| p-value: | 1e-4 |
| log p-value: | -9.680e+00 |
| Information Content per bp: | 1.901 |
| Number of Target Sequences with motif | 57.0 |
| Percentage of Target Sequences with motif | 4.85% |
| Number of Background Sequences with motif | 135.3 |
| Percentage of Background Sequences with motif | 2.80% |
| Average Position of motif in Targets | 115.1 +/- 64.5bp |
| Average Position of motif in Background | 106.8 +/- 57.6bp |
| Strand Bias (log2 ratio + to - strand density) | -0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.07 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
POL010.1_DCE_S_III/Jaspar
| Match Rank: | 1 |
| Score: | 0.71 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TAGCGA CAGCC- |
|
|
|
PB0056.1_Rfxdc2_1/Jaspar
| Match Rank: | 2 |
| Score: | 0.59 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TAGCGA---- CCGCATAGCAACGGA |
|
|
|
ZBTB33/MA0527.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.59 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------TAGCGA--- NAGNTCTCGCGAGAN |
|
|
|
GFX(?)/Promoter/Homer
| Match Rank: | 4 |
| Score: | 0.59 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TAGCGA---- TCTCGCGAGAAT |
|
|
|
PB0139.1_Irf5_2/Jaspar
| Match Rank: | 5 |
| Score: | 0.59 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --TAGCGA------- TTGACCGAGAATTCC |
|
|
|
ZBED1/MA0749.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.59 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TAGCGA---- CTATCGCGACATA |
|
|
|
PB0055.1_Rfx4_1/Jaspar
| Match Rank: | 7 |
| Score: | 0.58 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TAGCGA---- TACCATAGCAACGGT |
|
|
|
PB0054.1_Rfx3_1/Jaspar
| Match Rank: | 8 |
| Score: | 0.58 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TAGCGA-------- TGTGACCCTTAGCAACCGATTAA |
|
|
|
POL013.1_MED-1/Jaspar
| Match Rank: | 9 |
| Score: | 0.58 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TAGCGA CGGAGC-- |
|
|
|
CUX2/MA0755.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.58 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TAGCGA--- TTATCGATTA |
|
|
|