| p-value: | 1e-22 |
| log p-value: | -5.182e+01 |
| Information Content per bp: | 1.642 |
| Number of Target Sequences with motif | 31.0 |
| Percentage of Target Sequences with motif | 4.27% |
| Number of Background Sequences with motif | 1.8 |
| Percentage of Background Sequences with motif | 0.63% |
| Average Position of motif in Targets | 103.2 +/- 54.9bp |
| Average Position of motif in Background | 104.2 +/- 39.1bp |
| Strand Bias (log2 ratio + to - strand density) | 1.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
PB0029.1_Hic1_1/Jaspar
| Match Rank: | 1 |
| Score: | 0.74 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----TCGCAACC---- ACTATGCCAACCTACC |
|
|
|
RFX7/MA1554.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.69 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCGCAACC NTAGCAACG |
|
|
|
PB0055.1_Rfx4_1/Jaspar
| Match Rank: | 3 |
| Score: | 0.69 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TCGCAACC-- TACCATAGCAACGGT |
|
|
|
Hic1/MA0739.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.68 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TCGCAACC ATGCCAACC |
|
|
|
RFX1/MA0509.2/Jaspar
| Match Rank: | 5 |
| Score: | 0.67 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----TCGCAACC- TNCCATAGCAACNN |
|
|
|
PB0054.1_Rfx3_1/Jaspar
| Match Rank: | 6 |
| Score: | 0.67 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCGCAACC------ TGTGACCCTTAGCAACCGATTAA |
|
|
|
PB0056.1_Rfxdc2_1/Jaspar
| Match Rank: | 7 |
| Score: | 0.67 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TCGCAACC-- CCGCATAGCAACGGA |
|
|
|
PB0167.1_Sox13_2/Jaspar
| Match Rank: | 8 |
| Score: | 0.65 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----TCGCAACC----- ANNTNCCCACCCANNAC |
|
|
|
KLF4/MA0039.4/Jaspar
| Match Rank: | 9 |
| Score: | 0.65 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --TCGCAACC-- CGCCCCACCCCC |
|
|
|
RFX3/MA0798.2/Jaspar
| Match Rank: | 10 |
| Score: | 0.64 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----TCGCAACC- TNCCATAGCAACNN |
|
|
|