<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.3 20210610//EN"  "JATS-archivearticle1-3-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.3"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">76940</article-id><article-id pub-id-type="doi">10.7554/eLife.76940</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Immunology and Inflammation</subject></subj-group></article-categories><title-group><article-title>Fam49b dampens TCR signal strength to regulate survival of positively selected thymocytes and peripheral T cells</article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes"><name><surname>Park</surname><given-names>Chan-Su</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-4968-8304</contrib-id><email>cpark@chungbuk.ac.kr</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund4"/><xref ref-type="other" rid="fund5"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Guan</surname><given-names>Jian</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-0118-6578</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Rhee</surname><given-names>Peter</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Gonzalez</surname><given-names>Federico</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Lee</surname><given-names>Hee-sung</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Park</surname><given-names>Ji-hyun</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Coscoy</surname><given-names>Laurent</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-7337-2345</contrib-id><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Robey</surname><given-names>Ellen A</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-3630-5266</contrib-id><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="fn1">†</xref><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Shastri</surname><given-names>Nilabh</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-8060-3025</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="fn1">†</xref><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes"><name><surname>Sadegh-Nasseri</surname><given-names>Scheherazade</given-names></name><email>ssadegh1@jh.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund2"/><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con10"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00za53h95</institution-id><institution>Department of Pathology, The Johns Hopkins University School of Medicine</institution></institution-wrap><addr-line><named-content content-type="city">Baltimore</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02wnxgj78</institution-id><institution>Department of Pharmaceutics, College of Pharmacy, Chungbuk National University</institution></institution-wrap><addr-line><named-content content-type="city">Cheongju</named-content></addr-line><country>Republic of Korea</country></aff><aff id="aff3"><label>3</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01an7q238</institution-id><institution>Department of Nutritional Sciences and Toxicology, University of California,Berkeley</institution></institution-wrap><addr-line><named-content content-type="city">Berkeley</named-content></addr-line><country>United States</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01an7q238</institution-id><institution>Department of Molecular and Cell Biology, University of California, Berkeley</institution></institution-wrap><addr-line><named-content content-type="city">Berkeley</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Malissen</surname><given-names>Bernard</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/035xkbk20</institution-id><institution>Centre d'Immunologie de Marseille-Luminy, Aix Marseille Université</institution></institution-wrap><country>France</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Taniguchi</surname><given-names>Tadatsugu</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/057zh3y96</institution-id><institution>University of Tokyo</institution></institution-wrap><country>Japan</country></aff></contrib></contrib-group><author-notes><fn fn-type="other" id="fn1"><label>†</label><p>Senior author</p></fn></author-notes><pub-date publication-format="electronic" date-type="publication"><day>19</day><month>08</month><year>2024</year></pub-date><volume>13</volume><elocation-id>e76940</elocation-id><history><date date-type="received" iso-8601-date="2022-01-10"><day>10</day><month>01</month><year>2022</year></date><date date-type="accepted" iso-8601-date="2024-07-16"><day>16</day><month>07</month><year>2024</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint at bioRxiv.</event-desc><date date-type="preprint" iso-8601-date="2022-01-18"><day>18</day><month>01</month><year>2022</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2022.01.18.476719"/></event></pub-history><permissions><copyright-statement>© 2024, Park et al</copyright-statement><copyright-year>2024</copyright-year><copyright-holder>Park et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-76940-v1.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-76940-figures-v1.pdf"/><abstract><p>The fate of developing T cells is determined by the strength of T cell receptor (TCR) signal they receive in the thymus. This process is finely regulated through the tuning of positive and negative regulators in thymocytes. The Family with sequence similarity 49 member B (Fam49b) protein is a newly discovered negative regulator of TCR signaling that has been shown to suppress Rac-1 activity in vitro in cultured T cell lines. However, the contribution of Fam49b to the thymic development of T cells is unknown. To investigate this important issue, we generated a novel mouse line deficient in Fam49b (Fam49b-KO). We observed that Fam49b-KO double positive (DP) thymocytes underwent excessive negative selection, whereas the positive selection stage was unaffected. Fam49b deficiency impaired the survival of single positive thymocytes and peripheral T cells. This altered development process resulted in significant reductions in CD4 and CD8 single-positive thymocytes as well as peripheral T cells. Interestingly, a large proportion of the TCRγδ<sup>+</sup> and CD8αα<sup>+</sup>TCRαβ<sup>+</sup> gut intraepithelial T lymphocytes were absent in Fam49b-KO mice. Our results demonstrate that Fam49b dampens thymocytes TCR signaling in order to escape negative selection during development, uncovering the function of Fam49b as a critical regulator of the selection process to ensure normal thymocyte development and peripheral T cells survival.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>Fam49b</kwd><kwd>Rac</kwd><kwd>cytoskeleton remodeling</kwd><kwd>T cell development</kwd><kwd>negative selection</kwd><kwd>intraepithelial T cells</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Mouse</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01AI130210</award-id><principal-award-recipient><name><surname>Sadegh-Nasseri</surname><given-names>Scheherazade</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01AI121174</award-id><principal-award-recipient><name><surname>Sadegh-Nasseri</surname><given-names>Scheherazade</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R37AI060040</award-id><principal-award-recipient><name><surname>Sadegh-Nasseri</surname><given-names>Scheherazade</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100014188</institution-id><institution>Ministry of Science and ICT, South Korea</institution></institution-wrap></funding-source><award-id>RS-2023-00212022</award-id><principal-award-recipient><name><surname>Park</surname><given-names>Chan-Su</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100014188</institution-id><institution>Ministry of Science and ICT, South Korea</institution></institution-wrap></funding-source><award-id>MRC-2017R1A5A2015541</award-id><principal-award-recipient><name><surname>Park</surname><given-names>Chan-Su</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Fam49b is a critical regulator of selection process to ensure normal thymocyte development and peripheral T cells survival.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Developing T cells in the thymus follow an ordered progression from CD4<sup>-</sup>CD8<sup>-</sup> double negative (DN), to CD4<sup>+</sup>CD8<sup>+</sup> double positive (DP), and finally to CD4 or CD8 single positive (SP) T cells (<xref ref-type="bibr" rid="bib57">Xu et al., 2013</xref>). Positive selection, negative selection, and CD4/CD8 lineage fate commitment of DP thymocytes rely on the strength of the interactions between TCR and self-peptides-MHC complexes (<xref ref-type="bibr" rid="bib20">Hogquist, 2001</xref>). Inadequate interactions lead to ‘death by neglect’ whereas overly strong interactions lead to the elimination of thymocytes through ‘negative selection.’ Thus, only those T cells receiving a moderate TCR signal strength are positively selected and further develop into mature T cells (<xref ref-type="bibr" rid="bib20">Hogquist, 2001</xref>; <xref ref-type="bibr" rid="bib15">Gascoigne et al., 2016</xref>; <xref ref-type="bibr" rid="bib27">Klein et al., 2014</xref>). The TCR signal strength is also critical for CD4/CD8 lineage commitment. Enhancing TCR signaling in developing thymocytes favors the development of the CD4 lineage, whereas reducing TCR signaling favors the development of the CD8 lineage (<xref ref-type="bibr" rid="bib19">Hernández-Hoyos et al., 2000</xref>; <xref ref-type="bibr" rid="bib26">Kappes et al., 2005</xref>).</p><p>While the majority of thymocytes bearing high-affinity TCR for self-peptide MHC complexes undergo negative selection, not all self-reactive thymocytes follow this rule. Instead, these subsets of self-reactive non-deleting thymocytes are diverted to alternative T cell lineages through a process known as agonist-selection (<xref ref-type="bibr" rid="bib4">Baldwin et al., 2004</xref>; <xref ref-type="bibr" rid="bib48">Stritesky et al., 2012</xref>). Several agonist selected T cell subsets have been defined including the CD8αα<sup>+</sup>TCRαβ<sup>+</sup> intraepithelial lymphocytes (CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs), invariant natural killer T cells (iNKT cells), and Foxp3<sup>+</sup> Regulatory T cells (Treg cells) (<xref ref-type="bibr" rid="bib31">Lambolez et al., 2007</xref>; <xref ref-type="bibr" rid="bib28">Kronenberg and Gapin, 2002</xref>; <xref ref-type="bibr" rid="bib22">Hsieh et al., 2012</xref>). Functionally, agonist-selected T cells are thought to have a regulatory role in the immune system.</p><p>Actin cytoskeleton dynamics are important for multiple aspects of T cell function, including TCR signaling and adhesion, migration, differentiation, and execution of effector function (<xref ref-type="bibr" rid="bib9">Burkhardt et al., 2008</xref>; <xref ref-type="bibr" rid="bib29">Kumari et al., 2014</xref>; <xref ref-type="bibr" rid="bib6">Billadeau et al., 2007</xref>). In particular, actin cytoskeleton remodeling is required to provide scaffolding for TCR signaling proteins and for maintaining a stable immunological synapse between T cells and antigen-presenting cells (APCs) (<xref ref-type="bibr" rid="bib25">Kaizuka et al., 2007</xref>; <xref ref-type="bibr" rid="bib2">Babich et al., 2012</xref>; <xref ref-type="bibr" rid="bib3">Babich and Burkhardt, 2013</xref>). However, the mechanisms that link actin cytoskeleton dynamics to the T cell signaling are not well understood. It has been reported that T cells cytoskeletal reorganization and regulation of actin dynamics at the immunological synapse are regulated by the Rho family of small guanosine triphosphatases (Rho-GTPases) such as Rac (<xref ref-type="bibr" rid="bib9">Burkhardt et al., 2008</xref>). Most members of Rho-GTPases exist in two conformational states between inactive (GDP-bound) and active (GTP-bound) (<xref ref-type="bibr" rid="bib52">Tybulewicz and Henderson, 2009</xref>). The switch between the GDP- and GTP-bound states is tightly regulated by guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs). GEFs activate Rho-GTPases by promoting the exchange of GDP for GTP, whereas GAPs inhibit Rho-GTPases by stimulating their GTP hydrolysis activity. Vav family proteins (Vav1, Vav2, and Vav3) are GEFs for Rac. Active Rac-1 transduces signals by binding to effector proteins such as PAK and WAVE2 complex. Vav, Rac, and Pak play crucial roles in T cell development. For example, studies of mice lacking Vav-1 have shown that T cell development is partially blocked at pre-TCR β selection and is strongly blocked in both positive and negative selection (<xref ref-type="bibr" rid="bib51">Turner et al., 1997</xref>; <xref ref-type="bibr" rid="bib13">Fischer et al., 1995</xref>; <xref ref-type="bibr" rid="bib59">Zhang et al., 1995</xref>). Mice lacking both isoforms of Rac1 and Rac2 show defects in pre-TCR β-selection at DN thymocytes and positive selection of DP thymocytes (<xref ref-type="bibr" rid="bib12">Dumont et al., 2009</xref>; <xref ref-type="bibr" rid="bib18">Guo et al., 2008</xref>). Mice lacking Pak2 show defects in pre-TCR β-selection of DN thymocytes, positive selection of DP thymocytes, and maturation of SP thymocytes (<xref ref-type="bibr" rid="bib39">Phee et al., 2014</xref>).</p><p>Fam49b has been identified as an inhibitor of TCR signaling through binding with active Rac-1/2 in Fam49b-KO Jurkat T cells (<xref ref-type="bibr" rid="bib47">Shang et al., 2018</xref>). Those studies showed that lack of Fam49b led to hyperactivation of Jurkat T cells following TCR stimulation, as measured by the enhancement of CD69 induction, Rac-PAK axis signaling, and cytoskeleton reorganization (<xref ref-type="bibr" rid="bib47">Shang et al., 2018</xref>). Since TCR signaling strength controls thymocyte development, we hypothesized that Fam49b would be critical for thymocyte development in vivo and investigated this using a novel knockout mouse line. Here, we demonstrate that Fam49b is dispensable for positive selection but is required for negative selection by preventing overly robust elimination of thymocytes. Moreover, Fam49b-deficient peripheral naïve T cells showed impaired survival. Thus, we report that Fam49b is a critical regulator of negative selection and peripheral T cells survival.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Generation of Fam49b-KO mice and Fam49a-KO mice</title><p>To assess the role of Fam49b in T cell development, we generated Fam49b-KO mice by creating a premature stop codon in exon 6 of the <italic>Cyrib</italic> locus encoding Fam49b using CRISPR/Cas9 (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Fam49a is a homologous protein that is ~80% identical to Fam49b that has also been suggested to be involved in lymphopoiesis in zebrafish (<xref ref-type="bibr" rid="bib33">Li et al., 2016</xref>). We generated Fam49a-KO mice in a similar manner by creating a stop codon in exon 7 of the <italic>Cyria</italic> locus encoding Fam49a (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Immunoblot of spleen tissues confirmed that Fam49a or Fam49b expression was undetectable in Fam49a-KO mice or Fam49b-KO mice, respectively in contrast to the wild type (WT, C57BL/6 J) mice (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). Real-time RT-PCR analysis of flow cytometry-sorted WT thymocytes subsets showed Fam49b is expressed broadly throughout thymic development, whereas Fam49a was mainly expressed in mature T cells (<xref ref-type="fig" rid="fig1">Figure 1D</xref> and <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). The expression of Fam49a was not detectable in WT thymocytes (<xref ref-type="fig" rid="fig1">Figure 1D</xref>). Both Fam49a-KO and Fam49b-KO mice were fertile and did not show any apparent abnormalities.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Generation of Family with sequence similarity 49 member A (Fam49a)-KO and Family with sequence similarity 49 member B (Fam49b)-KO mice with CRISPR/Cas9 and expression of Fam49a and Fam49b in mice.</title><p>(<bold>A</bold>) Schematic diagram depicting the locations of guide RNAs (gRNAs) targeting the Fam49b (<bold>Upper</bold>). Representative Sanger sequencing chromatograms confirmed the genotype of Fam49b-KO mice (<bold>Lower</bold>). Red underline above the chromatograms indicates the deletion (5 bp) and pre-mature stop codon sequences are in red boxes. See also <xref ref-type="supplementary-material" rid="fig1sdata1">Figure 1—source data 1</xref>. (<bold>C</bold>) Immunoblot analysis of Fam49a and Fam49b expression in spleen from wild-type (WT), Fam49a-KO mice, and Fam49b-KO mice. Fam49a antibody (Sigma, SAB 1103179) is specific for an epitope mapping between amino acids 56–70 near the N-terminus of the human Fam49a molecule. Fam49b antibody (Santa Cruz, D-8) is specific for an epitope mapping between amino acids 8–20 near the N-terminus of human Fam49b molecule. The data are representative of three independent experiments. See also <xref ref-type="supplementary-material" rid="fig1sdata2">Figure 1—source data 2</xref>. (<bold>D</bold>) Immunoblot analysis of Fam49a and Fam49b expression in lymph nodes, thymus, and peripheral CD4 T cells, and peripheral CD8 T cells from WT mice. The data are representative of three independent experiments. See also <xref ref-type="supplementary-material" rid="fig1sdata2">Figure 1—source data 2</xref>.</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>Sanger sequencing for CYFIP Related Rac1 Interactor A (<italic>Cyria)</italic> and CYFIP Related Rac1 Interactor B (<italic>Cyrib)</italic>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-76940-fig1-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig1sdata2"><label>Figure 1—source data 2.</label><caption><title>Immunoblot for Family with sequence similarity 49 member A (Fam49a) (Cyria) and Family with sequence similarity 49 member B (Fam49b) (Cyrib).</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-76940-fig1-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig1-v1.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Family with sequence similarity 49 member B (Fam49b) expression in thymocyte subsets and T cells from wild-type (WT) mice.</title><p>(<bold>A</bold>) <italic>Cyrib</italic>/Fam49b mRNA expression analyzed by real-time RT-PCR of FACS-sorted subset of WT thymocytes and peripheral T cells. Data shown relative to β actin expression. Error bars denote SEM. Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig1s1sdata1">Figure 1—figure supplement 1—source data 1</xref>.</p><p><supplementary-material id="fig1s1sdata1"><label>Figure 1—figure supplement 1—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig1-figsupp1-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig1-figsupp1-v1.tif"/></fig></fig-group></sec><sec id="s2-2"><title>Defective T cell development in Fam49b-KO mice, but not Fam49a-KO mice</title><p>Flow cytometry analysis of cells isolated from lymph nodes showed that the frequency and number of peripheral CD4<sup>+</sup> T cells and CD8<sup>+</sup> T cells were significantly reduced in Fam49b-KO mice (<xref ref-type="fig" rid="fig2">Figure 2A</xref>) compared to WT and Fam49a-KO mice. Notably, the reduction in the number of CD8<sup>+</sup> T cells was greater than that of CD4<sup>+</sup> T cells. As a result, the ratio of CD4<sup>+</sup> T cells over CD8<sup>+</sup> T cells was increased in Fam49b-KO mice (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). In contrast, Fam49a-KO mice resembled WT mice in terms of T cell number and CD4/CD8 composition. To further investigate if the decrease in peripheral T cells in Fam49b-KO mice was due to defects of T cell development, we analyzed the surface expression of CD4 and CD8 on thymocytes. The frequencies and numbers of CD4 SP and CD8 SP cells were reduced and the ratios of CD4 SP to CD8 SP thymocytes were increased in Fam49b-KO mice thymi (<xref ref-type="fig" rid="fig2">Figure 2C</xref> and <xref ref-type="fig" rid="fig2">Figure 2D</xref>). These data indicate that Fam49b deficiency leads to impaired thymocyte development for both CD4<sup>+</sup> and CD8<sup>+</sup> T cells, with a more marked impact on the CD8<sup>+</sup> T cell population. In contrast, loss of Fam49a showed little, if any, impact on T cell numbers and cellularity in the periphery, or T cell thymic development. Given a lack of any phenotypic changes in Fam49a-KO mice T cells, together with an absence of Fam49a expression in the thymus (<xref ref-type="fig" rid="fig1">Figure 1D</xref>), we, therefore, focused the remainder of our studies on the Fam49b-KO mice.</p><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Reduced T cell numbers in Family with sequence similarity 49 member B (Fam49b)-KO mice, but not Family with sequence similarity 49 member A (Fam49a)-KO mice.</title><p>(<bold>A</bold>) Flow cytometry profiles of the expression of CD4 and CD8 (<bold>left</bold>) and the absolute number of lymphocytes in peripheral lymph nodes (<bold>right</bold>) from wild-type WT, Fam49a-KO, and Fam49b-KO mice. Numbers adjust to outlined areas indicate percentage of T cells among total lymphocytes. We used B220 as B cell marker. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 8 mice. ****p&lt;0.0001 (One-way ANOVA). Data are representative of four experiments. See also <xref ref-type="supplementary-material" rid="fig2sdata1">Figure 2—source data 1</xref>. (<bold>B</bold>) Ratio of CD4 T cells over CD8 T cells in spleen, peripheral lymph nodes, and mesenteric lymph node in WT, Fam49a-KO, and Fam49b-KO mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 8 mice. ****p&lt;0.0001 (One-way ANOVA). Data are representative of four experiments. See also <xref ref-type="supplementary-material" rid="fig2sdata1">Figure 2—source data 1</xref>. (<bold>C</bold>) Flow cytometry analyzing the expression of CD4 and CD8 in thymocytes. Contour plots show percentage of CD8 SP and CD4 SP in total thymocytes (<bold>upper</bold>). Percentage of TCRβ<sup>+</sup> CD8 SP in total thymocytes (<bold>lower left</bold>), and TCRβ<sup>+</sup> CD4 SP in total thymocytes (<bold>lower middle</bold>), and ratio of TCRβ<sup>+</sup> CD4 SP cells over TCRβ<sup>+</sup> CD8 SP was shown (<bold>lower right</bold>). Each dot represents an individual mouse. Small horizontal lines indicate the mean of 10 mice. ****p&lt;0.0001 (Mann-Whitney test). Data are representative of three experiments. See also <xref ref-type="supplementary-material" rid="fig2sdata1">Figure 2—source data 1</xref>. (<bold>D</bold>) Quantification of cell numbers of total thymocytes (<bold>left</bold>), TCRβ<sup>+</sup> CD8 SP (<bold>middle</bold>), and TCRβ<sup>+</sup> CD4 SP (<bold>right</bold>). Small horizontal lines indicate the mean of 10 mice. *p=0.0124 and ****p&lt;0.0001 (Mann-Whitney test). Data are representative of three experiments. See also <xref ref-type="supplementary-material" rid="fig2sdata1">Figure 2—source data 1</xref>.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig2">Figure 2</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig2-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig2-v1.tif"/></fig></sec><sec id="s2-3"><title>Fam49b-KO thymocytes initiate positive selection but fail to complete development</title><p>Successful T cell development is a combined effort of both thymocytes and thymic microenvironment such as thymic epithelial cells and cytokine production. To determine if the effect of Fam49b deficiency on thymocytes development was thymocyte intrinsic or dependent on the extrinsic thymic microenvironment, we generated bone marrow chimeras by injecting WT or Fam49b-KO CD45.2<sup>+</sup> bone marrow cells into lethally irradiated WT CD45.1<sup>+</sup> mice (B6.SJL-Ptprca Pepcb/BoyJ). A lower frequency and the number of peripheral T cells (<xref ref-type="fig" rid="fig3">Figure 3A</xref> and <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–1B</xref>) and increased ratio of peripheral CD4<sup>+</sup> T over CD8<sup>+</sup> T was observed in Fam49b-KO chimera mice compared to WT chimera mice (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). The Fam49b-KO thymocytes developed in WT thymic environment are like those developed in the germline Fam49b-KO environment in terms of both thymocyte and peripheral lymphocyte phenotypes (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2A–2C</xref>). Therefore, the effect of Fam49b mutation on T cell development is predominantly due to thymocyte intrinsic functions.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Defective thymic development in Family with sequence similarity 49 member B (Fam49b)-KO mice.</title><p>(<bold>A</bold>) Expression of TCRβ and B220 expressing cells (<bold>left</bold>) and frequency of TCRβ expressing cells among CD45.2<sup>+</sup> total lymph node cells from bone marrow chimera mice (<bold>right</bold>). Bone marrow from either wild-type (WT) or Fam49b-KO mice was injected i.v. into lethally irradiated CD45.1<sup>+</sup> WT mice and chimeric mice were analyzed 8 weeks later. Small horizontal lines indicate the mean of 7 mice. **=0.0047 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>. (<bold>B</bold>) Ratio of CD4 T cells over CD8 T cells in CD45.2<sup>+</sup> total lymph node cells from bone marrow chimera mice. Bone marrow from either WT or Fam49b-KO mice was injected i.v. into lethally irradiated CD45.1<sup>+</sup> WT mice and chimeric mice were analyzed 8 weeks later. Small horizontal lines indicate the mean of 7 mice. *p=0.0192 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>. (<bold>C</bold>) (<bold>left</bold>) Differential surface expression of CD69 and TCRβ was used to identify thymocyte population of different maturity in WT and Fam49b-KO mice. (<bold>right</bold>) Dot Plots show percentages of different thymocyte subpopulations in WT and Fam49b-KO mice. Numbers adjust to outlined areas indicate percentage of thymocytes subset among total thymocytes. Floating bars (min to max). horizontal lines indicate the mean of 12 mice. **p=0.0038 and ***p=0.0003 and ***p=0.0001 (Mann-Whitney test). Data are representative of five experiments. See also <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>. (<bold>D</bold>) Ratio of CD4 single positive (SP) cells over CD8 SP cells in TCRβ<sup>hi</sup>CD69<sup>-</sup> thymocyte subpopulation. horizontal lines indicate the mean of 12 mice. ****p&lt;0.0001 (Mann-Whitney test). Data are representative of five experiments. See also <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>. (<bold>E</bold>) (<bold>left</bold>) Differential surface expression of CD5 and TCRβ was used to identify thymocyte population of different maturity in WT and Fam49b-KO mice. (<bold>right</bold>) Dot Plots show percentages of different thymocyte subpopulations from mice. Numbers adjust to outlined areas indicate percentage of thymocytes subset among total thymocytes. Floating bars (min to max). Horizontal lines indicate the mean of 12 mice. ***p=0.0005 and ***p=0.0002 and ****p&lt;0.0001 (Mann-Whitney test). Data are representative of five experiments. See also <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>. (<bold>F</bold>) Ratio of CD4 SP cells over CD8 SP cells in TCRβ<sup>hi</sup>CD5<sup>hi</sup> thymocyte subpopulation. Small horizontal lines indicate the mean of 12 mice. ****p&lt;0.0001 (Mann-Whitney test). Data are representative of five experiments. See also <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>. (<bold>G</bold>) Frequency of TCRβ<sup>hi</sup>CD24<sup>low</sup> thymocyte subpopulation among total live thymocytes. Small horizontal lines indicate the mean of 12 mice. ****p&lt;0.0001 (Mann-Whitney test). Data are representative of five experiments. See also <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig3">Figure 3</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig3-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig3-v1.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Lower frequencies and numbers of T cells in Family with sequence similarity 49 member B (Fam49b)-KO chimera mice.</title><p>(<bold>A</bold>) Frequency of CD8 T cells (<bold>left</bold>) or CD4 T cells (<bold>right</bold>) among CD45.2<sup>+</sup> total lymph node cells from bone marrow chimera mice. Bone marrow from either wild-type (WT) or Fam49b-KO mice was injected i.v. into lethally irradiated CD45.1<sup>+</sup> WT mice and chimeric mice were analyzed 8 weeks later. Small horizontal lines indicate the mean of 7 mice. **p=0.0262 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig3s1sdata1">Figure 3—figure supplement 1—source data 1</xref>. (<bold>B</bold>) Absolute numbers of CD45.2<sup>+</sup>CD8 T cells (<bold>left</bold>) or CD45.2<sup>+</sup>CD4 T cells (<bold>right</bold>) in lymph node cells from bone marrow chimera mice. Bone marrow from either WT or Fam49b-KO mice was injected i.v. into lethally irradiated CD45.1<sup>+</sup> WT mice and chimeric mice were analyzed 8 weeks later. Small horizontal lines indicate the mean of 7 mice. **=0.0102 or 0.0114 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig3s1sdata1">Figure 3—figure supplement 1—source data 1</xref>.</p><p><supplementary-material id="fig3s1sdata1"><label>Figure 3—figure supplement 1—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig3-figsupp1-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig3-figsupp1-v1.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>Analyzing thymocytes in Family with sequence similarity 49 member B (Fam49b)-KO chimera mice.