<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.3 20210610//EN"  "JATS-archivearticle1-3-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.3"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">77616</article-id><article-id pub-id-type="doi">10.7554/eLife.77616</article-id><article-version article-version-type="publication-state">version of record</article-version><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Chromosomes and Gene Expression</subject></subj-group><subj-group subj-group-type="heading"><subject>Genetics and Genomics</subject></subj-group></article-categories><title-group><article-title>Deep sequencing of yeast and mouse tRNAs and tRNA fragments using OTTR</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Gustafsson</surname><given-names>Hans Tobias</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Ferguson</surname><given-names>Lucas</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf2"/></contrib><contrib contrib-type="author"><name><surname>Galan</surname><given-names>Carolina</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Yu</surname><given-names>Tianxiong</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Upton</surname><given-names>Heather</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="pa1">†</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Kaymak</surname><given-names>Ebru</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Weng</surname><given-names>Zhiping</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Collins</surname><given-names>Kathleen</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-3172-7088</contrib-id><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf2"/></contrib><contrib contrib-type="author" corresp="yes"><name><surname>Rando</surname><given-names>Oliver J</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-1516-9397</contrib-id><email>Oliver.Rando@umassmed.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0464eyp60</institution-id><institution>Department of Biochemistry and Molecular Biotechnology, University of Massachusetts Medical School</institution></institution-wrap><addr-line><named-content content-type="city">Worcester</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01an7q238</institution-id><institution>Department of Molecular and Cell Biology, University of California, Berkeley</institution></institution-wrap><addr-line><named-content content-type="city">Berkeley</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01an7q238</institution-id><institution>Center for Computational Biology, University of California, Berkeley</institution></institution-wrap><addr-line><named-content content-type="city">Berkeley</named-content></addr-line><country>United States</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0464eyp60</institution-id><institution>Program in Bioinformatics and Integrative Biology, University of Massachusetts Medical School</institution></institution-wrap><addr-line><named-content content-type="city">Worcester</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Chang</surname><given-names>Howard Y</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00f54p054</institution-id><institution>Stanford University</institution></institution-wrap><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Weigel</surname><given-names>Detlef</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0243gzr89</institution-id><institution>Max Planck Institute for Biology Tübingen</institution></institution-wrap><country>Germany</country></aff></contrib></contrib-group><author-notes><fn fn-type="present-address" id="pa1"><label>†</label><p>Addition Therapeutics, South San Francisco, United States</p></fn></author-notes><pub-date publication-format="electronic" date-type="publication"><day>25</day><month>04</month><year>2025</year></pub-date><volume>14</volume><elocation-id>e77616</elocation-id><history><date date-type="received" iso-8601-date="2022-02-04"><day>04</day><month>02</month><year>2022</year></date><date date-type="accepted" iso-8601-date="2025-04-08"><day>08</day><month>04</month><year>2025</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint at bioRxiv.</event-desc><date date-type="preprint" iso-8601-date="2022-02-04"><day>04</day><month>02</month><year>2022</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2022.02.04.479139"/></event></pub-history><permissions><copyright-statement>© 2025, Gustafsson et al</copyright-statement><copyright-year>2025</copyright-year><copyright-holder>Gustafsson et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-77616-v2.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-77616-figures-v2.pdf"/><abstract><p>Among the major classes of RNAs in the cell, tRNAs remain the most difficult to characterize via deep sequencing approaches, as tRNA structure and nucleotide modifications can each interfere with cDNA synthesis by commonly used reverse transcriptases (RTs). Here, we benchmark a recently developed RNA cloning protocol, termed Ordered Two-Template Relay (OTTR), to characterize intact tRNAs and tRNA fragments in budding yeast and in mouse tissues. We show that OTTR successfully captures both full-length tRNAs and tRNA fragments in budding yeast and in mouse reproductive tissues without any prior enzymatic treatment, and that tRNA cloning efficiency can be further enhanced via AlkB-mediated demethylation of modified nucleotides. As with other recent tRNA cloning protocols, we find that a subset of nucleotide modifications leave misincorporation signatures in OTTR datasets, enabling their detection without any additional protocol steps. Focusing on tRNA cleavage products, we compare OTTR with several standard small RNA-Seq protocols, finding that OTTR provides the most accurate picture of tRNA fragment levels by comparison to ‘ground truth’ Northern blots. Applying this protocol to mature mouse spermatozoa, our data dramatically alter our understanding of the small RNA cargo of mature mammalian sperm, revealing a far more complex population of tRNA fragments – including both 5′ and 3′ tRNA halves derived from the majority of tRNAs – than previously appreciated. Taken together, our data confirm the superior performance of OTTR to commercial protocols in analysis of tRNA fragments, and force a reappraisal of potential epigenetic functions of the sperm small RNA payload.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>tRNAs</kwd><kwd>genomics</kwd><kwd>germline</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Mouse</kwd><kwd><italic>S. cerevisiae</italic></kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01HD099816</award-id><principal-award-recipient><name><surname>Gustafsson</surname><given-names>Hans Tobias</given-names></name><name><surname>Ferguson</surname><given-names>Lucas</given-names></name><name><surname>Galan</surname><given-names>Carolina</given-names></name><name><surname>Yu</surname><given-names>Tianxiong</given-names></name><name><surname>Upton</surname><given-names>Heather</given-names></name><name><surname>Kaymak</surname><given-names>Ebru</given-names></name><name><surname>Weng</surname><given-names>Zhiping</given-names></name><name><surname>Collins</surname><given-names>Kathleen</given-names></name><name><surname>Rando</surname><given-names>Oliver J</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>F31HD097928</award-id><principal-award-recipient><name><surname>Galan</surname><given-names>Carolina</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100006978</institution-id><institution>UC Berkeley</institution></institution-wrap></funding-source><award-id>Bakar Fellows program</award-id><principal-award-recipient><name><surname>Collins</surname><given-names>Kathleen</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>A recently developed RNA cloning protocol efficiently captures both intact and fragmented tRNAs.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>tRNAs represent the physical embodiment of the genetic code and are broadly expressed in all cell types in the body and across a wide range of environmental conditions. Nonetheless, there is increasing evidence that the cellular repertoire of tRNAs differs between different cell types, and within a given cell type can be shaped by external factors from proliferation rate (<xref ref-type="bibr" rid="bib17">Gingold et al., 2014</xref>; <xref ref-type="bibr" rid="bib20">Hernandez-Alias et al., 2020</xref>) to metabolite levels (<xref ref-type="bibr" rid="bib27">Laxman et al., 2013</xref>). Mature tRNAs are also cleaved in response to cellular stressors (<xref ref-type="bibr" rid="bib28">Lee and Collins, 2005</xref>; <xref ref-type="bibr" rid="bib29">Lee et al., 2009</xref>; <xref ref-type="bibr" rid="bib47">Thompson et al., 2008</xref>; <xref ref-type="bibr" rid="bib53">Yamasaki et al., 2009</xref>), and the resulting cleavage products – broadly known as tRNA fragments, or tRFs – are increasingly appreciated as potential regulatory molecules in their own right (<xref ref-type="bibr" rid="bib2">Anderson and Ivanov, 2014</xref>; <xref ref-type="bibr" rid="bib25">Keam and Hutvagner, 2015</xref>; <xref ref-type="bibr" rid="bib46">Su et al., 2020</xref>).</p><p>In contrast to most other RNA species, characterization of tRNA and tRF levels by deep sequencing has been hampered by technical difficulties in the synthesis of cDNA. tRNAs are subject to a wide range of covalent nucleotide modifications, with some ~15–20% of all tRNA nucleotides thought to be covalently modified to form species ranging from 5-methylcytosine and pseudouridine to more complex modifications like wybutosine or methoxy-carbonyl-methyl-thiouridine (<xref ref-type="bibr" rid="bib35">Phizicky and Hopper, 2010</xref>; <xref ref-type="bibr" rid="bib36">Phizicky and Hopper, 2015</xref>; <xref ref-type="bibr" rid="bib32">Pan, 2018</xref>). Several of these modifications, particularly N1-methylguanosine (m<sup>1</sup>G), N1-methyladenosine (m<sup>1</sup>A), N3-methylcytosine (m<sup>3</sup>C), and N2,N2-dimethylguanosine (m<sup>2</sup><sub>2</sub>G), are known to interfere with commonly used reverse transcriptases (RTs) and prevent the synthesis of full-length cDNAs. As a result, until recently, systematic analyses of intact tRNA levels typically relied on microarray hybridization (<xref ref-type="bibr" rid="bib12">Dittmar et al., 2006</xref>; <xref ref-type="bibr" rid="bib11">Dittmar et al., 2004</xref>) to avoid a requirement for reverse transcription. With respect to tRFs, although typical deep sequencing efforts do capture some tRNA cleavage products, they are clearly limited to only a subset of the tRFs in a given sample. For instance, a large number of groups have characterized small (18–40 nt) RNAs in mammalian sperm, with most such studies documenting very high levels of 5′ fragments of a small handful of tRNAs (most notably including Gly-GCC, Glu-CTC, and Val-CAC). Yet Northern blots show that 3′ tRNA fragments are also present in these samples (<xref ref-type="bibr" rid="bib41">Sharma et al., 2018</xref>; <xref ref-type="bibr" rid="bib54">Zhang et al., 2018</xref>,) but are not captured by typical commercial library preparation protocols such as Illumina TruSeq.</p><p>A number of methods have been developed in the past few years to enable analysis of intact tRNAs by deep sequencing. For instance, to reduce barriers to reverse transcription caused by secondary structures, Hydro-tRNAseq introduced limited hydrolysis of full-length tRNAs to yield short fragments for cloning and sequencing (<xref ref-type="bibr" rid="bib24">Karaca et al., 2014</xref>; <xref ref-type="bibr" rid="bib18">Gogakos et al., 2017</xref>). Alternatively, several early protocols leveraged the highly processive thermostable group II intron reverse transcriptase (TGIRT) to overcome tRNA secondary structures (<xref ref-type="bibr" rid="bib31">Mohr et al., 2013</xref>), along with enzymatic demethylation of m<sup>1</sup>G, m<sup>1</sup>A, and m<sup>3</sup>C by bacterial AlkB in an attempt to avoid premature RT termination (<xref ref-type="bibr" rid="bib55">Zheng et al., 2015</xref>; <xref ref-type="bibr" rid="bib9">Cozen et al., 2015</xref>; <xref ref-type="bibr" rid="bib10">Dai et al., 2017</xref>). Although these first-generation protocols yielded few full-length tRNA sequences, a substantially improved TGIRT-based protocol – mim-tRNAseq – was recently shown to efficiently capture full-length tRNAs with only modest levels of premature RT termination (<xref ref-type="bibr" rid="bib3">Behrens et al., 2021</xref>). Other relatively recently developed tRNA cloning protocols include YAMAT-seq (<xref ref-type="bibr" rid="bib45">Shigematsu et al., 2017</xref>), LOTTE-seq (<xref ref-type="bibr" rid="bib14">Erber et al., 2020</xref>), QuantM-seq (<xref ref-type="bibr" rid="bib37">Pinkard et al., 2020</xref>), nano-tRNAseq (<xref ref-type="bibr" rid="bib30">Lucas et al., 2024</xref>), and LIDAR (<xref ref-type="bibr" rid="bib38">Scacchetti et al., 2024</xref>). We consider advantages and disadvantages of these various methods in the <italic>Discussion</italic>; for instance, many of the methods mentioned above – YAMAT-seq, nano-tRNAseq, LOTTE-seq, and QuantM-seq – rely on adaptor ligation to the 3’ CCA on the tRNA acceptor stem and are thus suitable for intact tRNA cloning but cannot be used for analysis of tRNA fragments.</p><p>To capture an accurate profile of small RNAs with well-defined RNA 5′ and 3′ ends, a novel protocol was developed – Ordered Two-Template Relay, or OTTR (<xref ref-type="bibr" rid="bib50">Upton et al., 2021</xref>) – that exploits an engineered version of the <italic>Bombyx mori</italic> R2 retroelement reverse transcriptase (<xref ref-type="bibr" rid="bib4">Bibiłło and Eickbush, 2002</xref>) for sequential template jumping. In a one-step RT reaction, OTTR joins 5′ and 3′ adaptors to a full-length cDNA copy of input RNA. Benchmarking a large number of protocols for bias in the capture of a defined mixture of synthetic small RNAs revealed significantly lower bias for OTTR than for any commercial protocol (<xref ref-type="bibr" rid="bib50">Upton et al., 2021</xref>). Intriguingly, characterization of RNA in tissue culture cell lines using OTTR captured substantial levels of intact tRNAs, suggesting that OTTR could be a promising protocol for tRNA sequencing applications.</p><p>Here, we set out to explore the utility of OTTR for analysis of intact tRNAs and tRFs in several biological systems. We successfully sequenced full-length intact tRNAs from budding yeast, and from mouse testis, and confirmed that a number of specific nucleotide modifications induce mismatch signatures in the tRNA sequencing dataset. We next turned to analysis of small RNA populations in three systems: budding yeast overexpressing the RNaseT2 family member RNY1p, mouse cauda epididymis, and mature cauda epididymal sperm. Comparison of OTTR with several commercial protocols, coupled with gold standard Northern blot validation, confirmed that OTTR more accurately captures tRFs than either NEBNext, Illumina Truseq, or a typical in-house protocol based on adaptor ligation. In the mouse samples, we show that OTTR captures a far greater variety of tRNA cleavage products, including abundant 3′ tRNA fragments, that are invisible to the majority of other protocols examined. Taken together, our data provide an updated view of the mouse sperm small RNA payload, and highlight the utility of OTTR for analysis of tRNAs and tRNA fragments by deep sequencing.