p><p>Also, in the discussion, we have added a new line</p><p>“Additional structural and computational studies of the S-pocket and catalytic mutants will be required to gain a more detailed understanding of the catalytic process and ß-lactam binding that can be modulated by the S-pocket”.</p><disp-quote content-type="editor-comment"><p>Line 479: Why have the properties (structural or sequence) have not been shown for the putative S-pocket. A close-up (structural superimposition of conserved residues) or sequence alignment should have been presented. Perhaps figures of electrostatic charge surface would convey the point the authors are trying to make. Figure 8 is the least informative as it currently stands.</p></disp-quote><p>A new figure, Figure 7—figure supplement 1F, has been added. A closeup of S-pocket residues are shown for different LDTs in <italic>Mycobacterium tuberculosis</italic>.</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>1. After modeling glucose into the S-pocket, authors propose R209, E168, R371, Y330 and A171, M157 and L391 as residues interacting with the sugar. However only a single mutation (R209E) disrupts binding of the PG precursor. The identification of only a single mutation is strange, because for a bonafide binding site, there should be at least &gt; 1 residue which can disrupt binding. Because other mutations are not reported that disrupt binding at S-pocket, there is not strong evidence that the S-pocket is an actual site for binding ligands. This poses an important question: is it possible that R209E affects Ldt-Mt2 function by just disrupting the IgD2-YkuD domain interface and subsequently destabilizes the active site? To confirm that the S-pocket is actually a distinct site that binds ligand and allosterically regulates the active site, there needs to be evidence that R209E does not merely disrupt dimerization of the two domains. The majority of the case for the existence of this pocket hinges on functional studies with R209E, therefore this possibility should be ruled out.</p></disp-quote><p>Following the suggestions from reviewers#2, we have performed additional mutations in the S-pocket to bolster the data on PG moiety.</p><p>Addressed in response to essential revision# 4.</p><p>In addition, to rule out any effect of R209E mutation on the secondary structure of Ldt<sub>Mt2</sub>, we performed CD spectra. CD spectra did not suspect any alteration in the secondary structure of the enzyme upon R209E mutation in the S-pocket. (Kindly see new Figure 2C).</p><disp-quote content-type="editor-comment"><p>2. Authors have extracted quite a bit of mechanistic detail from their simulations, including demonstrating cooperativity between the two sites. However authors should be cautious, because 100 ns trajectories are not long enough to give meaningful information about fluctuations or persistence of conformations. For a protein with 450 residues, my sense is that the trajectories are barely equilibrated at 100 ns. However RMSDs over the trajectory can be shown to give some indication of how overall structure is changing between 0 and 100 ns. This will help the authors determine whether the changes in active site residues that they report can be expected to persist over longer timescales. One suggestion to achieve longer trajectories: authors could truncate the complex to just the two domains of interest, which might allow increased simulation time to further support these claims.</p></disp-quote><p>In full agreement with reviewer#2, we have performed additional MD simulation at 200 ns with 2 domains only (IgD2-YkuD).</p><p>A new paragraph has been added on network analysis in the Results section.</p><p>Addressed in response to essential revision# 1.</p><disp-quote content-type="editor-comment"><p>This is a potentially exciting piece of work. To make this suitable for publication, authors must provide a little more evidence that the S-pocket is a site that binds ligand. For both ligands modeled into electron density, the observation of only small fragments of these ligands casts doubt on the veracity of their binding. Likewise, the identification of only a single mutation that disrupts S-pocket is not sufficient to support binding.</p><p>Additionally, for some of the claims being made using docking and MD simulations, particularly those of cooperativity and pocket cross-talk, authors have not demonstrated that their trajectories are long enough to extract these conclusions. Evidence should be provided to test equilibration and confirm that the key interactions/conformational changes presented here will persist in longer simulations. Alternatively, authors could add additional experimental validations to demonstrate cooperativity between the two sites.</p></disp-quote><p>We have performed additional MD at 200 ns followed by network analysis to discovery allosteric propagation. These results match with the allosteric changes observed in the high-resolution crystal structure with an experimental carbapenem T203. (Figure 3 and Figure 3—figure supplement 1).