</title><p>(<bold>A</bold>) Expression of activation marker CD5 on double positive (DP), TCRβ<sup>hi</sup> CD8 single positive (SP), and TCRβ<sup>hi</sup> CD4 SP thymocytes from wild-type (WT) chimera and Fam49b-KO chimera mice (<bold>left</bold>). Geometric MFI of CD5 on DP thymocytes (<bold>right</bold>). Small horizontal lines indicate the mean of 9 mice. ****p&lt;0.0001 (Mann-Whitney test). Data are representative of two experiments. See also <xref ref-type="supplementary-material" rid="fig3s2sdata1">Figure 3—figure supplement 2—source data 1</xref>. (<bold>B</bold>) Percentage of TCRβ<sup>hi</sup> CD8 SP in total CD45.2<sup>+</sup> thymocytes (<bold>left</bold>), and TCRβ<sup>hi</sup> CD4 SP in total CD45.2<sup>+</sup> thymocytes (<bold>left</bold>) and ratio of TCRβ<sup>hi</sup> CD4 SP cells over TCRβ<sup>hi</sup> CD8 SP in total thymocytes (<bold>right</bold>) was shown from WT chimera and Fam49b-KO chimera mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 9 mice. *p=0.049 and **p=0.0034 (Mann-Whitney test). Data are representative of two experiments. See also <xref ref-type="supplementary-material" rid="fig3s2sdata1">Figure 3—figure supplement 2—source data 1</xref>. (<bold>C</bold>) Ratio of TCRβ<sup>hi</sup> CD4 SP cells over TCRβ<sup>hi</sup> CD8 SP in total thymocytes (<bold>right</bold>) was shown from WT chimera and Fam49b-KO chimera mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 9 mice. ***p=0.005 (Mann-Whitney test). Data are representative of two experiments. See also <xref ref-type="supplementary-material" rid="fig3s2sdata1">Figure 3—figure supplement 2—source data 1</xref>.</p><p><supplementary-material id="fig3s2sdata1"><label>Figure 3—figure supplement 2—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig3-figsupp2-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig3-figsupp2-v1.tif"/></fig><fig id="fig3s3" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 3.</label><caption><title>Analyzing thymic selection using TCRβ and CD69 expression in thymus.</title><p>Representative flow cytometry plot showing TCRβ and CD69 expression (<bold>left</bold>) in total thymocytes from wild-type (WT), Family with sequence similarity 49 member A (Fam49a)-KO, and Fam49b-KO mice. Numbers indicate percentage of CD4 single positive (SP) or CD8 SP (<bold>right</bold>) from TCRβ by CD69 profile gated (l<bold>eft</bold>). Data are representative of five experiments.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig3-figsupp3-v1.tif"/></fig><fig id="fig3s4" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 4.</label><caption><title>Analyzing thymic selection using TCRβ and CD5 expression in thymus.</title><p>Representative flow cytometry plot showing TCRβ and CD5 expression (<bold>left</bold>) in total thymocytes from wild-type (WT), Family with sequence similarity 49 member A (Fam49a)-KO, and Fam49b-KO mice. Numbers indicate percentage of CD4 single positive (SP) or CD8 SP (<bold>right</bold>) from TCRβ by CD5 profile gated (<bold>left</bold>). The Data are representative of five experiments.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig3-figsupp4-v1.tif"/></fig></fig-group><p>Next, we sought to determine which step of T cell development was altered in Fam49b-KO mice. We thus subdivided thymocytes into four stages based on the differential expression of TCRβ and CD69 expression (<xref ref-type="fig" rid="fig3">Figure 3C</xref> and <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>; <xref ref-type="bibr" rid="bib23">Hu et al., 2012</xref>). The proportion of stage 1 thymocytes (TCRβ<sup>lo</sup>CD69<sup>-</sup>), which include the DN and pre-selection DP cells, were similar between WT and Fam49b-KO mice. The percentage of stage 2 thymocytes (TCRβ<sup>int</sup>CD69<sup>+</sup>), which represent transitional DP undergoing TCR-mediated positive selection, were significantly higher in the Fam49b-KO mice. The proportion of late-stage thymocytes including the post-positive selection (TCRβ<sup>hi</sup>CD69<sup>+</sup>) and the mature thymocytes (TCRβ<sup>hi</sup>CD69<sup>-</sup>) were markedly decreased (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). Consistent with our observation in the periphery, increased ratios of CD4 SP to CD8 SP were observed among the late-stage thymocytes (TCRβ<sup>hi</sup>CD69<sup>+</sup> and TCRβ<sup>hi</sup>CD69<sup>-</sup>) in Fam49b-KO mice (<xref ref-type="fig" rid="fig3">Figure 3D</xref>). These data show that the post-positive-selection process is impaired in Fam49b-KO thymocytes.</p><p>We further distinguished the pre-and post-positive selection populations by expression of cell surface TCRβ and CD5 (<xref ref-type="fig" rid="fig3">Figure 3E</xref> and <xref ref-type="fig" rid="fig3s4">Figure 3—figure supplement 4</xref>; <xref ref-type="bibr" rid="bib23">Hu et al., 2012</xref>). These markers define a developmental progression: stage 1 (TCRβ<sup>lo</sup>CD5<sup>lo</sup>) represents the pre-selection phase of DP thymocytes, and Stage 2 (TCRβ<sup>lo</sup>CD5<sup>int</sup>) are cells initiating positive selection. Stage 3 (TCRβ<sup>int</sup>CD5<sup>hi</sup>) represents thymocytes in the process of undergoing positive selection, and Stage 4 (TCRβ<sup>hi</sup>CD5<sup>hi</sup>) consists primarily of post-positive selection SP thymocytes. We observed that all the early phase populations (TCRβ<sup>lo</sup>CD5<sup>lo</sup>, TCRβ<sup>lo</sup>CD5<sup>int</sup>, TCRβ<sup>int</sup>CD5<sup>hi</sup>) increased significantly in proportion in Fam49b-KO, whereas the post-positive selection SP thymocytes (TCRβ<sup>hi</sup>CD5<sup>hi</sup>) were markedly decreased (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). Similarly, an increased ratio of CD4 SP to CD8 SP was observed in the post-positive selection population (TCRβ<sup>hi</sup>CD5<sup>hi</sup>) in Fam49b-KO thymocytes (<xref ref-type="fig" rid="fig3">Figure 3F</xref>). This phenotype was further verified by the observation of lower percentage of mature SP CD24<sup>lo</sup>TCRβ<sup>hi</sup> cells in Fam49b-KO mice compared with WT mice (<xref ref-type="fig" rid="fig3">Figure 3G</xref>). Taken together, these results suggest that Fam49b plays an important role in T cells development, especially in TCRβ<sup>hi</sup>CD69<sup>+</sup> and TCRβ<sup>hi</sup>CD69<sup>-</sup> thymocytes.</p></sec><sec id="s2-4"><title>Enhanced negative selection in Fam49b-KO thymocytes</title><p>Based on our observation that the loss of Fam49b led to decreased mature thymocyte populations, together with evidence that Fam49b can negatively regulate TCR signaling (<xref ref-type="bibr" rid="bib47">Shang et al., 2018</xref>), we hypothesized that enhanced clonal deletion due to elevated TCR signaling strength would lead to the loss of positively selected thymocytes in Fam49b-KO mice. To test this hypothesis, we assessed the cleavage of caspase 3, one of the key apoptosis events during clonal deletion (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>; <xref ref-type="bibr" rid="bib8">Breed et al., 2019</xref>). In the thymus, caspase 3 is cleaved in the apoptotic cells due to either clonal deletion (i.e. negative selection) or death by neglect (i.e. failed positive selection). To distinguish between these two fates, we stained the cells for TCRβ and CD5 molecules which are upregulated upon TCR stimulation. Thus, cleaved-caspase3<sup>+</sup>TCRβ<sup>hi</sup>CD5<sup>hi</sup> cells represent thymocytes undergoing clonal deletion, whereas cleaved-caspase 3<sup>+</sup>TCRβ<sup>-</sup>CD5<sup>-</sup> cells represent thymocytes undergoing death by neglect. We observed that the frequency of cells undergoing clonal deletion was increased among Fam49b-KO thymocytes, whereas the frequencies of cells to be eliminated through death by neglect were similar between Fam49b-KO and WT mice (<xref ref-type="fig" rid="fig4">Figure 4A</xref>).</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Enhanced negative selection due to elevated T cell receptor (TCR) signaling in Family with sequence similarity 49 member B (Fam49b)-KO thymocytes.</title><p>(<bold>A</bold>) Frequency of cleaved caspase 3<sup>+</sup> cells among TCRβ<sup>hi</sup>CD5<sup>hi</sup> (Signaled, <bold>upper left</bold>) and TCRβ<sup>-</sup>CD5<sup>-</sup> (Non-signaled, <bold>lower left</bold>) thymocytes. Frequency of CCR7<sup>+</sup> cleaved caspase 3<sup>+</sup> and CCR7<sup>-</sup> cleaved caspase 3<sup>+</sup> cells among TCRβ<sup>hi</sup>CD5<sup>hi</sup> (Signaled, <bold>upper right</bold>) and TCRβ<sup>-</sup>CD5<sup>-</sup> (Non-signaled, <bold>lower right</bold>) thymocytes. Small horizontal lines indicate the mean of 21 mice. **p=0.0017 and ****p&lt;0.0001 (Mann-Whitney test). Data are pooled from three independent experiments. See also <xref ref-type="supplementary-material" rid="fig4sdata1">Figure 4—source data 1</xref>. (<bold>B</bold>) Expression of activation marker CD5 on double positive (DP), TCRβ<sup>+</sup> CD4 single positive (SP), and TCRβ<sup>+</sup> CD8 SP thymocytes from WT and Fam49b-KO mice (<bold>left</bold>). Geometric MFI of CD5 on DP thymocytes (<bold>right</bold>). Small horizontal lines indicate the mean of 6 mice. **p=0.0022 (Mann-Whitney test). Data are representative of seven experiments. See also <xref ref-type="supplementary-material" rid="fig4sdata1">Figure 4—source data 1</xref>. (<bold>C</bold>) Immunoblot analysis of TCR cascade component activation in total thymocytes from WT or Fan49b-KO mice. Total thymocytes were stimulated with soluble anti-CD3ε and anti-CD4 antibodies for the times indicated. The data are representative of three independent experiments. See also <xref ref-type="supplementary-material" rid="fig4sdata2">Figure 4—source data 2</xref>. (<bold>D</bold>) Immunoblot analysis of PAK cascade component activation in total thymocytes from WT or Fan49b-KO mice. The data are representative of four independent experiments. See also <xref ref-type="supplementary-material" rid="fig4sdata3">Figure 4—source data 3</xref>.</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig4">Figure 4</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig4-data1-v1.xlsx"/></supplementary-material></p><p><supplementary-material id="fig4sdata2"><label>Figure 4—source data 2.</label><caption><title>Immunoblot for T cell receptor (TCR) signaling.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-76940-fig4-data2-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig4sdata3"><label>Figure 4—source data 3.</label><caption><title>Immunoblot for PAK signaling.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-76940-fig4-data3-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig4-v1.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Flow cytometry gating strategies to measure clonal deletion and death by neglect.</title><p>Signaled and Non-signaled thymocytes identified by TCRβ and CD5 expression, excluding B220<sup>+</sup>, NK1.1<sup>+</sup>, TCRγδ<sup>+</sup>, CD11b<sup>+</sup>, Ly-6C<sup>+</sup>, Ly-6G<sup>+</sup>, CD25<sup>+</sup> (Dump) cells. Clonal deletion and death by neglect identified by intracellular Cleaved Caspase 3 and anatomic location identified by CCR7. Numbers indicate percentage of cells in each.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig4-figsupp1-v1.tif"/></fig></fig-group><p>Negative selection can occur in the thymic cortex as DP thymocytes are undergoing positive selection or in the thymic medulla after positive selection (<xref ref-type="bibr" rid="bib34">McCaughtry et al., 2008</xref>). To determine whether loss of Fam49b led to increased deletion in the cortex or medulla, we stained the thymocytes for CCR7, which marks medullary thymocytes and is the receptor for the medullary chemokines CCL19/21 (<xref ref-type="bibr" rid="bib8">Breed et al., 2019</xref>; <xref ref-type="bibr" rid="bib53">Ueno et al., 2004</xref>). The frequencies of cleaved-caspase3<sup>+</sup>CCR7<sup>-</sup> cells and cleaved-caspase3<sup>+</sup>CCR7<sup>+</sup> cells were significantly increased in the Fam49b-KO mice, suggesting that more thymocytes were eliminated through clonal deletion in both the cortex and medulla of Fam49b-KO thymus as compared with WT thymus (<xref ref-type="fig" rid="fig4">Figure 4A</xref>).</p><p>Next, to determine if TCR-signal strength in Fam49b-KO thymocyte was increased, we assessed the surface expression of CD5, a surrogate marker for TCR-signal strength (<xref ref-type="bibr" rid="bib50">Tarakhovsky et al., 1995</xref>; <xref ref-type="bibr" rid="bib1">Azzam et al., 1998</xref>). We found that CD5 expression was upregulated on Fam49b-KO DP thymocytes, but not on CD4 SP and CD8 SP thymocytes (<xref ref-type="fig" rid="fig4">Figure 4B</xref>), suggesting Fam49b-KO DP thymocytes had received stronger TCR signaling than the WT thymocytes. Fam49b has been identified as an inhibitor of TCR signaling via the Rac-PAK axis in Fam49b-KO Jurkat T cells (<xref ref-type="bibr" rid="bib47">Shang et al., 2018</xref>). Thus, we assess the activation of key TCR signaling cascade components in total thymocytes of WT and Fam49b-KO mice after TCR stimulation with anti-CD3ε and CD4 mAb. Fam49b deficiency led to prolonged increases in all of the downstream phosphorylation events tested, including ZAP-70, LAT, PLCγ1, and ERK (<xref ref-type="fig" rid="fig4">Figure 4C</xref>). PAK phosphorylation was also dramatically elevated in Fam49b-KO thymocytes (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). In summary, enhanced TCR-signaling strength intrinsic to Fam49b-KO DP thymocytes led to excessive clonal deletion in the cortex and medulla, resulting in the loss of naïve mature T cells in both thymus and periphery in the mice.</p></sec><sec id="s2-5"><title>Decreased survival rate of Fam49b-KO SP thymocytes</title><p>To investigate the effect of Fam49b deficiency at later stages of thymocytes development, we analyzed the surface expression of CD69 and CD62L on SP thymocytes. SP thymocytes in the thymus can be divided into immature (CD69<sup>hi</sup>CD62L<sup>lo</sup>), semi-mature (CD69<sup>lo</sup>CD62L<sup>lo</sup>), and mature (CD69<sup>lo</sup>CD62L<sup>hi</sup>) SP subpopulation (<xref ref-type="bibr" rid="bib39">Phee et al., 2014</xref>). Consistent with excessive clonal deletion in the cortex and medulla (<xref ref-type="fig" rid="fig4">Figure 4A</xref>), the absolute numbers of immature and mature CD8 SP and CD4 SP were decreased from Fam49b-KO mice (<xref ref-type="fig" rid="fig5">Figure 5A</xref> and <xref ref-type="fig" rid="fig5">Figure 5B</xref>). Expression of IL-7Rα was increased in post-positive selection DP and SP thymocytes, while most DP thymocytes down-regulate expression of IL-7Rα (<xref ref-type="bibr" rid="bib54">Van De Wiele et al., 2004</xref>). We observed that IL-7Rα expression was significantly decreased in some Fam49b-KO CD4 SP thymocytes, suggesting Fam49b deficiency could affect survival of SP thymocytes (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). To determine whether loss of Fam49b increased cell death or apoptosis in SP thymocytes, we stained the SP thymocytes for 7-AAD and Annexin V to detect apoptotic and necrotic cells. A twofold increase in cell death was observed in Fam49b-deficient immature and semi-mature SP thymocytes, whereas the frequency of dead cells detected among mature SP thymocytes was unaffected (<xref ref-type="fig" rid="fig5">Figure 5D</xref> and <xref ref-type="fig" rid="fig5">Figure 5E</xref> and <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A–1B</xref>). Our results suggest that Fam49b plays a key role in the maturation and maintenance of immature and semi-mature SP thymocytes, but not in the survival of mature SP thymocytes.</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Elevated apoptosis in Family with sequence similarity 49 member B (Fam49b)-KO single positive (SP) thymocytes.</title><p>(<bold>A</bold>) Frequencies of immature (CD62L<sup>lo</sup>CD69<sup>hi</sup>), semi-mature (CD62<sup>lo</sup>CD69<sup>lo</sup>), and mature (CD62<sup>hi</sup>CD69<sup>lo</sup>) in the TCRβ<sup>hi</sup> CD8 SP (<bold>upper</bold>) and TCRβ<sup>hi</sup> CD4 SP thymocytes (<bold>lower</bold>) from wild-type (WT) and Fam49b-KO mice. Numbers adjust to outlined areas indicate percentage of each population among total SP TCRβ<sup>+</sup> thymocytes. Shown are representative data of ten mice per genotype. (<bold>B</bold>) Quantification of cell numbers of immature and mature fraction in TCRβ<sup>hi</sup> CD8 SP thymocytes (<bold>upper</bold>) and TCRβ<sup>hi</sup> CD4 SP thymocytes (<bold>lower</bold>). Each dot represents an individual mouse. Horizontal lines indicate the mean of 10 mice. **p=0.0069 and ***p=0.0004 and ****p&lt;0.0001 (Mann-Whitney test). Data are representative of three experiments. See also <xref ref-type="supplementary-material" rid="fig5sdata1">Figure 5—source data 1</xref> (<bold>C</bold>) Decreased expression of IL-7Rα on double positive (DP), total CD4 SP, immature CD4 SP, semi-mature CD4 SP, mature CD4 SP, total CD8 SP, immature CD8 SP, semi-mature CD8 SP, and mature CD8 SP thymocytes from WT and Fam49b-KO mice. Shown are representative data of ten mice per genotype. (<bold>D</bold>) Apoptosis detected using 7AAD/Annexin V staining in freshly isolated Immature (CD62L<sup>lo</sup>CD69<sup>hi</sup>), semi-mature (CD62<sup>lo</sup>CD69<sup>lo</sup>), and mature (CD62<sup>hi</sup>CD69<sup>lo</sup>) TCRβ<sup>hi</sup> CD4 SP thymocytes from WT (<bold>upper</bold>) and Fam49b-KO mice (<bold>lower</bold>). Shown are representative data of two independent experiments. (<bold>E</bold>) Frequency of 7AAD<sup>+</sup> and Annexin V<sup>+</sup> cells among immature CD4 SP (<bold>left</bold>) and semi-mature CD4 SP (<bold>right</bold>) thymocytes from WT and Fam49b-KO mice. Small horizontal lines indicate the mean of 4 mice. **p=0.0084 and ***p=0.0004 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig5sdata1">Figure 5—source data 1</xref>.</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig5">Figure 5</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig5-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig5-v1.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Elevated apoptosis in Family with sequence similarity 49 member B (Fam49b)-KO CD8 single positive (SP) thymocytes and peripheral T cells.</title><p>(<bold>A</bold>) Apoptosis detected using 7AAD/Annexin V staining in freshly isolated immature (CD62L<sup>lo</sup>CD69<sup>hi</sup>), semi-mature (CD62<sup>lo</sup>CD69<sup>lo</sup>), and mature (CD62<sup>hi</sup>CD69<sup>lo</sup>) TCRβ<sup>hi</sup>CD8 SP thymocytes from wild-type (WT) (upper) and Fam49b-KO mice (lower). Shown are representative data of two independent experiments. (<bold>B</bold>) Frequency of 7AAD<sup>+</sup> and Annexin V<sup>+</sup> cells among immature CD8 SP (<bold>left</bold>) or semi-mature TCRβ<sup>hi</sup>CD8 SP (<bold>right</bold>) thymocytes from WT and Fam49b-KO mice. Small horizontal lines indicate the mean of 4 mice. *p=0.0478 and **p=0.0006 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig5s1sdata1">Figure 5—figure supplement 1—source data 1</xref>.</p><p><supplementary-material id="fig5s1sdata1"><label>Figure 5—figure supplement 1—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig5-figsupp1-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig5-figsupp1-v1.tif"/></fig></fig-group></sec><sec id="s2-6"><title>Lower peripheral T cell survival of Fam49b-KO OT-I CD8 T cells</title><p>To explore thymocyte development in more detail, we crossed the Fam49b-KO mice onto the OT-I TCR-transgenic strain. Based on our observation that enhanced TCR-signaling strength intrinsic to Fam49b-KO DP thymocytes leads to excessive clonal deletion in the cortex and medulla (<xref ref-type="fig" rid="fig4">Figure 4A</xref> and <xref ref-type="fig" rid="fig4">Figure 4B</xref>), we postulated that enhanced TCR-signal strength of Fam49b-KO OT-I thymocytes could be diverted into negative selection from positive selection. However, contrary to the predictions, there were no significant differences in frequencies and numbers of CD8 SP thymocytes in Fam49b-KO OT-I mice at 6 weeks (<xref ref-type="fig" rid="fig6">Figure 6A</xref> and <xref ref-type="fig" rid="fig6">Figure 6B</xref>). Numbers of total CD8 T cells and naïve CD8 T cells were, again, normal in 6 weeks old Fam49b-KO OT-I mice. Interestingly, however, the numbers of total CD8 T cells and naïve CD8 T cells were significantly decreased in Fam49b-KO OT-I mice at 12 weeks. (<xref ref-type="fig" rid="fig6">Figure 6C</xref> and <xref ref-type="fig" rid="fig6">Figure 6D</xref> and <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A</xref>). Severe T cell deficiency in the periphery of Fam49b-KO OT-I mice at 12 weeks was at odds with the similar numbers of peripheral CD8 T cells of Fam49b-KO OT-I mice at 6 weeks. We hypothesized that Fam49b may play a key role in peripheral T cell survival. To determine whether loss of Fam49b increased cell death in naïve CD8 T cells, we stained the naïve CD8 T cells for 7-AAD and Annexin V. We found that the frequency of Annexin V<sup>+</sup> 7-AAD<sup>+</sup> naïve CD8 T cells weresignificantly increased in spleen and lymph nodes from Fam49b-KO OT-I mice as well as Fam49b-KO mice (<xref ref-type="fig" rid="fig6">Figure 6E</xref> and <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1B</xref>), suggesting Fam49b deficiency promotes naïve CD8 T cells death in the peripheral. BIM/Bcl-2 balance is essential for controlling the homeostasis of naïve and memory T cells (<xref ref-type="bibr" rid="bib55">Wojciechowski et al., 2007</xref>). Therefore, we measured the expression of BIM and Bcl-2 molecules in naïve T cells and total thymocytes from WT and Fam49b-KO mice. We observed that a higher ratio of BIM/Bcl-2 is detected in naïve T cells as well as total thymocytes (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A–B</xref>). In summary, these data show that Fam49b is required for peripheral T cells survival and maintenance.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Dramatic loss of peripheral T cells, but not thymocytes, in Family with sequence similarity 49 member B (Fam49b)-KO OT-I mice with age.</title><p>(<bold>A</bold>) Flow cytometry analyzing the expression of CD4 and CD8 in thymocytes from OT-I and Fam49b-KO OT-I mice at 6 weeks of age (<bold>upper</bold>). Contour plots show percentage of DP, CD8 single positive (SP), and CD4 SP among total thymocytes. Staining with antibody to the OT-I-specific variable region Vα2 (<bold>lower</bold>). Numbers above outlined areas indicate percentage of TCR-Vα2<sup>+</sup> cells among CD8 SP thymocytes. Shown are representative data of 6–8 mice per genotype. (<bold>B</bold>) Quantification of cell numbers of TCR-Vα2<sup>+</sup> CD8 SP thymocytes from OT-I and Fam49b-KO OT-I mice at 6 weeks of age. Small horizontal lines indicate the mean of 6–8 mice. Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig6sdata1">Figure 6—source data 1</xref>. (<bold>C</bold>) Percentage of TCR-Vα2<sup>+</sup> CD8 T cells in lymph nodes from OT-I and Fam49b-KO OT-I mice at either 6 weeks (<bold>upper left</bold>) or 12 weeks (<bold>lower left</bold>) of age. Quantification of cell numbers of TCR-Vα2<sup>+</sup> CD8 T cells in peripheral lymph nodes from OT-I and Fam49b-KO OT-I mice at either 6 weeks (<bold>upper right</bold>) or 12 weeks (<bold>lower right</bold>) of age. Small horizontal lines indicate the mean of 4–8 mice. Each dot represents an individual mouse. *p=0.0173 and **p=0.0077 (Mann-Whitney test). Data are pooled from three independent experiments. See also <xref ref-type="supplementary-material" rid="fig6sdata1">Figure 6—source data 1</xref>. (<bold>D</bold>) Percentage of TCR-Vα2<sup>+</sup> CD62L<sup>+</sup>CD44<sup>lo</sup> CD8 T cells in peripheral lymph nodes from OT-I and Fam49b-KO OT-I mice at either 6 weeks (<bold>upper left</bold>) or 12 weeks (<bold>lower left</bold>) of age. Quantification of cell numbers of TCR-Vα2<sup>+</sup> CD62L<sup>+</sup>CD44<sup>lo</sup> CD8 T cells in peripheral lymph nodes from OT-I and Fam49b-KO OT-I mice at either 6 weeks (<bold>upper right</bold>) or 12 weeks (<bold>lower right</bold>) of age. Small horizontal lines indicate the mean of 4–5 mice. Each dot represents an individual mouse. *p=0.0154 or 0.0204 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig6sdata1">Figure 6—source data 1</xref>. (<bold>E</bold>) Apoptosis detected using 7AAD/Annexin V staining in fleshly isolated CD62L<sup>+</sup>CD44<sup>lo</sup> CD8 T cells in peripheral lymph nodes (top) and spleen (<bold>lower</bold>) from OT-I and Fam49b-KO OT-I mice at 16 weeks of age. Shown are representative data of 4 mice per genotype. Right panels show average frequencies of 7AAD<sup>+</sup> and Annexin V<sup>+</sup> cells among CD62L<sup>+</sup>CD44<sup>lo</sup> CD8 T cells in peripheral lymph nodes (mean and SEM, n=4) and spleen (mean and SEM, n=4). *p=0.0286 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig6sdata1">Figure 6—source data 1</xref>.</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig6">Figure 6</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig6-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig6-v1.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Dramatic loss of CD44<sup>lo</sup> peripheral T cells in Family with sequence similarity 49 member B (Fam49b)-KO OT-I mice at 12 weeks.</title><p>(<bold>A</bold>) Absolute numbers of TCR-Vα2<sup>+</sup> CD8 T cell subset in peripheral lymph nodes from OT-I and Fam49b-KO OT-I mice at either 6 weeks (<bold>left</bold>) or 12 weeks (<bold>right</bold>) of age. TCR-Vα2<sup>+</sup> CD8 T cell subset with phenotype of naïve (CD62L+CD44 lo), acute effector (CD62L-CD44lo), effector memory (CD62L-CD44hi), and central memory (CD62L+CD44 hi). Small horizontal lines indicate the mean of 4–6 mice. Each dot represents an individual mouse. *p=0.0190 (Mann-Whitney test). Data are pooled from two independent experiments. See also <xref ref-type="supplementary-material" rid="fig6s1sdata1">Figure 6—figure supplement 1—source data 1</xref>. (<bold>B</bold>) Frequency of 7AAD<sup>+</sup> and Annexin V<sup>+</sup> cells in fleshly isolated naïve CD8 T (<bold>upper</bold>) or naive CD4 T (<bold>lower</bold>) cells from wild-type (WT) and Fam49b-KO mice. Small horizontal lines indicate the mean of 4–6 mice. *p=0.0159 or 0.0411 (Mann-Whitney test). Data are pooled from two independent experiments. See also o <xref ref-type="supplementary-material" rid="fig6s1sdata1">Figure 6—figure supplement 1—source data 1</xref>.</p><p><supplementary-material id="fig6s1sdata1"><label>Figure 6—figure supplement 1—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig6-figsupp1-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig6-figsupp1-v1.tif"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 2.</label><caption><title>Elevated ratio of BIM to Bcl-2 in Family with sequence similarity 49 member B (Fam49b)-KO mice compared to wild-type (WT) mice.</title><p>(<bold>A</bold>) Western blot analysis of BIM and Bcl-2 in naïve CD4 T cells and total thymocytes from 6 to 8 week-old WT and Fam49b-KO mice. The data are representative of three independent experiments. See also <xref ref-type="supplementary-material" rid="fig6s2sdata1">Figure 6—figure supplement 2—source data 1</xref>. (<bold>B</bold>) BIM and Bcl-2 balance of naïve CD4 T cells and total thymocytes in 6–8 week-old WT or Fam49b-KO mice. The expression ratio of BIM/Bcl-2 was examined and calculated by western blot from three independent experiments. Small horizontal lines indicate the mean of 3 mice. See also <xref ref-type="supplementary-material" rid="fig6s2sdata2">Figure 6—figure supplement 2—source data 2</xref>.</p><p><supplementary-material id="fig6s2sdata1"><label>Figure 6—figure supplement 2—source data 1.</label><caption><title>Immunoblot for BIM/Bcl-2.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-76940-fig6-figsupp2-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig6s2sdata2"><label>Figure 6—figure supplement 2—source data 2.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig6-figsupp2-data2-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig6-figsupp2-v1.tif"/></fig></fig-group></sec><sec id="s2-7"><title>Impaired development of natural IELs in Fam49b-KO mice</title><p>Some self-reactive thymocytes rely on strong TCR signaling to mature into unconventional T cell subsets through utilizing an alternative selection process known as agonist selection (<xref ref-type="bibr" rid="bib38">Oh-Hora et al., 2013</xref>; <xref ref-type="bibr" rid="bib21">Hogquist and Jameson, 2014</xref>). Due to the robust effects of Fam49b deficiency on TCR-signaling strength, we investigated whether Fam49b affects the development of well-known agonist-selected T cell subsets including CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs insmall intestinal epithelium, iNKT cells inliver, and Treg cells in lymph nodes (<xref ref-type="bibr" rid="bib31">Lambolez et al., 2007</xref>; <xref ref-type="bibr" rid="bib28">Kronenberg and Gapin, 2002</xref>; <xref ref-type="bibr" rid="bib22">Hsieh et al., 2012</xref>). We found that all three T cell subsets were differentially affected by the loss of Fam49b. The percentage of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs among IEL T cells was significantly decreased from 60% in WT mice to 30% in Fam49b-KO mice, whereas the frequency of liver iNKT cells was unaffected (<xref ref-type="fig" rid="fig7">Figure 7A</xref> and <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). The frequency of Treg among lymph node CD4<sup>+</sup> T cells increased slightly from 16 to 20% in lymph nodes in Fam49b-KO mice, though the absolute number of Treg was ~80% of the number in WT mice. Enhanced frequency of Treg seems to be a result of a greater reduction of total CD4<sup>+</sup> T cells compared to Treg (<xref ref-type="fig" rid="fig7">Figure 7A</xref> and <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2A</xref>).</p><fig-group><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Family with sequence similarity 49 member B (Fam49b)-KO mice have lower frequency of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> and TCRγδ<sup>+</sup> IELs T cells than wild-type (WT) mice.