| p-value: | 1e-13 |
| log p-value: | -3.067e+01 |
| Information Content per bp: | 1.598 |
| Number of Target Sequences with motif | 380.0 |
| Percentage of Target Sequences with motif | 16.37% |
| Number of Background Sequences with motif | 409.4 |
| Percentage of Background Sequences with motif | 11.20% |
| Average Position of motif in Targets | 97.6 +/- 56.1bp |
| Average Position of motif in Background | 99.0 +/- 55.6bp |
| Strand Bias (log2 ratio + to - strand density) | -0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.11 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
NFIC/MA0161.2/Jaspar
| Match Rank: | 1 |
| Score: | 0.80 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CTTGGCTA- TACTTGGCAGA |
|
|
|
NFIX/MA0671.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTTGGCTA- NTTGGCANN |
|
|
|
NFIA/MA0670.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.73 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CTTGGCTA- NNTTGGCANN |
|
|
|
NF1-halfsite(CTF)/LNCaP-NF1-ChIP-Seq(Unpublished)/Homer
| Match Rank: | 4 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTTGGCTA CTTGGCAA |
|
|
|
POL004.1_CCAAT-box/Jaspar
| Match Rank: | 5 |
| Score: | 0.68 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CTTGGCTA-- TGATTGGCTANN |
|
|
|
SD0002.1_at_AC_acceptor/Jaspar
| Match Rank: | 6 |
| Score: | 0.66 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CTTGGCTA NNACTTGCCTT |
|
|
|
Smad3(MAD)/NPC-Smad3-ChIP-Seq(GSE36673)/Homer
| Match Rank: | 7 |
| Score: | 0.65 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CTTGGCTA- -TWGTCTGV |
|
|
|
PB0158.1_Rfx3_2/Jaspar
| Match Rank: | 8 |
| Score: | 0.65 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CTTGGCTA-------- ACTGACCCTTGGTTACCACAAAG |
|
|
|
NFY(CCAAT)/Promoter/Homer
| Match Rank: | 9 |
| Score: | 0.63 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CTTGGCTA CCGATTGGCT- |
|
|
|
Nr5a2(NR)/mES-Nr5a2-ChIP-Seq(GSE19019)/Homer
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----CTTGGCTA TGACCTTGAN-- |
|
|
|