</p><p>As an alternative, we have performed additional mutations in the S-pocket and catalytic center to further bolster claim in Biapenem binding in S-pocket and catalytic site in cooperativity (Figure 1 and Figure 4).</p><p>Addressed in response to essential revision# 1, essential revision# 3 and essential revision# 4</p><disp-quote content-type="editor-comment"><p>Reviewer #3 (Recommendations for the authors):</p><p>Abstract: the first sentence suggests that only M. tuberculosis has Ld transpeptidases, which is incorrect. Please edit this accordingly. The site termed 'S-pocket' on Line 42 is referred to as 'S-site' on line 45; please adopt a consistent terminology.</p></disp-quote><p>With the suggestion from reviewer#3, first line of the abstract has been changed to “L,D-transpeptidase function predominates in atypical 3 – 3 transpeptide networking of peptidoglycan (PG) layer <italic>in Mycobacterium tuberculosis</italic>.”</p><p>Also, S-pocket has been referred consistently.</p><disp-quote content-type="editor-comment"><p>Introduction: although it is well-written, I do not think the summary of the paper (Lines 149-155) accurately reflect the results of the paper. In my view, the results on β-lactams and not peptidoglycan are the significant portion of the paper. Also, claims such as 'several interdisciplinary approaches' and 'explain the mechanism for the manifestation of activity of Ldtm2' are not completely supported, since the authors uncover an additional facet of the functioning of the enzyme. These sentences should be tempered.</p></disp-quote><p>We are highly grateful to the reviewers#3 for these suggestions. We have made changes in the last sentence of introduction.</p><disp-quote content-type="editor-comment"><p>Line 161: it is not clear whether the crystal structure at 1.57A is an improvement on previous efforts and whether this improved resolution is what enables the authors to discover the glucose binding in the S-pocket. The text should be re-written to make these points clear.</p></disp-quote><p>As per the advice from reviewer#3, a new sentence has been added</p><p>“This high-resolution crystal structure was an improvement of our previous efforts (Erdemli <italic>et al.</italic>, 2012; Kumar <italic>et al.</italic>, 2017) that enabled us to identify an electron density in a pocket”</p><disp-quote content-type="editor-comment"><p>Figure 1B: comparable data for glucose would help the readers assess the strength of the conclusions regarding PG. In this panel, and in similar panels in other figures, it is not clear if the trend is significant. Could the authors show error bars for such figures, and perhaps include a plot of Tm vs. substrate concentration in the inset to highlight the trend better?</p></disp-quote><p>With suggestions from reviewer#3, a ∆Tm vs substrate concentration plot has been placed in new Figure 1B<bold>.</bold></p><p>Additional mutations have been done in the S-pocket to bolster the data on PG-sugar moiety binding with S-pocket.</p><p>Kindly see response to essential revision# 4.</p><disp-quote content-type="editor-comment"><p>Figure 1D: the inner and outer cavity in the catalytic site that is discussed in the text is not labelled in the figure, and so it is hard to appreciate the location of the larger pentameric PG molecule. Furthermore, the authors could show Thermofluor data for a suitable point-mutant in the inner cavity to confirm their claims that the PG molecule can be located within the S-pocket and the inner cavity and complement the data in Figure 1B.</p></disp-quote><p>With suggestions from reviewer#3, inner and outer pocket of catalytic have been properly labeled in Figure 1E.</p><p>In our understanding, mutation in the inner pocket would not affect the binding of PG-sugar moiety at S-pocket. Only the stem peptide of PG chain would bind the inner pocket. We lack a full native PG substrate that could bind both S-pocket and inner pocket in one go. That is why we choose Biapenem for our study that could bind both S-pocket and catalytic site.</p><p>We have a line in the discussion “prior to 3-3 transpeptide linkage, both S-pocket and catalytic site may work in cooperativity to facilitate synchronous binding of two PG substrates (donor and acceptor substrates); however, this requires experimental validation using nascent PG substrates that are beyond the scope of our study<bold>”.</bold></p><p>As we lack a native substate for studying the catalysis and allostery, that is why we choose ß-lactam for observing the catalytic activity.</p><p>The location of inner peptide has been reported in earlier studies and this pocket is supposed to bind the acceptor stem peptide of PG (Erdemli et al., 2012). Structure of PG with Ldt<sub>BS</sub> further supports our modeling study for PG stem binding in inner pocket.