</title><p>(<bold>A</bold>) Flow cytometry analysis of CD8αα<sup>+</sup> TCRβ<sup>+</sup> IELs T cells (<bold>top</bold>), CD1d-tetramer<sup>+</sup> iNKT cells in the liver (<bold>middle</bold>), and Foxp3<sup>+</sup>CD25<sup>+</sup> lymphoid regulatory T cells in the peripheral lymph nodes (<bold>bottom</bold>) from WT and Fam49b-KO mice. Right panels show average frequencies of each population among total lymphocytes or CD4 T cells. ***p=0.0003 and ****p&lt;0.0001 (Mann-Whitney test). Data are pooled from seven independent experiments (CD8αα<sup>+</sup> TCRβ<sup>+</sup> IELs; mean and SEM, n=12–13), representative of four experiments (iNKT cells; mean and SEM, n=6), or representative from seven independent experiments (Treg; mean and SEM, n=8). See also <xref ref-type="supplementary-material" rid="fig7sdata1">Figure 7—source data 1</xref>. (<bold>B</bold>) Frequency of TCRγδ<sup>+</sup> IELs T cells, CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs T cells, and CD8αβ<sup>+</sup>TCRβ<sup>+</sup> IELs T cells among total live IELs cells in WT and Fam49b-KO mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 12–13 mice. ****p&lt;0.0001 (Mann-Whitney test). Data are pooled from seven independent experiments. See also <xref ref-type="supplementary-material" rid="fig7sdata1">Figure 7—source data 1</xref>. (<bold>C</bold>) Frequency of CD5<sup>+</sup> T cells and CD5<sup>-</sup> T cells among total CD3ε<sup>+</sup> IELs T cells in WT and Fam49b-KO mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 8 mice. ***p=0.0002 (Mann-Whitney test). Data are pooled from six independent experiments. See also <xref ref-type="supplementary-material" rid="fig7sdata1">Figure 7—source data 1</xref>.</p><p><supplementary-material id="fig7sdata1"><label>Figure 7—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig7">Figure 7</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig7-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig7-v1.tif"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 1.</label><caption><title>Flow cytometry gating strategies to analyze IELs T cells.</title><p>TCRγ<italic>δ</italic>+IEL, CD8α<italic>α</italic>+TCRβ+IELs, CD8α<italic>β</italic>+TCRα<italic>β</italic>+IELs, CD4 +TCRα<italic>β</italic>+IELs, CD4 +CD8<italic>α</italic>+TCRαβ, and CD4-CD8α -TCRαβ IELs T cells were analyzed in wild-type (WT) and Family with sequence similarity 49 member B (Fam49b)-KO mice.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig7-figsupp1-v1.tif"/></fig><fig id="fig7s2" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 2.</label><caption><title>Total number of Treg cells in lymph nodes, and minor IELs T subsets.</title><p>(<bold>A</bold>) Total number of Foxp3<sup>+</sup> regulatory T cells in peripheral lymph nodes from wild-type (WT) and Family with sequence similarity 49 member B (Fam49b)-KO mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 7–8 mice. **p=0.0012 (Mann-Whitney test). Data are representative from seven independent experiments. See also <xref ref-type="supplementary-material" rid="fig7s2sdata1">Figure 7—figure supplement 2—source data 1</xref> (<bold>B</bold>) Frequency of CD4<sup>+</sup>TCRαβ<sup>+</sup> IELs, CD4<sup>+</sup>CD8α<sup>+</sup>TCRαβ IELs, and CD4<sup>-</sup>CD8α<sup>-</sup>TCRαβ IELs T among total live IELs T cells in WT and Fam49b-KO mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 12 mice. *p=0.0235 and **p=0.0025 and ****p&lt;0.0001 (Mann-Whitney test). Data are pooled from six independent experiments See also <xref ref-type="supplementary-material" rid="fig7s2sdata1">Figure 7—figure supplement 2—source data 1</xref>.</p><p><supplementary-material id="fig7s2sdata1"><label>Figure 7—figure supplement 2—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig7-figsupp2-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig7-figsupp2-v1.tif"/></fig><fig id="fig7s3" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 3.</label><caption><title>Intraepithelial lymphocyte (IEL) precursors in thymus.</title><p>(<bold>A</bold>) Two subsets of mature TCRβ<sup>+</sup> double negative (DN) IEL precursor cells in thymus. Frequency (<bold>left</bold>) and Numbers (<bold>right</bold>) of PD-1<sup>+</sup> (Type A) and PD-1<sup>-</sup> (Type B) mature TCRβ<sup>+</sup> DN IEL precursor cells in wild-type (WT) and Family with sequence similarity 49 member B (Fam49b)-KO mice at 6–7 weeks of age. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 7 mice. **p=0.003 and ****p&lt;0.0001 (Mann-Whitney test). Data are representative of three experiments. See also <xref ref-type="supplementary-material" rid="fig7s3sdata1">Figure 7—figure supplement 3—source data 1</xref>. (<bold>B</bold>) Expression of Integrin α4β7 on PD-1<sup>+</sup> TCRβ<sup>+</sup> DN IEL precursor (Type A) of WT and Fam49b-KO mice or double positive (DP) (control) thymocytes. Data are representative of three experiments. Shown are representative data of seven mice per genotype. (<bold>C</bold>) Expression of CD103 (Integrin αE) on PD-1<sup>-</sup> TCRβ<sup>+</sup> DN IEL precursor (Type B) of WT and Fam49b-KO mice or DP (control) thymocytes. Data are representative of three experiments. Shown are representative data of seven mice per genotype.</p><p><supplementary-material id="fig7s3sdata1"><label>Figure 7—figure supplement 3—source data 1.</label><caption><title>The numerical data used to generate the <xref ref-type="fig" rid="fig7s3">Figure 7—figure supplement 3</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-76940-fig7-figsupp3-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-fig7-figsupp3-v1.tif"/></fig></fig-group><p>Gut IEL T lymphocytes are extremely heterogenous, and based on the differentiation mechanisms, can be subdivided into two major subpopulations including natural intraepithelial lymphocytes (natural IELs) and induced intraepithelial lymphocytes (induced IELs) (<xref ref-type="bibr" rid="bib10">Cheroutre et al., 2011</xref>). Natural IELs are home to the gut immediately after thymic maturation. They are TCRγδ<sup>+</sup> and TCRαβ<sup>+</sup> T cells that can be either CD8αα<sup>+</sup> or CD8αα<sup>−</sup>. In contrast, induced IELs arise from conventional peripheral CD8αβ<sup>+</sup>TCRαβ<sup>+</sup> T cells and are activated post-thymically in response to peripheral antigens. The two populations can be distinguished by the expression of CD5; natural IELs are CD5<sup>-</sup> and induced IELs CD5<sup>+</sup> (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). Based on our observation of the dramatic loss of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs in Fam49b-KO mice, we postulated that other IEL subsets might be altered as well. Fam49b-KO mice showed a substantial reduction of natural IELs, including both the TCRγδ<sup>+</sup> IELs as well as CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs (<xref ref-type="fig" rid="fig7">Figure 7B</xref>), whereas the relative frequencies of induced IELs (CD8αβ<sup>+</sup>TCRαβ<sup>+</sup> IELs) were increased (<xref ref-type="fig" rid="fig7">Figure 7C</xref> and <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2B</xref>). These results suggest that Fam49b is involved in shaping the agonist-selected unconventional T cell populations and that Fam49b deficiency leads to substantial loss of the natural IELs, including CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs and TCRγδ<sup>+</sup> IELs.</p><p>CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs develop from two distinct CD8αα IEL precursors (IELps) in the thymus (<xref ref-type="bibr" rid="bib43">Ruscher et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Ruscher et al., 2020</xref>). CD8αα IELps include PD-1<sup>+</sup> type A and PD-1<sup>-</sup> type B IELps populations. Type A IELps localized to the cortex and were integrin α4β7<sup>+</sup>, while type B IELps localized to the medulla and expressed CD103. Based on our observation of the dramatic loss of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs in Fam49b-KO mice, we postulated that two CD8αα IELps might be altered in the thymus. Contrary to our expectations, there was no decrease in the frequencies and numbers of two CD8αα IELps in the thymus (<xref ref-type="fig" rid="fig7s3">Figure 7—figure supplement 3A</xref>). The integrin expression of each CD8αα IELps was also comparable between WT and Fam49b-KO mice (<xref ref-type="fig" rid="fig7s3">Figure 7—figure supplement 3B–3C</xref>). Severe CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs deficiency in the gut was at odds with the higher number of thymic Type B IELps. We found that Fam49b is also required for the maintenance and survival of peripheral T cells (<xref ref-type="fig" rid="fig6">Figure 6</xref> and <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). Therefore, we reasoned that the lower number of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs may be the result of impaired maintenance or survival in the periphery, rather than a problem with thymic IELps development.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Development of T cells is critically dependent on the strength of signaling through the TCR that leads to positive or negative selection (<xref ref-type="bibr" rid="bib16">Gaud et al., 2018</xref>; <xref ref-type="bibr" rid="bib24">Hwang et al., 2020</xref>). However, the roles of additional intracellular proteins and signaling pathways that regulate TCR signaling strength in the thymus have not been fully elucidated. Here, by studying the thymic development of T cells in Fam49b-KO mice, we report that Fam49b finetunes thymic selection by negatively regulating TCR signal-strength in the thymus and is essential for normal thymocyte development. Mice deficient in Fam49b developed severe T cell lymphopenia due to enhanced TCR-signaling in DP thymocytes. In Fam49b-KO thymus, the post-positively selected population was significantly reduced, while the generation of DN or immature DP thymocytes was mostly unaffected. We further confirmed that the loss of post-positive selection thymocytes in Fam49b-KO mice was due to enhanced clonal deletion instead of death by neglect. As a result, the frequencies of CD4 SP and CD8 SP cells in the Fam49b-KO thymi were significantly reduced.</p><p>While the medulla is a specialized site for negative selection, a substantial amount of negative selection occurs in the thymic cortex, overlapping in space and time with positive selection (<xref ref-type="bibr" rid="bib49">Stritesky et al., 2013</xref>; <xref ref-type="bibr" rid="bib35">McDonald et al., 2015</xref>). We found that the frequency of the thymocytes undergoing clonal deletion was significantly increased in Fam49b-KO thymus, while the frequency of thymocytes undergoing death by neglect remained the same. Moreover, most of thymocytes undergoing clonal deletion were CCR7<sup>-</sup> cortex resident thymocytes (~65%) in both WT and Fam49b-KO thymus. These data imply that Fam49b is needed immediately after the initial positive selection stage to serve as a ‘brake’ which dampens TCR signaling, thus helping to avoid negative selection. This ‘brake,’ once taken out of the picture, leads to overexuberant clonal deletion and subsequent loss of a large proportion of the mature T cells.</p><p>Fam49b-KO DP thymocytes received a stronger TCR signal compared to WT DP thymocytes. At the molecular level, Fam49b directly interacts with active Rac and negatively regulates its activity (<xref ref-type="bibr" rid="bib47">Shang et al., 2018</xref>; <xref ref-type="bibr" rid="bib14">Fort et al., 2018</xref>; <xref ref-type="bibr" rid="bib58">Yuki et al., 2019</xref>). Rac plays key roles in cytoskeleton remodeling, signal transduction, and regulation of gene expression in thymocytes and peripheral T cells (<xref ref-type="bibr" rid="bib46">Saoudi et al., 2014</xref>; <xref ref-type="bibr" rid="bib7">Bosco et al., 2009</xref>). The modulation of Rac activity by switching between its two conformational states, i.e., inactive (GDP-bound) and active (GTP-bound), is essential for multiple stages of thymocyte development and maturation. Previous studies suggested that Rac activity is important for β selection at DN thymocytes as well as positive and negative selection at DP thymocytes (<xref ref-type="bibr" rid="bib12">Dumont et al., 2009</xref>; <xref ref-type="bibr" rid="bib46">Saoudi et al., 2014</xref>). Moreover, transgenic mice that express constitutively active Rac-1 mutant revealed that Rac-1 activity could reverse the fate of thymocytes from positive to negative selection in the thymus (<xref ref-type="bibr" rid="bib17">Gomez et al., 2001</xref>). Taken together, the phenotype similarities between active Rac-1 transgenic and our Fam49b-KO mice, and the association between Rac and Fam49b molecule, suggests that the impaired T cell development in Fam49b-KO mice is likely a result of enhanced Rac activity in DP thymocytes.</p><p>How might enhanced Rac activity lead to the defective T cell development in Fam49b-KO mice? Rac is known to regulate actin reorganization in T cells through binding with the Rac downstream effectors, such as the PAK and WAVE2 complex (<xref ref-type="bibr" rid="bib29">Kumari et al., 2014</xref>). The Pak2-deficient CD4 thymocytes showed weakened TCR-signaling strength as indicated by the reduction of Nur77 expression in response to αCD3-stimulation (<xref ref-type="bibr" rid="bib39">Phee et al., 2014</xref>), suggesting that the Rac-driven cytoskeleton remodeling is important for downstream events of TCR signaling. Negatively regulated Rac-driven cytoskeleton remodeling could attenuate protrusion and migration process in T cells. Fam49b-deficient cells showed increased cellular spread and reduced protrusion-retraction dynamics (<xref ref-type="bibr" rid="bib14">Fort et al., 2018</xref>; <xref ref-type="bibr" rid="bib58">Yuki et al., 2019</xref>). Moreover, negative selection occurs via lengthy interactions between T cells and APCs, whereas positive selection is transient interactions (<xref ref-type="bibr" rid="bib36">Melichar et al., 2013</xref>). Therefore, it is possible that altered cytoskeleton remodeling activity in Fam49b-KO thymocytes contributed to their elevated TCR-signaling strength and enhanced negative selection, perhaps by prolonging interactions with thymic APCs.</p><p>We found that Fam49b-KO mice showed impaired survival in immature and semi-mature SP thymocytes, and peripheral naïve T cells. Activated Rac1 has been shown to phosphorylate Jun N-terminal kinase (JNK), which in turn phosphorylates Jun and leads to the appearance of active AP-1 (<xref ref-type="bibr" rid="bib16">Gaud et al., 2018</xref>; <xref ref-type="bibr" rid="bib56">Wu et al., 2008</xref>). AP-1 is a transcription factor that participates in tuning on transcription of many genes important for T cell activation (<xref ref-type="bibr" rid="bib32">Lee et al., 2018</xref>). Although JNK is required for TCR signaling, JNK can also promote apoptotic signaling by the upregulation of pro-apoptotic genes such as BIM (<xref ref-type="bibr" rid="bib11">Dhanasekaran and Reddy, 2008</xref>). JNK-deficient thymocytes were resistant to cell death induction caused by apoptotic stimuli such as anti-CD3ε, anti-FAS, and TNF-α (<xref ref-type="bibr" rid="bib42">Rincón et al., 1998</xref>; <xref ref-type="bibr" rid="bib5">Behrens et al., 2001</xref>; <xref ref-type="bibr" rid="bib45">Sabapathy et al., 2001</xref>), suggesting that JNK signaling is required for TCR-mediated apoptosis of thymocytes. Moreover, Rac1-mediated Bcl-2 induction is also important for the differentiation of CD4 SP from DP thymocyte lines by preventing TCRβ-induced apoptosis (<xref ref-type="bibr" rid="bib37">Oda et al., 2007</xref>). We suggest, therefore, that Fam49b protein is a fine regulatory protein of TCR signaling to induce thymic development and T cell activation while suppressing apoptosis caused by excessive Rac1/JNK signaling.</p><p>Among all the unusual phenotypes of peripheral T cells in Fam49b-KO mice, one surprising yet interesting observation was the significant loss of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> and TCRγδ<sup>+</sup> IELs T cells. These T cell subsets were previously defined as unconventional T cells derived from self-reactive thymocytes that mature through agonist selection. The development of agonist-selected T cells relies on relatively strong and sustained TCR signaling which correlates with the magnitude of store-operated Ca2<sup>+</sup> entry and NFAT activity (<xref ref-type="bibr" rid="bib48">Stritesky et al., 2012</xref>; <xref ref-type="bibr" rid="bib38">Oh-Hora et al., 2013</xref>). Yet it remains unclear why these cells that receive unusually high TCR signal are not eliminated through negative selection, but instead traffic into the gut and become IEL T cells (<xref ref-type="bibr" rid="bib43">Ruscher et al., 2017</xref>; <xref ref-type="bibr" rid="bib40">Pobezinsky et al., 2012</xref>). Interestingly, thymocytes undergoing agonist selection into CD8αα<sup>+</sup> TCRαβ<sup>+</sup> IELs T cells exhibited a rapid and confined migration pattern, in contrast to negatively selecting cells, which showed arrested migration (<xref ref-type="bibr" rid="bib30">Kurd et al., 2021</xref>). Fam49b-deficient cells showed increased cellular mobility (<xref ref-type="bibr" rid="bib58">Yuki et al., 2019</xref>). It is tempting to speculate that the overactivation of Rac-1 in Fam49b-KO mice might rescue IEL precursors from negative selection, perhaps by favoring confined migration over migratory arrest after encountering with agonist ligands.</p><p>In conclusion, Fam49b is critical for the thymic development of conventional T cells as well as unconventional natural IELs T cells. Interestingly, the function of Fam49b is restrained to the late-phase T cell development, where it dampens TCR signals to avert negative selection of DP thymocytes. The action of Fam49b is key in distinguishing positive from negative selection in thymic development. In addition, Fam49b is essential for the survival of naïve T cells in the peripheral. Thus, our study offers new insights on the association between modulation of TCR-signaling strength, cytoskeleton remodeling, thymic development processes, and peripheral T cells survival.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Reagent type (species) or resource</th><th align="left" valign="bottom">Designation</th><th align="left" valign="bottom">Source or reference</th><th align="left" valign="bottom">Identifiers</th><th align="left" valign="bottom">Additional information</th></tr></thead><tbody><tr><td align="left" valign="bottom">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="bottom">C57BL/6 J</td><td align="left" valign="bottom">Jackson Laboratory</td><td align="left" valign="bottom">Stock No. 000664, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:IMSR_JAX:000664">IMSR_JAX:000664</ext-link></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="bottom">CD45.1</td><td align="left" valign="bottom">Jackson Laboratory</td><td align="left" valign="bottom">Stock No. 002014, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:IMSR_JAX:002014">IMSR_JAX:002014</ext-link></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="bottom"><italic>Cyria</italic><sup>-/-</sup><break/>(C57BL/6 J background)</td><td align="left" valign="bottom">Generation of knockout mice in this paper</td><td align="left" valign="bottom"/><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="bottom"><italic>Cyrib</italic><sup>-/-</sup><break/>(C57BL/6 J background)</td><td align="left" valign="bottom">Generation of knockout mice in this paper</td><td align="left" valign="bottom"/><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-human Fam49a<break/>(Rabbit polyclonal)</td><td align="left" valign="bottom">Millipore</td><td align="left" valign="bottom">Cat# SAB1103179<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_10900801">AB_10900801</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-Fam49b (Mouse monoclonal, Clone D-8)</td><td align="left" valign="bottom">Santa Cruz</td><td align="left" valign="bottom">Cat# SC-390478</td><td align="left" valign="bottom">WB (1:2000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-GAPDH (Rabbit polyclonal)</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">Cat# ab9485, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_307275">AB_307275</ext-link></td><td align="left" valign="bottom">WB (1:2000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-PLCγ1 (Rabbit monoclonal, Clone D9H10)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 5690<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_10691383">AB_10691383</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-p-PLCγ1 (Rabbit polyclonal)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2821<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_330855">AB_330855</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-ZAP-70 (Rabbit monoclonal, Clone 99F2)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2705<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2273231">AB_2273231</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-p-ZAP-70 (Rabbit monoclonal, Clone 65E4)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2717<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2218658">AB_2218658</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-p44/42 MAPK (Erk1/2) (Rabbit polyclonal)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 9102<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_330744">AB_330744</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-p-p44/42 MAPK (Erk1/2) (Rabbit monoclonal, Clone 197G2)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 4377<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_331775">AB_331775</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-p-LAT (Rabbit monoclonal, Clone E3S5L)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 20172<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_3073971">AB_3073971</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-LAT (Rabbit monoclonal, Clone E3U6J)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 45533</td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-BIM (Rabbit monoclonal, Clone C34C5)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2933<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_1030947">AB_1030947</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-Bcl-2 (Rabbit monoclonal, Clone D17C4)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 3498<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_1903907">AB_1903907</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-p-PAK1 (Ser144)/ PAK2 (Ser141) (Rabbit polyclonal)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2606<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2299279">AB_2299279</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-p-PAK1 (Ser199/204)/ PAK2 (Ser192/197) (Rabbit polyclonal)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2605<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2160222">AB_2160222</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-p-PAK1 (Thr423)/ PAK2 (Thr402) (Rabbit polyclonal)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2601<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_330220">AB_330220</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-PAK1 (Rabbit polyclonal)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2602<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_330222">AB_330222</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-PAK2 (Rabbit monoclonal, Clone C17A10)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2615<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2267950">AB_2267950</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-PAK3 (Rabbit polyclonal)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2609<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2225298">AB_2225298</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">anti-PAK1/2/3 (Rabbit polyclonal)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 2604<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2160225">AB_2160225</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-mouse IgG (Dunkey polyclonal)</td><td align="left" valign="bottom">Licor</td><td align="left" valign="bottom">Cat# 926–68072, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_10953628">AB_10953628</ext-link></td><td align="left" valign="bottom">WB (1:10000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-Rabbit IgG (Goat polyclonal)</td><td align="left" valign="bottom">Licor</td><td align="left" valign="bottom">Cat# 926–32211, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_621843">AB_621843</ext-link></td><td align="left" valign="bottom">WB (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD3ε-FITC (Rat monoclonal, Clone 17A2)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 100204, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_312661">AB_312661</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD4-APC (Rat monoclonal, Clone RM4-5)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 100516, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_312719">AB_312719</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD5-APC-Cy7 (Rat monoclonal, Clone 53–7.3)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 100649, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2860587">AB_2860587</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD8α-BV421 (Rat monoclonal, Clone 53–6.7)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 100738, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_11204079">AB_11204079</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD8β-PE-Cy7 (Rat monoclonal, Clone 53–5.8)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 140416, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2564385">AB_2564385</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD11b-PerCP-Cy5.5 (Rat monoclonal, Clone M1/70)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 101228, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_893232">AB_893232</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD19-PerCP-Cy5.5 (Rat monoclonal, Clone 6D5)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 115534, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2072925">AB_2072925</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD24-FITC (Rat monoclonal, Clone M1/69)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 101806, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_312839">AB_312839</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD25-APC (Rat monoclonal, Clone PC61)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 102012, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_312861">AB_312861</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD44-Pacific Blue (Rat monoclonal, Clone IM7)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 103020, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_493683">AB_493683</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD45-Pacific Blue (Rat monoclonal, Clone 30-F11)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 103126, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_493535">AB_493535</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD45.1-PE (Mouse monoclonal, Clone A20)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 110708, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_313497">AB_313497</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD45.2-FITC (Mouse monoclonal, Clone 104)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 109806, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_313443">AB_313443</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD45R/B220-PerCP-Cy5.5 (Rat monoclonal, Clone RA3-6B2)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 103236, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_893354">AB_893354</ext-link></td><td align="left" valign="bottom">FC(1:400)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD62L-APC (Rat monoclonal, Clone MEL-14)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 104412, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_313099">AB_313099</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD69-PE (Armenian Hamster monoclonal, Clone H1.2F3)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">BioLegend Cat# 104507, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_313110">AB_313110</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD103-Alexa Fluor 700 (Armenian Hamster monoclonal, Clone 2E7)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">BioLegend Cat# 121442, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2813993">AB_2813993</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD197/CCR7-BV421 (Rat monoclonal, Clone 4B12)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 120120, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2561446">AB_2561446</ext-link></td><td align="left" valign="bottom">FC (1:50)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-Ly6G-PerCP-Cy5.5 (Rat monoclonal, Clone 1A8)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 127616, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_1877271">AB_1877271</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-Ly6C-PerCP-Cy5.5 (Rat monoclonal, Clone HK1.4)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 128012, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_1659241">AB_1659241</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-NK1.1-PerCP-Cy5.5 (Mouse monoclonal, Clone PK136)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 108728, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2132705">AB_2132705</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-TCRβ-PE/Cy7 (Armenian Hamster monoclonal, Clone H57-597)</td><td align="left" valign="bottom">BioLegand</td><td align="left" valign="bottom">Cat# 