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Cloning of full-length tRNAs in budding yeast, and mouse testis</title><p>We initially sought to compare OTTR with several commercial protocols for analysis of small (18–40 nt) RNA populations in mouse sperm. Our proof-of-concept datasets revealed abundant nucleotide mismatches at presumed sites of tRNA nucleotide modifications (see below), as observed in multiple prior deep sequencing analyses of tRNAs (<xref ref-type="bibr" rid="bib55">Zheng et al., 2015</xref>; <xref ref-type="bibr" rid="bib9">Cozen et al., 2015</xref>; <xref ref-type="bibr" rid="bib10">Dai et al., 2017</xref>; <xref ref-type="bibr" rid="bib3">Behrens et al., 2021</xref>). We therefore set out first to sequence intact tRNAs to empirically characterize effects of nucleotide modifications on deep sequencing libraries, to help guide bioinformatic analyses of tRNA-derived sequences.</p><p>We focused on two biological systems. First, given the ease of growing large quantities of <italic>S. cerevisiae</italic> for validation of our sequencing data by Northern blots, along with the extensive characterization of tRNA modifications in this species, we sequenced intact tRNAs from actively growing budding yeast. Second, mouse sperm are thought to carry a payload of small RNAs dominated by 5′ tRNA halves (<xref ref-type="bibr" rid="bib34">Peng et al., 2012</xref>), and an increasing number of studies have implicated mouse sperm RNAs as potential mediators of intergenerational paternal effects (<xref ref-type="bibr" rid="bib42">Sharma, 2019</xref>). However, given that sperm do not carry substantial levels of intact tRNAs (<xref ref-type="bibr" rid="bib41">Sharma et al., 2018</xref>; <xref ref-type="bibr" rid="bib54">Zhang et al., 2018</xref>), we instead first turned to mouse testis samples as a source of intact mammalian tRNAs.</p><p>For each sample, we generated total RNA, then either fractionated RNAs over a spin column to enrich for &lt;200 nt RNAs (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>), or gel-purified 60–100 nt RNAs. A second size selection step was added following cDNA synthesis to deplete adaptor dimers and enrich for libraries carrying ~60–100 bp inserts. Resulting OTTR libraries were then sequenced to an average of ~10 million reads. Surprisingly, we consistently recovered more full-length tRNAs when using the more lenient RNA sizing by <italic>mir</italic>Vana spin column (<xref ref-type="fig" rid="fig1">Figure 1A</xref>), suggesting that the process of gel-mediated size selection likely results in tRNA fragmentation. We therefore focused downstream analyses on tRNA-mapping reads in the <italic>mir</italic>Vana-sized OTTR libraries.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>OTTR successfully captures full length tRNAs in yeast and mouse.</title><p>(<bold>A</bold>) Insert length distributions for full-length tRNA OTTR libraries for budding yeast, and mouse testis, as indicated. Libraries were prepared following one of two initial size selection steps: ‘Gel’ refers to libraries from total RNA subject to acrylamide gel-based purification of 60–100 nt RNAs, ‘Mirvana’ refers to libraries build using the small (&lt;200 nt) fraction recovered from <italic>mir</italic>Vana RNA spin columns (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>), and ‘rep’1 and 2 refer to replicate datasets. (<bold>B, C</bold>) Efficient capture of full length tRNAs from mouse (<bold>B</bold>) and yeast (<bold>C</bold>) samples using OTTR. For each tRNA species with over 1000 reads, percentage of full length tRNA reads was calculated. See also (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). (<bold>D</bold>) Coverage plots for three exemplar tRNAs in the yeast OTTR dataset. Red and green bars show sequence start and stop nt, respectively, while blue bars show sequence coverage internal to a start or stop. WT indicates wild-type. (<bold>E</bold>) Improved full-length tRNA coverage in <italic>trm1</italic>Δ yeast lacking m<sup>2</sup><sub>2</sub>G, plotted as in panel (<bold>C</bold>). (<bold>F</bold>) Coverage plots for an exemplar tRNA comparing WT and <italic>trm1</italic>Δ yeast. Coverage plots (normalized to the coverage at the tRNA 3’ end for each library) are superimposed, with light blue WT over purple <italic>trm1</italic>Δreads; purple thus highlights the differential between libraries.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig1-v2.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Enrichment of short and long RNA populations.</title><p>(<bold>A</bold>) Gel shows <italic>mir</italic>Vana column-enriched short and long RNA fractions, isolated from yeast and various mouse tissues, as indicated. (<bold>B</bold>) Length distribution for mouse testis tRNA reads; while data for <xref ref-type="fig" rid="fig1">Figure 1A</xref> show lengths of tRNA-mapping reads with detectable 5’ and 3’ adaptor sequences, data here include longer reads that are too long to include the 3’ adaptor. Note the second peak at ~82–85 nt, corresponding to the subset of tRNAs with longer variable loops (Leu and Ser tRNAs). Unfortunately, we did not capture any longer reads as this dataset was inadvertently generated using the Illumina 75 cycle sequencing kit (which nonetheless yields up to 85 nt of sequence). As a result, our characterization of full-length tRNA capture (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplements 2</xref>–<xref ref-type="fig" rid="fig1s3">3</xref>) modestly underestimates full length capture of tRNAs with long variable loops.</p><p><supplementary-material id="fig1s1sdata1"><label>Figure 1—figure supplement 1—source data 1.</label><caption><title>Source data shows the original gel without any obscuring annotations.</title></caption><media mimetype="application" mime-subtype="pdf" xlink:href="elife-77616-fig1-figsupp1-data1-v2.pdf"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig1-figsupp1-v2.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 2.</label><caption><title>Full length tRNA capture across protocols.</title><p>Comparison of full length tRNA capture across various deep sequencing approaches to tRNA sequencing. Datasets from yeast (<bold>A</bold>), mouse (<bold>B</bold>), and human (<bold>C</bold>) samples are shown. For each dataset, pie charts show fractions of tRNA-mapping reads reflecting full-length tRNAs, 5’ or 3’ tRNA fragments, and miscellaneous tRNA-mapping reads (internal fragments, sequences mapping to precursor tRNA sequences including 5’ and 3’ leader and trailer sequences). Bar plots underneath show coverage for a typical tRNA for each dataset. For datasets with multiple cell types or tissues, the selected datasets are representative of tRNA capture across the remaining samples (not shown).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig1-figsupp2-v2.tif"/></fig><fig id="fig1s3" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 3.</label><caption><title>Quantitative comparison of tRNA levels across methods.</title><p>Scatterplots show levels of tRNAs measured by OTTR (x axis for all plots) compared to levels measured in the indicated methods, shown on the y axes. For each species – yeast (<bold>A</bold>) and mouse (<bold>B</bold>) – top panels show tRNA levels calculated using all tRNA-mapping reads, so that partial tRNA fragments captured by protocols with poor recovery of full-length tRNAs (ARM, for example, where premature RT termination results in intact tRNAs being captured as 3’ fragments) are counted towards overall tRNA levels. For mouse samples in (<bold>B</bold>), 1 ‘pseudoread’ was added to all tRNA abundance values as a subset of tRNAs were not captured in one or both protocols being compared and zeroes cannot be visualized on a log scale scatterplot. Bottom panels show comparisons for intact tRNA reads for the protocols with &gt;25% intact tRNAs. This includes data from Table S11 from <xref ref-type="bibr" rid="bib30">Lucas et al., 2024</xref>, a Nanopore-based tRNA sequencing method not included in <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>. For mouse samples (<bold>B</bold>), note that LIDAR was the only published method used for analysis of intact tRNAs in the mouse testis; the comparisons to the QuantM liver and cortex samples are not ‘apples to apples’, and differences between datasets could result either from tissue-specific tRNA pools, or from technical differences between protocols.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig1-figsupp3-v2.tif"/></fig></fig-group><p>Initial mapping of OTTR reads to mature tRNA sequences using standard analytical pipelines was hindered by the high numbers of sequence mismatches resulting from reverse transcription ‘errors’ at modified nucleotides in tRNAs. We therefore turned to the tRAX analytical pipeline (<xref ref-type="bibr" rid="bib21">Holmes et al., 2022</xref>), a mismatch-tolerant pipeline that accounts for the wide range of post-transcriptional modifications to tRNAs that can complicate typical RNA mapping pipelines. For each tRNA, we calculated the percentage of full-length reads, finding that the majority (~70–90% of reads) of tRNAs were full length in both mouse and yeast samples (<xref ref-type="fig" rid="fig1">Figure 1B–D</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>).</p><p>Comparison to a range of prior tRNA sequencing datasets (<xref ref-type="bibr" rid="bib18">Gogakos et al., 2017</xref>; <xref ref-type="bibr" rid="bib55">Zheng et al., 2015</xref>; <xref ref-type="bibr" rid="bib9">Cozen et al., 2015</xref>; <xref ref-type="bibr" rid="bib3">Behrens et al., 2021</xref>; <xref ref-type="bibr" rid="bib45">Shigematsu et al., 2017</xref>; <xref ref-type="bibr" rid="bib14">Erber et al., 2020</xref>; <xref ref-type="bibr" rid="bib37">Pinkard et al., 2020</xref>; <xref ref-type="bibr" rid="bib38">Scacchetti et al., 2024</xref>; <xref ref-type="bibr" rid="bib52">Watkins et al., 2022</xref>; <xref ref-type="bibr" rid="bib39">Scheepbouwer et al., 2023</xref>) revealed that YAMAT-seq was the most efficient protocol for intact tRNA capture, with reads almost completely derived from full length tRNAs (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). That said, YAMAT-seq data were very low complexity, with two tRNAs (Lys-CTT, Glu-GTC) representing 82–86% of all tRNA mapping reads across all three cell lines analyzed (not shown). After YAMAT-seq, OTTR and mim-tRNAseq (<xref ref-type="bibr" rid="bib3">Behrens et al., 2021</xref>) were comparable in terms of capturing full-length tRNAs with ~70–90% of tRNA-mapping reads representing full-length sequences, while the remaining protocols captured various types of partial tRNAs potentially attributable to premature RT termination, internal RT priming, or other forms of tRNA degradation or breakage (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). Moreover, we find good overall quantitative agreement between intact tRNA levels measured by OTTR and datasets from comparable samples (e.g. actively growing yeast, and mouse testis), including a dataset obtained using the Nanopore-based nano-tRNAseq (<xref ref-type="bibr" rid="bib30">Lucas et al., 2024</xref>) protocol (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>). Finally, we explored the ability of these various protocols to capture the known correspondence between tRNA gene copy number and tRNA abundance, with mim-tRNAseq exhibiting the best performance (<italic>R</italic>=0.96), followed by OTTR (<italic>R</italic>=0.5–0.7 across datasets), followed by ARM-seq, Lotte, and nano-tRNAseq (<italic>R</italic>=0.4–0.5 for all three protocols).</p><p>Visualization of sequence coverage and read start and stop locations for several tRNAs (<xref ref-type="fig" rid="fig1">Figure 1D</xref>) suggested that known nucleotide modification sites, including the common m<sup>1</sup>G modification found at position 9 of many tRNAs (eg, tRNA-Ile-AAT), could be barriers to reverse transcription. To directly test whether premature termination is affected by nucleotide modifications, we prepared full-length tRNA libraries from <italic>trm1</italic>Δ yeast lacking the methylase responsible for m<sup>2</sup><sub>2</sub>G (<xref ref-type="bibr" rid="bib23">Hopper et al., 1982</xref>). We find further gains in the efficiency of full-length tRNA capture in this strain background (<xref ref-type="fig" rid="fig1">Figure 1E and F</xref>), suggesting that this nucleotide modification presents a partial barrier to reverse transcription (see below).</p></sec><sec id="s2-2"><title>Signatures of nucleotide modifications in full-length tRNA sequences</title><p>Many of the nucleotide modifications in tRNAs involve chemical alterations that affect the pattern of hydrogen bond donors and acceptors at the base pairing interface. As a result, ‘incorrect’ nucleotides (relative to those expected from tRNA genomic sequences) can be incorporated into cDNA at these positions during the process of reverse transcription, resulting in a ‘mutation/misincorporation’ signature for modified nucleotides in deep sequencing data. Examination of individual yeast tRNAs revealed high levels of misincorporation at multiple positions throughout the tRNA (<xref ref-type="fig" rid="fig2">Figure 2A</xref>), with mismatches localized at various known modification sites, including the expected mismatches at m<sup>1</sup>G, m<sup>2</sup><sub>2</sub>G, m<sup>3</sup>C, and m<sup>1</sup>A nucleotides. Examination of the same tRNA species in our <italic>trm1</italic>Δ dataset revealed the expected loss of nucleotide misincorporation at G26 in this mutant (<xref ref-type="fig" rid="fig2">Figure 2B</xref>), confirming that the m<sup>2</sup><sub>2</sub>G nucleotide modification is responsible for the mutational signature at this position.</p><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Nucleotide modifications revealed by genomic mismatches.</title><p>(<bold>A</bold>) Sequence coverage of the two indicated tRNAs, with reads matching the genomic tRNA sequence shown in blue, and apparent misincorporations in red. Known nucleotide modifications are shown below each mismatch location. Question mark at position 9 for Thr-AGT indicates no annotated modification at this site in the MODOMICS database (although this site is a common site for the m<sup>1</sup>G modification in other tRNAs); interestingly, the adjacent nucleotide (position 10) is a known site for N2-methylated guanine in this tRNA. (B) Misincorporation data from the <italic>trm1</italic>Δ dataset for the same two tRNAs as in panel (A). Red arrows indicate loss of mismatches at position 26 in both tRNAs. (<bold>C–E</bold>) Frequency of mismatches across all tRNAs for wild-type yeast (<bold>C</bold>) <italic>trm1</italic>Δ yeast (<bold>D</bold>) and mouse (<bold>E</bold>) OTTR tRNA datasets. In each plot, the % misincorporation is shown for each tRNA position (x axis) for each tRNA species (indicated by colors) with over 2000 reads. Red arrow in panel (<bold>D</bold>) shows the loss of the misincorporation signature at position 26 in <italic>trm1</italic>Δ yeast. (<bold>F</bold>) Detailed view of mismatch frequency at the six indicated nucleotide positions of budding yeast tRNAs. Bar graphs are from the same data as in panel (<bold>C</bold>) The known nucleotide modifications at these positions are annotated.