</p><disp-quote content-type="editor-comment"><p>Lines 200-205: it is unclear what the phrases 'deletion of IgD2 from the YkUD domain as assessed from the YkuD domain alone' means. At Line 205, the S-pocket is described as being carried by the IgD2 domain but</p></disp-quote><p>Based on the point noticed by the reviewer, we have made a small change in the sentence</p><p>“This suggests an important role of S-pocket which is partly carried by the IgD2 domain in governing the catalytic activity of Ldt<sub>Mt2</sub> enzyme”.</p><disp-quote content-type="editor-comment"><p>Lines 271-273: while I do not disagree qualitatively with the descriptions, there is clearly a large shift in Tm at the lowest concentration of bioapenem, which is not reflected in the text.</p></disp-quote><p>In response to reviewer#3, we have added new data on biapenem binding with Ldt<sub>Mt2</sub> and mutants that clearly reflects a saturable binding in the S-pocket. A new Figure 4D has been added.</p><p>Kindly see response to essential revision# 3.</p><disp-quote content-type="editor-comment"><p>Line 304: in contrast, the decreased stability of the S351A mutant has nothing to do with the biapenem binding – the statement describing this is misleading, Please revise this.</p></disp-quote><p>With reviewer’s advice, the sentence has been removed.</p><disp-quote content-type="editor-comment"><p>Figure 4B: based on the statements in the text, the effect of biapenem binding on melting structure is completely abroagated by the R209E and S351A mutations, yet the graphs show red arrows for the change in Tm. Please remove these if the trend is non-significant.</p></disp-quote><p>T<sub>m</sub> arrows have been removed from S351, R209E and other mutants.</p><disp-quote content-type="editor-comment"><p>Figure 4C: given the content-rich format of eLife, the authors should provide animations of the simulations they describe, which would be far more informative than the snapshots presented.</p><p>Figure presentation: in many figures, the red arrow labels are hard to see. Please make the arrows bigger.</p></disp-quote><p>Arrows have been marked bigger in new Figure 4E (this corresponds to earlier Figure 4C). Figures have been properly labeled properly.</p><disp-quote content-type="editor-comment"><p>Figure 6 and last section of the Results: the motivation for studying in detail the molecule T203 is unclear. Is it because it has the most dramatic effects based on the results of Figure 5? The authors should cite relevant publications for this drug and include in the discussion how such a finding on an experimental carbapenem may be beneficial, as this is a strength of this manuscript.</p></disp-quote><p>We have added the reference for experimental carbapenem T203 in the results, (Pankaj Kumar et al., <italic>Nature Chemical Biology</italic>, 2017).</p><p>With suggestion from reviewer, we have added a new sentence in the discussion</p><p>“This study provides a high-resolution crystal structure of Ldt<sub>Mt2</sub> with an experimental carbapenem T203 that can be the basis for understanding structure-activity relationship (SAR) data on ß-lactam binding in the S-pocket and catalytic site. Insights gained from this analysis may guide the acquisition and/or the design and synthesis of new inhibitors. Additional structural and computational studies of the S-pocket and catalytic mutants will be required to gain a more detailed understanding of the catalytic process and ß-lactam binding that can be modulated by the S-pocket.”</p><disp-quote content-type="editor-comment"><p>Figures and figure legends: many methodological details e.g., the software used for the curve fitting can be moved to the Materials and methods and do not need to be repeated for every figure.</p></disp-quote><p>The changes have been made accordingly.</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><disp-quote content-type="editor-comment"><p>The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:</p><p>1) S-pocket: R209 continues to be the only residue with a significant impact on ligand binding/catalysis. Y330 was used as a second proxy for the S-site, but its effect is much more muted than R209 or E207. The data with E207A, while not comprehensive (e.g. nitrocefin hydrolysis), does support the S-site more than data with Y330F – please note this.</p></disp-quote><p>Nitrocefin hydrolysis assay has also been performed with E207A mutant to compare with wild-type. We have provided new Figure 2 —figure supplement 1 to support Figure 2.</p><disp-quote content-type="editor-comment"><p>2) The CD spectra of wt vs R209A show some differences ~ 210 nm that could be explained by reduced β-sheet content in the spectrum of the variant protein. Such a change could indicate problems with the protein fold that might account for the differences in catalytic activity. Can the spectra be fit to determine whether this difference is meaningful? This will bolster the data suggesting that R209 forms part of an allosteric site.</p></disp-quote><p>We have added a new explanation about the CD spectra data in the manuscript. Several of the experiments in the manuscript, including: (a) CD spectra, (b) ThermoFluor and (c) Molecular dynamic simulations suggest no major change in overall folding of the protein due to R209E mutation.