109222, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_893625">AB_893625</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-TCRγδ-PE (Armenian Hamster monoclonal, Clone GL3)</td><td align="left" valign="bottom">BioLegend</td><td align="left" valign="bottom">Cat# 118108, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_313832">AB_313832</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-CD16/CD32 (Rat monoclonal, Clone 93)</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="left" valign="bottom">Cat# 14-0161-85, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_467134">AB_467134</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-Cleaved Caspase 3-PE (Rabbit monoclonal, Clone D3E9)</td><td align="left" valign="bottom">Cell Signaling Technology</td><td align="left" valign="bottom">Cat# 12768, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2798021">AB_2798021</ext-link></td><td align="left" valign="bottom">FC (1:50)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-Foxp3-PE (Rab monoclonal, Clone FJK16s)</td><td align="left" valign="bottom">eBioscience</td><td align="left" valign="bottom">Cat# 12-5773-82, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_465936">AB_465936</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-TCRVα2-FITC (Rat monoclonal, Clone H57-597)</td><td align="left" valign="bottom">BioLegand</td><td align="left" valign="bottom">Cat# 127806, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_1134188">AB_1134188</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-IL-7RαBV650 (Rat monoclonal, Clone A7R34)</td><td align="left" valign="bottom">BioLegand</td><td align="left" valign="bottom">Cat# 135043, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2629681">AB_2629681</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-PD-1 APC (Rat monoclonal, Clone RMP1-30)</td><td align="left" valign="bottom">BioLegand</td><td align="left" valign="bottom">Cat# 109112, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_10612938">AB_10612938</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti- LPAM-1 (Integrin α4β7) PE (Rat monoclonal, Clone DATK32)</td><td align="left" valign="bottom">BioLegand</td><td align="left" valign="bottom">Cat# 120606, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_493267">AB_493267</ext-link></td><td align="left" valign="bottom">FC (1:200)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Biotin anti-mouse CD3 antibody</td><td align="left" valign="bottom">Biolegend</td><td align="left" valign="bottom">Cat# 100244<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2563947">AB_2563947</ext-link></td><td align="left" valign="bottom">60 μg/ml</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Biotin anti-mouse CD4 antibody</td><td align="left" valign="bottom">Biolegend</td><td align="left" valign="bottom">Cat# 100404<break/>RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_312688">AB_312688</ext-link></td><td align="left" valign="bottom">60 μg/ml</td></tr><tr><td align="left" valign="bottom">Peptide, recombinant protein</td><td align="left" valign="bottom">Streptavidin</td><td align="left" valign="bottom">SouthernBiotech</td><td align="left" valign="bottom">Cat# 7100–01</td><td align="left" valign="bottom">60 μg/ml</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom"><italic>Cyrib</italic>_F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primers</td><td align="left" valign="bottom"><named-content content-type="sequence">AGGAGCTGGCCACGAAATAC</named-content></td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom"><italic>Cyrib</italic>_R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primers</td><td align="left" valign="bottom"><named-content content-type="sequence">GGCGTACTAGTCAAGGCTCC</named-content></td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom"><italic>Actb</italic>_F</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primers</td><td align="left" valign="bottom"><named-content content-type="sequence">CCTGAACCCTAAGGCCAACC</named-content></td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom"><italic>Actb</italic>_R</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">PCR primers</td><td align="left" valign="bottom"><named-content content-type="sequence">ATGGCGTGAGGGAGAGCATA</named-content></td></tr><tr><td align="left" valign="bottom">Commercial assay or kit</td><td align="left" valign="bottom">RNeasy Plus Micro Kit</td><td align="left" valign="bottom">QIAGEN</td><td align="left" valign="bottom">Cat# 74034</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Commercial assay or kit</td><td align="left" valign="bottom">SuperScript IV Firs-Strand Synthesis Reaction,</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="left" valign="bottom">Cat# 18091050</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Commercial assay or kit</td><td align="left" valign="bottom">PowerUp SYBR Green Master Mix</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="left" valign="bottom">Cat# A25741</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Commercial assay or kit</td><td align="left" valign="bottom">Liver dissociation kit, mouse</td><td align="left" valign="bottom">MACS</td><td align="left" valign="bottom">Cat# 130-105-807</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Chemical compound, drug</td><td align="left" valign="bottom">DTT</td><td align="left" valign="bottom">Fisher Scientific</td><td align="left" valign="bottom">Cat# BP172-5</td><td align="left" valign="bottom">(1 mM)</td></tr><tr><td align="left" valign="bottom">Software, algorithm</td><td align="left" valign="bottom">Image Studio Lite</td><td align="left" valign="bottom"/><td align="left" valign="bottom">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:SCR_013715">SCR_013715</ext-link></td><td align="left" valign="bottom">v5.2.5</td></tr><tr><td align="left" valign="bottom">Software, algorithm</td><td align="left" valign="bottom">FlowJo</td><td align="left" valign="bottom">FlowJo</td><td align="left" valign="bottom">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:SCR_008520">SCR_008520</ext-link></td><td align="left" valign="bottom">v10.7.1</td></tr><tr><td align="left" valign="bottom">Software, algorithm</td><td align="left" valign="bottom">GraphPad Prism</td><td align="left" valign="bottom">GraphPad Software</td><td align="left" valign="bottom">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:SCR_002798">SCR_002798</ext-link></td><td align="left" valign="bottom">v9</td></tr><tr><td align="left" valign="bottom">Other</td><td align="left" valign="bottom">Ghost Dye Violet 510 Viability dye</td><td align="left" valign="bottom">Tonbo Bioscience</td><td align="left" valign="bottom">Cat# 13–0870 T100</td><td align="left" valign="bottom">FC (1:1000)</td></tr></tbody></table></table-wrap><sec id="s4-1"><title>Mice</title><p>C57BL/6 J (WT, stock no: 000664) and CD45.1 mice (B6.SJL-Ptprca Pepcb/BoyJ, stock no: 002014) were purchased from the Jackson Laboratory and bred in-house. Fam49a-KO and Fam49b-KO mice were generated by CRISPR/Cas9 gene-editing technology. The construct was electroporated into embryonic stem cells at the University of California at Berkeley gene targeting facility. All mouse procedures were approved by the Johns Hopkins University Animal Care and Use Committee and were following relevant ethical regulations (M021M261).</p></sec><sec id="s4-2"><title>Antibodies and reagents</title><p>Western blotting: anti-Fam49a (1103179) Millipore Sigma (St. Louis, MO); anti-Fam49b (D-8) Santa Cruz (Dallas, Texas); anti-GAPDH (ab9485) Abcam (Waltham, MA); anti-PLCγ1 (D9H10), anti-p-PLCγ1, anti-ZAP-70 (99F2), anti-p-ZAP-70, anti-ERK 1/2, anti-p-ERK 1/2 (197G2), anti-LAT (E3U6J), anti-p-LAT (E3S5L), anti-BIM (C34C5), anti-Bcl-2 (D17C4), anti-p-PAK 1(Ser144)/2 (Ser141), anti-p-PAK 1(Ser199/204)/2(Ser192/197), anti-p-PAK 1(Thr423)/PAK 2(Thr402), anti-PAK 1, anti-PAK 2 (C17A10), anti-PAK-3, anti-PAK 1/2/3, Cell Signaling Technology (Danvers, MA); anti-mouse IgG (926–68072), anti-rabbit IgG (926–32211) Li-cor (Lincoln, NE). - Flow cytometry: anti-CD3e (17A2), anti-CD4 (RM4-5), anti-CD5 (53–7.3), anti-CD8α (53–6.7), anti-CD8β (53–5.8), CD11b (M1/70), anti-CD19 (ID3), anti-CD24 (M1/69), anti-CD25 (PC61), anti-CD44 (IM7), anti-CD45 (30-F11), anti-CD45.1 (A20), anti-CD45.2 (104), anti-CD45R/B220 (RA3-6B2), anti-CD62L (MEL-14), anti-CD69 (H1.2F3), anti-CD197/CCR7 (4B12), anti-Ly6G (IA8), anti-Ly-6C (HK1.4), anti-NK1.1 (PK136), anti-TCRβ (H57-597), anti-TCRγδ (GL3), anti-TCRVα2 (B20.1), anti-IL-7Rα (A7R34), anti-Integrin α4β7 (DATK32), anti-CD103 (2E7) anti-PD-1 (RMP1-30), BioLegend (San Diego, CA); anti-CD16/32 (93) ThermoFisher Scientific Waltham, MA; anti-Cleaved Caspase 3 (D3E9) Cell signaling (Danvers, MA); Foxp3 (FJK-16s) eBioscience (San Diego, CA).Tetramerization: PBS-57 loaded mouse CD1d monomers were synthesized by the Tetramer Core Facility of the US National Institute of Health, Streptavidin-APC (PJ27S) and Streptavidin-RPE (PJRS27-1) were purchased from Prozyme (Agilent, Santa Clara, CA).</p></sec><sec id="s4-3"><title>T cell activation assay</title><p>Total thymocytes were rested for 4 hr in RPMI medium at 37°C, 5%. After resting, cells were incubated with biotin-conjugated anti-CD3 (60 μg/ml, 145–2 C11) and anti-CD4 (60 μg/ml, GK1.5) for 20 min on ice. Cells were washed and incubated for 5 min on ice with streptavidin (60 μg/ml, SouthernBiotech, USA) for cross-linking and incubated for the indicated time at 37°C. 1 ml of cold PBS was added at the end of stimulation and cell pellets were lysed for western blotting.</p></sec><sec id="s4-4"><title>Immunoblotting</title><p>Cell extracts were prepared by resuspending cells in PBS, then lysing them in RIPA buffer containing protease inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA). Protein concentrations were determined with the BCA Protein Reagent Kit (Pierce, ThermoFisher Scientific), after which 2-mercaptoethanol and 4 x Laemmli Sample buffer (Bio-Rad, Hercules, CA) were added and the samples were boiled. Western blotting was performed according to standard protocols using anti-Fam49a pAb, and anti-Fam49b mAb, and anti-GAPDH pAb. IRDye800CW conjugated goat anti-rabbit and IRDye680RD conjugated donkey anti-mouse were used as secondary antibodies. The membrane was scanned with the Odyssey Infrared Imaging System (Li-cor, model 9120).</p></sec><sec id="s4-5"><title>Real-time RT-PCR</title><p>The subsets of C57BL/6 thymocytes was collected using BD FACSAria II Cell sorter by the Ross Flow Cytometry Core Facility of the johns Hopkins. DN1 cells were gated as CD25<sup>–</sup>CD44<sup>hi</sup>; DN2 cells were gated as CD25<sup>+</sup>CD44<sup>int–hi</sup>; DN3 cells were gated as CD25<sup>+</sup>CD44<sup>neg–lo</sup>; and DN4 cells were gated as CD25<sup>–</sup>CD44<sup>–</sup>. Total RNA was isolated using the RNeasy Plus Micro Kit (Qiagen, Germantown, MD) and cDNA was amplified by SuperScript IV First-Strand Synthesis (Invitrogen, ThermoFisher Scientific) according to the manufacturer’s instructions. Real-time PCR was performed using SYBRgreen PCR Master Mix (Applied Biosystems, ThermoFisher Scientific) and the ViiA 7 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific). Fam49b primers were forward, 5’-<named-content content-type="sequence">AGGAGCTGGCCACGAAATAC</named-content>-3’, and reverse, 5’- <named-content content-type="sequence">GGCGTACTAGTCAAGGCTCC</named-content>-3’. Results were normalized to β-actin expression with the 2−ΔCt method.</p></sec><sec id="s4-6"><title>Isolation of immune cells</title><p>Small-intestine IELs were isolated as previously described (<xref ref-type="bibr" rid="bib41">Qiu and Sheridan, 2018</xref>): Changes were made as follows: DTT (BP172-5, Fisher Scientific) was used instead of DTE. Immune cells were collected from the interface of the 44% and 67% Percoll gradient and characterized by flow cytometry. Hepatic lymphocytes were isolated using a Liver dissociation kit (Miltenyi Biotec, Auburn, CA) according to the manufacturer’s instructions. Samples were resuspended in 33% Percoll and spun, and the cell pellet was collected and labeled for flow cytometry. Naïve CD4<sup>+</sup> T cell in the spleen and lymph nodes from C57BL/6 or FAM49b-KO mice were sorted using Naïve CD4<sup>+</sup> T cell Isolation Kit (Miltenyibiotec, USA) according to the manufacturer instructions. Samples were resuspended in RIPA buffer for western blot.</p></sec><sec id="s4-7"><title>Generation of bone marrow chimera</title><p>T cell-depleted bone marrow cells from CD45.2<sup>+</sup> C57BL/6, Fam49a-KO mice, or Fam49b-KO mice (1×10<sup>6</sup> cells) were used to reconstitute sublethally irradiated (1000 rad) CD45.1<sup>+</sup> wild-type mice by i.v. injection. Reconstituted mice were analyzed 8 weeks after bone marrow transfer.</p></sec><sec id="s4-8"><title>Cell staining</title><p>For cleaved caspase 3 staining (<xref ref-type="bibr" rid="bib8">Breed et al., 2019</xref>), homogenized mice thymocyte cells were stained with anti-CCR7/CD197 at a final dilution of 1:50 for 30 min at 37 °C prior to additional surface stains. Following surface staining, cells were fixed with Cytofix/Cytoperm (BD Biosciences) for 20 min at 4 °C. Cells were then washed with Perm/Wash buffer (BD Biosciences) twice. Cells were stained with anti–cleaved caspase 3 at a 1:50 dilution at 23 °C for 30 min.</p><p>For iNKT staining, Biotinylated PBS-57 loaded or unloaded monomers were obtained from the Tetramer Core Facility of the National Institutes of Health and tetramerized with PE-labeled streptavidin from ProZyme. Hepatic lymphocytes were resuspended in 100 µl of sorter buffer (PBS with 2% FCS, 1 mM EDTA, and 0.1% sodium azide) and stained with PE-iNKT tetramers at a final dilution of 1:200 at 23 °C for 30 min.</p><p>For transcription factor staining, cells were incubated with surface antibody at 4 °C for 20 min, permeabilized at 4 °C for 30 min, and then stained with anti–Foxp3 at 23 °C for 30 min using a Foxp3/Transcription transcription factor buffer set (Invitrogen, ThermoFisher Scientific).</p><p>For 7AAD/Annexin V staining, cells were incubated with surface antibody at 4 °C for 20 min and then stained with anti–7-AAD and Annexin V at 23 °C for 15 min using an Annexin V apoptosis detection kit with 7-AAD (Biolegend). Samples were acquired with BD FACSCelesta (BD Biosciences), and data were analyzed with FlowJo (version 10.7.1).</p></sec><sec id="s4-9"><title>Statistical testing</title><p>GraphPad Prism was used for all statistical analyses. A nonparametric Mann-Whitney U test or one-way ANOVA was used for the estimation of statistical significance. Data is shown as mean ± SEM. *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001.</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing – review and editing</p></fn><fn fn-type="con" id="con2"><p>Investigation, Writing – review and editing</p></fn><fn fn-type="con" id="con3"><p>Investigation</p></fn><fn fn-type="con" id="con4"><p>Resources</p></fn><fn fn-type="con" id="con5"><p>Investigation</p></fn><fn fn-type="con" id="con6"><p>Investigation</p></fn><fn fn-type="con" id="con7"><p>Supervision, Writing – review and editing</p></fn><fn fn-type="con" id="con8"><p>Supervision, Writing – review and editing</p></fn><fn fn-type="con" id="con9"><p>Supervision, Funding acquisition</p></fn><fn fn-type="con" id="con10"><p>Supervision, Funding acquisition, Writing – review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>All mouse procedures were approved by the Johns Hopkins University Animal Care and Use Committee and were following relevant ethical regulations (M021M261).</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="transrepform"><label>Transparent reporting form</label><media xlink:href="elife-76940-transrepform1-v1.pdf" mimetype="application" mime-subtype="pdf"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>All data generated or analysed during this study are included in the manuscript and supporting files. Source data files has been provided for Figures 2–7 and their accompanying figure supplements. Sanger Sequencing data for Cyria and Cyrib, and immunoblot for Cyria (Fam49a) and Cyrib (Fam49b) have been provided for Figure 1 (Figure 1—source data 1 and 2, respectively).</p></sec><ack id="ack"><title>Acknowledgements</title><p>We thank Dr. J David Peske for his editorial comments. Dr. Nilabh Shastri passed away in 2021. May he rest in peace. This work was supported by NIH grant (R01AI130210, R01AI121174, R37AI060040) and the Korea government (MSIT) (RS-2023–00212022, MRC-2017R1A5A2015541).</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Azzam</surname><given-names>HS</given-names></name><name><surname>Grinberg</surname><given-names>A</given-names></name><name><surname>Lui</surname><given-names>K</given-names></name><name><surname>Shen</surname><given-names>H</given-names></name><name><surname>Shores</surname><given-names>EW</given-names></name><name><surname>Love</surname><given-names>PE</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>CD5 expression is developmentally regulated by T cell receptor (TCR) signals and TCR avidity</article-title><source>The Journal of Experimental Medicine</source><volume>188</volume><fpage>2301</fpage><lpage>2311</lpage><pub-id pub-id-type="doi">10.1084/jem.188.12.2301</pub-id><pub-id pub-id-type="pmid">9858516</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Babich</surname><given-names>A</given-names></name><name><surname>Li</surname><given-names>S</given-names></name><name><surname>O’Connor</surname><given-names>RS</given-names></name><name><surname>Milone</surname><given-names>MC</given-names></name><name><surname>Freedman</surname><given-names>BD</given-names></name><name><surname>Burkhardt</surname><given-names>JK</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>F-actin polymerization and retrograde flow drive sustained PLCγ1 signaling during T cell activation</article-title><source>The Journal of Cell Biology</source><volume>197</volume><fpage>775</fpage><lpage>787</lpage><pub-id pub-id-type="doi">10.1083/jcb.201201018</pub-id><pub-id pub-id-type="pmid">22665519</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Babich</surname><given-names>A</given-names></name><name><surname>Burkhardt</surname><given-names>JK</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Coordinate control of cytoskeletal remodeling and calcium mobilization during T-cell activation</article-title><source>Immunological Reviews</source><volume>256</volume><fpage>80</fpage><lpage>94</lpage><pub-id pub-id-type="doi">10.1111/imr.12123</pub-id><pub-id pub-id-type="pmid">24117814</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Baldwin</surname><given-names>TA</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name><name><surname>Jameson</surname><given-names>SC</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>The fourth way? Harnessing aggressive tendencies in the thymus</article-title><source>Journal of Immunology</source><volume>173</volume><fpage>6515</fpage><lpage>6520</lpage><pub-id pub-id-type="doi">10.4049/jimmunol.173.11.6515</pub-id><pub-id pub-id-type="pmid">15557139</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Behrens</surname><given-names>A</given-names></name><name><surname>Sabapathy</surname><given-names>K</given-names></name><name><surname>Graef</surname><given-names>I</given-names></name><name><surname>Cleary</surname><given-names>M</given-names></name><name><surname>Crabtree</surname><given-names>GR</given-names></name><name><surname>Wagner</surname><given-names>EF</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Jun N-terminal kinase 2 modulates thymocyte apoptosis and T cell activation through c-Jun and nuclear factor of activated T cell (NF-AT)</article-title><source>PNAS</source><volume>98</volume><fpage>1769</fpage><lpage>1774</lpage><pub-id pub-id-type="doi">10.1073/pnas.98.4.1769</pub-id><pub-id pub-id-type="pmid">11172026</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Billadeau</surname><given-names>DD</given-names></name><name><surname>Nolz</surname><given-names>JC</given-names></name><name><surname>Gomez</surname><given-names>TS</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Regulation of T-cell activation by the cytoskeleton</article-title><source>Nature Reviews. Immunology</source><volume>7</volume><fpage>131</fpage><lpage>143</lpage><pub-id pub-id-type="doi">10.1038/nri2021</pub-id><pub-id pub-id-type="pmid">17259969</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bosco</surname><given-names>EE</given-names></name><name><surname>Mulloy</surname><given-names>JC</given-names></name><name><surname>Zheng</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Rac1 GTPase: a “Rac” of all trades</article-title><source>Cellular and Molecular Life Sciences</source><volume>66</volume><fpage>370</fpage><lpage>374</lpage><pub-id pub-id-type="doi">10.1007/s00018-008-8552-x</pub-id><pub-id pub-id-type="pmid">19151919</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Breed</surname><given-names>ER</given-names></name><name><surname>Watanabe</surname><given-names>M</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Measuring thymic clonal deletion at the population level</article-title><source>Journal of Immunology</source><volume>202</volume><fpage>3226</fpage><lpage>3233</lpage><pub-id pub-id-type="doi">10.4049/jimmunol.1900191</pub-id><pub-id pub-id-type="pmid">31010850</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Burkhardt</surname><given-names>JK</given-names></name><name><surname>Carrizosa</surname><given-names>E</given-names></name><name><surname>Shaffer</surname><given-names>MH</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>The actin cytoskeleton in T cell activation</article-title><source>Annual Review of Immunology</source><volume>26</volume><fpage>233</fpage><lpage>259</lpage><pub-id pub-id-type="doi">10.1146/annurev.immunol.26.021607.090347</pub-id><pub-id pub-id-type="pmid">18304005</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cheroutre</surname><given-names>H</given-names></name><name><surname>Lambolez</surname><given-names>F</given-names></name><name><surname>Mucida</surname><given-names>D</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The light and dark sides of intestinal intraepithelial lymphocytes</article-title><source>Nature Reviews. Immunology</source><volume>11</volume><fpage>445</fpage><lpage>456</lpage><pub-id pub-id-type="doi">10.1038/nri3007</pub-id><pub-id pub-id-type="pmid">21681197</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dhanasekaran</surname><given-names>DN</given-names></name><name><surname>Reddy</surname><given-names>EP</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>JNK signaling in apoptosis</article-title><source>Oncogene</source><volume>27</volume><fpage>6245</fpage><lpage>6251</lpage><pub-id pub-id-type="doi">10.1038/onc.2008.301</pub-id><pub-id pub-id-type="pmid">18931691</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dumont</surname><given-names>C</given-names></name><name><surname>Corsoni-Tadrzak</surname><given-names>A</given-names></name><name><surname>Ruf</surname><given-names>S</given-names></name><name><surname>de Boer</surname><given-names>J</given-names></name><name><surname>Williams</surname><given-names>A</given-names></name><name><surname>Turner</surname><given-names>M</given-names></name><name><surname>Kioussis</surname><given-names>D</given-names></name><name><surname>Tybulewicz</surname><given-names>VLJ</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Rac GTPases play critical roles in early T-cell development</article-title><source>Blood</source><volume>113</volume><fpage>3990</fpage><lpage>3998</lpage><pub-id pub-id-type="doi">10.1182/blood-2008-09-181180</pub-id><pub-id pub-id-type="pmid">19088377</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fischer</surname><given-names>KD</given-names></name><name><surname>Zmuldzinas</surname><given-names>A</given-names></name><name><surname>Gardner</surname><given-names>S</given-names></name><name><surname>Barbacid</surname><given-names>M</given-names></name><name><surname>Bernstein</surname><given-names>A</given-names></name><name><surname>Guidos</surname><given-names>C</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Defective T-cell receptor signalling and positive selection of Vav-deficient CD4+ CD8+ thymocytes</article-title><source>Nature</source><volume>374</volume><fpage>474</fpage><lpage>477</lpage><pub-id pub-id-type="doi">10.1038/374474a0</pub-id><pub-id pub-id-type="pmid">7700360</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fort</surname><given-names>L</given-names></name><name><surname>Batista</surname><given-names>JM</given-names></name><name><surname>Thomason</surname><given-names>PA</given-names></name><name><surname>Spence</surname><given-names>HJ</given-names></name><name><surname>Whitelaw</surname><given-names>JA</given-names></name><name><surname>Tweedy</surname><given-names>L</given-names></name><name><surname>Greaves</surname><given-names>J</given-names></name><name><surname>Martin</surname><given-names>KJ</given-names></name><name><surname>Anderson</surname><given-names>KI</given-names></name><name><surname>Brown</surname><given-names>P</given-names></name><name><surname>Lilla</surname><given-names>S</given-names></name><name><surname>Neilson</surname><given-names>MP</given-names></name><name><surname>Tafelmeyer</surname><given-names>P</given-names></name><name><surname>Zanivan</surname><given-names>S</given-names></name><name><surname>Ismail</surname><given-names>S</given-names></name><name><surname>Bryant</surname><given-names>DM</given-names></name><name><surname>Tomkinson</surname><given-names>NCO</given-names></name><name><surname>Chamberlain</surname><given-names>LH</given-names></name><name><surname>Mastick</surname><given-names>GS</given-names></name><name><surname>Insall</surname><given-names>RH</given-names></name><name><surname>Machesky</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Fam49/CYRI interacts with Rac1 and locally suppresses protrusions</article-title><source>Nature Cell Biology</source><volume>20</volume><fpage>1159</fpage><lpage>1171</lpage><pub-id pub-id-type="doi">10.1038/s41556-018-0198-9</pub-id><pub-id pub-id-type="pmid">30250061</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gascoigne</surname><given-names>NRJ</given-names></name><name><surname>Rybakin</surname><given-names>V</given-names></name><name><surname>Acuto</surname><given-names>O</given-names></name><name><surname>Brzostek</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>TCR signal strength and T cell development</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>32</volume><fpage>327</fpage><lpage>348</lpage><pub-id pub-id-type="doi">10.1146/annurev-cellbio-111315-125324</pub-id><pub-id pub-id-type="pmid">27712102</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gaud</surname><given-names>G</given-names></name><name><surname>Lesourne</surname><given-names>R</given-names></name><name><surname>Love</surname><given-names>PE</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Regulatory mechanisms in T cell receptor signalling</article-title><source>Nature Reviews. Immunology</source><volume>18</volume><fpage>485</fpage><lpage>497</lpage><pub-id pub-id-type="doi">10.1038/s41577-018-0020-8</pub-id><pub-id pub-id-type="pmid">29789755</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gomez</surname><given-names>M</given-names></name><name><surname>Kioussis</surname><given-names>D</given-names></name><name><surname>Cantrell</surname><given-names>DA</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>The GTPase Rac-1 controls cell fate in the thymus by diverting thymocytes from positive to negative selection</article-title><source>Immunity</source><volume>15</volume><fpage>703</fpage><lpage>713</lpage><pub-id pub-id-type="doi">10.1016/s1074-7613(01)00235-7</pub-id><pub-id pub-id-type="pmid">11728333</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guo</surname><given-names>F</given-names></name><name><surname>Cancelas</surname><given-names>JA</given-names></name><name><surname>Hildeman</surname><given-names>D</given-names></name><name><surname>Williams</surname><given-names>DA</given-names></name><name><surname>Zheng</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Rac GTPase isoforms Rac1 and Rac2 play a redundant and crucial role in T-cell development</article-title><source>Blood</source><volume>112</volume><fpage>1767</fpage><lpage>1775</lpage><pub-id pub-id-type="doi">10.1182/blood-2008-01-132068</pub-id><pub-id pub-id-type="pmid">18579797</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hernández-Hoyos</surname><given-names>G</given-names></name><name><surname>Sohn</surname><given-names>SJ</given-names></name><name><surname>Rothenberg</surname><given-names>EV</given-names></name><name><surname>Alberola-Ila</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Lck activity controls CD4/CD8 T cell lineage commitment</article-title><source>Immunity</source><volume>12</volume><fpage>313</fpage><lpage>322</lpage><pub-id pub-id-type="doi">10.1016/s1074-7613(00)80184-3</pub-id><pub-id pub-id-type="pmid">10755618</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hogquist</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Signal strength in thymic selection and lineage commitment</article-title><source>Current Opinion in Immunology</source><volume>13</volume><fpage>225</fpage><lpage>231</lpage><pub-id pub-id-type="doi">10.1016/s0952-7915(00)00208-9</pub-id><pub-id pub-id-type="pmid">11228417</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hogquist</surname><given-names>KA</given-names></name><name><surname>Jameson</surname><given-names>SC</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>The self-obsession of T cells: how TCR signaling thresholds affect fate “decisions” and effector function</article-title><source>Nature