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig2-v2.tif"/></fig><p>To explore the effects of modified nucleotides on RT misincorporation globally across all tRNA species and all positions, we plotted ‘mutations’ for each nucleotide position across all tRNAs in wild type and <italic>trm1</italic>Δ yeast, and in mouse testis (<xref ref-type="fig" rid="fig2">Figure 2C–E</xref>). Consistent with prior observations (<xref ref-type="bibr" rid="bib3">Behrens et al., 2021</xref>; <xref ref-type="bibr" rid="bib37">Pinkard et al., 2020</xref>), we observed high levels of misincorporation at tRNA positions 9, 26, and 58, corresponding to well-known locations of m<sup>1</sup>G, m<sup>2</sup><sub>2</sub>G, and m<sup>1</sup>A, respectively. Moreover, as seen for individual tRNAs (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, red arrows), we find that the mutational signature at position 26 is completely lost in the <italic>trm1</italic>Δ background (<xref ref-type="fig" rid="fig2">Figure 2D</xref>, red arrow), confirming the causal link between the m<sup>2</sup><sub>2</sub>G modification and the misincorporation signature at this position. Closer examination of the specific tRNA species exhibiting mismatches at any given position in yeast (<xref ref-type="fig" rid="fig2">Figure 2F</xref>) confirmed that mismatches were only observed in the subset of tRNAs known to be modified at the position in question (<xref ref-type="bibr" rid="bib13">Dunin-Horkawicz et al., 2006</xref>), as for example alanine tRNAs carry m<sup>1</sup>G at position 9 whereas histidine tRNAs do not (<xref ref-type="fig" rid="fig2">Figure 2F</xref>, leftmost panel).</p><p>Beyond the mutational signature observed at known locations of m<sup>2</sup><sub>2</sub>G, m<sup>1</sup>G, and m<sup>1</sup>A, several other locations were associated with sequencing mismatches (<xref ref-type="fig" rid="fig2">Figure 2C and F</xref>). These included known locations for 3-methylcytidine (32), inosine and 1-methylinosine (34 and 37), and wybutosine (37), as well as lower frequency of misincorporation at several locations currently annotated as unmodified nucleotides in the MODOMICS database (<xref ref-type="bibr" rid="bib13">Dunin-Horkawicz et al., 2006</xref>). Taken together, these data demonstrate the utility of OTTR for analysis of a range of nucleotide modifications.</p></sec><sec id="s2-3"><title>Analysis of tRNA cleavage in budding yeast following nuclease overexpression</title><p>Turning to analysis of smaller (&lt;40 nt) RNAs, we next set out to benchmark several small RNA cloning protocols in the experimentally tractable budding yeast model system. Cellular tRNAs can be cleaved by a number of different nucleases, including RNase A, T, and L family members, in a variety of species (<xref ref-type="bibr" rid="bib28">Lee and Collins, 2005</xref>; <xref ref-type="bibr" rid="bib47">Thompson et al., 2008</xref>; <xref ref-type="bibr" rid="bib53">Yamasaki et al., 2009</xref>; <xref ref-type="bibr" rid="bib48">Thompson and Parker, 2009</xref>; <xref ref-type="bibr" rid="bib1">Andersen and Collins, 2012</xref>). Conveniently, budding yeast do not encode any RNase A or L family members, and encode a single RNase T2 family member, RNY1p. As RNY1p overexpression has previously been reported to drive high levels of tRNA cleavage (<xref ref-type="bibr" rid="bib48">Thompson and Parker, 2009</xref>), we generated a construct bearing <italic>RNY1</italic> under the control of the galactose-inducible p<italic>GAL1-10</italic> promoter. We confirmed by Northern blot analysis that overexpression of RNY1p lead to high levels of tRNA-Gly-GCC cleavage in our hands (<xref ref-type="fig" rid="fig3">Figure 3A</xref>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A and B</xref>), providing a convenient system for the production of high levels of tRNA fragments for benchmarking small RNA cloning protocols.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Benchmarking OTTR capture of tRNA fragments in budding yeast overexpressing RNY1p.</title><p>(<bold>A</bold>) Northern blots for tRNA-Gly-GCC 3′ end during a time course of RNY1p overexpression (from uninduced to 6 hr induction) in budding yeast. (<bold>B</bold>) Size distributions for tRNA-mapping reads in various small RNA libraries prepared from yeast following six hours of RNY1p overexpression. See also <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>. (<bold>C</bold>) Overall coverage of all tRNA isoacceptors – calculated by summing all reads mapping to a given tRNA species – shown for the indicated small RNA cloning protocols. (<bold>D, E</bold>) Left panels show coverage maps for tRNA-Gly-GCC (<bold>D</bold>) or tRNA-Asp-GTC (<bold>E</bold>) for the six indicated cloning protocols. Each plot shows the distribution of all 5′ (start) and 3′ (end) ends of the relevant sequencing reads, as well as the cumulative sequencing coverage across the tRNA. Right panels for each tRNA show Northern blots for the 5′ side, and the 3′ side, of the relevant tRNA (from yeast subject to 6 hr of RNY1p overexpression), as indicated. Black arrow highlights the full-length tRNA band. The deep sequencing datasets from NEBNext and <xref ref-type="bibr" rid="bib16">Fu et al., 2018</xref> protocols capture only the 3′ half of tRNA-Gly-GCC, and the 5′ half of Asp-GTC, while OTTR captures both 5′ and 3′ halves. In both cases, Northern blots confirm the validity of the OTTR dataset, with both 5′ and 3′ halves present at similar abundance for both of these tRNAs.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Original images of Northern blots used in <xref ref-type="fig" rid="fig3">Figure 3</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-77616-fig3-data1-v2.zip"/></supplementary-material></p><p><supplementary-material id="fig3sdata2"><label>Figure 3—source data 2.</label><caption><title>Annotated Northern blots for source data.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-77616-fig3-data2-v2.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>tRF profiling in budding yeast following RNY1p expression.</title><p>(<bold>A</bold>) Size distribution of tRNA-mapping reads in the indicated libraries prepared from yeast carrying the p<italic>Gal:RNY1</italic> plasmid grown under noninducing raffinose conditions (top panel), or grown for 6 hours in galactose to induce RNY1p (bottom panel). The wide rage of fragment sizes prior to RNY1p induction likely reflects tRNA degradation during RNA handling, in contrast to the induction of precise cleavage at the anticodon following RNY1p induction. In addition, spike-ins of <italic>Schizosaccharomyces pombe</italic> total RNA for normalization confirm an ~10-fold increase (not shown) in tRNA fragments following RNY1p induction in <italic>S. cerevisiae</italic>. (<bold>B</bold>) Coverage of tRNA-Gly-GCC in OTTR libraries before (top) and after (bottom) RNY1p overexpression. As in panel (<bold>A</bold>), specific cleavage at the anticodon is readily distinguished from the more nonspecific tRNA degradation seen in uninduced conditions. (<bold>C</bold>) Coverage of tRNA fragments in RNY1p-induced yeast. As in <xref ref-type="fig" rid="fig3">Figure 3C</xref>, for all libraries sequenced. (<bold>D</bold>) 5′ and 3′ tRF detection. As in panel (<bold>C</bold>), but here reads were separately mapped to tRNA 5′ or 3′ halves and the two halves are plotted separately, as indicated.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig3-figsupp1-v2.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>Northern blotting validates OTTR capture of tRNA halves in yeast overexpressing RNY1p.</title><p>As in <xref ref-type="fig" rid="fig3">Figure 3D and E</xref>, for two additional tRNAs.</p><p><supplementary-material id="fig3s2sdata1"><label>Figure 3—figure supplement 2—source data 1.</label><caption><title>Original images of Northern blots used in <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-77616-fig3-figsupp2-data1-v2.zip"/></supplementary-material></p><p><supplementary-material id="fig3s2sdata2"><label>Figure 3—figure supplement 2—source data 2.</label><caption><title>Annotated Northern blots for source data.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-77616-fig3-figsupp2-data2-v2.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig3-figsupp2-v2.tif"/></fig></fig-group><p>To compare small RNA cloning protocols, we overexpressed <italic>RNY1</italic> for six hours in large cultures, purified total RNA, and split the RNA into aliquots for cloning. We generated an initial sequencing dataset to enable comparisons between three basic protocols: (1) a ssRNA ligase strategy (<xref ref-type="bibr" rid="bib16">Fu et al., 2018</xref>) based on RNA ligase-dependent adaptor ligation strategies common to most small RNA-seq protocols; (2) the widely-used NEBNext Small RNA kit; and (3) OTTR. In each case, libraries carrying inserts &lt;50 nt were size selected by gel prior to sequencing, to focus on tRNA fragments (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). All three protocols captured tRFs of similar lengths, albeit with moderate differences between the three protocols – NEBNext was a particular outlier in this regard, with peaks of read counts for specific tRF lengths that were far more prominent in these libraries than in libraries made with the other two protocols.</p><p>To compare these cloning protocols in more granular detail, we calculated the representation of all yeast tRNAs in each of the various deep sequencing datasets. As shown in <xref ref-type="fig" rid="fig3">Figure 3C</xref> and <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1C</xref>, we captured relatively few distinct tRNA fragments using the NEB protocol, contrasting with the far wider range of tRFs captured using the Fu2018 protocol and OTTR. Overall, we find that OTTR revealed the greatest diversity of tRFs of all the protocols examined. We extended this analysis by binning tRNA-mapping reads according to the coverage of either the 5′ or 3′ half of each yeast tRNA. This analysis (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1D</xref>) again reveals remarkably few tRNA species efficiently captured by NEBNext, contrasting with somewhat better tRNA capture using the <xref ref-type="bibr" rid="bib16">Fu et al., 2018</xref> protocol, with our OTTR datasets exhibiting the greatest complexity in the range of tRNA fragments captured. The relatively even representation of yeast tRNA species, and 5′ and 3′ halves, is consistent with the expectation that RNase T2 family members like RNY1p should have only modest sequence preferences beyond a preference for pyrimidines present in single-stranded RNA loop regions, and should therefore cleave most tRNAs. In particular, the relatively even distribution of ratios between 5′ and 3′ halves across all tRNAs observed in the OTTR datasets is consistent with Northern blot results (see below), demonstrating roughly similar levels of 5′ and 3′ cleavage products for all four tRNAs assayed.</p><p>To enable validation by comparison to an independent measure of tRNA fragment levels, we next examined nucleotide-resolution coverage data for several tRNAs that exhibited substantial differences in measured abundance between the three protocols. <xref ref-type="fig" rid="fig3">Figure 3D and E</xref> show coverage plots for two exemplar tRNAs – chosen based on dramatic differences in capture of the two halves of the tRNA across the three different protocols – with coverage of the tRNA shown in blue along with the locations of tRNA fragment 5′ and 3′ ends. For example, although all three protocols robustly captured the 3′ half of tRNA-Gly-GCC, OTTR uniquely captured the 5′ fragments of this tRNA that were absent from the other two libraries (<xref ref-type="fig" rid="fig3">Figure 3D</xref>). To validate these protocols by comparison to an independent ground truth, we assayed the 5′ and 3′ halves of four tRNAs by Northern blotting (<xref ref-type="fig" rid="fig3">Figure 3D and E</xref>, right panels, and <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). For the two tRNAs for which the different deep sequencing protocols showed substantial differences in tRNA coverage, OTTR more faithfully captured the tRNA fragment ratio detected by Northern blots. Taken together, our data show that OTTR captures a wider range of tRNA fragments, more even levels of 5′ and 3′ tRNA halves, and better agrees with ground truth Northern blots, all of which strongly support the utility of OTTR for analysis of tRNA-derived small RNAs.</p></sec><sec id="s2-4"><title>The small RNA payload of mature mouse spermatozoa</title><p>We next turned to analysis of small RNAs in the mouse germline. Scores of studies over the past decade have documented abundant tRNA fragments in mammalian sperm, with the majority of published datasets documenting highly abundant 5′ tRFs, with the 5′ halves of tRNA-Glu-CTC, tRNA-Val-CAC, and tRNA-Gly-GCC representing the three most abundant tRFs in mouse sperm (<xref ref-type="bibr" rid="bib34">Peng et al., 2012</xref>; <xref ref-type="bibr" rid="bib40">Sharma et al., 2016</xref>). However, it has been clear for years that standard deep sequencing analyses are insufficient to fully capture the sperm RNA payload. First, RNA cleavage by RNase A, T, or L family members is known to leave RNA 3′ ends bearing a cyclic 2′–3′ phosphate (which can spontaneously resolve to 2′- or 3′-phosphorylated ends), a modification that prevents RNA ligation during cloning. Indeed, resolving cyclic 2′–3′ phosphates via T4 Polynucleotide Kinase (PNK) treatment (<xref ref-type="bibr" rid="bib22">Honda et al., 2015</xref>) resulted a dramatic shift in captured sperm RNAs (<xref ref-type="bibr" rid="bib41">Sharma et al., 2018</xref>), revealing a far greater abundance and diversity of rRNA cleavage products than previously appreciated, along with longer 5′ tRFs that presumably reflect the primary cleavage site for reproductive tract nucleases (see below). In addition, Northern blotting studies in sperm and epididymis samples revealed the presence of 3′ tRNA halves that are not represented in deep sequencing datasets (<xref ref-type="bibr" rid="bib41">Sharma et al., 2018</xref>; <xref ref-type="bibr" rid="bib54">Zhang et al., 2018</xref>), further emphasizing our incomplete understanding of the mammalian sperm RNA payload.</p><p>To directly compare the performance of various small RNA cloning protocols in capturing mouse sperm RNAs, we pooled cauda epididymal sperm from 10 males for total RNA extraction. Total RNAs were <italic>mir</italic>Vana size selected prior to being split into three large aliquots and either (1) left untreated, (2) treated with PNK in the absence of ATP to catalyze 3′ end dephosphorylation, or (3) treated with PNK and ATP to both resolve 3′ phosphates and to phosphorylate RNA 5′ ends. Each pool was then further split into three aliquots and cloned using either Illumina TruSeq, NEBNext Small RNA, or OTTR. <xref ref-type="fig" rid="fig4">Figure 4A–C</xref> show insert size distributions, mapping rates to various RNA species, and abundance of various tRNA species, respectively.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>A revised view of the mouse sperm small RNA payload.</title><p>(<bold>A</bold>) Small RNA length distributions, as in <xref ref-type="fig" rid="fig3">Figure 3B</xref>, for tRNA-mapping reads in various mouse sperm RNA libraries generated using the indicated protocols. (<bold>B</bold>) Pie charts showing overall mapping of each library to the indicated RNA classes. (<bold>C</bold>) Overall coverage of all tRNA species in each dataset, as in <xref ref-type="fig" rid="fig3">Figure 3C</xref>. Here, each dataset also has a pie chart showing the percentage of tRNA-mapping reads derived from the 5′ or the 3′ half of tRNAs, as indicated. See also <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>. (<bold>D</bold>) Coverage plots for four typical tRNAs, as in <xref ref-type="fig" rid="fig3">Figure 3D and E</xref>.