</p><disp-quote content-type="editor-comment"><p>3) Cooperativity between the catalytic site and the active site: there is no clear evidence that cabapenam binding occurs cooperatively. In the absence of a quantitative assessment of cooperativity, it might be best to state that this is a possibility rather than a phenomenon that has been determined.</p></disp-quote><p>With the suggestions from editor, we have made necessary changes in the statement on cooperativity. However, with a new data on MD simulations of the Ldt<sub>Mt2</sub>-T203 crystal structure (Video 1, Video 2 and Figure 6 —figure supplement 2 are provided), a cooperativity in dual ß-lactam binding is clearly evident that has been explain in the last paragraph of the Results.</p><disp-quote content-type="editor-comment"><p>4) The binding of T203 to the active site is clear, but the 2Fo-Fc map shows low occupancy at the S-site. Were greater concentrations of the drug used? IF so, do those data reveal improved occupancy at the S-site?</p></disp-quote><p>In our study with crystallization of Ldt<sub>Mt2</sub> with carbapenems, including T203, we have gone up to 6mM concentration, but could never improve the occupancy in S-pocket. However, our MD simulation data with Ldt<sub>Mt2</sub>-T203 clearly explains that binding of T203 in the S-pocket is influenced by the binding in catalytic pocket (Video 1, Video 2 and Figure 6 —figure supplement 2). T203 drug does not bind alone in the S-pocket.</p><disp-quote content-type="editor-comment"><p>Additionally, the comments below were provided by a reviewer.</p><p>Reviewer #2 (Recommendations for the authors):</p><p>Ahmad et al., have addressed my largest concern, going to extra steps to make sure that other S-pocket mutations disrupt small molecule binding. This portion of the manuscript is more convincing and the discovery of the S-pocket is quite novel.</p><p>While simulations have been increased, the authors still did not address the question of equilibration or show RMSDs over the length of the trajectory to show the feasibility of extracting mechanistic details from these simulations. However, the description of the conformational differences between wildtype and mutant Ldt-Mt2 is quite compelling.</p><p>Overall, concerns still remain about the computational work.</p><p>1. Authors mention that they have computed a dynamic network analysis for their MD trajectories. There is no explanation of what this analysis means or what information it provides. The method section is not instructive about the nature of this analysis, except to say that it was performed using VMD. It is also not my understanding that this method is used to calculate 'distances', as these can be calculated directly from the trajectory. To my knowledge, dynamic network analyses should minimally include discussions of one or more of the following: nodes and/or edges, suboptimal communication pathways, community structures, correlations, etc. If this detail about dynamic network analysis remains, there needs to be an explanation of what the approach is (explicit details in the Methods section), what information was generated for their trajectories and if possible, figures showing exactly what was extracted. As it stands now, all that is present are these distance plots and the density representations, which are informative but not dynamic networks. See https://doi.org/10.1073/pnas.0810961106 as a reference.</p></disp-quote><p>We are so obliged to the reviewer for his continuous support in improving our manuscript by his critical comments.</p><p>Based on the suggestions from reviewer, network analysis has been done to identify the pathways of allosteric communications between S-pocket and catalytic site. Kindly find new Figure 3 —figure supplement 3 and Figure 3 – source data 3.</p><disp-quote content-type="editor-comment"><p>2. The docking study with biapenem is a weakness of this work. Because this part relies on docked and not crystal structures, the premise is tenuous to begin with. The fact that the small molecules fly out by 40 ns even in the best case is not reassuring that there is real binding. The most convincing way to use MD to make this point would be to use the crystal structure with the T203 at both sites as a starting point. My strong recommendation would be to remove this portion of the study or strengthen the work significantly by repeating the study with T203 and seeing whether the previously observed cooperativity persists.</p></disp-quote><p>With suggestions from the reviewer, following changes have been made in the manuscript:</p><p>a. Additional details of MD simulation with biapenem have been added in the method sections.</p><p>b. MD simulation has also been performed with LdtMt2-203 crystal structure to identify the cooperativity in dual ß-lactam binding. Kindly find (Video 1, Video 2 and Figure 6 —figure supplement 2).</p></body></sub-article></article>