Immunology</source><volume>15</volume><fpage>815</fpage><lpage>823</lpage><pub-id pub-id-type="doi">10.1038/ni.2938</pub-id><pub-id pub-id-type="pmid">25137456</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hsieh</surname><given-names>C-S</given-names></name><name><surname>Lee</surname><given-names>H-M</given-names></name><name><surname>Lio</surname><given-names>C-WJ</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Selection of regulatory T cells in the thymus</article-title><source>Nature Reviews. Immunology</source><volume>12</volume><fpage>157</fpage><lpage>167</lpage><pub-id pub-id-type="doi">10.1038/nri3155</pub-id><pub-id pub-id-type="pmid">22322317</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hu</surname><given-names>Q</given-names></name><name><surname>Nicol</surname><given-names>SA</given-names></name><name><surname>Suen</surname><given-names>AYW</given-names></name><name><surname>Baldwin</surname><given-names>TA</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Examination of thymic positive and negative selection by flow cytometry</article-title><source>Journal of Visualized Experiments</source><volume>2012</volume><elocation-id>68</elocation-id><pub-id pub-id-type="doi">10.3791/4269</pub-id><pub-id pub-id-type="pmid">23093039</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hwang</surname><given-names>J-R</given-names></name><name><surname>Byeon</surname><given-names>Y</given-names></name><name><surname>Kim</surname><given-names>D</given-names></name><name><surname>Park</surname><given-names>S-G</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Recent insights of T cell receptor-mediated signaling pathways for T cell activation and development</article-title><source>Experimental &amp; Molecular Medicine</source><volume>52</volume><fpage>750</fpage><lpage>761</lpage><pub-id pub-id-type="doi">10.1038/s12276-020-0435-8</pub-id><pub-id pub-id-type="pmid">32439954</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kaizuka</surname><given-names>Y</given-names></name><name><surname>Douglass</surname><given-names>AD</given-names></name><name><surname>Varma</surname><given-names>R</given-names></name><name><surname>Dustin</surname><given-names>ML</given-names></name><name><surname>Vale</surname><given-names>RD</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Mechanisms for segregating T cell receptor and adhesion molecules during immunological synapse formation in Jurkat T cells</article-title><source>PNAS</source><volume>104</volume><fpage>20296</fpage><lpage>20301</lpage><pub-id pub-id-type="doi">10.1073/pnas.0710258105</pub-id><pub-id pub-id-type="pmid">18077330</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kappes</surname><given-names>DJ</given-names></name><name><surname>He</surname><given-names>X</given-names></name><name><surname>He</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>CD4-CD8 lineage commitment: an inside view</article-title><source>Nature Immunology</source><volume>6</volume><fpage>761</fpage><lpage>766</lpage><pub-id pub-id-type="doi">10.1038/ni1230</pub-id><pub-id pub-id-type="pmid">16034433</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Klein</surname><given-names>L</given-names></name><name><surname>Kyewski</surname><given-names>B</given-names></name><name><surname>Allen</surname><given-names>PM</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Positive and negative selection of the T cell repertoire: what thymocytes see (and don’T see)</article-title><source>Nature Reviews. Immunology</source><volume>14</volume><fpage>377</fpage><lpage>391</lpage><pub-id pub-id-type="doi">10.1038/nri3667</pub-id><pub-id pub-id-type="pmid">24830344</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kronenberg</surname><given-names>M</given-names></name><name><surname>Gapin</surname><given-names>L</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>The unconventional lifestyle of NKT cells</article-title><source>Nature Reviews. Immunology</source><volume>2</volume><fpage>557</fpage><lpage>568</lpage><pub-id pub-id-type="doi">10.1038/nri854</pub-id><pub-id pub-id-type="pmid">12154375</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kumari</surname><given-names>S</given-names></name><name><surname>Curado</surname><given-names>S</given-names></name><name><surname>Mayya</surname><given-names>V</given-names></name><name><surname>Dustin</surname><given-names>ML</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>T cell antigen receptor activation and actin cytoskeleton remodeling</article-title><source>Biochimica et Biophysica Acta</source><volume>1838</volume><fpage>546</fpage><lpage>556</lpage><pub-id pub-id-type="doi">10.1016/j.bbamem.2013.05.004</pub-id><pub-id pub-id-type="pmid">23680625</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kurd</surname><given-names>NS</given-names></name><name><surname>Hoover</surname><given-names>A</given-names></name><name><surname>Yoon</surname><given-names>J</given-names></name><name><surname>Weist</surname><given-names>BM</given-names></name><name><surname>Lutes</surname><given-names>L</given-names></name><name><surname>Chan</surname><given-names>SW</given-names></name><name><surname>Robey</surname><given-names>EA</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Factors that influence the thymic selection of CD8αα intraepithelial lymphocytes</article-title><source>Mucosal Immunology</source><volume>14</volume><fpage>68</fpage><lpage>79</lpage><pub-id pub-id-type="doi">10.1038/s41385-020-0295-5</pub-id><pub-id pub-id-type="pmid">32483197</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lambolez</surname><given-names>F</given-names></name><name><surname>Kronenberg</surname><given-names>M</given-names></name><name><surname>Cheroutre</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Thymic differentiation of TCR alpha beta(+) CD8 alpha alpha(+) IELs</article-title><source>Immunological Reviews</source><volume>215</volume><fpage>178</fpage><lpage>188</lpage><pub-id pub-id-type="doi">10.1111/j.1600-065X.2006.00488.x</pub-id><pub-id pub-id-type="pmid">17291288</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname><given-names>JU</given-names></name><name><surname>Kim</surname><given-names>LK</given-names></name><name><surname>Choi</surname><given-names>JM</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Revisiting the concept of targeting NFAT to control T cell immunity and autoimmune diseases</article-title><source>Frontiers in Immunology</source><volume>9</volume><elocation-id>2747</elocation-id><pub-id pub-id-type="doi">10.3389/fimmu.2018.02747</pub-id><pub-id pub-id-type="pmid">30538703</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname><given-names>RA</given-names></name><name><surname>Traver</surname><given-names>D</given-names></name><name><surname>Matthes</surname><given-names>T</given-names></name><name><surname>Bertrand</surname><given-names>JY</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Ndrg1b and fam49ab modulate the PTEN pathway to control T-cell lymphopoiesis in the zebrafish</article-title><source>Blood</source><volume>128</volume><fpage>3052</fpage><lpage>3060</lpage><pub-id pub-id-type="doi">10.1182/blood-2016-09-742502</pub-id><pub-id pub-id-type="pmid">27827822</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McCaughtry</surname><given-names>TM</given-names></name><name><surname>Baldwin</surname><given-names>TA</given-names></name><name><surname>Wilken</surname><given-names>MS</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Clonal deletion of thymocytes can occur in the cortex with no involvement of the medulla</article-title><source>The Journal of Experimental Medicine</source><volume>205</volume><fpage>2575</fpage><lpage>2584</lpage><pub-id pub-id-type="doi">10.1084/jem.20080866</pub-id><pub-id pub-id-type="pmid">18936237</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McDonald</surname><given-names>BD</given-names></name><name><surname>Bunker</surname><given-names>JJ</given-names></name><name><surname>Erickson</surname><given-names>SA</given-names></name><name><surname>Oh-Hora</surname><given-names>M</given-names></name><name><surname>Bendelac</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Crossreactive αβ T cell receptors are the predominant targets of thymocyte negative selection</article-title><source>Immunity</source><volume>43</volume><fpage>859</fpage><lpage>869</lpage><pub-id pub-id-type="doi">10.1016/j.immuni.2015.09.009</pub-id><pub-id pub-id-type="pmid">26522985</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Melichar</surname><given-names>HJ</given-names></name><name><surname>Ross</surname><given-names>JO</given-names></name><name><surname>Herzmark</surname><given-names>P</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name><name><surname>Robey</surname><given-names>EA</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Distinct temporal patterns of T cell receptor signaling during positive versus negative selection in situ</article-title><source>Science Signaling</source><volume>6</volume><elocation-id>ra92</elocation-id><pub-id pub-id-type="doi">10.1126/scisignal.2004400</pub-id><pub-id pub-id-type="pmid">24129702</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oda</surname><given-names>H</given-names></name><name><surname>Suzuki</surname><given-names>H</given-names></name><name><surname>Sakai</surname><given-names>K</given-names></name><name><surname>Kitahara</surname><given-names>S</given-names></name><name><surname>Patrick</surname><given-names>MS</given-names></name><name><surname>Azuma</surname><given-names>Y</given-names></name><name><surname>Sugi</surname><given-names>K</given-names></name><name><surname>Kitamura</surname><given-names>T</given-names></name><name><surname>Kaye</surname><given-names>J</given-names></name><name><surname>Shirai</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Rac1-mediated Bcl-2 induction is critical in antigen-induced CD4 single-positive differentiation of a CD4+CD8+ immature thymocyte line</article-title><source>Journal of Leukocyte Biology</source><volume>81</volume><fpage>500</fpage><lpage>508</lpage><pub-id pub-id-type="doi">10.1189/jlb.1005585</pub-id><pub-id pub-id-type="pmid">17090688</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oh-Hora</surname><given-names>M</given-names></name><name><surname>Komatsu</surname><given-names>N</given-names></name><name><surname>Pishyareh</surname><given-names>M</given-names></name><name><surname>Feske</surname><given-names>S</given-names></name><name><surname>Hori</surname><given-names>S</given-names></name><name><surname>Taniguchi</surname><given-names>M</given-names></name><name><surname>Rao</surname><given-names>A</given-names></name><name><surname>Takayanagi</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Agonist-selected T cell development requires strong T cell receptor signaling and store-operated calcium entry</article-title><source>Immunity</source><volume>38</volume><fpage>881</fpage><lpage>895</lpage><pub-id pub-id-type="doi">10.1016/j.immuni.2013.02.008</pub-id><pub-id pub-id-type="pmid">23499491</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Phee</surname><given-names>H</given-names></name><name><surname>Au-Yeung</surname><given-names>BB</given-names></name><name><surname>Pryshchep</surname><given-names>O</given-names></name><name><surname>O’Hagan</surname><given-names>KL</given-names></name><name><surname>Fairbairn</surname><given-names>SG</given-names></name><name><surname>Radu</surname><given-names>M</given-names></name><name><surname>Kosoff</surname><given-names>R</given-names></name><name><surname>Mollenauer</surname><given-names>M</given-names></name><name><surname>Cheng</surname><given-names>D</given-names></name><name><surname>Chernoff</surname><given-names>J</given-names></name><name><surname>Weiss</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Pak2 is required for actin cytoskeleton remodeling, TCR signaling, and normal thymocyte development and maturation</article-title><source>eLife</source><volume>3</volume><elocation-id>e02270</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.02270</pub-id><pub-id pub-id-type="pmid">24843022</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pobezinsky</surname><given-names>LA</given-names></name><name><surname>Angelov</surname><given-names>GS</given-names></name><name><surname>Tai</surname><given-names>X</given-names></name><name><surname>Jeurling</surname><given-names>S</given-names></name><name><surname>Van Laethem</surname><given-names>F</given-names></name><name><surname>Feigenbaum</surname><given-names>L</given-names></name><name><surname>Park</surname><given-names>J-H</given-names></name><name><surname>Singer</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Clonal deletion and the fate of autoreactive thymocytes that survive negative selection</article-title><source>Nature Immunology</source><volume>13</volume><fpage>569</fpage><lpage>578</lpage><pub-id pub-id-type="doi">10.1038/ni.2292</pub-id><pub-id pub-id-type="pmid">22544394</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Qiu</surname><given-names>Z</given-names></name><name><surname>Sheridan</surname><given-names>BS</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Isolating lymphocytes from the mouse small intestinal immune system</article-title><source>Journal of Visualized Experiments</source><volume>2018</volume><elocation-id>132</elocation-id><pub-id pub-id-type="doi">10.3791/57281</pub-id><pub-id pub-id-type="pmid">29553537</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rincón</surname><given-names>M</given-names></name><name><surname>Whitmarsh</surname><given-names>A</given-names></name><name><surname>Yang</surname><given-names>DD</given-names></name><name><surname>Weiss</surname><given-names>L</given-names></name><name><surname>Dérijard</surname><given-names>B</given-names></name><name><surname>Jayaraj</surname><given-names>P</given-names></name><name><surname>Davis</surname><given-names>RJ</given-names></name><name><surname>Flavell</surname><given-names>RA</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>The JNK pathway regulates the In vivo deletion of immature CD4(+)CD8(+) thymocytes</article-title><source>The Journal of Experimental Medicine</source><volume>188</volume><fpage>1817</fpage><lpage>1830</lpage><pub-id pub-id-type="doi">10.1084/jem.188.10.1817</pub-id><pub-id pub-id-type="pmid">9815259</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ruscher</surname><given-names>R</given-names></name><name><surname>Kummer</surname><given-names>RL</given-names></name><name><surname>Lee</surname><given-names>YJ</given-names></name><name><surname>Jameson</surname><given-names>SC</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>CD8αα intraepithelial lymphocytes arise from two main thymic precursors</article-title><source>Nature Immunology</source><volume>18</volume><fpage>771</fpage><lpage>779</lpage><pub-id pub-id-type="doi">10.1038/ni.3751</pub-id><pub-id pub-id-type="pmid">28530714</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ruscher</surname><given-names>R</given-names></name><name><surname>Lee</surname><given-names>ST</given-names></name><name><surname>Salgado</surname><given-names>OC</given-names></name><name><surname>Breed</surname><given-names>ER</given-names></name><name><surname>Osum</surname><given-names>SH</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Intestinal CD8αα IELs derived from two distinct thymic precursors have staggered ontogeny</article-title><source>The Journal of Experimental Medicine</source><volume>217</volume><elocation-id>e20192336</elocation-id><pub-id pub-id-type="doi">10.1084/jem.20192336</pub-id><pub-id pub-id-type="pmid">32687575</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sabapathy</surname><given-names>K</given-names></name><name><surname>Kallunki</surname><given-names>T</given-names></name><name><surname>David</surname><given-names>JP</given-names></name><name><surname>Graef</surname><given-names>I</given-names></name><name><surname>Karin</surname><given-names>M</given-names></name><name><surname>Wagner</surname><given-names>EF</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>c-Jun NH2-terminal kinase (JNK)1 and JNK2 have similar and stage-dependent roles in regulating T cell apoptosis and proliferation</article-title><source>The Journal of Experimental Medicine</source><volume>193</volume><fpage>317</fpage><lpage>328</lpage><pub-id pub-id-type="doi">10.1084/jem.193.3.317</pub-id><pub-id pub-id-type="pmid">11157052</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Saoudi</surname><given-names>A</given-names></name><name><surname>Kassem</surname><given-names>S</given-names></name><name><surname>Dejean</surname><given-names>A</given-names></name><name><surname>Gaud</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Rho-GTPases as key regulators of T lymphocyte biology</article-title><source>Small GTPases</source><volume>5</volume><elocation-id>e28208</elocation-id><pub-id pub-id-type="doi">10.4161/sgtp.28208</pub-id><pub-id pub-id-type="pmid">24825161</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shang</surname><given-names>W</given-names></name><name><surname>Jiang</surname><given-names>Y</given-names></name><name><surname>Boettcher</surname><given-names>M</given-names></name><name><surname>Ding</surname><given-names>K</given-names></name><name><surname>Mollenauer</surname><given-names>M</given-names></name><name><surname>Liu</surname><given-names>Z</given-names></name><name><surname>Wen</surname><given-names>X</given-names></name><name><surname>Liu</surname><given-names>C</given-names></name><name><surname>Hao</surname><given-names>P</given-names></name><name><surname>Zhao</surname><given-names>S</given-names></name><name><surname>McManus</surname><given-names>MT</given-names></name><name><surname>Wei</surname><given-names>L</given-names></name><name><surname>Weiss</surname><given-names>A</given-names></name><name><surname>Wang</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Genome-wide CRISPR screen identifies FAM49B as a key regulator of actin dynamics and T cell activation</article-title><source>PNAS</source><volume>115</volume><fpage>E4051</fpage><lpage>E4060</lpage><pub-id pub-id-type="doi">10.1073/pnas.1801340115</pub-id><pub-id pub-id-type="pmid">29632189</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stritesky</surname><given-names>GL</given-names></name><name><surname>Jameson</surname><given-names>SC</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Selection of self-reactive T cells in the thymus</article-title><source>Annual Review of Immunology</source><volume>30</volume><fpage>95</fpage><lpage>114</lpage><pub-id pub-id-type="doi">10.1146/annurev-immunol-020711-075035</pub-id><pub-id pub-id-type="pmid">22149933</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stritesky</surname><given-names>GL</given-names></name><name><surname>Xing</surname><given-names>Y</given-names></name><name><surname>Erickson</surname><given-names>JR</given-names></name><name><surname>Kalekar</surname><given-names>LA</given-names></name><name><surname>Wang</surname><given-names>X</given-names></name><name><surname>Mueller</surname><given-names>DL</given-names></name><name><surname>Jameson</surname><given-names>SC</given-names></name><name><surname>Hogquist</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Murine thymic selection quantified using a unique method to capture deleted T cells</article-title><source>PNAS</source><volume>110</volume><fpage>4679</fpage><lpage>4684</lpage><pub-id pub-id-type="doi">10.1073/pnas.1217532110</pub-id><pub-id pub-id-type="pmid">23487759</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tarakhovsky</surname><given-names>A</given-names></name><name><surname>Kanner</surname><given-names>SB</given-names></name><name><surname>Hombach</surname><given-names>J</given-names></name><name><surname>Ledbetter</surname><given-names>JA</given-names></name><name><surname>Müller</surname><given-names>W</given-names></name><name><surname>Killeen</surname><given-names>N</given-names></name><name><surname>Rajewsky</surname><given-names>K</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>A role for CD5 in TCR-mediated signal transduction and thymocyte selection</article-title><source>Science</source><volume>269</volume><fpage>535</fpage><lpage>537</lpage><pub-id pub-id-type="doi">10.1126/science.7542801</pub-id><pub-id pub-id-type="pmid">7542801</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Turner</surname><given-names>M</given-names></name><name><surname>Mee</surname><given-names>PJ</given-names></name><name><surname>Walters</surname><given-names>AE</given-names></name><name><surname>Quinn</surname><given-names>ME</given-names></name><name><surname>Mellor</surname><given-names>AL</given-names></name><name><surname>Zamoyska</surname><given-names>R</given-names></name><name><surname>Tybulewicz</surname><given-names>VL</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>A requirement for the Rho-family GTP exchange factor Vav in positive and negative selection of thymocytes</article-title><source>Immunity</source><volume>7</volume><fpage>451</fpage><lpage>460</lpage><pub-id pub-id-type="doi">10.1016/s1074-7613(00)80367-2</pub-id><pub-id pub-id-type="pmid">9354466</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tybulewicz</surname><given-names>VLJ</given-names></name><name><surname>Henderson</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Rho family GTPases and their regulators in lymphocytes</article-title><source>Nature Reviews. Immunology</source><volume>9</volume><fpage>630</fpage><lpage>644</lpage><pub-id pub-id-type="doi">10.1038/nri2606</pub-id><pub-id pub-id-type="pmid">19696767</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ueno</surname><given-names>T</given-names></name><name><surname>Saito</surname><given-names>F</given-names></name><name><surname>Gray</surname><given-names>DHD</given-names></name><name><surname>Kuse</surname><given-names>S</given-names></name><name><surname>Hieshima</surname><given-names>K</given-names></name><name><surname>Nakano</surname><given-names>H</given-names></name><name><surname>Kakiuchi</surname><given-names>T</given-names></name><name><surname>Lipp</surname><given-names>M</given-names></name><name><surname>Boyd</surname><given-names>RL</given-names></name><name><surname>Takahama</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>CCR7 signals are essential for cortex-medulla migration of developing thymocytes</article-title><source>The Journal of Experimental Medicine</source><volume>200</volume><fpage>493</fpage><lpage>505</lpage><pub-id pub-id-type="doi">10.1084/jem.20040643</pub-id><pub-id pub-id-type="pmid">15302902</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Van De Wiele</surname><given-names>CJ</given-names></name><name><surname>Marino</surname><given-names>JH</given-names></name><name><surname>Murray</surname><given-names>BW</given-names></name><name><surname>Vo</surname><given-names>SS</given-names></name><name><surname>Whetsell</surname><given-names>ME</given-names></name><name><surname>Teague</surname><given-names>TK</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Thymocytes between the beta-selection and positive selection checkpoints are nonresponsive to IL-7 as assessed by STAT-5 phosphorylation</article-title><source>Journal of Immunology</source><volume>172</volume><fpage>4235</fpage><lpage>4244</lpage><pub-id pub-id-type="doi">10.4049/jimmunol.172.7.4235</pub-id><pub-id pub-id-type="pmid">15034036</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wojciechowski</surname><given-names>S</given-names></name><name><surname>Tripathi</surname><given-names>P</given-names></name><name><surname>Bourdeau</surname><given-names>T</given-names></name><name><surname>Acero</surname><given-names>L</given-names></name><name><surname>Grimes</surname><given-names>HL</given-names></name><name><surname>Katz</surname><given-names>JD</given-names></name><name><surname>Finkelman</surname><given-names>FD</given-names></name><name><surname>Hildeman</surname><given-names>DA</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Bim/Bcl-2 balance is critical for maintaining naive and memory T cell homeostasis</article-title><source>The Journal of Experimental Medicine</source><volume>204</volume><fpage>1665</fpage><lpage>1675</lpage><pub-id pub-id-type="doi">10.1084/jem.20070618</pub-id><pub-id pub-id-type="pmid">17591857</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname><given-names>X</given-names></name><name><surname>Tu</surname><given-names>X</given-names></name><name><surname>Joeng</surname><given-names>KS</given-names></name><name><surname>Hilton</surname><given-names>MJ</given-names></name><name><surname>Williams</surname><given-names>DA</given-names></name><name><surname>Long</surname><given-names>F</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Rac1 activation controls nuclear localization of beta-catenin during canonical Wnt signaling</article-title><source>Cell</source><volume>133</volume><fpage>340</fpage><lpage>353</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2008.01.052</pub-id><pub-id pub-id-type="pmid">18423204</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname><given-names>X</given-names></name><name><surname>Zhang</surname><given-names>S</given-names></name><name><surname>Li</surname><given-names>P</given-names></name><name><surname>Lu</surname><given-names>J</given-names></name><name><surname>Xuan</surname><given-names>Q</given-names></name><name><surname>Ge</surname><given-names>Q</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Maturation and emigration of single-positive thymocytes</article-title><source>Clinical &amp; Developmental Immunology</source><volume>2013</volume><elocation-id>282870</elocation-id><pub-id pub-id-type="doi">10.1155/2013/282870</pub-id><pub-id pub-id-type="pmid">24187562</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yuki</surname><given-names>KE</given-names></name><name><surname>Marei</surname><given-names>H</given-names></name><name><surname>Fiskin</surname><given-names>E</given-names></name><name><surname>Eva</surname><given-names>MM</given-names></name><name><surname>Gopal</surname><given-names>AA</given-names></name><name><surname>Schwartzentruber</surname><given-names>JA</given-names></name><name><surname>Majewski</surname><given-names>J</given-names></name><name><surname>Cellier</surname><given-names>M</given-names></name><name><surname>Mandl</surname><given-names>JN</given-names></name><name><surname>Vidal</surname><given-names>SM</given-names></name><name><surname>Malo</surname><given-names>D</given-names></name><name><surname>Dikic</surname><given-names>I</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>CYRI/FAM49B negatively regulates RAC1-driven cytoskeletal remodelling and protects against bacterial infection</article-title><source>Nature Microbiology</source><volume>4</volume><fpage>1516</fpage><lpage>1531</lpage><pub-id pub-id-type="doi">10.1038/s41564-019-0484-8</pub-id><pub-id pub-id-type="pmid">31285585</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>R</given-names></name><name><surname>Alt</surname><given-names>FW</given-names></name><name><surname>Davidson</surname><given-names>L</given-names></name><name><surname>Orkin</surname><given-names>SH</given-names></name><name><surname>Swat</surname><given-names>W</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Defective signalling through the T- and B-cell antigen receptors in lymphoid cells lacking the vav proto-oncogene</article-title><source>Nature</source><volume>374</volume><fpage>470</fpage><lpage>473</lpage><pub-id pub-id-type="doi">10.1038/374470a0</pub-id><pub-id pub-id-type="pmid">7700359</pub-id></element-citation></ref></ref-list></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.76940.sa0</article-id><title-group><article-title>Editor's evaluation</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Malissen</surname><given-names>Bernard</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/035xkbk20</institution-id><institution>Centre d'Immunologie de Marseille-Luminy, Aix Marseille Université</institution></institution-wrap><country>France</country></aff></contrib></contrib-group><related-object id="sa0ro1" object-id-type="id" object-id="10.1101/2022.01.18.476719" link-type="continued-by" xlink:href="https://sciety.org/articles/activity/10.1101/2022.01.18.476719"/></front-stub><body><p>The protein called Family with sequence similarity 49 member B (in short Fam49b) is a newly discovered negative regulator of TCR signaling that suppresses Rac-1 activity in vitro. The present manuscript analyzes in a comprehensive and solid manner the role of Fam49b during thymic T cell development. It is a very valuable piece of work in that it demonstrates that the Fam49b protein dampens thymocyte TCR signaling allowing thymocytes to escape negative selection.</p></body></sub-article><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.76940.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Malissen</surname><given-names>Bernard</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/035xkbk20</institution-id><institution>Centre d'Immunologie de Marseille-Luminy, Aix Marseille Université</institution></institution-wrap><country>France</country></aff></contrib></contrib-group></front-stub><body><boxed-text id="sa2-box1"><p>Our editorial process produces two outputs: i) <ext-link ext-link-type="uri" xlink:href="https://sciety.org/articles/activity/10.1101/2022.01.18.476719">public reviews</ext-link> designed to be posted alongside <ext-link ext-link-type="uri" xlink:href="https://www.biorxiv.org/content/10.1101/2022.01.18.476719v1">the preprint</ext-link> for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.