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Global tRNA coverage in mouse sperm small RNA OTTR libraries.</title><p>(<bold>A</bold>) Coverage of all mouse tRNAs species in the indicated libraries, plotted as in <xref ref-type="fig" rid="fig4">Figure 4C</xref>. Note that for each library type, we performed two biological replicate experiments; as these were essentially indistinguishable, only one replicate is shown here. The right column includes data from a second batch of OTTR datasets, in which we generated two biological replicates for mouse sperm and for mouse cauda epididymis. Again, only one of the two replicates is shown here as both replicates were nearly identical. (<bold>B</bold>) As in panel (<bold>A</bold>), including published mouse sperm datasets obtained using LIDAR (<xref ref-type="bibr" rid="bib38">Scacchetti et al., 2024</xref>) or PANDORA (<xref ref-type="bibr" rid="bib43">Shi et al., 2021</xref>).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig4-figsupp1-v2.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Effects of PNK treatment on tRF levels.</title><p>(<bold>A</bold>) For each set of libraries – TruSeq, NEB, OTTR reps1-2, and OTTR reps3-4 – relative abundance of 5′ and 3′ tRFs for each dataset was normalized relative to the median value across the four untreated (eg no PNK) libraries. Dataset labels describe the sample (mouse), library preparation protocol (IT, NEB, OTTR), and protocol variation (nt: untreated; 18 H: extended RT time; PNK: PNK treatment without ATP; PNK_ATP; PNK + ATP). This visualization reveals increased abundance of a wide range of tRFs resulting from PNK treatment, as for example 3′ tRNA fragments were generally increased in abundance in TruSeq and NEB libraries following PNK + ATP treatment. That said, even after PNK +ATP treatment these tRFs were still scarce in TruSeq and NEB libraries compared to OTTR libraries with or without PNK pre-treatment (not visualized here using within-protocol normalization; see <xref ref-type="fig" rid="fig4">Figure 4C</xref>). Many 5′ tRFs were enriched following PNK treatment in all three library conditions (eg Leu-CAA), while a smaller subset of 5′ tRFs were PNK-enriched in TruSeq and NEB datasets only (eg Cys-GCA). The capacity for OTTR to capture 2′–3′ cyclic phosphate-containing templates excluded by ligase-dependent library preparations likely contributed to the reported improvements in library capture bias in ribosome profiling libraries where RNase I was used to prepare mRNA ribosome protected fragments (<xref ref-type="bibr" rid="bib15">Ferguson et al., 2023</xref>). (<bold>B</bold>) Example of PNK-dependent cleavage-site capture in OTTR libraries. All three panels show read start, stop, and coverage for tRNA-His-GTG. Red arrow shows the 3′ end of a longer 5′ tRF seen only following PNK treatment. (<bold>C</bold>) For each tRNA in the mouse genome with over 100 reads of total coverage, the percentage of read starts (left column) or read ends (right column) was calculated for each library type. Read starts and stops percentages were then averaged across all tRNAs, and are plotted for untreated, PNK-treated, and PNK + ATP-treated libraries. Red arrows highlight PNK-specific peaks, green arrows highlight PNK + ATP-specific peaks, and black arrows highlight peaks enriched in both PNK and PNK + ATP treatments compared to untreated RNA libraries.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig4-figsupp2-v2.tif"/></fig></fig-group><p>Focusing first on commercially available kits, our untreated TruSeq and NEBNext datasets recapitulated features of mouse sperm RNAs documented in many prior TruSeq studies (<xref ref-type="bibr" rid="bib34">Peng et al., 2012</xref>; <xref ref-type="bibr" rid="bib40">Sharma et al., 2016</xref>), including abundant 5′ tRFs deriving primarily from tRNA-Glu-CTC, tRNA-Val-CAC, and tRNA-Gly-GCC (<xref ref-type="fig" rid="fig4">Figure 4C and D</xref>, <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A</xref>). In contrast, we find that OTTR reveals a far greater range of tRFs than either of the commercial protocols, capturing both 5’ and 3’ tRNA fragments from a much broader representation of tRFs than either of the commercial protocols. These findings are consistent with prior Northern blot studies demonstrating the presence of both 5′ and 3′ tRNA halves in mouse sperm. Moreover, comparing our data to two recent tRF-focused mouse sperm datasets, we find that OTTR captured the most diverse population of tRNA fragments, followed closely by LIDAR (<xref ref-type="bibr" rid="bib38">Scacchetti et al., 2024</xref>), and contrasting with the heavily biased tRF populations captured by PANDORA (<xref ref-type="bibr" rid="bib43">Shi et al., 2021</xref>; <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B</xref>).</p></sec><sec id="s2-5"><title>Variations on the OTTR protocol and technical guidance</title><p>Finally, given the well-known impact of nucleotide modifications, and 3′ end chemistry (<xref ref-type="bibr" rid="bib41">Sharma et al., 2018</xref>; <xref ref-type="bibr" rid="bib22">Honda et al., 2015</xref>; <xref ref-type="bibr" rid="bib51">Wang et al., 2021</xref>,) on RNA cloning, we set out to characterize the impact of these RNA features on the RNA species captured by the OTTR protocol. As noted above, RNA cleavage by nucleases of the RNase A, T, or L families leaves behind either a cyclic 2′–3′ phosphate or 2′ or 3′ phosphates at the 3′ end of the 5′ fragment. This modification clearly interferes with RNA ligation, but whether it impacts the ligation-independent OTTR protocol is unknown. We therefore first sought to compare the effects of PNK treatment on the spectrum of RNA species captured by various small RNA cloning protocols. Focusing first on the ligation-based cloning methods, we confirm prior reports (<xref ref-type="bibr" rid="bib41">Sharma et al., 2018</xref>; <xref ref-type="bibr" rid="bib43">Shi et al., 2021</xref>; <xref ref-type="bibr" rid="bib51">Wang et al., 2021</xref>) showing that PNK treatment (with or without ATP) resulted in a substantial increase in capture of rRNA-derived fragments (<xref ref-type="fig" rid="fig4">Figure 4B</xref>), consistent with the hypothesis that rRNA fragments in mammalian sperm are generated by a nuclease of the RNase A, T, or L families. PNK treatment also enabled improved capture of specific cleavage products in the TruSeq and NEB libraries, as assessed by increased overall levels of particular tRFs (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>).</p><p>Compared to the ligation-based small RNA-Seq libraries, the composition of OTTR libraries was far less dependent on PNK treatment (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). Many of the tRNA fragments that required PNK treatment for capture in TruSeq or NEB libraries were already abundant in untreated OTTR libraries and unaffected by PNK treatment (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2A</xref>). Nonetheless, PNK treatment did lead to improved capture of a subset of tRFs in OTTR libraries (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2A</xref>), and close examination of 3′ cleavage sites revealed capture of longer species for some 5′ tRFs (see for example <xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2B</xref>, red arrows). Taken together, our findings demonstrate that although OTTR appears to be able to capture small RNAs bearing 3′ phosphates and/or 2′–3′ cyclic phosphate moieties, PNK treatment nonetheless enhances capture of some RNA cleavage products by this protocol and thus should be included for quantitative analyses of tRNA and rRNA cleavage products.</p><p>In addition to 3′ end chemistry, a number of common nucleotide modifications in tRNAs are well known to interfere with typically used RTs; indeed, these modifications are generally thought to be a major reason for the historical difficulty of cloning intact tRNAs (<xref ref-type="bibr" rid="bib55">Zheng et al., 2015</xref>; <xref ref-type="bibr" rid="bib9">Cozen et al., 2015</xref>; <xref ref-type="bibr" rid="bib10">Dai et al., 2017</xref>). Although the baseline OTTR protocol successfully captures tRNAs and tRNA fragments without any enzymatic pretreatment, the improved capture of full-length tRNAs in <italic>trm1</italic>Δ yeast (<xref ref-type="fig" rid="fig1">Figure 1E and F</xref>) suggested that nucleotide modifications might nonetheless impede R2 RT under at least some OTTR library preparation conditions. We therefore characterized the effects of AlkB-mediated nucleotide demethylation (<xref ref-type="bibr" rid="bib55">Zheng et al., 2015</xref>; <xref ref-type="bibr" rid="bib9">Cozen et al., 2015</xref>; <xref ref-type="bibr" rid="bib10">Dai et al., 2017</xref>) on small RNA cloning using OTTR, exploring both intact tRNA and tRNA fragment cloning in both yeast and mouse systems.</p><p>Focusing first on full-length tRNAs, we confirm that AlkB treatment removes m<sup>1</sup>A and m<sup>3</sup>C, as assessed by the near-complete loss of nucleotide mismatches at the relevant positions, but had little to no effect on m<sup>1</sup>G or m<sup>2</sup><sub>2</sub>G (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). Overall, we find modest changes in intact tRNA capture following AlkB demethylation, with up to ~threefold altered levels of capture of a variety of tRNAs in the mouse system (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). Turning next to cloning of tRNA fragments, AlkB treatment resulted in globally increased levels of the majority of 3′ tRNA halves (<xref ref-type="fig" rid="fig5">Figure 5C and D</xref>), consistent with the m<sup>1</sup>A present at position 58 in the majority of tRNAs impeding reverse transcription. Finally, as AlkB had no effect on m<sup>2</sup><sub>2</sub>G levels, we also cloned tRNA halves from a <italic>trm1</italic>Δ yeast strain – lacking this modification – overexpressing RNY1p. As with m<sup>1</sup>A, we find that the m<sup>2</sup><sub>2</sub>G modification interferes with reverse transcription by the OTTR RT enzyme, as we observed in our <italic>trm1</italic>Δ samples ~fourfold increased levels of those 5′ tRNA halves that normally carry this modification in wild-type (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Taken together, these findings demonstrate that although OTTR can successfully clone modified tRNAs, cloning efficiency is nonetheless affected by m<sup>1</sup>A and m<sup>2</sup><sub>2</sub>G. Although at present there is no enzymatic treatment commercially available to remove m<sup>2</sup><sub>2</sub>G, AlkB-mediated demethylation of m<sup>1</sup>A should be a routine addition to OTTR-based characterization of tRNA levels.</p><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Removing nucleotide modifications improves tRNA capture using OTTR.</title><p>(<bold>A</bold>) Mismatches at the indicated positions are plotted as in <xref ref-type="fig" rid="fig2">Figure 2F</xref> for full-length tRNA sequencing from yeast. Top row shows control-treated yeast RNAs, bottom row shows AlkB-treated RNAs. (<bold>B</bold>) Scatterplots for intact tRNA abundance in yeast (left) and mouse testis (right), comparing control-treated RNA (x axis) with AlkB-treated RNA (y axis). Some tRNAs, particularly a subset of serine and leucine tRNAs in the mouse sample, exhibit ~threefold differences in abundance following AlkB treatment. (<bold>C</bold>) Scatterplots show abundance of 5′ and 3′ tRNA fragments in yeast overexpressing RNY1 (top panel), or in the mouse epididymis (bottom panel), before and after AlkB treatment. (<bold>D</bold>) Heatmaps showing changes in tRNA fragment representation across the indicated samples for yeast (left panel) and mouse epididymis (right panel).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-77616-fig5-v2.tif"/></fig></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Here, we compared the performance of a variety of small RNA cloning protocols in characterization of tRNAs and tRNA fragments. By several metrics, we find that OTTR outperforms major commercial RNA-seq protocols, and is comparable or superior to a wide range of custom protocols developed specifically to address challenges associated with tRNA capture.</p><p>First, considering full-length tRNA cloning, OTTR performs comparably to the mim-tRNAseq method (<xref ref-type="bibr" rid="bib3">Behrens et al., 2021</xref>), which ligates an adaptor to complete or partial RT products, and the YAMAT-seq protocol (<xref ref-type="bibr" rid="bib45">Shigematsu et al., 2017</xref>), which ligates adaptors to mature tRNA acceptor stems before RT (<xref ref-type="bibr" rid="bib3">Behrens et al., 2021</xref>; <xref ref-type="bibr" rid="bib45">Shigematsu et al., 2017</xref>; <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). Although they use different RTs, all three protocols give some readout of diverse nucleotide modifications including m<sup>1</sup>G, m<sup>2</sup><sub>2</sub>G, m<sup>3</sup>C, m<sup>1</sup>A, i6A, t6A, inosine, and wybutosine, inferred from mismatches between sequencing read and genomic locus. YAMAT-seq provides the most specific capture of intact tRNAs due to the ligation step involving a Y-shaped adaptor targeting the 3’ CCA of mature tRNAs; subsequent PCR can only amplify full-length tRNAs. However, YAMAT-seq libraries exhibit poor complexity, with the vast majority (82–86%) of tRNA sequences coming from two tRNA species. In contrast, mim-tRNAseq and OTTR exhibit similar levels of intact tRNA capture, similar complexity of species captured, with good (<italic>R</italic>~0.5) correlations between the protocols in measured tRNA levels in yeast (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3A</xref>), albeit with mim-tRNAseq exhibiting better (<italic>R</italic>~0.96) correlation than OTTR (<italic>R</italic>~0.7) to tRNA gene copy numbers. Finally, we note that although LIDAR captures relatively few full-length tRNAs – this is expected from the use of random priming for reverse transcription in this protocol – we also find good correlations between LIDAR and OTTR datasets when counting all partial tRNA reads toward the inferred levels of intact tRNAs (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3B</xref>, top panel).</p><p>We additionally show that OTTR more accurately captures tRNA fragments than NEBNext, Illumina TruSeq, an UMI-based custom protocol (<xref ref-type="bibr" rid="bib16">Fu et al., 2018</xref>), and the recently developed PANDORA protocol (<xref ref-type="bibr" rid="bib43">Shi et al., 2021</xref>). Among published mouse sperm datasets, only LIDAR (<xref ref-type="bibr" rid="bib38">Scacchetti et al., 2024</xref>) exhibits similar complexity in tRF capture to OTTR. The OTTR protocol was previously benchmarked using miRXplore – a synthetic miRNA reference standard of 962 small RNA oligos <xref ref-type="bibr" rid="bib50">Upton et al., 2021</xref> – and for ribosome footprints (<xref ref-type="bibr" rid="bib15">Ferguson et al., 2023</xref>). Our benchmarking here extends previous work to tRNAs and tRFs.