</p></boxed-text><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;Fam49b dampens TCR signal strength to regulate survival of positively selected thymocytes&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Tadatsugu Taniguchi as the Senior Editor. The reviewers have opted to remain anonymous.</p><p>The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.</p><p>Essential revisions (for the authors):</p><p>The three Reviewers are convergent views and consider that the experiments are well performed and the results are convincing. They consider that</p><p>1) having data from TCR transgenic mice,</p><p>2) adding some data from experiments in response to the questions that were raised, would greatly improve the manuscript.</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>1. Thymocyte selection (and the effects of mutations on selection) is difficult to explore in mice with a polyclonal T cell repertoire, but can be studied in more detail in TCR transgenic (TCR-tg) mice that express a TCR with known specificity. It would be informative to see the phenotype of TCR-tg x Fam49b mice. Any possible effects on positive selection, in particular, would be better revealed with this model and the proposed shift from positive to negative selection could be better demonstrated. Also, CD28 has been shown to be critical for negative selection. Analysis of CD28 KO/Fam49b KO mice would be very informative as it would be predicted that the assumed negative selection would be prevented or that there would be a strong diversion of cells to the DN TCR+ thymocyte CD8aa TCR+ iIEL precursor lineage as shown in PMID: 22544394.</p><p>2. The deletion strategy shown in Figure 1a,b could result in expression of Fam49a and Fam49b proteins with c-terminal truncations that might be partially active. What epitopes were the antibodies used for Figure 1c raised against? Are these epitopes present in potential truncated proteins expressed in the KO mice? Analysis of mRNA expression by rt-PCR should also be performed.</p><p>3. It is possible that Fam49a and Fam49b have partially redundant functions. Did the authors generate double KO mice to analyze if this is feasible?</p><p>4. Signaling experiments should be performed with Fam49b thymocytes/T cells to document the predicted effects on signal transduction. A survey of TCR signaling responses is warranted in this study. Analysis of thymocyte adhesion similar to experiments done with Rac-tg mice (PMID: 22544394) would be informative.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>This study is very well designed, but, while there is support for the main message of this study (Fam49b is involved in thymic selection), there are several aspects that should be clarified by performing new experiments in order to improve the manuscript. The authors should consider the following major points:</p><p>– One major drawback of this manuscript is the lack of TCR transgenic mice that could have been included to avoid potential bias due to a shift in TCR repertoire. In addition, the authors claim &quot;Our results demonstrate that Fam49b dampens thymocytes TCR signaling in order to escape negative selection ….&quot; but there is no single experiment addressing the impact of Fam49b deficiency on TCR signaling in thymocytes. The authors should cross their Fam49b KO mice with TCR Tg in order to analyze if Fam49b deficiency affects calcium flux in a way that is representative of decreased positive selection or enhanced negative selection. Since this protein has been shown to regulate the actin cytoskeleton through Rac1-Pak, we could have expected some signaling studies of this axis and more generally of other pathways (ZAP, Vav1, ERK, Rela, Akt, …) and imaging studies of synapse organization.</p><p>– The effect of Fam49b deficiency is relatively mild in the thymus as compared to that in the periphery. The authors should explain why peripheral T cells are so strongly decreased since it is difficult to justify this strong decrease of peripheral T cells (particularly CD8<sup>+</sup> T cells) simply by increased negative selection.</p><p>– Absolute numbers of thymic cells in Figure 2D should be included.</p><p>– The authors performed bone marrow chimera experiments to show T-cell intrinsic defects. In Figure 3A, they show the data concerning peripheral T cells but no data about the effect in the thymus despite this sentence: &quot;The Fam49b-KO thymocytes developed in WT thymic environment are like those developed in the germline Fam49b-KO environment in terms of both thymocyte and peripheral lymphocyte phenotypes. Therefore, the effect of Fam49b mutation on T cell development is predominantly due to thymocyte intrinsic functions.&quot; This data should be added to the figure.</p><p>– The data presented in figure 3C and Figure 3 E show a &quot;block&quot; at the transition from TCRbintCD69+ to TCRbhiCD69+ and TCRbintCD5hi to TCRbhiCD5hi, suggesting defective signals in TCRbintCD69+ and TCRbintCD5hi which leads to inefficient transition. Both TCRbintCD69+ and TCRbintCD5hi are still very enriched with DP cells (see supplementary data). So, I wouldn't necessarily conclude that post-positive selection events are affected by this deficiency. This point should be clarified.</p><p>– In Figure 4B, the staining of CD69 in CD8<sup>+</sup> T cells is weird and is suggestive that CD3low cells were not excluded in the gating strategy. Did the authors exclude CD3 low CD8<sup>+</sup> T cells from their analysis on CD8SP thymocytes in general?</p><p>It is also difficult to conclude that the increased CD5 expression on DP cells is due to higher TCR signaling or rather to a shift in TCR repertoire towards higher affinity TCR. An analysis in TCR transgenic mice would resolve this issue</p><p>– In Figure 4C, the IL-2 production was tested after three days of stimulation. This is too late since the peak of IL-2 production occurs in general 24h after stimulation. Kinetics of IL-2 production will be more informative.</p><p>– The data presented in Figure 5 concerning the differential impact of Fam49b deficiency on CD8aa TCRab+ IELs, liver iNKT cells and lymph node Tregs Tregs are very descriptive, without any data on the development in the thymus. This should be clarified.</p><p><italic>Reviewer #3 (Recommendations for the authors):</italic></p><p>1) Figure 1: it would be informative to add the sequencing trace files for the confirmation of the mutation. Furthermore, after which amino acid (what is the protein length of Fam49a and Fam49b) is the stop codon? Is it possible that a truncated form of Fam49a and Fam49b is expressed? Would the antibodies that have been used for the western blots detect truncated forms? Based on the information provided, it is not clear whether the antibodies against Fam94a and Fem49b recognize the N, C terminus or another region of the proteins.</p><p>2) Figure 2A and B: It would be informative to also show the percentages and numbers of TCRb+ cells as well as to pre-gate on TCRb+ cells when displaying CD4 and CD8a expression. Is there an increase in DN cells in the periphery? Which marker was used for B cells? CD19? This is not indicated.</p><p>3) In Figure panel 2D: it would be important to pre-gate on TCRb-high cells for determining the CD4/CD8SP ratio. Otherwise, the CD8SP population includes the CD8 ISP subset.</p><p>4) Figure 3: Did the authors also analyze CD44 and CD62L expression in the mixed BM chimeric mice? This would help to understand whether the altered CD44/CD62L expression (relative reduction of the frequency of naive cells) shown in Figure 2C is T cell-intrinsic or potentially a consequence of (a partial) T cell homeostatic expansion due to T cell lymphopenia.</p><p>5) The authors conclude that the reduced numbers of SP cells and peripheral T cells is due to a defect in negative selection. How can the authors exclude that the reduced numbers of T cells is not due to a general survival defect of post positive selection SP thymocytes? What about expression of pro-apoptotic and pro-survival factors such as Bim and Bcl2, respectively? And what about IL-7 receptor α expression, which is upregulated during positive selection. The expression of these factors should be analyzed.</p><p>6) The conclusion that negative selection is altered is based on the results shown in Figure 4A. The frequency of cleaved Caspase-3+ cells is very low. To strengthen the conclusion it would be good to include other approaches that indicate altered negative selection. What happens if WT and Fam49b KO thymocytes are cultured overnight in the presence/absence of anti-CD3 stimulation: would this also reveal changes in cleaved Caspase3? What about superantigen (SEB)-induced deletion of specific TCR Vb isoforms? This is another readout that can be used to study negative selection.</p><p>7) How does altered signaling strength in Fam49b KO thymocytes affect the development of thymic Foxp3+ Tregs and thymic NKT cells? Is there a difference in the frequency of these cells in the thymus? In Figure 5, data are shown from LN (Foxp3) and liver (iNKT) but no data are shown from the thymus.</p><p>8) The data from peripheral T cells are not convincingly supporting the conclusion that TCR signaling strength is altered. Cell proliferation is normal, wouldn't one expect changes in proliferation if signaling strength in KO cells is changed? What about the upregulation of activation markers such as CD69 and CD25? It would also be informative to plot Cell trace violet dilution with intracellular IL-2 staining to determine whether enhanced IL-2 is linked with a particular division stage. What about other cytokines, e.g. TNF or IFNγ? And what happens if cells are stimulated with anti-CD3/CD28 – would there still be a difference in IL-2?</p><p>9) The IEL data are interesting. It would be good to show the gating strategy as well as a representative contour plot for all subsets shown in the diagram in panel 5B and 5C. However, the reduction of the natural IELs could be due to changes in negative selection or – similar to my comment #5 – reduced survival of selected cells (without affecting negative selection). This should be at least discussed as an alternative explanation.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Fam49b dampens TCR signal strength to regulate survival of positively selected thymocytes&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Tadatsugu Taniguchi (Senior Editor) and a Reviewing Editor.</p><p>The 3 Reviewers appreciate the important additions contained in the revised manuscript such as the inclusion of data from TCR transgenic mice that improve the quality and impact of the study. However and as outlined below by the 3 Reviewers several precise issues need to be addressed prior to publication in <italic>eLife</italic>.</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>The revised manuscript contains some important additions such as the inclusion of data from TCR transgenic mice that improve the quality and impact of the study. That said, this report is mainly descriptive with very little mechanistic insight. It was hoped that the requested signaling/biochemistry experiments would contribute to mechanism, but as stated below, the results of these studies are not trustworthy. Several issues need to be addressed prior to publication:</p><p>1. The observation that Fam49a KO mice have no obvious phenotype is not a valid reason for not generating Fam49a/49b double KO (DKO) mice. As mentioned in the review, there could be partial redundancy between Fam49a and 49b and the DKO could have a phenotype more severe than the Fam49b KO. This reviewer does not insist on the generation of the DKO (though it is unfortunate) but does want to make the point that the authors' reasoning for not generating the DKO is flawed.</p><p>2. The CD69 surface expression results are perplexing. While CD5 surface expression is &quot;analog&quot; and parallels TCR signal intensity, CD69 expression has historically been found to be more &quot;digital&quot; (i.e., CD69+ and CD69- populations rather than a shift in MFI), though the data in Figure 4b indicate an analog pattern (the differences shown are also very slight).</p><p>3. In Figure 5a and 5b, how do the authors explain normal numbers of semi-mature cells when the numbers of immature and mature cells are reduced?</p><p>4. The results in Figure 5c are not convincing (that there is a difference in the expression of IL-7ra).</p><p>5. In Figure 5d,e how do the authors explain increased cell death of semi-mature cells when these cells were not reduced (Figure 5a,b)?</p><p>6. Higher expression of CD5 and CD69 in Figure 6 is not convincing.</p><p>7. Figure 6d, how do the authors explain the low % of naive OTI T cells in the control mice? Typically, &gt;90% of OTI CD8<sup>+</sup> T cells are naive in lympho-replete mice.</p><p>8. Figure 6f,g, these results are the most problematic in the revised paper. pERK should be virtually undetectable in unstimulated thymocytes and T cells. Also, there is no increase in pERK after stimulation indicating that the cells are not activated. Other effectors (pLAT, pZAP, pZAP-70) should be checked. Several experiments should be performed and statistics shown in Figure 6g. Most notably, the authors do not evaluate Rac activation in the mutant mice to show that it is elevated as predicted!</p><p>9. The results in Figure 7 are interesting but the authors did not perform the requested experiment, namely to generate CD28 KO / Fam49b KO (DKO) mice to test if negative selection is indeed increased in Fam49b mice. Deletion of CD28 would allow the rescue of otherwise negatively selected thymocytes, and an increase in DN, TCR+, PD-1+ cells in CD28/Fam49b DKO mice compared to CD28 KO mice would provide strong support for their hypothesis that negative selection is increased in the absence of Fam49b.</p><p>10. Supplement 3a and 3b are mentioned in the text but not included in the figures.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>We would like to thank the authors for performing several experiments that resolved some issues raised during my first reviewing process. These new experimental data sets revealed that Fam49b, besides its impact on thymic selection, plays an important role in T cell survival in the periphery. Based on these new findings, the authors should amend the discussion that is mainly focused on thymic selection. In addition, the data presented concerning the impact Fam49b on TCR signaling are not convincing and concerns only ERK without quantification and statistical analyses. This part should be strengthened by analyzing other signaling pathways.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Fam49b dampens TCR signal strength to regulate survival of positively selected thymocytes and peripheral T cells&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Tadatsugu Taniguchi (Senior Editor) and a Reviewing Editor.</p><p>The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:</p><p>The authors' explanation for the perplexing results in Figure 5a and 5b (i.e., that proliferation differences could explain why the numbers of semi-mature cells are normal in the KO when the numbers of immature and mature cells are reduced) is unsatisfactory. The reviewer is unaware of any data showing that SP thymocytes proliferate at any stage of their maturation. If I am mistaken, please provide the citation for these findings. I think it more likely that the gating (particularly distinguishing CD62L-lo from -neg and CD69-lo from -neg) is prone to error. In any event, the finding that semi-mature cells are not reduced but immature and mature cells are reduced it very confusing. Because I believe this is a technical problem, I suggest just showing the results for only immature and mature cells to avoid this apparent inconsistency.</p><p>In Figure 2c, what are CD62L-CD44- cells? Legend says plots are LN T cells not total LN cells, but Figure 2c shows a large population of CD62L-CD44- cells. To our knowledge, no CD62L-CD44- T cell populations have been previously described. Could it be that the cells in Figure 2c are total LN cells?</p><p>Line 163 &quot;Taken together, these results suggest that positive selection remains mostly unaffected by the lack of Fam49b molecule, Fam49b plays a more important role in the later stages of T cell development in the thymus.&quot; What &quot;later stages&quot; of development are they referring to? Do they mean survival? Also, the reduction of TCR-hi CD69+ cells (Figure 3c) suggests that late stages of positive selection are affected. I would maintain that &quot;post-selection&quot; means CD69-neg and that any CD69+ cell is undergoing selection.</p><p>Line 126 &quot;we concluded that Fam49a is unlikely to 127 play a significant role in T cell development&quot; is obviously misleading since the authors mention in their response that the double Fam49a/49b KO has a more severe phenotype than the Fam49a KO.</p><p>Since the authors did make OTI TCR transgenic Fam49b KO mice then it would be very helpful to see analysis of positive selection (e.g., as shown in Figure 3c,e, Figure 4b, Figure 5b) to show if the affects observed with polyclonal mice are observed with TCR transgenic mice.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Fam49b dampens TCR signal strength to regulate survival of positively selected thymocytes and peripheral T cells&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Tadatsugu Taniguchi (Senior Editor) and a Reviewing Editor.</p><p>The manuscript has been improved but there is a remaining issue that need to be addressed, as outlined below:</p><p>Therefore, prior to accepting the manuscript please remove the data and the text corresponding to Figure 2c as requested below by Reviewer #1.</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>I appreciate the authors efforts to respond to my concerns/comments. I accept their response to all of the points except for the problem with Figure 2c. It is true that there is a very small percentage of CD44-CD62L- T cells that can be detected in B6 mice, however this percentage is typically &lt;5% of CD4 and CD8 cells. In Figure 2c, 16% of B6 CD4<sup>+</sup> T cells are CD62L-CD44- and 30% of B6 CD8<sup>+</sup> T cells are CD62L-CD44-. This is abnormal. Further, CD62L+CD44+ central memory cells are missing from the B6 CD4 subset in Figure 2c but are present in B6 CD8<sup>+</sup> cells. This is also abnormal. Altogether this means that there is a problem with the FACS experiment used for Figure 2c. If the authors are unable to obtain believable CD44 vs CD62L FACS profiles for their control mice then the results from KO mice cannot be interpreted and Figure 2c should be removed as it is misleading as is.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.76940.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential revisions (for the authors):</p><p>The three Reviewers are convergent views and consider that the experiments are well performed and the results are convincing. They consider that</p><p>1) having data from TCR transgenic mice,</p></disp-quote><p>We appreciate this kind and helpful suggestion. We generated Fam49b-KO OT-I mice and analyzed thymocytes and peripheral T cells. These new results are presented in Revised Figure 6 and are described in the Result section (page 10, lines 211-233).</p><disp-quote content-type="editor-comment"><p>2) adding some data from experiments in response to the questions that were raised, would greatly improve the manuscript.</p></disp-quote><p>We have added many new experimental data per reviewers’ suggestions. We hope that our point-by-point responses to the reviewer’s comments are clear and satisfactory.</p><disp-quote content-type="editor-comment"><p>Reviewer #1 (Recommendations for the authors):</p><p>1. Thymocyte selection (and the effects of mutations on selection) is difficult to explore in mice with a polyclonal T cell repertoire, but can be studied in more detail in TCR transgenic (TCR-tg) mice that express a TCR with known specificity. It would be informative to see the phenotype of TCR-tg x Fam49b mice. Any possible effects on positive selection, in particular, would be better revealed with this model and the proposed shift from positive to negative selection could be better demonstrated.</p></disp-quote><p>We appreciate the reviewer for raising this important question. As suggested, we generated Fam49b-KO OT-I mice, and analyzed thymocytes and peripheral T cells (Revised Figure 6). Based on our observation that enhanced TCR-signaling strength intrinsic to Fam49b-KO DP thymocytes leads to excessive clonal deletion in the cortex and medulla (Figure 4A and Figure 4B), we postulated that enhanced TCR-signal strength of Fam49b-KO TCR-Vα2<sup>+</sup> DP thymocytes could be diverted into negative selection from positive selection. Even though Fam49b-KO TCR-Vα2<sup>+</sup> DP showed higher expression of CD5 and CD69 molecules (Revised Figure 6—figure supplement 1A-1B), suggesting Fam49b-KO TCR-Vα2<sup>+</sup> DP thymocytes had received stronger TCR signaling than the WT TCR-Vα2<sup>+</sup> DP thymocytes, the frequencies and numbers of CD8 SP thymocyte (Revised Figure 6A-6B) as well as peripheral T cells (Revised Figure 6C-6D) were comparable between WT OT-I and Fam49b-KO OT-I mice of 6 weeks of age. We reasoned that the increased TCR signaling of DP in Fam49b-KO OT-I mice is still below the threshold for inducing apoptosis in DP and SP CD8 T cells in the thymus.</p><p>Interestingly, Fam49b-KO OT-I mice showed dramatical reductions in total CD8 T cell (Revised Figure 6C), especially naïve CD8 T cells, (Revised Figure 6D) with age. Based on our observation of the dramatic loss of naïve CD8 T cells in Fam49b-KO OT-I mice with age, we hypothesized that Fam49b is required for peripheral T cells survival. To determine if Fam49b-KO deficiency led to increased apoptosis in naïve CD8 T cells, we assessed apoptosis of peripheral naïve CD8 T cells in Fam49b-KO OT-I mice using 7-AAD and annexin V staining. We found that apoptosis of peripheral T cells was markedly elevated in naïve CD8 T cells from Fam49b-KO OT-I mice (Revised Figure 6E) and polyclonal Fam49b-KO mice (Revised Figure 6—figure supplement 1D). In summary, by analyzing Fam49b-KO OT-I mice, we found new function of Fam49b molecules on peripheral T cells. Fam49b plays an important role in the maintenance and survival of peripheral T cells. These results are presented in Revised Figure 6 and are described in the Result section (page 10, lines 211-233)</p><disp-quote content-type="editor-comment"><p>Also, CD28 has been shown to be critical for negative selection. Analysis of CD28 KO/Fam49b KO mice would be very informative as it would be predicted that the assumed negative selection would be prevented or that there would be a strong diversion of cells to the DN TCR+ thymocyte CD8aa TCR+ iIEL precursor lineage as shown in PMID: 22544394.</p></disp-quote><p>This is an interesting perspective. It has been reported that CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs develop from two distinct CD8αα IEL precursors (IELps) in the thymus, which are Type A IELps (PD-1<sup>+</sup>) and Type B IELps (PD-1<sup>-</sup>) [1]. In that paper, CD28-KO mice, in which self-reactive thymocytes are diverted into the CD8αα IEL lineage, had only more Type A IELps (PD-1<sup>+</sup>), not more Type B IELps (PD-1<sup>−</sup>), than WT mice. We examined the frequencies and numbers of IELps in the thymus from WT and Fam49b-KO mice at 6-7 weeks of age. We observed comparable numbers of Type A IELps, but more Type B IELps in Fam49b-KO mice than in WT mice (Revised Figure 7—figure supplement 3A right panel). These results suggested that Fam49b might be specifically involved in development of thymic Type B IELps lineage, but not Type A IELps lineage, in a CD28-independent manner.</p><disp-quote content-type="editor-comment"><p>2. The deletion strategy shown in Figure 1a,b could result in expression of Fam49a and Fam49b proteins with c-terminal truncations that might be partially active. What epitopes were the antibodies used for Figure 1c raised against? Are these epitopes present in potential truncated proteins expressed in the KO mice? Analysis of mRNA expression by rt-PCR should also be performed.</p></disp-quote><p>We apologize for the lack of clarity. Anti-Fam49a polyclonal antibodies (Σ, SAB 1103179) was produced by synthetic peptide corresponding to amino acids 56-70 of human FAM49a molecules in rabbit. Anti-Fam49b mouse monoclonal antibody (Santa cruz, D-8, sc-390478) binds to 8-20 near the N-terminus of Fam49b of human origin. We clarified this point in the corresponding Figure 1C legend. Fam49a-KO gene ablation is achieved by creating premature stop codon in exon 7, which can be translated into 140 amino acids of truncated Fam49a protein (Revised Figure 1B). Fam49b-KO gene ablation is achieved by creating premature stop codon in exon 6, which can be translated into 117 amino acids of truncated Fam49a protein (Revised Figure 1A). Therefore, potential c-terminal truncated Fam49a or Fam49b proteins could be recognized by Anti-Fam49a Ab or Anti-Fam49b antibody respectively, if the truncated Fam49a or Fam49b proteins are stably expressed in KO mice. However, we did not detect the band expected to be a truncated Fam49a or Fam49b protein by western blotting (Figure 1C). We believed that the potential truncated Fam49a or Fam49b protein can’t be translated or is very unstably expressed in KO mice.</p><disp-quote content-type="editor-comment"><p>3. It is possible that Fam49a and Fam49b have partially redundant functions. Did the authors generate double KO mice to analyze if this is feasible?</p></disp-quote><p>That is an interesting query. However, we did not generate double KO mice because there was no significant difference between WT mice and Fam49a-KO in terms of the phenotype of peripheral T cells and thymocytes subsets. Fam49a-KO mice phenotype results are presented in Figure 2 and are described in the Result section (page 6-7, lines 103-125)</p><disp-quote content-type="editor-comment"><p>4. Signaling experiments should be performed with Fam49b thymocytes/T cells to document the predicted effects on signal transduction. A survey of TCR signaling responses is warranted in this study. Analysis of thymocyte adhesion similar to experiments done with Rac-tg mice (PMID: 22544394) would be informative.</p></disp-quote><p>As suggested, we performed signaling experiments using Fam49b-KO OT-I mice (Revised Figure 6F). We examined activation of ERK because Fam49b is known to negatively regulate Rac-PAK-ERK in T cells [2]. ERK phosphorylation was markedly increased in Fam49b-KO thymocytes than in WT thymocytes, which may support the idea of enhanced TCR signaling in Fam49b-KO thymocytes. We also observed slight increase of BIM/BCl<sup>-</sup>2 ratio in Fam49b-KO naïve OT-I T cells than WT naïve OT-I cells (Revised Figure 6G), suggesting that Fam49b is required for peripheral T cells survival. The corresponding data are presented in Revised Figure 6. The question of the effect of Fam49b on thymocyte adhesion is interesting. Fam49b-KO OT-I mice showed normal T cell development in the thymus, suggesting that Fam49b-KO OT-I thymocytes might not be suitable for thymocyte adhesion experiments.</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>This study is very well designed, but, while there is support for the main message of this study (Fam49b is involved in thymic selection), there are several aspects that should be clarified by performing new experiments in order to improve the manuscript. The authors should consider the following major points:</p><p>– One major drawback of this manuscript is the lack of TCR transgenic mice that could have been included to avoid potential bias due to a shift in TCR repertoire. In addition, the authors claim &quot;Our results demonstrate that Fam49b dampens thymocytes TCR signaling in order to escape negative selection ….&quot; but there is no single experiment addressing the impact of Fam49b deficiency on TCR signaling in thymocytes. The authors should cross their Fam49b KO mice with TCR Tg in order to analyze if Fam49b deficiency affects calcium flux in a way that is representative of decreased positive selection or enhanced negative selection. Since this protein has been shown to regulate the actin cytoskeleton through Rac1-Pak, we could have expected some signaling studies of this axis and more generally of other pathways (ZAP, Vav1, ERK, Rela, Akt, …) and imaging studies of synapse organization.</p></disp-quote><p>We thank the reviewers for this valuable suggestion. Reviewer #1 also made a similar comment about the issue of Fam49b-KO TCR transgenic mice (Reviewer #1’s comment no. 1. and no. 4). Accordingly, we generated Fam49b-KO OT-I mice, and analyzed thymocytes and peripheral T cells (Revised Figure 6). Unexpectedly, the frequencies and numbers of CD8 SP thymocyte as well as peripheral T cells were comparable between WT and Fam49b-KO OT-I mice of 6 weeks of age (Revised Figure 6A-6D). Therefore, we seriously considered the reviewers’ comments that the effect of Fam49b deficiency is relatively mild in the thymus as compared to that in the periphery (Reviewer #2’s comment no.2) and the decreased number of T cells could have resulted from survival defect (Reviewer #3’s comment no. 5 and no.9). Since we observed significant reduction of naive T cells in Fam49b-KO mice, we postulated that Fam49b deficiency might reduce peripheral T cells survival. As expected, Fam49b-KO OT-I mice showed dramatical reduction of total CD8 T cell (Revised Figure 6C), especially naïve CD8 T cells (Revised Figure 6D) at 12 weeks of age. In agreement with result from 12 weeks old mice, increased apoptosis of naïve T cells was observed in Fam49b-KO OT-I mice (Revised Figure 6E). It has been reported that Fam49b negatively regulate Rac/PAK/ERK/ERK pathway [3-5]. We observed that ERK phosphorylation was dramatically increased in FAM49b-KO OT-I total thymocytes (Revised Figure 6F).</p><disp-quote content-type="editor-comment"><p>– The effect of Fam49b deficiency is relatively mild in the thymus as compared to that in the periphery. The authors should explain why peripheral T cells are so strongly decreased since it is difficult to justify this strong decrease of peripheral T cells (particularly CD8<sup>+</sup> T cells) simply by increased negative selection.</p></disp-quote><p>We do agree that this is an important question. As mentioned above, we found new function of Fam49b on peripheral T cells. Fam49b plays a key role in maintenance and general survival of peripheral T cells (Revised Figure 6). Moreover, we found that Fam49b deficiency leads to the defective maturation of SP thymocytes (Revised Figure 5). Our findings of defective thymic T cell maturation and peripheral T cell survival in Fam49b-KO mice might explain why the decrease in the number of peripheral T cells is greater than the decrease in the number of SP thymocytes.</p><disp-quote content-type="editor-comment"><p>– Absolute numbers of thymic cells in Figure 2D should be included.</p></disp-quote><p>Per Reviewer’s suggestion, we have added Revised Figure 2E, which shows the total numbers of thymocytes, TCRβ<sup>hi</sup> CD8 SP, and TCRβ<sup>hi</sup> CD4 SP. The absolute numbers of TCRβ<sup>hi</sup> CD4 SP and TCRβ<sup>hi</sup> CD8 SP were lower in Fam49b-KO mice than WT mice (Revised Figure 2E). This result is consistent with our observation that Fam49b-KO mice have lower numbers of immature SP and mature SP than WT mice (Revised Figure 5B).</p><disp-quote content-type="editor-comment"><p>– The authors performed bone marrow chimera experiments to show T-cell intrinsic defects. In Figure 3A, they show the data concerning peripheral T cells but no data about the effect in the thymus despite this sentence: &quot;The Fam49b-KO thymocytes developed in WT thymic environment are like those developed in the germline Fam49b-KO environment in terms of both thymocyte and peripheral lymphocyte phenotypes. Therefore, the effect of Fam49b mutation on T cell development is predominantly due to thymocyte intrinsic functions.&quot; This data should be added to the figure.</p></disp-quote><p>We thank the Reviewer for the suggestion and have added the (Revised Figure 3—figure supplement 2). Increased expression of CD5 on DP (Revised Figure 3—figure supplement 2A) and a lower frequency of TCRβ<sup>hi</sup> CD8 SP and TCRβ<sup>hi</sup> CD4 SP (Revised Figure 3—figure supplement 2B) and enhanced ratio of TCRβ<sup>hi</sup> CD4 SP and TCRβ<sup>hi</sup> CD8 SP (Revised Figure 3—figure supplement 2C) were observed in the thymus from Fam49b-KO chimera mice compared to WT chimera mice.</p><disp-quote content-type="editor-comment"><p>– The data presented in figure 3C and Figure 3 E show a &quot;block&quot; at the transition from TCRbintCD69+ to TCRbhiCD69+ and TCRbintCD5hi to TCRbhiCD5hi, suggesting defective signals in TCRbintCD69+ and TCRbintCD5hi which leads to inefficient transition. Both TCRbintCD69+ and TCRbintCD5hi are still very enriched with DP cells (see supplementary data). So, I wouldn't necessarily conclude that post-positive selection events are affected by this deficiency. This point should be clarified.</p></disp-quote><p>We appreciate this important comment. Enhanced TCR-signaling strength intrinsic to Fam49b-KO DP thymocytes may lower the threshold for positive selection, resulting in a diminution in the frequency of thymocytes undergoing death by neglect where positive selection failed. We found that the frequency of thymocytes undergoing death by neglect remained the same in Fam49b-KO thymus, while frequency of thymocytes undergoing clonal deletion was significantly increased (Revised Figure 4A). Therefore, we concluded that “positive selection remains mostly unaffected by lack of Fam49b molecule, while Fam49b plays a more important role in the later stages of T cell development in the thymus”.</p><disp-quote content-type="editor-comment"><p>– In Figure 4B, the staining of CD69 in CD8<sup>+</sup> T cells is weird and is suggestive that CD3low cells were not excluded in the gating strategy. Did the authors exclude CD3 low CD8<sup>+</sup> T cells from their analysis on CD8SP thymocytes in general?</p></disp-quote><p>We thank the reviewer for these thoughtful comments. Reviewer #3 also made a similar comment about the issue of ISP subset (Reviewer #3’s comment no. 3.). Previously, we analyzed CD8 SP and CD4 SP without TCRβ pre-gating. As the reviewer pointed out, we pre-gated on TCRβ-positive cells, and excluded TCRβ-negative CD8 and CD4 ISP cells from the conventional CD8 or CD4 SP thymocytes respectively. CD69 expression in CD8 SP resulted in a two peaked histogram (Revised Figure 4B). The expression of CD69 on CD8 SP was comparable between WT and Fam49b-KO mice as before (Revised Figure 4B). We have now clarified TCRβ pre-gating in the corresponding figure legend. We replaced the FACS plots of CD8 SP and CD8 SP in Revised Figure 4B with TCRβ pre-gating.</p><disp-quote content-type="editor-comment"><p>It is also difficult to conclude that the increased CD5 expression on DP cells is due to higher TCR signaling or rather to a shift in TCR repertoire towards higher affinity TCR. An analysis in TCR transgenic mice would resolve this issue</p></disp-quote><p>We appreciate this valuable suggestion. We showed that CD5 expressions were upregulated on DP in Fam49b-KO OT-I mice (Revised Figure 6—figure supplement 1A upper panel). However, the frequency and numbers of CD8 SP were comparable between WT and Fam49b-KO OT-I mice (Revised Figure 6A-6B). We reasoned that the increased TCR signal of DP in Fam49b-KO OT-I mice is still below the threshold for inducing apoptosis in DP and CD8 SP.</p><disp-quote content-type="editor-comment"><p>– In Figure 4C, the IL-2 production was tested after three days of stimulation. This is too late since the peak of IL-2 production occurs in general 24h after stimulation. Kinetics of IL-2 production will be more informative.</p></disp-quote><p>Thank you for your suggestion. It has been reported that accumulation of IL-2 as measured by ELISA steadily increased and then plateaued up to 70 h after in vitro stimulation, even though the peak of IL-2 production occurs in general 24h after stimulation [6]. We speculated that IL-2 levels in supernatant might be increased in 24 h after CD3ε stimulation. And we have removed the data from peripheral total T cell activation (Figure 4C and Supplementary Figure 5) due to qualitative differences between naïve and memory T cells such as cytokine secretion and proliferation. The effect of fam49b on differentiation and activity of peripheral T cells subset is an important question to be addressed in further studies.</p><disp-quote content-type="editor-comment"><p>– The data presented in Figure 5 concerning the differential impact of Fam49b deficiency on CD8aa TCRab+ IELs, liver iNKT cells and lymph node Tregs Tregs are very descriptive, without any data on the development in the thymus. This should be clarified.</p></disp-quote><p>We thank the Reviewer for this suggestion. We found a strong reduction of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs compared to Treg and iNKT cells. Therefore, we analyzed thymic CD8αα IEL precursors (IELps) in Fam49b-KO mice. It has been reported that there are two distinct CD8αα IELps in the thymus, which are Type A IELps (PD-1<sup>+</sup>) and Type B IELps (PD-1<sup>-</sup>)[1]. We observed a comparable number of Type A IELps, but more Type B IELps in Fam49b-KO mice than in WT mice (Revised Figure 7—figure supplement 3A right panel). Severe CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs deficiency in the gut was at odds with the higher number of thymic IELps in Fam49b-KO mice. By analyzing Fam49b-KO OT-I mice, we found that Fam49b molecules is also required for the maintenance and survival of peripheral T cells (Revised Figure 6). Therefore, it is possible that the lower number of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs may be the result of impaired maintenance or survival in the periphery, rather than a defect of thymic IELps development. We have included this in the Result section (page 11, lines 262-273).</p><disp-quote content-type="editor-comment"><p>Reviewer #3 (Recommendations for the authors):</p><p>1) Figure 1: it would be informative to add the sequencing trace files for the confirmation of the mutation. Furthermore, after which amino acid (what is the protein length of Fam49a and Fam49b) is the stop codon? Is it possible that a truncated form of Fam49a and Fam49b is expressed? Would the antibodies that have been used for the western blots detect truncated forms? Based on the information provided, it is not clear whether the antibodies against Fam94a and Fem49b recognize the N, C terminus or another region of the proteins.</p></disp-quote><p>We apologized for the lack of clarity. As the reviewer pointed out, we added the sequencing trace files showing the Fam49a and Fam49b mutation in Revised Figure 1A and 1B below. Fam49a-KO gene ablation is achieved by creating premature stop codon in exon 7, which can be translated into 140 amino acids of truncated Fam49a protein. Fam49b-KO gene ablation is achieved by creating premature stop codon in exon 6, which can be translated into 117 amino acids of truncated Fam49a protein. We clarified this point in the corresponding figure legend. Anti-Fam49a polyclonal antibodies (Σ, SAB 1103179) was produced by synthetic peptide corresponding to amino acids 56-70 of human FAM49a molecules in rabbit. Anti-Fam49b mouse monoclonal antibody (Santa cruz, D-8, sc-390478) binds to 8-20 near the N-terminus of Fam49b of human origin. Therefore, it will be possible that a truncated form of Fam49a and Fam49b protein could be detected by Fam49a or Fam49b antibodies respectively, if the truncated Fam49a or Fam49b proteins are stably expressed in KO mice. However, we did not detect the band expected to be a truncated Fam49a or Fam49b protein by western blotting. Therefore, we believe that a truncated form of Fam49a or Fam49b protein, if expressed, are likely to be expressed very unstably in KO mice.</p><disp-quote content-type="editor-comment"><p>2) Figure 2A and B: It would be informative to also show the percentages and numbers of TCRb+ cells as well as to pre-gate on TCRb+ cells when displaying CD4 and CD8a expression. Is there an increase in DN cells in the periphery? Which marker was used for B cells? CD19? This is not indicated.</p></disp-quote><p>We thank the Reviewer for this suggestion. As the reviewer pointed out, we examined frequencies of CD4<sup>+</sup> cells and CD8α<sup>+</sup> cells with pre-gating TCRβ<sup>+</sup> cells in lymph nodes of WT, Fam49a-KO mice, and Fam49b-KO mice (<xref ref-type="fig" rid="sa2fig1">Author response image 1A</xref>). Since reduction in the number of CD8<sup>+</sup> T cells was greater than that of CD4<sup>+</sup> T cells (Figure 2A), the frequency of CD8α<sup>+</sup> cells with pre-gating TCRβ<sup>+</sup> cells decreased in Fam49b-KO mice (<xref ref-type="fig" rid="sa2fig1">Author response image 1A</xref>). Next, we analyzed the frequency and number of TCRβ<sup>+</sup>CD4<sup>-</sup>CD8α<sup>-</sup> cell (Double-Negative, DN) T cells in lymph nodes of WT, Fam49a-KO mice, and Fam49b-KO mice. The frequency of DN T cells among total lymphocytes were increased from 0.004% to 0.006% in Fam49b-KO mice (<xref ref-type="fig" rid="sa2fig1">Author response image 1B</xref>), though the number of DN T cells were comparable (<xref ref-type="fig" rid="sa2fig1">Author response image 1C</xref>). Fam49b deficiency does not lead to a strong reduction in DN T cells. We used B220 molecules for B cells marker. We clarified this point in the corresponding Figure legend.</p><fig id="sa2fig1" position="float"><label>Author response image 1.</label><caption><title>(A) Flow cytometry profiles of the expression of CD4 and CD8 of lymphocytes with pre-gating TCRβ<sup>+</sup> cells in peripheral lymph nodes from WT, Fam49a-KO, and Fam49b-KO mice.</title><p>Numbers adjust to outlined areas indicate percentage of cells among total TCRβ<sup>+</sup> cells lymphocytes. (B) Frequencies of TCRβ<sup>+</sup>CD4<sup>-</sup>CD8α<sup>-</sup> cell cells among total lymphocytes in lymph nodes from WT, Fam49a-KO mice, and Fam49b-KO mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 8 mice. ****p&lt;0.0001 (One-way ANOVA). (C) Numbers of TCRβ<sup>+</sup>CD4<sup>-</sup>CD8α<sup>-</sup> cell in lymph nodes from WT, Fam49a-KO mice, and Fam49b-KO mice. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 8 mice.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig1-v1.tif"/></fig><disp-quote content-type="editor-comment"><p>3) In Figure panel 2D: it would be important to pre-gate on TCRb-high cells for determining the CD4/CD8SP ratio. Otherwise, the CD8SP population includes the CD8 ISP subset.</p></disp-quote><p>We agree and have incorporated this suggestion throughout our paper. Reviewer #2 also asked a similar question about the issue of ISP subset (Reviewer #2’s comment no. 6.). We previously analyzed CD4 SP and CD8 SP without TCRβ pre-gating. As the reviewer pointed out, we pre-gated on TCRβ-high cells, and excluded TCRβ-low ISP cells from the conventional CD4<sup>+</sup> SP thymocytes and CD8<sup>+</sup> SP thymocytes. We observed that frequencies and numbers of TCRβ-high CD4 SP and TCRβ-high CD8 SP were still reduced, and the ratios of TCRβ-high CD4 SP to TCRβ-high CD8 SP were also increased as before. We replaced individual value plot in Revised Figure 2D and described TCRβ pre-gating in the corresponding Figure legend.</p><disp-quote content-type="editor-comment"><p>4) Figure 3: Did the authors also analyze CD44 and CD62L expression in the mixed BM chimeric mice? This would help to understand whether the altered CD44/CD62L expression (relative reduction of the frequency of naive cells) shown in Figure 2C is T cell-intrinsic or potentially a consequence of (a partial) T cell homeostatic expansion due to T cell lymphopenia.</p></disp-quote><p>We have not analyzed CD44 and CD62L expression in chimeric mice. However, we believe that Revised Figure 6 (page 11, lines 262-273) would address this issue because we found new function of Fam49b molecules on peripheral T cells by analyzing Fam49b-KO OT-I mice. Fam49b plays an important role not only in the development of T cells in the thymus but also in the maintenance and survival of peripheral T cells. Therefore, we concluded that reduction of naïve T cells in Fam49b-KO mice was a result of T cell defect in thymus as well as T cell-intrinsic survival defect in the peripheral.</p><disp-quote content-type="editor-comment"><p>5) The authors conclude that the reduced numbers of SP cells and peripheral T cells is due to a defect in negative selection. How can the authors exclude that the reduced numbers of T cells is not due to a general survival defect of post positive selection SP thymocytes? What about expression of pro-apoptotic and pro-survival factors such as Bim and Bcl2, respectively? And what about IL-7 receptor α expression, which is upregulated during positive selection. The expression of these factors should be analyzed.</p></disp-quote><p>To directly address the reviewer’s question, we examined the maturation of SP thymocytes. As pointed out by the Reviewer, SP maturation in the thymus were markedly impaired in Fam49b-KO mice (Revised Figure 5A-5B). Moreover, IL-7Rα expression was partially decreased in semi-mature and mature CD4 SP in Fam49b-KO thymus (Revised Figure 5C). We have described this in the Result section (page 9, lines 194-203). Higher ratio of BIM/BCl<sup>-</sup>2 was detected in naïve Fam49b-KO CD8<sup>+</sup> OT-I peripheral T cells (Revised Figure 6F-6G). We have described this in the Result section (page 10, lines 225-233).</p><disp-quote content-type="editor-comment"><p>6) The conclusion that negative selection is altered is based on the results shown in Figure 4A. The frequency of cleaved Caspase-3+ cells is very low. To strengthen the conclusion it would be good to include other approaches that indicate altered negative selection. What happens if WT and Fam49b KO thymocytes are cultured overnight in the presence/absence of anti-CD3 stimulation: would this also reveal changes in cleaved Caspase3?</p></disp-quote><p>We agree with the assessment of the Reviewer. The absolute numbers of immature CD8 SP and CD4 SP were decreased from Fam49b-KO mice (Revised Figure 5B), which may support the idea of increased apoptosis in DP thymocytes from Fam49b-KO mice. A more than two-fold increase in apoptosis was observed in Fam49b-KO immature and semi-mature CD4 SP (Revised Figure 5D-5E) and CD8 SP (Revised Figure 5—figure supplement 1A-1B). These results are consistent with our observation that the frequencies of cleaved Caspase-3<sup>+</sup> cells of signaled thymocytes undergoing clonal deletion were increased in the cortex and medulla.</p><disp-quote content-type="editor-comment"><p>What about superantigen (SEB)-induced deletion of specific TCR Vb isoforms? This is another readout that can be used to study negative selection.</p></disp-quote><p>Per reviewer’s suggestion, we investigated the role of Fam49b in negative selection in a superantigen-mediated deletion model. The C57BL-derived mouse strains express superantigens Mtv-8 and 9, which cause deletion of Vβ3<sup>+</sup>, Vβ5<sup>+</sup>, Vβ11<sup>+</sup> and Vβ12<sup>+</sup> TCR clonotypic thymocytes and peripheral T cells when the MHC molecule I–E is also present. Vβ6<sup>+</sup> thymocytes and peripheral T cells do not recognize Mtv-8 and 9, and were not deleted. To introduce I-E, which is absent on the B6-backcrossed Fam49b-KO mice, we bred them to Balb/c mice which express I-E. In H-2<sup>d/d</sup> mice, which express I-E molecules. Superantigen-mediated deletion efficiency was comparable between WT and Fam49b-KO mice (<xref ref-type="fig" rid="sa2fig2">Author response image 2</xref>). Therefore, we concluded that Fam49b-deficiency does not change negative selection.</p><fig id="sa2fig2" position="float"><label>Author response image 2.</label><caption><title>Negative selection in Fam49b-KO mice.</title><p>B6 mice (H-2b) bearing wild-type or mutated Fam49b allele were backcrossed or not onto Balb/c (H-2d) mice and the expression of indicated Vβ elements in CD4 (left) or CD8 (right) peripheral T cells was analyze3d by flow cytometry.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig2-v1.tif"/></fig><disp-quote content-type="editor-comment"><p>7) How does altered signaling strength in Fam49b KO thymocytes affect the development of thymic Foxp3+ Tregs and thymic NKT cells? Is there a difference in the frequency of these cells in the thymus? In Figure 5, data are shown from LN (Foxp3) and liver (iNKT) but no data are shown from the thymus.</p></disp-quote><p>We have not analyzed thymic Treg and NKT precursors in Fam49b-KO mice because we only observed strong reduction of CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs compared to Treg and iNKT. Therefore, we analyzed thymic CD8αα IEL precursors instead. The results are presents in Revised Figure 7—figure supplement 1A-1C and are described in the Result section (page 11-12, lines 262-273).</p><disp-quote content-type="editor-comment"><p>8) The data from peripheral T cells are not convincingly supporting the conclusion that TCR signaling strength is altered. Cell proliferation is normal, wouldn't one expect changes in proliferation if signaling strength in KO cells is changed? What about the upregulation of activation markers such as CD69 and CD25? It would also be informative to plot Cell trace violet dilution with intracellular IL-2 staining to determine whether enhanced IL-2 is linked with a particular division stage. What about other cytokines, e.g. TNF or IFNγ? And what happens if cells are stimulated with anti-CD3/CD28 – would there still be a difference in IL-2?</p></disp-quote><p>We agree with the Reviewer. We generated Fam49b-KO OT-I transgenic mice and investigated activation of ERK because Fam49b is known to negatively regulate Rac-PAK-ERK axis in T cells [2]. As expected, ERK phosphorylation was markedly increased in Fam49b-KO thymocytes than in WT thymocytes (Revised Figure 6F), which may support the idea of enhanced TCR signaling in Fam49b-KO thymocytes. However, the frequencies and numbers of CD8 SP thymocyte (Revised Figure 6A-6B) as well as peripheral T cells (Revised Figure 6C-6D) were comparable between WT OT-I and Fam49b-KO OT-I mice of 6 weeks of age. We reasoned that the increased TCR signaling of DP in Fam49b-KO OT-I mice still remains below the threshold for inducing apoptosis of DP and CD8 SP in the thymus. And, we removed the data from peripheral T cell activation (Figure 4C and Supplementary Figure 5), since they had little direct relevance to the thesis on the effect of Fam49b on T cell development in the thymus and peripheral survival. We think these changes present improved demonstration for stronger TCR strength in Fam49b-KO mice, and hope that you agree with us.</p><disp-quote content-type="editor-comment"><p>9) The IEL data are interesting. It would be good to show the gating strategy as well as a representative contour plot for all subsets shown in the diagram in panel 5B and 5C. However, the reduction of the natural IELs could be due to changes in negative selection or – similar to my comment #5 – reduced survival of selected cells (without affecting negative selection). This should be at least discussed as an alternative explanation.</p></disp-quote><p>We agree. We have included a new Revised Figure 7-fiure supplement 1 to further illustrate the gating strategy and show representative IELs T cell populations in WT and Fam49b-KO mice. Reviewer #2 also posed a similar question about reduction of the nature IELs. Please see Reviewer #2’s comment number 8 above.</p><p>References</p><p>1. Ruscher, R., et al., <italic>CD8alphaalpha intraepithelial lymphocytes arise from two main thymic precursors.</italic> Nat Immunol, 2017. 18(7): p. 771-779.</p><p>2. Shang, W., et al., <italic>Genome-wide CRISPR screen identifies FAM49B as a key regulator of actin dynamics and T cell activation.</italic> Proc Natl Acad Sci U S A, 2018. 115(17): p. E4051-E4060.</p><p>3. Fischer, A.M., et al., <italic>The role of erk1 and erk2 in multiple stages of T cell development.</italic> Immunity, 2005. 23(4): p. 431-43.</p><p>4. Eblen, S.T., et al., <italic>Rac-PAK signaling stimulates extracellular signal-regulated kinase (ERK) activation by regulating formation of MEK1-ERK complexes.</italic> Mol Cell Biol, 2002. 22(17): p. 6023-33.</p><p>5. D'Souza, W.N., et al., <italic>The Erk2 MAPK regulates CD8 T cell proliferation and survival.</italic> J Immunol, 2008. 181(11): p. 7617-29.</p><p>6. Sojka, D.K., et al., <italic>IL-2 secretion by CD4<sup>+</sup> T cells</italic> in vivo <italic>is rapid, transient, and influenced by TCR-specific competition.</italic> J Immunol, 2004. 172(10): p. 6136-43.</p><p>[Editors’ note: what follows is the authors’ response to the second round of review.]</p><disp-quote content-type="editor-comment"><p>The 3 Reviewers appreciate the important additions contained in the revised manuscript such as the inclusion of data from TCR transgenic mice that improve the quality and impact of the study. However and as outlined below by the 3 Reviewers several precise issues need to be addressed prior to publication in eLife.</p></disp-quote><p>We have added many new experimental data per reviewers’ suggestions. We hope that our point-by-point responses to the reviewer’s comments are clear and satisfactory.</p><disp-quote content-type="editor-comment"><p>Reviewer #1 (Recommendations for the authors):</p><p>The revised manuscript contains some important additions such as the inclusion of data from TCR transgenic mice that improve the quality and impact of the study. That said, this report is mainly descriptive with very little mechanistic insight. It was hoped that the requested signaling/biochemistry experiments would contribute to mechanism, but as stated below, the results of these studies are not trustworthy. Several issues need to be addressed prior to publication:</p><p>1. The observation that Fam49a KO mice have no obvious phenotype is not a valid reason for not generating Fam49a/49b double KO (DKO) mice. As mentioned in the review, there could be partial redundancy between Fam49a and 49b and the DKO could have a phenotype more severe than the Fam49b KO. This reviewer does not insist on the generation of the DKO (though it is unfortunate) but does want to make the point that the authors' reasoning for not generating the DKO is flawed.</p></disp-quote><p>To response the reviewer's question, we have attempted to make Fam49a/b DKO mice. First, we generate Fam49a-KO Fam49b-Het mice and crossed them with each other. It was expected that 25% of mice born would be Fam49a/b-DKO. However, contrary to our expectations, Fam49a/b-DKO mice could not be obtained in 30 pups aged 3 weeks obtained from three breeding attempts. All pups were either Fam49a-KO Fam49b-WT or Fam49a-KO Fam49b-het. Therefore, we could not proceed with the assay experiment because Fam49a/b-DKO mice were not born. We predicted that loss of the expression of two proteins, Fam49b and Fam49b, induces stillbirth of offspring during pregnancy or early birth. We would like to mention that Rac1 deficient mouse embryo also failed to form appropriate germ cell layers and died at gastrulation [1].</p><disp-quote content-type="editor-comment"><p>2. The CD69 surface expression results are perplexing. While CD5 surface expression is &quot;analog&quot; and parallels TCR signal intensity, CD69 expression has historically been found to be more &quot;digital&quot; (i.e., CD69+ and CD69- populations rather than a shift in MFI), though the data in Figure 4b indicate an analog pattern (the differences shown are also very slight).</p></disp-quote><p>We thank the reviewer for pointing out this important issue and apologize for the confusion caused. Accordingly, we have removed the CD69 expression data in Figure 4B.</p><disp-quote content-type="editor-comment"><p>3. In Figure 5a and 5b, how do the authors explain normal numbers of semi-mature cells when the numbers of immature and mature cells are reduced?</p><p>1) normal numbers of semi-mature cells when the number of immature are reduced?</p></disp-quote><p>We thank the reviewer for this valuable question. The newly generated SP thymocytes in the thymic medulla undergo further maturation over several days before exit [2]. We believe that compensatory proliferation of semi-mature SP thymocytes populations in the medulla can account for this recovery, even if a small number of immature SP thymocytes migrate from the cortex to the medulla.</p><disp-quote content-type="editor-comment"><p>2) the numbers of mature cells are reduced when normal numbers of semi-mature cells?</p></disp-quote><p>The proper actin cytoskeleton remodeling-dependent signaling is required for maturation of SP thymocyte [3, 4]. Previous study has showed that survival of semi-mature SP thymocytes was also significantly decreased in PAK2-deficient mice [3]. Mechanistically, Rac-Fam49b-PAK2 is required for actin reorganization triggered by TCR in thymocytes [5]. We also observed a twofold increase in cell death in Fam49b-deficient semi-mature SP thymocytes (Figure 5D-E and Figure 5—figure supplement 1A-B). Based on this knowledge and our observation, we suggest that decreased number of mature SP thymocytes from Fam49b-KO mice might have been the result of impaired survival and maintenance of semi-mature SP thymocyte.</p><disp-quote content-type="editor-comment"><p>4. The results in Figure 5c are not convincing (that there is a difference in the expression of IL-7ra).</p></disp-quote><p>In Fam49b-KO mice, IL-7Rα expression was not significantly different in immature and mature SP thymocytes but was only significantly decreased in semi-mature CD4 SP thymocytes (Figure 5C). Consistent with reduced IL-7Rα expression, we also found that apoptosis of semi-mature SP thymocytes was significantly increased in Figure 5D-E. Previous study has demonstrated that Fam49b inhibited TCR signaling via Rac-PAK axis signaling [6]. Moreover, it has been reported that IL-7Rα expression and survival of semi-mature SP thymocytes was also significantly decreased in RAK2-deficient mice [3], suggesting that PAK2 signaling is required for survival of semi-mature SP thymocytes. Therefore, we suggest that Rac-Fam49b-PAK2 axis signaling plays a key role in the survival and maintenance of semi-mature CD4 SP thymocytes in the medulla.</p><disp-quote content-type="editor-comment"><p>5. In Figure 5d,e how do the authors explain increased cell death of semi-mature cells when these cells were not reduced (Figure 5a,b)?</p></disp-quote><p>We reasoned that compensatory proliferation of semi-mature SP thymocytes populations in the medulla can account for this recovery. Like the results of Fam49b-KO mice, there is a paper showing that semi-mature CD4 SP thymocyte survival is reduced in PAK2-deficient mice, although even cell numbers are slightly increased [3].</p><disp-quote content-type="editor-comment"><p>6. Higher expression of CD5 and CD69 in Figure 6 is not convincing.