</p><p>We demonstrate here that OTTR is suitable for cloning of both full-length tRNAs as well as tRNA fragments, in contrast to protocols such as YAMAT-seq which require adaptor ligation to the intact tRNA acceptor stem (<xref ref-type="bibr" rid="bib45">Shigematsu et al., 2017</xref>) and are thus limited to full-length tRNA cloning. Similarly, although the Nanopore-based nano-tRNAseq can capture full-length tRNAs, the read numbers in the extant dataset are orders of magnitude lower than obtainable using short read sequencing (~200–400,000 reads in the two datasets in the Supplement from <xref ref-type="bibr" rid="bib30">Lucas et al., 2024</xref>), and the current protocol is not suitable for capturing shorter species like tRNA fragments.</p><p>Taken together, the ability to reliably capture a wide variety of RNAs end-to-end, combined with the simplicity of library preparation, highlight the utility of OTTR as a small RNA cloning protocol for a variety of applications. In our view, OTTR is comparable to mim-tRNAseq (<xref ref-type="bibr" rid="bib3">Behrens et al., 2021</xref>) in applicability: although mim-tRNAseq has not yet been benchmarked against tRNA fragments, the efficient capture of full-length tRNAs, along with the workflow that does not rely on specialized acceptor stem ligation, suggest that this protocol could perform similarly to OTTR for shorter RNAs. LIDAR is also comparable, with advantages and disadvantages relative to OTTR and mim-tRNAseq: the use of random priming for LIDAR results in full-length tRNAs being captured as partial fragments, which makes this protocol a poor choice for applications focused on simultaneous capture of intact and fragmented tRNAs in the same sample. On the other hand, the internal priming enables capture of RNA species with blocked 3’ ends, regardless of the nature of the 3’ block – while 3’ phosphates can be resolved with PNK treatment, other 3’ blocks may be novel or may lack appropriate treatments for resolution, and in these cases LIDAR (and Hydro-tRNAseq <xref ref-type="bibr" rid="bib18">Gogakos et al., 2017</xref>) are uniquely suited to overcoming the blocked 3’ end.</p><p>A variety of enzymatic or chemical RNA treatments can be envisioned that would modify the range of RNAs captured by OTTR. We show here that AlkB-mediated demethylation of various tRNA nucleotides – as pioneered in the ARM-Seq and DM-Seq methods (<xref ref-type="bibr" rid="bib55">Zheng et al., 2015</xref>; <xref ref-type="bibr" rid="bib9">Cozen et al., 2015</xref>; <xref ref-type="bibr" rid="bib10">Dai et al., 2017</xref>) – results in significantly improved capture of 3′ tRNA halves (<xref ref-type="fig" rid="fig5">Figure 5C and D</xref>). Moreover, eliminating m<sup>2</sup><sub>2</sub>G via deletion of Trm1 also results in improved capture of relevant tRNA halves (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Taken together, for tRNA or tRF quantification, we recommend carrying out OTTR on AlkB-demethylated input RNAs. That said, modifications such as m<sup>2</sup><sub>2</sub>G cannot yet be easily removed; it is therefore essential to keep in mind that altered levels of tRNAs or tRNA halves in a given biological system could either reflect changes to tRNA production or stability, or could result from altered levels of inhibitory nucleotide modifications. The latter case should, however, be identifiable by analysis of nucleotide misincorporation signatures (<xref ref-type="fig" rid="fig2">Figure 2</xref>), at least for those modifications that leave such signatures. OTTR could also be applied to profile tRNA charging, for example by preferential capture of uncharged RNAs (after isolation of total RNA under acidic conditions) or by using aminoacylation as a protection against 3′ nucleotide removal (via periodate oxidation and β-elimination), followed by base treatment to deacylate charged tRNAs. These and other modifications may prove beneficial depending on the goals of any particular study.</p><sec id="s3-1"><title>Revisiting the mouse sperm RNA payload</title><p>Biologically, our primary interest in benchmarking OTTR was to further explore the still-mysterious small RNA composition of mammalian sperm populations. Over the past decade, scores of studies have largely agreed in defining the mammalian sperm small RNA payload as being dominated by 5′ tRFs, with 5′ ends of tRNA-Glu-CTC, Val-CAC, Val-AAC, Gly-GCC, and Gly-CCC being most abundant (<xref ref-type="bibr" rid="bib34">Peng et al., 2012</xref>; <xref ref-type="bibr" rid="bib42">Sharma, 2019</xref>). rRNA fragments have also been highlighted in several studies of mammalian sperm, although in our experience rRNA fragments proved the most variable between experimentalists, raising the concern that levels of rRNA fragments might be particularly susceptible to artifacts arising during cell lysis, RNA isolation, and/or library preparation.</p><p>For several years, it has been clear that the consensus view of mammalian sperm RNAs has been incomplete. We previously showed that removal of 3′ phosphate or 2′–3′ cyclic phosphate modifications revealed a large population of rRNA fragments, as well as slightly longer 5′ tRNA fragments than typically captured, consistent with RNase A or T family cleavage events being responsible for rRNA and tRNA cleavage in the germline (<xref ref-type="bibr" rid="bib41">Sharma et al., 2018</xref>). Moreover, several groups used Northern blots to show that 3′ tRFs are in fact present in sperm, despite their absence from small RNA-seq datasets (<xref ref-type="bibr" rid="bib41">Sharma et al., 2018</xref>; <xref ref-type="bibr" rid="bib54">Zhang et al., 2018</xref>).</p><p>Here, we build on these studies, using OTTR to provide the most accurate picture of the sperm small RNA payload to date. We find that sperm carry a population of small RNAs dominated by rRNA fragments, along with both 5′ and 3′ tRNA halves arising from the majority of tRNAs. Smaller populations of microRNAs and piRNAs are also present, consistent with prior reports of the sperm RNA payload. This revised view of the sperm RNA payload raises two major biological questions.</p><p>First, our findings undermine the view of sperm RNAs based on the privileged abundance of a handful of specific tRNA 5′ halves, where only specific tRNAs are subject to cleavage, or specific tRNA halves are stabilized and/or selected for trafficking to sperm, thus forming a special population of small RNAs for delivery to the zygote. Instead, our revised view of sperm small RNAs is more consistent with a generalized cleavage of the RNA populations of any typical cell, with the preponderance of rRNA and tRNA fragments consistent with the abundance of the intact precursor species in developing sperm or typical somatic tissues. Our data do not address the question of whether a given rRNA or tRNA fragment derives from ‘in situ’ cleavage of rRNAs or tRNAs present at the completion of spermatogenesis – as opposed to their being generated in somatic support cells in the reproductive tract (<xref ref-type="bibr" rid="bib7">Conine and Rando, 2022</xref>) – but our data motivate a reappraisal of the biogenesis of structural RNA fragments in the male germline.</p><p>Second, our data raise questions about the biochemical nature of the RNAs delivered to the zygote upon fertilization. Regulatory functions have been identified for multiple solitary 5′ or 3′ tRFs in isolation (<xref ref-type="bibr" rid="bib2">Anderson and Ivanov, 2014</xref>; <xref ref-type="bibr" rid="bib46">Su et al., 2020</xref>; <xref ref-type="bibr" rid="bib19">Guzzi et al., 2018</xref>; <xref ref-type="bibr" rid="bib5">Boskovic et al., 2020</xref>; <xref ref-type="bibr" rid="bib26">Kim et al., 2020</xref>; <xref ref-type="bibr" rid="bib33">Pan et al., 2021</xref>), suggesting numerous potential regulatory roles for sperm-delivered tRFs in the early embryo. However, given our finding that for many tRNAs both 5′ and 3′ tRNA halves can be found in sperm at similar abundance, it will be important to understand the biochemical context in which these RNAs are delivered to the zygote. Are both 5′ and 3′ tRNA halves still associated with one another as part of a nicked tRNA (<xref ref-type="bibr" rid="bib8">Costa et al., 2023</xref>; <xref ref-type="bibr" rid="bib6">Chen and Wolin, 2023</xref>,) or are the two halves dissociated and potentially folded into alternative conformations (<xref ref-type="bibr" rid="bib49">Tosar et al., 2018</xref>), or bound to RNA-binding proteins? Understanding the molecular nature of the tRNA halves that are delivered to the zygote during fertilization has major implications for their potential functions in the early embryo.</p><p>Together, our data significantly update our understanding of the sperm epigenome, and motivate re-appraisal of mammalian germline small RNA biogenesis, and of stress and diet effects on sperm RNA populations.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Mouse husbandry and tissue collection</title><p>All samples were obtained from male mice of the FVBN/J strain background, consuming control diet Ain-93g, euthanized at 12 weeks of age according to IACUC protocol. For testis samples, both testes were collected from a single FVBN/J male, separated from the epididymis and cleaned of adhering fat, washed with PBS and snap frozen in liquid N<sub>2</sub> for later RNA extraction.</p><p>For cauda sperm isolation, cauda epididymis samples were collected from 10 males and placed into Donners complete media and tissue was cleared of fat and connective tissue before incisions were made using a 26 G needle while keeping the bulk tissue intact. Tissue was gently squeezed allowing sperm to escape into solution. After incubation at 37 °C for 1 hr, sperm containing media was transferred to a fresh tube and collected by centrifugation at 5000 rpm for 5 min followed by a 1 X PBS wash. To eliminate somatic cell contamination, sperm were subjected to a 1 mL 1% Triton X-100 incubation 37 °C for 15 min with 1500 rpm on Thermomixer and collected by centrifugation at 5000 rpm for 5 min. Somatic cell lysis was followed by a 1 x ddH<sub>2</sub>O wash and 30 s spin 14,000 rpm to pellet sperm.</p></sec><sec id="s4-2"><title>Yeast RNA purification and size selection</title><p>The yeast strains used in this study were built on the BY4741 haploid strain background according to standard methods, generating the following strains:</p><table-wrap id="inlinetable1" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Yeast Strains</th><th align="left" valign="bottom">Parent</th><th align="left" valign="bottom">Genotype</th><th align="left" valign="bottom">Plasmid</th></tr></thead><tbody><tr><td align="left" valign="bottom">yTG66</td><td align="left" valign="bottom">BY4741</td><td align="left" valign="bottom">MAT<bold>a</bold> <italic>ura3</italic>Δ0 <italic>leu2</italic>Δ0 <italic>his3</italic>Δ1 <italic>met15</italic>Δ0</td><td align="left" valign="bottom">pRS416</td></tr><tr><td align="left" valign="bottom">yTG72</td><td align="left" valign="bottom">BY4741</td><td align="left" valign="bottom">MAT<bold>a</bold> <italic>ura3</italic>Δ0 <italic>leu2</italic>Δ0 <italic>his3</italic>Δ1 <italic>met15</italic>Δ0 <italic>rny1</italic>Δ::kanMX6</td><td align="left" valign="bottom">pTG35</td></tr><tr><td align="left" valign="bottom">yTG109</td><td align="left" valign="bottom">BY4741</td><td align="left" valign="bottom">MAT<bold>a</bold> <italic>ura3</italic>Δ0 <italic>leu2</italic>Δ0 <italic>his3</italic>Δ1 <italic>met15</italic>Δ0 <italic>trm1</italic>Δ::kanMX6</td><td align="left" valign="bottom">pTG35</td></tr><tr><th align="left" valign="bottom">Plasmids</th><th align="left" valign="bottom">Parent</th><th align="left" valign="bottom">Genotype</th></tr><tr><td align="left" valign="bottom">pRS416</td><td align="left" valign="bottom"/><td align="left" valign="bottom"><italic>URA3</italic> CEN/ARS</td></tr><tr><td align="left" valign="bottom">pTG35</td><td align="left" valign="bottom">pRS416</td><td align="left" valign="bottom"><italic>URA3</italic> CEN/ARS P<italic><sub>GAL1-10</sub>-RNY1</italic></td></tr></tbody></table></table-wrap><p>For all experiments, cells were grown at 30 °C and harvested by centrifugation (2 min at 4000 RPM in 4 °C) and snap frozen in liquid nitrogen.</p><p>For full-length tRNA experiments, yTG66 and yTG109 were grown overnight in selective synthetic media containing 2% dextrose, saturated cultures were diluted to OD600=0.1 and grown in selective synthetic media containing 2% dextrose until they reached OD600=0.5–07.</p><p>For tRF experiments, yTG72 were grown overnight in selective synthetic media containing 2% raffinose. Saturated cultures were diluted to OD600=0.1 in selective synthetic media containing 2% raffinose and grown until early-midlog (OD600=0.3–0.4). Cells were then centrifuged and diluted in selective synthetic media containing 2% galactose to an OD600 so that they reach OD600=0.5–0.7 in 360 min (‘WT’ samples were resuspended in selective synthetic media containing 2% galactose, centrifuged, and snap frozen immediately).</p><p>Total RNA was prepared by resuspending cell pellets in TNE buffer (50 mM Tris-Cl pH7.4, 100 mM NaCl, 10 mM EDTA) and then vortexed with beads for a total of 2 min (with incubation on ice for a minute after the first minute of vortexing). Equal volume acid phenol chloroform, and SDS to a final volume of 1% was added and samples were vortexed to mix, and then incubated at 65 °C for 7 min, followed by an additional vortex. An additional acid phenol chloroform extraction was performed followed by a chloroform extraction before RNA was precipitated, washed, and resuspended in H<sub>2</sub>O.</p></sec><sec id="s4-3"><title>Sperm RNA purification and small RNA size selection</title><p>For mouse sperm RNAs, immediately following cauda sperm purification, sperm RNAs were isolated using the <italic>mir</italic>Vana miRNA Isolation Kit following the enrichment procedure for small RNAs as per manual. Protocol was modified with one half volume of 100% ethanol added to the aqueous phase recovered from organic extraction (recommended volume is one third).</p></sec><sec id="s4-4"><title>Northern blots</title><p>~3 μg of total RNA from RNY1p-expressing yeast was run on a 15% PAGE-Urea gel at 15 W until dye front reached bottom of gel (~20 min). Probes were as follows:</p><list list-type="simple" id="list1"><list-item><p>Arg-CCG 5′: <named-content content-type="sequence">TAACCATTGCACTAGAGGAG</named-content></p></list-item><list-item><p>Arg-CCG 3′: <named-content content-type="sequence">GCTCCTCCCGGGACTCGAAC</named-content></p></list-item><list-item><p>Asp-GTC 5′: <named-content content-type="sequence">CTGACCATTAAACTATCACG</named-content></p></list-item><list-item><p>Asp-GTC 3′: <named-content content-type="sequence">CTGACCATTAAACTATCACG</named-content></p></list-item><list-item><p>Gly-GCC 5′: <named-content content-type="sequence">TACCACTAAACCACTTGCGC</named-content></p></list-item><list-item><p>Gly-GCC 3′: <named-content content-type="sequence">GCGCAAGCCCGGAATCGAAC</named-content></p></list-item><list-item><p>Lys-CTT 5′: <named-content content-type="sequence">TACCGATTGCGCCAACAAGG</named-content></p></list-item><list-item><p>Lys-CTT 3′: <named-content content-type="sequence">GCCCTGTAGGGGGCTCGAAC</named-content></p></list-item></list></sec><sec id="s4-5"><title>T4 polynucleotide kinase (PNK) treatment</title><p>Column purified small RNAs from 10 animals were pooled and split into groups: T4 PNK treatment with ATP, T4 PNK treatment without ATP, and a control no treatment group. T4 PNK treatment with ATP was incubated at 37 °C for 30 min in T4 PNK reaction buffer, 10 mM ATP, and 50U T4 PNK (NEB) M0201S. T4 PNK treatment without ATP was incubated at 37 °C for 30 min in reaction buffer pH6 and 50U T4 PNK (M0201S). All sperm small RNAs samples were then cleaned and concentrated using RNA Clean &amp; Concentrator–5 (Zymo) prior to library preparation.