</p></disp-quote><p>We agree with the Reviewer that the increase of CD5 expression on DP thymocyte from Fam49b-KO OT-I mice was not as noticeable (previous Figure 6—figure supplement 1A) compared to the data of DP thymocyte from Fam49b-KO mice in Figure 4B. Moreover, contrary to the predictions, there were no significant differences in frequencies and numbers of CD8 SP thymocytes in Fam49b-KO OT-I mice at 6 weeks (Figure 6A-B), suggesting that Fam49b protein does not have a significant effect on T cell development in the thymus of Fam49b-KO OT-I mice. Thus, we removed the CD5 and CD69 expression of thymus from Fam49b-KO OT-I mice in previous Figure 6—figure supplement 1A-B since they had little direct relevance to the key finding in Fan49b-KO OT-I mice that Fam49b is required for peripheral T cell survival. We think these changes present improved demonstration for impaired survival in Fam49b-KO peripheral OT-I T cells, and hope that you agree with us.</p><disp-quote content-type="editor-comment"><p>7. Figure 6d, how do the authors explain the low % of naive OTI T cells in the control mice? Typically, &gt;90% of OTI CD8<sup>+</sup> T cells are naive in lympho-replete mice.</p></disp-quote><p>We apologize for the lack of clarity. Percentage of naïve OT-I T cells was calculated as a percentage of naïve CD8 OT-I T cells (CD62L<sup>+</sup>CD44<sup>lo</sup>TCR-Vα2<sup>+</sup>CD8<sup>+</sup> T cells) among total lymphocytes, not total CD8 OT-I T cells (TCR-Vα2<sup>+</sup>CD8<sup>+</sup> T cells). About 30% of the total lymphocytes in WT OT-I mice are CD8 OT-I T cells, and about 65% of CD8 OT-I T cells are CD62L<sup>+</sup>CD44<sup>lo</sup> naïve CD8 OT-I T cells (<xref ref-type="fig" rid="sa2fig3">Author response image 3</xref>). Therefore, the proportion of naïve CD8 T cells among all lymphocytes is approximately 20%. As reviewer pointed out, &gt;90% of CD8 OT-I T cells are CD44<sup>lo</sup> CD8 OT-I naïve T cells (Figure 6D)</p><fig id="sa2fig3" position="float"><label>Author response image 3.</label><caption><title>Naïve CD8 OT-I T cells identified by TCR-Vα2<sup>+</sup>, CD8α<sup>+</sup>, TCRβ<sup>+</sup>, CD4<sup>-</sup>, CD62L<sup>+</sup>, and CD44<sup>lo</sup>.</title></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig3-v1.tif"/></fig><disp-quote content-type="editor-comment"><p>8. Figure 6f,g, these results are the most problematic in the revised paper. pERK should be virtually undetectable in unstimulated thymocytes and T cells. Also, there is no increase in pERK after stimulation indicating that the cells are not activated. Other effectors (pLAT, pZAP, pZAP-70) should be checked. Several experiments should be performed and statistics shown in Figure 6g. Most notably, the authors do not evaluate Rac activation in the mutant mice to show that it is elevated as predicted!</p><p>1) pERK should be virtually undetectable in unstimulated thymocytes and T cells. Also, there is no increase in pERK after stimulation indicating that the cells are not activated.</p></disp-quote><p>We appreciated this important comment. The resting time after thymocyte isolation was increased from 2 hours to 4 hours to prevent the basal expression of pERK before TCR stimulation. We clearly observed that the pERK expression was significantly increased after TCR stimulation. These results are presented in Revised Figure 4C and described this point in the corresponding Materials and methods.</p><disp-quote content-type="editor-comment"><p>2) Other effectors (pLAT, pZAP, pZAP-70) should be checked.</p></disp-quote><p>As the reviewer pointed out, we examined the activation of key TCR signaling cascade component (ZAP-70, LAT, PLCγ1, and ERK). Fam49b deficiency led to prolonged increases in all the downstream phosphorylation events tested (a new Revised Figure 4C), suggesting that Fam49b-deficiency thymocytes received enhanced TCR signaling.</p><disp-quote content-type="editor-comment"><p>3) Several experiments should be performed and statistics shown in Figure 6g.</p></disp-quote><p>We apologize for the lack of clarity. We analyzed the expression of BIM and BCl<sup>-</sup>2 molecules in naïve T cells and total thymocytes by western blot from three independent experiments. We observed that BIM/BCl<sup>-</sup>2 ratio was markedly increased in Fam49-KO thymocytes and naïve T cells. These results are presented in new Revised Figure6—figure supplement 2A-2B and described this point in the corresponding Figure legend.</p><disp-quote content-type="editor-comment"><p>4) the authors do not evaluate Rac activation in the mutant mice to show that it is elevated as predicted!</p></disp-quote><p>Fam49b has been identified as an inhibitor of TCR signaling via Rac-PAK axis in Fam49b-KO Jurkat T cells [6]. Consistent with the results of this paper, PAK phosphorylation was also dramatically elevated in Fam49b-KO thymocytes (a new Revised Figure 4D). Therefore, we concluded that Fam49b-deficiency thymocytes may receive enhanced TCR signaling via Rac-PAK aixs.</p><disp-quote content-type="editor-comment"><p>9. The results in Figure 7 are interesting but the authors did not perform the requested experiment, namely to generate CD28 KO / Fam49b KO (DKO) mice to test if negative selection is indeed increased in Fam49b mice. Deletion of CD28 would allow the rescue of otherwise negatively selected thymocytes, and an increase in DN, TCR+, PD-1+ cells in CD28/Fam49b DKO mice compared to CD28 KO mice would provide strong support for their hypothesis that negative selection is increased in the absence of Fam49b.</p><p>1) The results in Figure 7 are interesting but the authors did not perform the requested experiment, namely to generate CD28 KO / Fam49b KO (DKO) mice to test if negative selection is indeed increased in Fam49b mice</p></disp-quote><p>The intensity and duration of TCR signaling based on TCR affinity to self-peptide:self-MHC complex are the major determinants of positive and negative selection [7]. Negative selection, also known as clonal deletion, involves inducing apoptosis in thymocytes that bind with high affinity to self-peptide:self-MHC complex during the DP and SP stages, while positive selection induce survival and differentiation programs in DP thymocytes. We found that enhanced TCR-signaling strength intrinsic to Fam49b-KO DP thymocytes (Revised Figure 4C) led to excessive clonal deletion in the cortex and medulla (Figure 4A), while the frequency of thymocytes undergoing death by neglect remained the same in Fam49b-KO thymus (Figure 4A).</p><p>How might enhanced Rac activity lead to the enhanced clonal deletion, involving apoptosis, in Fam49b-KO mice? Rac is known to regulate actin reorganization in thymocyte and T cells [5]. Negatively regulated Rac-driven cytoskeleton remodeling of Fam49b-deficient thymocytes could attenuate protrusion and chemoattractant-induced cell migration process because Fam49b-deficient cells showed increased cellular spread and reduced protrusion-retraction dynamics [8, 9]. Moreover, it has been reported that negative selection occurs via lengthy interactions between T cells and APCs, whereas positive selection are transient interactions [10]. Therefore, it is possible that altered cytoskeleton remodeling activity in Fam49b-deficient thymocytes contributed to their elevated TCR-signaling strength and enhanced clonal deletion, perhaps by prolonging interactions with thymic APCs. We have described this possibility in the Discussion section (page 14, lines 315-325)</p><disp-quote content-type="editor-comment"><p>2) Deletion of CD28 would allow the rescue of otherwise negatively selected thymocytes, and an increase in DN, TCR+, PD-1+ cells in CD28/Fam49b DKO mice compared to CD28 KO mice would provide strong support for their hypothesis that negative selection is increased in the absence of Fam49b.</p></disp-quote><p>As reviewer suggested, it has been reported that TCRαβ<sup>+</sup> DN IEL precursor (IELp) would arise from autoreactive cells diverted from clonal deletion in response to strong TCR signaling [11, 12]. CD28–deficient mice have more TCRαβ<sup>+</sup> DN IELp in the thymus, suggesting that CD28-mediated costimulation is needed to induce autoreactive thymocytes to undergo clonal deletion that have received strong TCR signaling during negative selection [11]. Based on our observation of the dramatic loss of CD8αα+TCRαβ+ IELs in Fam49b-KO mice (Figure 7A), we postulated that TCRαβ<sup>+</sup> DN IEL precursor might be decrease in thymus. Contrary to our expectations, TCRαβ<sup>+</sup> DN IELp was slightly increased (<xref ref-type="fig" rid="sa2fig4">Author response image 4</xref>).</p><p>How might enhanced Rac activity lead to the increase of thymic IELp in Fam49b-KO mice? While both negative selection and agonist selection of IELp are directed by a strong TCR signal, the factors that specify these divergent fates are complicated and remain unclear [13]. Interestingly, thymocytes undergoing agonist selection into IELp exhibited a rapid and confined migration pattern, in contrast to negatively selecting cells, which showed arrested migration [13]. Fam49b-deficient cells showed increased cellular mobility [9]. It is tempting to speculate that overactivation of Rac-1 in Fam49b-KO mice might rescue IEL precursors from negative selection, perhaps by favoring confined migration over migratory arrest after encountering with agonist ligands. We have described this possibility in the Discussion section (page 14-15, lines 339-350)</p><fig id="sa2fig4" position="float"><label>Author response image 4.</label><caption><title>Numbers of TCRβ<sup>+</sup> DN IEL precursor cells in WT and Fam49b-KO mice at 6-7 weeks of age.</title><p>Each dot represents an individual mouse. Small horizontal lines indicate the mean of 6-7 mice. **p=0.0031 (Mann-Whitney test). Data are representative of three experiments.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig4-v1.tif"/></fig><disp-quote content-type="editor-comment"><p>3) The results in Figure 7 are interesting but the authors did not perform the requested experiment, namely to generate CD28 KO / Fam49b KO (DKO) mice to test if negative selection is indeed increased in Fam49b mice</p></disp-quote><p>It has been reported that CD8αα<sup>+</sup>TCRαβ<sup>+</sup> IELs develop from two main thymic IELp, which are PD-1<sup>+</sup>(T-bet<sup>-</sup>) IELp and PD-1<sup>-</sup>(T-bet<sup>+</sup>) IELp [12]. Consistent with the proposal of clonal deletion as an alternative fate for IELp, the number of PD-1<sup>+</sup> IELp and PD-1<sup>-</sup> IELp was greater in the thymus of mice deficient in the proapoptotic protein Bim (Bim-deficient mice; a model in which normally deleted T cells are ‘rescued’ [14]) than in that of WT mice. In addition, CD28-KO mice, in which self-reactive thymocytes are diverted into the CD8αα IEL lineage [11], had only more PD-1<sup>+</sup> IELp cells, not more PD-1<sup>-</sup> IELp, than WT mice [12]. These characteristics suggested that the PD-1<sup>+</sup> IELp and PD-1<sup>−</sup> IELp are represent separate lineages, and CD28 costimulatory signaling would be only involved in the generation of PD-1<sup>+</sup> IELp. We have examined the frequencies and numbers of these two IELps (PD-1<sup>+</sup> IELp and PD-1<sup>-</sup>IELp) in the thymus from WT and Fam49b-KO mice at 6-7 weeks of age. Interestingly, we observed comparable numbers of PD-1<sup>+</sup> IELp, but more PD-1<sup>-</sup> IELp in Fam49b-KO mice than in WT mice (Figure 7—figure supplement 3A right panel). We reasoned that Fam49b might be specifically involved in development of thymic PD-1<sup>-</sup> IELp lineage, but not PD-1<sup>+</sup> IELp lineage, in a CD28-independent manner. In addition to the complexity of thymic IELps, various factors could regulate the generation of agonist selected thymic IELps [13]. Therefore, we think that CD28/Fam49b DKO mice could not be a good animal model to test whether negative selection is increased. The effect of fam49b on generation of thymic IELp is an important question to be addressed in further studies. We hope the above explanation sufficiently answers your questions, and we hope you agree with us.</p><disp-quote content-type="editor-comment"><p>10. Supplement 3a and 3b are mentioned in the text but not included in the figures.</p></disp-quote><p>We thank the reviewer for noticing and have included Figure 7—figure supplement 3A-3B in the figures.</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>We would like to thank the authors for performing several experiments that resolved some issues raised during my first reviewing process. These new experimental data sets revealed that Fam49b, besides its impact on thymic selection, plays an important role in T cell survival in the periphery. Based on these new findings, the authors should amend the discussion that is mainly focused on thymic selection.</p></disp-quote><p>We thank the Reviewer for the suggestion and have amended the Discussion section (page 14, lines 327-337). We have also revised the title and the Introduction section (page 5, lines 89-91) to emphasize that Fam49b protein plays an important role in peripheral T cell survival as well as thymocytes.</p><disp-quote content-type="editor-comment"><p>In addition, the data presented concerning the impact Fam49b on TCR signaling are not convincing and concerns only ERK without quantification and statistical analyses. This part should be strengthened by analyzing other signaling pathways.</p></disp-quote><p>Fam49b has been identified as an inhibitor of TCR signaling via Rac-PAK axis in Fam49b-KO Jurkat T cells [6]. Therefore, we investigated the activation of key TCR signaling cascade component (ZAP-70, LAT, PLCγ1, and ERK). We observed that Fam49b deficiency led to prolonged increases in all the downstream phosphorylation events investigated in thymocytes (a new Revised Figure 4C). Moreover, PAK phosphorylation was also dramatically elevated in Fam49b-KO thymocytes (a new Revised Figure 4D). Therefore, we concluded that Fam49b-deficiency thymocytes received enhanced TCR signaling via Rac-PAK aixs.</p><p>[Editors’ note: what follows is the authors’ response to the third round of review.]</p><disp-quote content-type="editor-comment"><p>The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:</p><p>The authors' explanation for the perplexing results in Figure 5a and 5b (i.e., that proliferation differences could explain why the numbers of semi-mature cells are normal in the KO when the numbers of immature and mature cells are reduced) is unsatisfactory. The reviewer is unaware of any data showing that SP thymocytes proliferate at any stage of their maturation. If I am mistaken, please provide the citation for these findings. I think it more likely that the gating (particularly distinguishing CD62L-lo from -neg and CD69-lo from -neg) is prone to error. In any event, the finding that semi-mature cells are not reduced but immature and mature cells are reduced it very confusing. Because I believe this is a technical problem, I suggest just showing the results for only immature and mature cells to avoid this apparent inconsistency.</p></disp-quote><p>We thank the reviewer for pointing out this important issue and apologize for the confusion caused. Accordingly, we have removed the CD69 expression data in Figure 4B.</p><disp-quote content-type="editor-comment"><p>1) Legend says plots are LN T cells not total LN cells, but Figure 2c shows a large population of CD62L-CD44- cells. Could it be that the cells in Figure 2c are total LN cells?</p></disp-quote><p>The plots are LN T cells not total LN cells.</p><disp-quote content-type="editor-comment"><p>2) In Figure 2c, what are CD62L-CD44- cells? To our knowledge, no CD62L-CD44- T cell populations have been previously described.</p></disp-quote><p>According to the Biolegend's Naïve/Nemory T cell analysis kit manual, CD62L<sup>-</sup>CD44<sup>low</sup> T cells (named effector T cells) exist in mice (https://www.biolegend.com/en-gb/products/mouse-naive-memory-t-cell-id-panel-9757). These CD62L<sup>-</sup>CD44<sup>low</sup> T cell population are also observed in other paper (PLZF induces the spontaneous acquisition of memory/effector functions in T cells independently of NKT cell-related signals J Immunol. 2010 Jun 15;184(12):6746-55(PMID: 20495068)). However, characteristics of these T cells has been rarely studied. According to a paper published in the journal of PNAS in 2021, these T cells is important for age-related resistance to PD-1 blockade [1].</p><disp-quote content-type="editor-comment"><p>Line 163 &quot;Taken together, these results suggest that positive selection remains mostly unaffected by the lack of Fam49b molecule, Fam49b plays a more important role in the later stages of T cell development in the thymus.&quot; What &quot;later stages&quot; of development are they referring to? Do they mean survival? Also, the reduction of TCR-hi CD69+ cells (Figure 3c) suggests that late stages of positive selection are affected. I would maintain that &quot;post-selection&quot; means CD69-neg and that any CD69+ cell is undergoing selection.</p><p>1) What &quot;later stages&quot; of development are they referring to? Do they mean survival?</p></disp-quote><p>We use “later stages” to refer to post-positive selection (TCRβ<sup>hi</sup>CD69<sup>+</sup>) and the mature thymocytes (TCRβ<sup>hi</sup>CD69<sup>-</sup>). Lower frequency of post-positive selection (TCRβ<sup>hi</sup>CD69<sup>+</sup>) and the mature thymocytes (TCRβ<sup>hi</sup>CD69<sup>-</sup>) may reflect survival issues following positive selection.</p><disp-quote content-type="editor-comment"><p>2) Also, the reduction of TCR-hi CD69+ cells (Figure 3c) suggests that late stages of positive selection are affected. I would maintain that &quot;post-selection&quot; means CD69-neg and that any CD69+ cell is undergoing selection.</p></disp-quote><p>It is possible that strong TCR signaling due to Fam49b protein deficiency may allow Fam49b-KO thymocytes that would otherwise die by &quot;death by neglect&quot; to pass &quot;positive selection&quot;. We thought that if this possibility occurred in Fam49b-KO mice, the frequency of thymocytes dying by “death by neglect” would be decreased. However, we observed that the frequencies of cells to be eliminated through “death by neglect” (cleaved-caspase 3<sup>+</sup>TCRβ<sup>-</sup>CD5<sup>-</sup> cells) were similar between Fam49b-KO and WT mice (Figure 4A bottom row). Thus, we described that “positive selection remains mostly unaffected by the lack of Fam49b molecule”.</p><p>Since the reader encounter Figure 4A after Figure 3C, the statement “positive selection remains mostly unaffected by the lack of Fam49b molecule” may be unnecessarily confusing to reader. Moreover, as the reviewer points out, we cannot completely dismiss the possibility that the lower frequency of TCRβ<sup>hi</sup>CD69<sup>+</sup> thymocytes in Figure 3C may indicate impairment in the later stages of positive selection. Therefore, we have modified sentences as follows “Taken together, these results suggest that Fam49b play an important role of T cells development, especially in TCRβ<sup>hi</sup>CD69<sup>+</sup> and TCRβ<sup>hi</sup>CD69<sup>-</sup> thymocytes”</p><disp-quote content-type="editor-comment"><p>Line 126 &quot;we concluded that Fam49a is unlikely to 127 play a significant role in T cell development&quot; is obviously misleading since the authors mention in their response that the double Fam49a/49b KO has a more severe phenotype than the Fam49a KO.</p></disp-quote><p>As suggested by the reviewer, and considering the possibility that the Fam49a protein could affect T cell development, we have removed the sentence &quot;we concluded that Fam49a is unlikely to play a significant role in T cell development&quot; from lines 126-127.</p><disp-quote content-type="editor-comment"><p>Since the authors did make OTI TCR transgenic Fam49b KO mice then it would be very helpful to see analysis of positive selection (e.g., as shown in Figure 3c,e, Figure 4b, Figure 5b) to show if the affects observed with polyclonal mice are observed with TCR transgenic mice.</p><p>1) analysis of positive selection (e.g., as shown in Figure 3c,e, Figure 4b)</p></disp-quote><p>One limitation of OT-I transgenic mice is that the transgenic TCR is highly expressed throughout the development of thymocytes [2]. In polyclonal C57BL/6 WT mice, αβTCR, CD4, and CD8α are expressed at the DP thymocyte stage, resulting in positive and negative selection. However, in WT and Fam49b-KO OT-I mice, αβTCR expression significantly increases from the DN stage (<xref ref-type="fig" rid="sa2fig5">Author response image 5A</xref>). As a result, identifying populations based on TCRβ and CD69/CD5 expression to further characterize positive selection is challenging.</p><fig id="sa2fig5" position="float"><label>Author response image 5.</label><caption><title>(A) Flow cytometry analyzing the expression of CD4 and CD8α in thymocytes from WT and Fam49b-KO OT-I mice (upper).</title><p>Flow cytometry analyzing the expression of OT-I-specific variable region TCR-Vα2 and TCRβ on gated CD4<sup>-</sup>CD8α<sup>-</sup> DN thymocytes from WT and Fam49b-KO OT-I mice at 6 weeks of age (lower). Shown are representative data of three-four mice per genotype.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig5-v1.tif"/></fig><p>However, CD5 expression do correlate with the strength of TCR signaling. In polyclonal C57BL/6 WT mice, most DP thymocytes do not undergo positive or negative selection, which requires TCR engagement of pMHC, and thus do not upregulate CD5 expression (<xref ref-type="fig" rid="sa2fig6">Author response image 6A</xref>). WT and Fam49b-KO OT-I mice have a large population of TCR-Vα2<sup>+</sup> DP thymocytes that undergo positive selection, as indicated by an increase in the CD5<sup>+</sup> population compared to polyclonal WT mice (<xref ref-type="fig" rid="sa2fig6">Author response image 6B</xref>). An interesting observation is that Fan49b-KO OT-I mice express high level of CD5 on TCR-Vα2<sup>+</sup> DP compared to WT OT-I mice, which is consistent with the phenotype of polyclonal Fam49b-KO mice (shown in Figure 4B). This observation indicates that Fam49b-KO OT-I DP thymocytes had received stronger TCR signaling than the WT OT-I DP thymocytes. We postulated that enhanced TCR-signal strength of Fam49b-KO OT-I DP thymocytes could be diverted into negative selection from positive selection. However, contrary to the predictions, there were no significant differences in frequencies and numbers of CD8 SP thymocytes between WT and Fam49b-KO OT-I mice (Figure 6A and Figure 6B). Therefore, we suggest that fam49b deficiency did not induce strong TCR signaling enough to pass the threshold for the negative selection in Fan49b-KO OT-I mice.</p><fig id="sa2fig6" position="float"><label>Author response image 6.</label><caption><title>(A) Expression of activation marker CD5 on TCR-Vα2<sup>+</sup> DP and TCR-Vα2<sup>+</sup> CD8 SP thymocytes from WT and Fam49b-KO OT-I mice at 6 weeks of age.</title><p>(B) Geometric MFI of CD5 on TCR-Vα2<sup>+</sup> DP. Small horizontal lines indicate the mean of 4 mice. *p=0.0278 (Mann-Whitney test). Shown are representative data of three independent experiment.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig6-v1.tif"/></fig><p>When analyzing thymocytes using CD69 and TCRβ expression, compared to polyclonal C57BL/6 WT mice (Figure 3C), most of the TCR-Va2<sup>+</sup> thymocytes in WT and Fam49b-KO OT-I mice are in Stage 4 (TCRβ<sup>hi</sup>CD69<sup>-</sup>) (<xref ref-type="fig" rid="sa2fig7">Author response image 7A</xref>). No significant difference was observed between WT and Fam49b-KO OT-I mice (<xref ref-type="fig" rid="sa2fig4">Author response image 4A</xref>).</p><p>When analyzing thymocytes using CD5 and TCRβ expression, compared to polyclonal C57BL/6 WT mice (Figure 3E), Stage 3 (TCRβ<sup>int</sup>CD5<sup>hi</sup>) and Stage 4 (TCRβ<sup>hi</sup>CD5<sup>hi</sup>) account for the largest proportion of TCR-Va2+ thymocytes in WT and Fam49b-KO OT-I mice (<xref ref-type="fig" rid="sa2fig5">Author response image 5B</xref>). No significant difference was observed between WT and Fam49b-KO OT-I mice (<xref ref-type="fig" rid="sa2fig7">Author response image 7B</xref>).</p><fig id="sa2fig7" position="float"><label>Author response image 7.</label><caption><title>(A) Differential surface expression of CD69 and TCRβ was used to identify thymocyte population of different maturity in WT and Fam49b-KO OT-I mice.</title><p>(right) Dot Plots show percentages of different thymocyte subpopulations among TCR-Vα2 positive thymocytes from WT and Fam49b-KO OT-I mice. Data are representative of two experiments. (B) Differential surface expression of CD5 and TCRβ was used to identify thymocyte population of different maturity in WT and Fam49b-KO OT-I mice. (right) Dot Plots show percentages of different thymocyte subpopulations among TCR-Vα2 positive thymocytes from WT and Fam49b-KO OT-I mice. Data are representative of two experiments.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig7-v1.tif"/></fig><disp-quote content-type="editor-comment"><p>2) analysis CD8SP maturity (e.g., as shown in Figure 5b)</p></disp-quote><p>We observed that CD5 expression levels were similar between WT and Fam49b-KO OT-I CD8 SP thymocytes (<xref ref-type="fig" rid="sa2fig5">Author response image 5B</xref>). When analyzing the TCR-Va2<sup>+</sup> CD8 SP thymocytes of WT and Fam49b-KO OT-I mice using the expression of CD69 and CD62L, compared to polyclonal C57BL/6 WT mice (Figure 5E), the CD69<sup>+</sup>CD62L<sup>-</sup> population was significantly reduced in WT and Fanm49b-KO OT-I mice (<xref ref-type="fig" rid="sa2fig8">Author response image 8A</xref>). Additionally, maturity of CD8 SP thymocytes was similar between WT and Fam49b-KO OT-I mice (<xref ref-type="fig" rid="sa2fig8">Author response image 8B</xref>).</p><fig id="sa2fig8" position="float"><label>Author response image 8.</label><caption><title>(A) Frequencies of immature (CD62L<sup>lo</sup>CD69<sup>hi</sup>), semi-mature (CD62<sup>lo</sup>CD69<sup>lo</sup>), and mature (CD62<sup>hi</sup>CD69<sup>lo</sup>) in the TCR-Vα2<sup>+</sup>TCRβ<sup>+</sup> CD8 SP thymocytes from WT and Fam49b-KO OT-I mice.</title><p>Numbers adjust to outlined areas indicate percentage of each population among total TCR-Vα2<sup>+</sup>TCRβ<sup>+</sup> CD8 SP thymocytes. Shown are representative data of three-four mice per genotype. (B) Quantification of cell numbers of immature and mature fraction in TCR-Vα2<sup>+</sup>TCRβ<sup>+</sup> CD8 SP thymocytes. Each dot represents an individual mouse. Data are representative of two experiments.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig8-v1.tif"/></fig><p>1. Nakajima, Y., et al., <italic>Critical role of the CD44(low)CD62L(low) CD8(+) T cell subset in restoring antitumor immunity in aged mice.</italic> Proc Natl Acad Sci U S A, 2021. 118(23).</p><p>2. Hu, Q., et al., <italic>Examination of thymic positive and negative selection by flow cytometry.</italic> J Vis</p><p>[Editors’ note: what follows is the authors’ response to the fourth round of review.]</p><disp-quote content-type="editor-comment"><p>The manuscript has been improved but there is a remaining issue that need to be addressed, as outlined below:</p><p>Therefore, prior to accepting the manuscript please remove the data and the text corresponding to Figure 2c as requested below by Reviewer #1.</p><p>Reviewer #1 (Recommendations for the authors):</p><p>I appreciate the authors efforts to respond to my concerns/comments. I accept their response to all of the points except for the problem with Figure 2c. It is true that there is a very small percentage of CD44-CD62L- T cells that can be detected in B6 mice, however this percentage is typically &lt;5% of CD4 and CD8 cells. In Figure 2c, 16% of B6 CD4<sup>+</sup> T cells are CD62L-CD44- and 30% of B6 CD8<sup>+</sup> T cells are CD62L-CD44-. This is abnormal. Further, CD62L+CD44+ central memory cells are missing from the B6 CD4 subset in Figure 2c but are present in B6 CD8<sup>+</sup> cells. This is also abnormal. Altogether this means that there is a problem with the FACS experiment used for Figure 2c.</p></disp-quote><p>We have designed a new multicolor flow cytometry panel to minimize overlap between fluorescence signals. We identified a lower frequency of CD44<sup>lo</sup>CD62L<sup>-</sup> T cell subset than before (10% of CD4 T cells and 13% of CD8 T cells), but still a higher percentage than the reviewer stated (<xref ref-type="fig" rid="sa2fig9">Author response image 9</xref>). However, importantly, the number of naïve (CD44<sup>lo</sup> CD62L<sup>+</sup>) CD4<sup>+</sup> and CD8<sup>+</sup> T cells were still significantly reduced in Fam49b-KO mice compared to WT mice. Approximately 5-7% of CD62L<sup>+</sup>CD44<sup>+</sup> CD4 T cells were identified in WT mice.</p><disp-quote content-type="editor-comment"><p>If the authors are unable to obtain believable CD44 vs CD62L FACS profiles for their control mice then the results from KO mice cannot be interpreted and Figure 2c should be removed as it is misleading as is.</p></disp-quote><p>Since the frequency of CD44<sup>lo</sup>CD62L<sup>-</sup> T cell subset remains higher than what the reviewer pointed out, we have, in accordance with the reviewer’s suggestion, removed Figure 3C and related text in the revised manuscript. We believe that this revision will help minimize any potential confusion for reader without affecting the overall argument of the manuscript.</p><fig id="sa2fig9" position="float"><label>Author response image 9.</label><caption><title>Expression of CD44 and CD62L on T cells (left) and absolute number of T cell subset (right) in peripheral lymph nodes in CD4 T cells (upper) and CD8 T cells (lower) from WT and Fam49b-KO mice.</title><p>T subset with phenotype of naïve (CD62L<sup>+</sup>CD44<sup>lo</sup>), acute effector (CD62L<sup>-</sup>CD44<sup>lo</sup>), effector memory (CD62L<sup>-</sup>CD44<sup>hi</sup>), and central memory (CD62L<sup>+</sup>CD44<sup>hi</sup>). Numbers adjust to outlined areas indicate percentage of T cells subset among total T cells. Each dot represents an individual mouse. Small horizontal lines indicate the mean of 5-6 mice.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-76940-sa2-fig9-v1.tif"/></fig></body></sub-article></article>