</p></sec><sec id="s4-6"><title>AlkB treatment</title><p>Up to 5 µg of total RNA was treated with rtStar tRF&amp;tiRNA Pretreatment Kit (Arraystar) according to protocol. AlkB-treated RNA was then cleaned and size selected with RNA Clean &amp; Concentrator (Zymo Research). T4 PNK treatment with ATP was incubated at 37 °C for 30 min. After reaction was stopped, the RNA was cleaned with PCI, precipitated with Isopropanol, and resuspended in 30 µl H2O. AlkB treatment was incubated at 25 °C for 240 min. After quenching the reaction, RNA was cleaned with RNA Clean &amp; Concentrator–5 (Zymo) prior to library preparation.</p></sec><sec id="s4-7"><title>Small RNA sequencing</title><p>Small RNA sequencing was performed using one of four protocols: TruSeq Small RNA Library Preparation Kit (Illumina), NEBNext Small RNA Library Prep Set for Illumina (NEB), a standard in-house ligation-based cloning protocol (<xref ref-type="bibr" rid="bib16">Fu et al., 2018</xref>; see below), and Collins Lab OTTR Library Preparation Kit (<xref ref-type="bibr" rid="bib50">Upton et al., 2021</xref>). TruSeq and NEBNext library preparation was performed according to manufacturer instructions. In addition, we carried out a slightly altered NEBNext protocol incorporating UMIs to account for potential jackpotting during library preparation. Here, we used the same UMIs as described in <xref ref-type="bibr" rid="bib16">Fu et al., 2018</xref>, where we incorporated UMIs at both ends (NEB +2 UMIs), as well as 5’ end only (NEB +1 UMI).</p></sec><sec id="s4-8"><title><xref ref-type="bibr" rid="bib16">Fu et al., 2018</xref> ligation-based library preparation</title><p>A 3′ DNA adapter – containing an UMI sequence in 3 nt blocks of random nucleotides separated by pre-defined 3nt consensus sequences, an adenylated 5′ end and a dideoxycytosine blocked 3′end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hr at 25 °C. The ligated product was then purified on a 10% PAGE-Urea gel, followed by gel extraction and ethanol precipitation. The purified ligated product was then ligated to a mix of equimolar 5′ RNA adaptors containing UMIs in 3nt blocks of random nucleotides separated by two distinct pre-defined 3nt consensus sequence with T4 RNA ligase (Ambion, AM2141) for 2 hr at 25 °C. The final ligated product was then ethanol precipitated, and cDNA synthesis was performed with AMV reverse transcriptase (NEB, M0277L). cDNA was finally PCR amplified with standard Illumina sequencing primers with AccuPrime Pfx DNA polymerase for 12–14 cycles. Final PCR product was cleaned up with PCI extraction followed by ethanol precipitation and finally separated by 7.5% PAGE-Urea to remove adaptor dimers. The desired product was excised from the gel and eluted in 750 µl elution buffer overnight at room temperature, followed by isopropanol precipitation and resuspension in 9 µl H<sub>2</sub>O. Final libraries were pooled and sequenced on Illumina NextSeq 500 with a 75-cycle high-output kit.</p></sec><sec id="s4-9"><title>Ordered two-template relay</title><p>OTTR was performed as described in <xref ref-type="bibr" rid="bib50">Upton et al., 2021</xref> Briefly, total RNA was size selected either by mirVana (&lt;200 nt) or gel purification (60-100nt). Input RNA was labeled at the 3′ end by incubation in terminal transferase buffer containing ddATP for 90 min in 30 °C, followed by an addition of ddGTP and another incubation at 30 °C for 30 min. After heat inactivation of the labelling reaction (65 °C for 5 min), unincorporated ddATP/ddGTP were hydrolyzed by incubation in 5 mM MgCl2 and 0.5 units of shrimp alkaline phosphatase (rSAP) at 37 °C for 15 min. rSAP reaction was stopped by addition of 5 mM EGTA and incubation at 65°C for 5 min. Samples were then incubated in templated cDNA synthesis buffer, adaptors, and dNTPs at 37 °C for 20 min, followed by heat inactivation at 65 °C for 5 min.</p><p>cDNA was size selected on an 8% PAGE-Urea gel to minimize adaptor dimer sequencing as described in <xref ref-type="bibr" rid="bib15">Ferguson et al., 2023</xref> Size selected cDNA was PCR amplified for 12–14 cycles with KAPA HiFi hot start (KAPA Biosystems, KK4602). Final PCR product was cleaned up with PCI extraction followed by ethanol precipitation and finally separated by 7.5% PAGE-Urea to remove adaptor dimers. The desired product was excised from the gel and eluted in 750 µl elution buffer overnight at room temperature, followed by isopropanol precipitation and resuspension in 9 µl H<sub>2</sub>O. Final libraries were pooled and sequenced on Illumina NextSeq 500 with a 75-cycle high-output kit.</p><p>UMIs in OTTR are introduced by using an adapter template where the 3′rC is replaced by 3′rC[UMI]. UMIs are sequenced as the first seven bases of read 1, and can be further combined with the +1 Y base of the primer-duplex (<xref ref-type="bibr" rid="bib15">Ferguson et al., 2023</xref>). We used two different versions of UMI adaptors in these experiments. A shorter 5 N UMI, and a longer 12 N UMI.</p><list list-type="simple" id="list2"><list-item><p>5 N: <named-content content-type="sequence">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNR/3ddC</named-content></p></list-item><list-item><p>12 N:<named-content content-type="sequence">ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNCGANNNNTACNNNNR/3ddC</named-content></p></list-item></list><p>During the end stages of manuscript preparation, we observed extensive variability in capture of 5′ tRNA fragments from day to day. We ultimately identified the terminal transferase step – the non-templated adenosine addition to input RNA molecules that is the first step of OTTR – as the culprit for failed 5′ tRNA fragment capture. We found that robust RNA labeling was compromised by both oxidation of the manganese, which was critical to switch polymerase activity from cDNA synthesis to terminal transferase, and by the oxidation of dithiothreitol (DTT) in the neutral polymerase storage buffer. Manganese oxidation was reduced by incorporating 10 mM sodium acetate pH 5.5 and 28 mM (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, while polymerase storage buffer DTT was replaced with 0.2 mM TCEP, which is known to be less sensitive to long-time storage at a neutral pH. These optimizations, and other modifications, are unpublished at this time (Ferguson et al, under review) but available from <ext-link ext-link-type="uri" xlink:href="https://karnateq.com/">KarnaTeq.com</ext-link>.</p></sec><sec id="s4-10"><title>Extended 3′ adaptor ligation</title><p>For each of the two ligation-based protocols used for mouse sperm (Truseq, NEB Next), two replicate libraries for mouse sperm were prepared with the additional condition of an 18 hr ligation at 16 °C for the ligation of the 3′ adapter in the attempt to increase ligation efficiency. For OTTR, an 18 hr incubation was added for half of libraries after terminal labeling, during the cDNA synthesis step. However, these interventions had minimal effect on sperm small RNA profiles and both replicates are interchangeable.</p></sec><sec id="s4-11"><title>Data analysis</title><p>To analyze small RNA sequencing data, we first removed adapters using cutadapt (version 2.9) and PCR duplicate were removed with seqkit (version 0.14.0). The trimmed and deduplicated reads were then analyzed using both an in-house pipeline and the unpublished tool tRAX (version 1.0.0; <ext-link ext-link-type="uri" xlink:href="http://trna.ucsc.edu/tRAX/">http://trna.ucsc.edu/tRAX/</ext-link>; <xref ref-type="bibr" rid="bib21">Holmes et al., 2022</xref>) and the results were compared. Firstly, we used Bowtie (version 1.1.0) to map the reads to the annotated rRNA, snoRNA, snRNA, and tRNA sequences in the corresponding species (yeast, mouse, and human) in descending priority, and then the unmappable reads to the respective genomes. The Bowtie parameters used for rRNA, snoRNA, snRNA and genome alignment were ‘-v 0 k 1’; while the Bowtie parameters used for tRNA alignment were ‘-y -k 100 <monospace>--</monospace>best <monospace>--</monospace>strata’ considering tRNA nucleotide modifications. The abundance of each type of small RNAs was normalized by the total sequencing depth, that is, the total number of small RNA and genome mapping reads in a sequencing library. Secondly, we used tRAX <xref ref-type="bibr" rid="bib21">Holmes et al., 2022</xref> to process the trimmed and deduplicated reads with default parameters; the results largely agreed with what was obtained with our in-house pipeline.</p></sec><sec id="s4-12"><title>Comparison to published datasets</title><p>Datasets were downloaded and trimmed as follows. If nothing else is noted, adaptor timing was performed with cutadapt 4.1; only reads with a minimum read length of 15 nt and quality scores over 20 were kept for downstream analysis. Trimming details follow for specific datasets.</p><list list-type="simple" id="list3"><list-item><p>ALL-tRNA-seq: (GEO# GSE186736): <named-content content-type="sequence">AGATCGGAAGAGCACACGTCTGAA</named-content> was trimmed from the 3’-end of the read, followed by the removal of the 4 N UMI located on each side of the insert.</p></list-item><list-item><p>ARM-seq (GEO# SRP056032): <named-content content-type="sequence">AGATCGGAAGAGCACACGTCTGAA</named-content> was trimmed from the 3’-end of each read.</p></list-item><list-item><p>DM-tRNA-seq (GEO# GSE66550): Reads were already trimmed upon download.</p></list-item><list-item><p>HYDRO-seq: (GEO# GSE95683): <named-content content-type="sequence">TCGTATGCCGTCTTCTGCTTG</named-content> was trimmed from the 3’-end of the read, followed by the removal of 5nt from the 3’-end.</p></list-item><list-item><p>LIDAR-seq: (GEO# GSE233343): Trimmed according to instructions on GitHub <ext-link ext-link-type="uri" xlink:href="https://github.com/bonasio-lab/LIDAR">https://github.com/bonasio-lab/LIDAR</ext-link> (<xref ref-type="bibr" rid="bib44">Shields, 2024</xref>).</p></list-item><list-item><p>LOTTE-seq: (GEO# PRJNA541863): <named-content content-type="sequence">CGACACTGTCGGTAC</named-content> was trimmed from the 3’-end of the read.</p></list-item><list-item><p>mim-tRNA-seq: (GEO# GSE152621): Reads were already trimmed upon download.</p></list-item><list-item><p>MSR-seq: (GEO# GSE198441) Paired-end reads were merged using Pear/0.9.11. <named-content content-type="sequence">AGATCGGAAGAGCACACGTCTGC</named-content> was then trimmed from the 3’-end of the read, followed by the removal of UMI sequences on each side of the insert.</p></list-item><list-item><p>PANDORA-seq: (GEO# GSE144666): Reads were already trimmed upon download</p></list-item><list-item><p>QuantM-seq: (GEO# GSE141436): <named-content content-type="sequence">TCCAACTGGATACTGGN</named-content> was trimmed from the 5’-end of the reads, <named-content content-type="sequence">GTATCCAGTTGGAATT</named-content> was trimmed from the 3’-end of the reads.</p></list-item><list-item><p>YAMAT-seq: (GEO# SRP096584): <named-content content-type="sequence">ACTGGATACTGG</named-content> was trimmed from the 5’-end of the reads, <named-content content-type="sequence">GTATCCAGTTGGAATT</named-content> was trimmed from the 3’-end of the reads.</p></list-item></list><p>Each sample was then mapped to the matching reference genome (mm10, hg38, or sacCer3) using tRAX as described above. tRAX output was used to calculate fraction of tRNA-mapping reads representing full-length, 5’ fragments, 3’ fragments, or other (internal fragments and leader/trailer sequences; <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). For comparisons of intact tRNA levels between datasets, all reads mapping to a given tRNA were used in the top panels of <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>. (e.g. truncated 5’ and 3’ fragments were assumed to report on the intact tRNA from which they derived), as the majority of protocols captured relatively low levels (&lt;25%) of intact tRNAs.</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn><fn fn-type="COI-statement" id="conf2"><p>is an inventor on published patent applications filed by University of California describing OTTR technology, all of which are also described in peer-reviewed journal publications. Has equity in the company that licensed the OTTR technology (Karnateq)</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Resources</p></fn><fn fn-type="con" id="con3"><p>Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology</p></fn><fn fn-type="con" id="con4"><p>Software, Formal analysis</p></fn><fn fn-type="con" id="con5"><p>Resources, Investigation</p></fn><fn fn-type="con" id="con6"><p>Investigation</p></fn><fn fn-type="con" id="con7"><p>Formal analysis</p></fn><fn fn-type="con" id="con8"><p>Resources, Supervision</p></fn><fn fn-type="con" id="con9"><p>Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Visualization, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>Animal husbandry and experimentation was reviewed, approved, and monitored under the University of Massachusetts Medical School Institutional Animal Care and Use Committee (Protocol ID: A-1833-18).</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="mdar"><label>MDAR checklist</label><media xlink:href="elife-77616-mdarchecklist1-v2.docx" mimetype="application" mime-subtype="docx"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>Deep sequencing data are available at GEO, accession #GSE197651.</p><p>The following dataset was generated:</p><p><element-citation publication-type="data" specific-use="isSupplementedBy" id="dataset1"><person-group person-group-type="author"><name><surname>Gustafsson</surname><given-names>HT</given-names></name><name><surname>Galan</surname><given-names>C</given-names></name><name><surname>Yu</surname><given-names>T</given-names></name><name><surname>Upton</surname><given-names>HE</given-names></name><name><surname>Ferguson</surname><given-names>L</given-names></name><name><surname>Kaymak</surname><given-names>E</given-names></name><name><surname>Weng</surname><given-names>Z</given-names></name><name><surname>Collins</surname><given-names>K</given-names></name><name><surname>Rndo</surname><given-names>OJ</given-names></name></person-group><year iso-8601-date="2022">2022</year><data-title>Deep sequencing of yeast and mouse tRNAs and tRNA fragments using OTTR</data-title><source>NCBI Gene Expression Omnibus</source><pub-id pub-id-type="accession" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE197651">GSE197651</pub-id></element-citation></p><p>The following previously published dataset was used:</p><p><element-citation publication-type="data" specific-use="references" id="dataset2"><person-group person-group-type="author"><name><surname>Behrens</surname><given-names>A</given-names></name><name><surname>Rodschinka</surname><given-names>G</given-names></name><name><surname>Nedialkova</surname><given-names>DD</given-names></name></person-group><year iso-8601-date="2021">2021</year><data-title>High-resolution quantitative profiling of tRNA abundance and modification status in eukaryotes by mim-tRNAseq</data-title><source>NCBI Gene Expression Omnibus</source><pub-id pub-id-type="accession" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE152621">GSE152621</pub-id></element-citation></p></sec><ack id="ack"><title>Acknowledgements</title><p>We thank P Zamore and I Gainetdinov for the generous gift of primers and technical assistance with the Fu et al 2018 ligation-based RNA cloning protocol, and R Flynn for critical reading of the manuscript and insightful discussions. This work was funded by NIH R01HD099816 (HTG, OJR), F31HD097928 (CG), and the UC Berkeley Bakar Fellows program (KC).</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Andersen</surname><given-names>KL</given-names></name><name><surname>Collins</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Several RNase T2 enzymes function in induced tRNA and rRNA turnover in the ciliate Tetrahymena</article-title><source>Molecular Biology of the Cell</source><volume>23</volume><fpage>36</fpage><lpage>44</lpage><pub-id pub-id-type="doi">10.1091/mbc.E11-08-0689</pub-id><pub-id pub-id-type="pmid">22049026</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Anderson</surname><given-names>P</given-names></name><name><surname>Ivanov</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>tRNA fragments in human health and disease</article-title><source>FEBS Letters</source><volume>588</volume><fpage>4297</fpage><lpage>4304</lpage><pub-id pub-id-type="doi">10.1016/j.febslet.2014.09.001</pub-id><pub-id pub-id-type="pmid">25220675</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Behrens</surname><given-names>A</given-names></name><name><surname>Rodschinka</surname><given-names>G</given-names></name><name><surname>Nedialkova</surname><given-names>DD</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>High-resolution quantitative profiling of tRNA abundance and modification status in eukaryotes by mim-tRNAseq</article-title><source>Molecular Cell</source><volume>81</volume><fpage>1802</fpage><lpage>1815</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2021.01.028</pub-id><pub-id pub-id-type="pmid">33581077</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bibiłło</surname><given-names>A</given-names></name><name><surname>Eickbush</surname><given-names>TH</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>The reverse transcriptase of the R2 non-LTR retrotransposon: continuous synthesis of cDNA on non-continuous RNA templates</article-title><source>Journal of Molecular Biology</source><volume>316</volume><fpage>459</fpage><lpage>473</lpage><pub-id pub-id-type="doi">10.1006/jmbi.2001.5369</pub-id><pub-id pub-id-type="pmid">11866511</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Boskovic</surname><given-names>A</given-names></name><name><surname>Bing</surname><given-names>XY</given-names></name><name><surname>Kaymak</surname><given-names>E</given-names></name><name><surname>Rando</surname><given-names>OJ</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Control of noncoding RNA production and histone levels by a 5’ tRNA fragment</article-title><source>Genes &amp; Development</source><volume>34</volume><fpage>118</fpage><lpage>131</lpage><pub-id pub-id-type="doi">10.1101/gad.332783.119</pub-id><pub-id pub-id-type="pmid">31831626</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname><given-names>X</given-names></name><name><surname>Wolin</surname><given-names>SL</given-names></name></person-group><year iso-8601-date="2023">2023</year><article-title>Transfer RNA halves are found as nicked tRNAs in cells: evidence that nicked tRNAs regulate expression of an RNA repair operon</article-title><source>RNA</source><volume>29</volume><fpage>620</fpage><lpage>629</lpage><pub-id pub-id-type="doi">10.1261/rna.079575.122</pub-id><pub-id pub-id-type="pmid">36781286</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Conine</surname><given-names>CC</given-names></name><name><surname>Rando</surname><given-names>OJ</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Soma-to-germline RNA communication</article-title><source>Nature Reviews. Genetics</source><volume>23</volume><fpage>73</fpage><lpage>88</lpage><pub-id pub-id-type="doi">10.1038/s41576-021-00412-1</pub-id><pub-id pub-id-type="pmid">34545247</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Costa</surname><given-names>B</given-names></name><name><surname>Li Calzi</surname><given-names>M</given-names></name><name><surname>Castellano</surname><given-names>M</given-names></name><name><surname>Blanco</surname><given-names>V</given-names></name><name><surname>Cuevasanta</surname><given-names>E</given-names></name><name><surname>Litvan</surname><given-names>I</given-names></name><name><surname>Ivanov</surname><given-names>P</given-names></name><name><surname>Witwer</surname><given-names>K</given-names></name><name><surname>Cayota</surname><given-names>A</given-names></name><name><surname>Tosar</surname><given-names>JP</given-names></name></person-group><year iso-8601-date="2023">2023</year><article-title>Nicked tRNAs are stable reservoirs of tRNA halves in cells and biofluids</article-title><source>PNAS</source><volume>120</volume><elocation-id>e2216330120</elocation-id><pub-id pub-id-type="doi">10.1073/pnas.2216330120</pub-id><pub-id pub-id-type="pmid">36652478</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cozen</surname><given-names>AE</given-names></name><name><surname>Quartley</surname><given-names>E</given-names></name><name><surname>Holmes</surname><given-names>AD</given-names></name><name><surname>Hrabeta-Robinson</surname><given-names>E</given-names></name><name><surname>Phizicky</surname><given-names>EM</given-names></name><name><surname>Lowe</surname><given-names>TM</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>ARM-seq: AlkB-facilitated RNA methylation sequencing reveals a complex landscape of modified tRNA fragments</article-title><source>Nature Methods</source><volume>12</volume><fpage>879</fpage><lpage>884</lpage><pub-id pub-id-type="doi">10.1038/nmeth.3508</pub-id><pub-id pub-id-type="pmid">26237225</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dai</surname><given-names>Q</given-names></name><name><surname>Zheng</surname><given-names>G</given-names></name><name><surname>Schwartz</surname><given-names>MH</given-names></name><name><surname>Clark</surname><given-names>WC</given-names></name><name><surname>Pan</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Selective enzymatic demethylation of N(2),N(2) -Dimethylguanosine in RNA and its application in high-throughput tRNA sequencing</article-title><source>Angewandte Chemie</source><volume>56</volume><fpage>5017</fpage><lpage>5020</lpage><pub-id pub-id-type="doi">10.1002/anie.201700537</pub-id><pub-id pub-id-type="pmid">28371071</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dittmar</surname><given-names>KA</given-names></name><name><surname>Mobley</surname><given-names>EM</given-names></name><name><surname>Radek</surname><given-names>AJ</given-names></name><name><surname>Pan</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Exploring the regulation of tRNA distribution on the genomic scale</article-title><source>Journal of Molecular Biology</source><volume>337</volume><fpage>31</fpage><lpage>47</lpage><pub-id pub-id-type="doi">10.1016/j.jmb.2004.01.024</pub-id><pub-id pub-id-type="pmid">15001350</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dittmar</surname><given-names>KA</given-names></name><name><surname>Goodenbour</surname><given-names>JM</given-names></name><name><surname>Pan</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Tissue-specific differences in human transfer RNA expression</article-title><source>PLOS Genetics</source><volume>2</volume><elocation-id>e221</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.0020221</pub-id><pub-id pub-id-type="pmid">17194224</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dunin-Horkawicz</surname><given-names>S</given-names></name><name><surname>Czerwoniec</surname><given-names>A</given-names></name><name><surname>Gajda</surname><given-names>MJ</given-names></name><name><surname>Feder</surname><given-names>M</given-names></name><name><surname>Grosjean</surname><given-names>H</given-names></name><name><surname>Bujnicki</surname><given-names>JM</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>MODOMICS: a database of RNA modification pathways</article-title><source>Nucleic Acids Research</source><volume>34</volume><fpage>D145</fpage><lpage>D149</lpage><pub-id pub-id-type="doi">10.1093/nar/gkj084</pub-id><pub-id pub-id-type="pmid">16381833</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Erber</surname><given-names>L</given-names></name><name><surname>Hoffmann</surname><given-names>A</given-names></name><name><surname>Fallmann</surname><given-names>J</given-names></name><name><surname>Betat</surname><given-names>H</given-names></name><name><surname>Stadler</surname><given-names>PF</given-names></name><name><surname>Mörl</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>LOTTE-seq (Long hairpin oligonucleotide based tRNA high-throughput sequencing): specific selection of tRNAs with 3’-CCA end for high-throughput sequencing</article-title><source>RNA Biology</source><volume>17</volume><fpage>23</fpage><lpage>32</lpage><pub-id pub-id-type="doi">10.1080/15476286.2019.1664250</pub-id><pub-id pub-id-type="pmid">31486704</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ferguson</surname><given-names>L</given-names></name><name><surname>Upton</surname><given-names>HE</given-names></name><name><surname>Pimentel</surname><given-names>SC</given-names></name><name><surname>Mok</surname><given-names>A</given-names></name><name><surname>Lareau</surname><given-names>LF</given-names></name><name><surname>Collins</surname><given-names>K</given-names></name><name><surname>Ingolia</surname><given-names>NT</given-names></name></person-group><year iso-8601-date="2023">2023</year><article-title>Streamlined and sensitive mono- and di-ribosome profiling in yeast and human cells</article-title><source>Nature Methods</source><volume>20</volume><fpage>1704</fpage><lpage>1715</lpage><pub-id pub-id-type="doi">10.1038/s41592-023-02028-1</pub-id><pub-id pub-id-type="pmid">37783882</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fu</surname><given-names>Y</given-names></name><name><surname>Wu</surname><given-names>PH</given-names></name><name><surname>Beane</surname><given-names>T</given-names></name><name><surname>Zamore</surname><given-names>PD</given-names></name><name><surname>Weng</surname><given-names>Z</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Elimination of PCR duplicates in RNA-seq and small RNA-seq using unique molecular identifiers</article-title><source>BMC Genomics</source><volume>19</volume><elocation-id>531</elocation-id><pub-id pub-id-type="doi">10.1186/s12864-018-4933-1</pub-id><pub-id pub-id-type="pmid">30001700</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gingold</surname><given-names>H</given-names></name><name><surname>Tehler</surname><given-names>D</given-names></name><name><surname>Christoffersen</surname><given-names>NR</given-names></name><name><surname>Nielsen</surname><given-names>MM</given-names></name><name><surname>Asmar</surname><given-names>F</given-names></name><name><surname>Kooistra</surname><given-names>SM</given-names></name><name><surname>Christophersen</surname><given-names>NS</given-names></name><name><surname>Christensen</surname><given-names>LL</given-names></name><name><surname>Borre</surname><given-names>M</given-names></name><name><surname>Sørensen</surname><given-names>KD</given-names></name><name><surname>Andersen</surname><given-names>LD</given-names></name><name><surname>Andersen</surname><given-names>CL</given-names></name><name><surname>Hulleman</surname><given-names>E</given-names></name><name><surname>Wurdinger</surname><given-names>T</given-names></name><name><surname>Ralfkiær</surname><given-names>E</given-names></name><name><surname>Helin</surname><given-names>K</given-names></name><name><surname>Grønbæk</surname><given-names>K</given-names></name><name><surname>Ørntoft</surname><given-names>T</given-names></name><name><surname>Waszak</surname><given-names>SM</given-names></name><name><surname>Dahan</surname><given-names>O</given-names></name><name><surname>Pedersen</surname><given-names>JS</given-names></name><name><surname>Lund</surname><given-names>AH</given-names></name><name><surname>Pilpel</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>A dual program for translation regulation in cellular proliferation and differentiation</article-title><source>Cell</source><volume>158</volume><fpage>1281</fpage><lpage>1292</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2014.08.011</pub-id><pub-id pub-id-type="pmid">25215487</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gogakos</surname><given-names>T</given-names></name><name><surname>Brown</surname><given-names>M</given-names></name><name><surname>Garzia</surname><given-names>A</given-names></name><name><surname>Meyer</surname><given-names>C</given-names></name><name><surname>Hafner</surname><given-names>M</given-names></name><name><surname>Tuschl</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Characterizing expression and processing of precursor and mature human tRNAs by hydro-tRNAseq and PAR-CLIP</article-title><source>Cell Reports</source><volume>20</volume><fpage>1463</fpage><lpage>1475</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2017.07.029</pub-id><pub-id pub-id-type="pmid">28793268</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guzzi</surname><given-names>N</given-names></name><name><surname>Cieśla</surname><given-names>M</given-names></name><name><surname>Ngoc</surname><given-names>PCT</given-names></name><name><surname>Lang</surname><given-names>S</given-names></name><name><surname>Arora</surname><given-names>S</given-names></name><name><surname>Dimitriou</surname><given-names>M</given-names></name><name><surname>Pimková</surname><given-names>K</given-names></name><name><surname>Sommarin</surname><given-names>MNE</given-names></name><name><surname>Munita</surname><given-names>R</given-names></name><name><surname>Lubas</surname><given-names>M</given-names></name><name><surname>Lim</surname><given-names>Y</given-names></name><name><surname>Okuyama</surname><given-names>K</given-names></name><name><surname>Soneji</surname><given-names>S</given-names></name><name><surname>Karlsson</surname><given-names>G</given-names></name><name><surname>Hansson</surname><given-names>J</given-names></name><name><surname>Jönsson</surname><given-names>G</given-names></name><name><surname>Lund</surname><given-names>AH</given-names></name><name><surname>Sigvardsson</surname><given-names>M</given-names></name><name><surname>Hellström-Lindberg</surname><given-names>E</given-names></name><name><surname>Hsieh</surname><given-names>AC</given-names></name><name><surname>Bellodi</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Pseudouridylation of tRNA-derived fragments steers translational control in stem cells</article-title><source>Cell</source><volume>173</volume><fpage>1204</fpage><lpage>1216</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2018.03.008</pub-id><pub-id pub-id-type="pmid">29628141</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hernandez-Alias</surname><given-names>X</given-names></name><name><surname>Benisty</surname><given-names>H</given-names></name><name><surname>Schaefer</surname><given-names>MH</given-names></name><name><surname>Serrano</surname><given-names>L</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Translational efficiency across healthy and tumor tissues is proliferation-related</article-title><source>Molecular Systems Biology</source><volume>16</volume><elocation-id>e9275</elocation-id><pub-id pub-id-type="doi">10.15252/msb.20199275</pub-id><pub-id pub-id-type="pmid">32149479</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="preprint"><person-group person-group-type="author"><name><surname>Holmes</surname><given-names>AD</given-names></name><name><surname>Howard</surname><given-names>JM</given-names></name><name><surname>Chan</surname><given-names>PP</given-names></name><name><surname>Lowe</surname><given-names>TM</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>tRNA Analysis of eXpression (tRAX): a tool for integrating analysis of tRNAs, tRNA-derived small RNAs, and tRNA modifications</article-title><source>bioRxiv</source><pub-id pub-id-type="doi">10.1101/2022.07.02.498565</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Honda</surname><given-names>S</given-names></name><name><surname>Loher</surname><given-names>P</given-names></name><name><surname>Shigematsu</surname><given-names>M</given-names></name><name><surname>Palazzo</surname><given-names>JP</given-names></name><name><surname>Suzuki</surname><given-names>R</given-names></name><name><surname>Imoto</surname><given-names>I</given-names></name><name><surname>Rigoutsos</surname><given-names>I</given-names></name><name><surname>Kirino</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Sex hormone-dependent tRNA halves enhance cell proliferation in breast and prostate cancers</article-title><source>PNAS</source><volume>112</volume><fpage>E3816</fpage><lpage>E3825</lpage><pub-id pub-id-type="doi">10.1073/pnas.1510077112</pub-id><pub-id pub-id-type="pmid">26124144</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hopper</surname><given-names>AK</given-names></name><name><surname>Furukawa</surname><given-names>AH</given-names></name><name><surname>Pham</surname><given-names>HD</given-names></name><name><surname>Martin</surname><given-names>NC</given-names></name></person-group><year iso-8601-date="1982">1982</year><article-title>Defects in modification of cytoplasmic and mitochondrial transfer RNAs are caused by single nuclear mutations</article-title><source>Cell</source><volume>28</volume><fpage>543</fpage><lpage>550</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(82)90209-4</pub-id><pub-id pub-id-type="pmid">7074684</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Karaca</surname><given-names>E</given-names></name><name><surname>Weitzer</surname><given-names>S</given-names></name><name><surname>Pehlivan</surname><given-names>D</given-names></name><name><surname>Shiraishi</surname><given-names>H</given-names></name><name><surname>Gogakos</surname><given-names>T</given-names></name><name><surname>Hanada</surname><given-names>T</given-names></name><name><surname>Jhangiani</surname><given-names>SN</given-names></name><name><surname>Wiszniewski</surname><given-names>W</given-names></name><name><surname>Withers</surname><given-names>M</given-names></name><name><surname>Campbell</surname><given-names>IM</given-names></name><name><surname>Erdin</surname><given-names>S</given-names></name><name><surname>Isikay</surname><given-names>S</given-names></name><name><surname>Franco</surname><given-names>LM</given-names></name><name><surname>Gonzaga-Jauregui</surname><given-names>C</given-names></name><name><surname>Gambin</surname><given-names>T</given-names></name><name><surname>Gelowani</surname><given-names>V</given-names></name><name><surname>Hunter</surname><given-names>JV</given-names></name><name><surname>Yesil</surname><given-names>G</given-names></name><name><surname>Koparir</surname><given-names>E</given-names></name><name><surname>Yilmaz</surname><given-names>S</given-names></name><name><surname>Brown</surname><given-names>M</given-names></name><name><surname>Briskin</surname><given-names>D</given-names></name><name><surname>Hafner</surname><given-names>M</given-names></name><name><surname>Morozov</surname><given-names>P</given-names></name><name><surname>Farazi</surname><given-names>TA</given-names></name><name><surname>Bernreuther</surname><given-names>C</given-names></name><name><surname>Glatzel</surname><given-names>M</given-names></name><name><surname>Trattnig</surname><given-names>S</given-names></name><name><surname>Friske</surname><given-names>J</given-names></name><name><surname>Kronnerwetter</surname><given-names>C</given-names></name><name><surname>Bainbridge</surname><given-names>MN</given-names></name><name><surname>Gezdirici</surname><given-names>A</given-names></name><name><surname>Seven</surname><given-names>M</given-names></name><name><surname>Muzny</surname><given-names>DM</given-names></name><name><surname>Boerwinkle</surname><given-names>E</given-names></name><name><surname>Ozen</surname><given-names>M</given-names></name><collab>Baylor Hopkins Center for Mendelian Genomics</collab><name><surname>Clausen</surname><given-names>T</given-names></name><name><surname>Tuschl</surname><given-names>T</given-names></name><name><surname>Yuksel</surname><given-names>A</given-names></name><name><surname>Hess</surname><given-names>A</given-names></name><name><surname>Gibbs</surname><given-names>RA</given-names></name><name><surname>Martinez</surname><given-names>J</given-names></name><name><surname>Penninger</surname><given-names>JM</given-names></name><name><surname>Lupski</surname><given-names>JR</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Human CLP1 mutations alter tRNA biogenesis, affecting both peripheral and central nervous system function</article-title><source>Cell</source><volume>157</volume><fpage>636</fpage><lpage>650</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2014.02.058</pub-id><pub-id pub-id-type="pmid">24766809</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Keam</surname><given-names>SP</given-names></name><name><surname>Hutvagner</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>tRNA-derived fragments (tRFs): emerging new roles for an ancient RNA in the regulation of gene expression</article-title><source>Life</source><volume>5</volume><fpage>1638</fpage><lpage>1651</lpage><pub-id pub-id-type="doi">10.3390/life5041638</pub-id><pub-id pub-id-type="pmid">26703738</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kim</surname><given-names>HK</given-names></name><name><surname>Yeom</surname><given-names>JH</given-names></name><name><surname>Kay</surname><given-names>MA</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Transfer RNA-derived small RNAs: another layer of gene regulation and novel targets for disease therapeutics</article-title><source>Molecular Therapy</source><volume>28</volume><fpage>2340</fpage><lpage>2357</lpage><pub-id pub-id-type="doi">10.1016/j.ymthe.2020.09.013</pub-id><pub-id pub-id-type="pmid">32956625</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Laxman</surname><given-names>S</given-names></name><name><surname>Sutter</surname><given-names>BM</given-names></name><name><surname>Wu</surname><given-names>X</given-names></name><name><surname>Kumar</surname><given-names>S</given-names></name><name><surname>Guo</surname><given-names>X</given-names></name><name><surname>Trudgian</surname><given-names>DC</given-names></name><name><surname>Mirzaei</surname><given-names>H</given-names></name><name><surname>Tu</surname><given-names>BP</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Sulfur amino acids regulate translational capacity and metabolic homeostasis through modulation of tRNA thiolation</article-title><source>Cell</source><volume>154</volume><fpage>416</fpage><lpage>429</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2013.06.043</pub-id><pub-id pub-id-type="pmid">23870129</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname><given-names>SR</given-names></name><name><surname>Collins</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Starvation-induced cleavage of the tRNA anticodon loop in <italic>Tetrahymena thermophila</italic></article-title><source>The Journal of Biological Chemistry</source><volume>280</volume><fpage>42744</fpage><lpage>42749</lpage><pub-id pub-id-type="doi">10.1074/jbc.M510356200</pub-id><pub-id pub-id-type="pmid">16272149</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname><given-names>YS</given-names></name><name><surname>Shibata</surname><given-names>Y</given-names></name><name><surname>Malhotra</surname><given-names>A</given-names></name><name><surname>Dutta</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>A novel class of small RNAs: tRNA-derived RNA fragments (tRFs)</article-title><source>Genes &amp; Development</source><volume>23</volume><fpage>2639</fpage><lpage>2649</lpage><pub-id pub-id-type="doi">10.1101/gad.1837609</pub-id><pub-id pub-id-type="pmid">19933153</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lucas</surname><given-names>MC</given-names></name><name><surname>Pryszcz</surname><given-names>LP</given-names></name><name><surname>Medina</surname><given-names>R</given-names></name><name><surname>Milenkovic</surname><given-names>I</given-names></name><name><surname>Camacho</surname><given-names>N</given-names></name><name><surname>Marchand</surname><given-names>V</given-names></name><name><surname>Motorin</surname><given-names>Y</given-names></name><name><surname>Ribas de Pouplana</surname><given-names>L</given-names></name><name><surname>Novoa</surname><given-names>EM</given-names></name></person-group><year iso-8601-date="2024">2024</year><article-title>Quantitative analysis of tRNA abundance and modifications by nanopore RNA sequencing</article-title><source>Nature Biotechnology</source><volume>42</volume><fpage>72</fpage><lpage>86</lpage><pub-id pub-id-type="doi">10.1038/s41587-023-01743-6</pub-id><pub-id pub-id-type="pmid">37024678</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mohr</surname><given-names>S</given-names></name><name><surname>Ghanem</surname><given-names>E</given-names></name><name><surname>Smith</surname><given-names>W</given-names></name><name><surname>Sheeter</surname><given-names>D</given-names></name><name><surname>Qin</surname><given-names>Y</given-names></name><name><surname>King</surname><given-names>O</given-names></name><name><surname>Polioudakis</surname><given-names>D</given-names></name><name><surname>Iyer</surname><given-names>VR</given-names></name><name><surname>Hunicke-Smith</surname><given-names>S</given-names></name><name><surname>Swamy</surname><given-names>S</given-names></name><name><surname>Kuersten</surname><given-names>S</given-names></name><name><surname>Lambowitz</surname><given-names>AM</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing</article-title><source>RNA</source><volume>19</volume><fpage>958</fpage><lpage>970</lpage><pub-id pub-id-type="doi">10.1261/rna.039743.113</pub-id><pub-id pub-id-type="pmid">23697550</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pan</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Modifications and functional genomics of human transfer RNA</article-title><source>Cell Research</source><volume>28</volume><fpage>395</fpage><lpage>404</lpage><pub-id pub-id-type="doi">10.1038/s41422-018-0013-y</pub-id><pub-id pub-id-type="pmid">29463900</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pan</surname><given-names>Q</given-names></name><name><surname>Han</surname><given-names>T</given-names></name><name><surname>Li</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Novel insights into the roles of tRNA-derived small RNAs</article-title><source>RNA Biology</source><volume>18</volume><fpage>2157</fpage><lpage>2167</lpage><pub-id pub-id-type="doi">10.1080/15476286.2021.1922009</pub-id><pub-id pub-id-type="pmid">33998370</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peng</surname><given-names>H</given-names></name><name><surname>Shi</surname><given-names>J</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Zhang</surname><given-names>H</given-names></name><name><surname>Liao</surname><given-names>S</given-names></name><name><surname>Li</surname><given-names>W</given-names></name><name><surname>Lei</surname><given-names>L</given-names></name><name><surname>Han</surname><given-names>C</given-names></name><name><surname>Ning</surname><given-names>L</given-names></name><name><surname>Cao</surname><given-names>Y</given-names></name><name><surname>Zhou</surname><given-names>Q</given-names></name><name><surname>Chen</surname><given-names>Q</given-names></name><name><surname>Duan</surname><given-names>E</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>A novel class of tRNA-derived small RNAs extremely enriched in mature mouse sperm</article-title><source>Cell Research</source><volume>22</volume><fpage>1609</fpage><lpage>1612</lpage><pub-id pub-id-type="doi">10.1038/cr.2012.141</pub-id><pub-id pub-id-type="pmid">23044802</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Phizicky</surname><given-names>EM</given-names></name><name><surname>Hopper</surname><given-names>AK</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>tRNA biology charges to the front</article-title><source>Genes &amp; Development</source><volume>24</volume><fpage>1832</fpage><lpage>1860</lpage><pub-id pub-id-type="doi">10.1101/gad.1956510</pub-id><pub-id pub-id-type="pmid">20810645</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Phizicky</surname><given-names>EM</given-names></name><name><surname>Hopper</surname><given-names>AK</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>tRNA processing, modification, and subcellular dynamics: past, present, and future</article-title><source>RNA</source><volume>21</volume><fpage>483</fpage><lpage>485</lpage><pub-id pub-id-type="doi">10.1261/rna.049932.115</pub-id><pub-id pub-id-type="pmid">25780105</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pinkard</surname><given-names>O</given-names></name><name><surname>McFarland</surname><given-names>S</given-names></name><name><surname>Sweet</surname><given-names>T</given-names></name><name><surname>Coller</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Quantitative tRNA-sequencing uncovers metazoan tissue-specific tRNA regulation</article-title><source>Nature Communications</source><volume>11</volume><elocation-id>4104</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-020-17879-x</pub-id><pub-id pub-id-type="pmid">32796835</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Scacchetti</surname><given-names>A</given-names></name><name><surname>Shields</surname><given-names>EJ</given-names></name><name><surname>Trigg</surname><given-names>NA</given-names></name><name><surname>Lee</surname><given-names>GS</given-names></name><name><surname>Wilusz</surname><given-names>JE</given-names></name><name><surname>Conine</surname><given-names>CC</given-names></name><name><surname>Bonasio</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2024">2024</year><article-title>A ligation-independent sequencing method reveals tRNA-derived RNAs with blocked 3’ termini</article-title><source>Molecular Cell</source><volume>84</volume><fpage>3843</fpage><lpage>3859</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2024.07.008</pub-id><pub-id pub-id-type="pmid">39096899</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Scheepbouwer</surname><given-names>C</given-names></name><name><surname>Aparicio-Puerta</surname><given-names>E</given-names></name><name><surname>Gomez-Martin</surname><given-names>C</given-names></name><name><surname>Verschueren</surname><given-names>H</given-names></name><name><surname>van Eijndhoven</surname><given-names>M</given-names></name><name><surname>Wedekind</surname><given-names>LE</given-names></name><name><surname>Giannoukakos</surname><given-names>S</given-names></name><name><surname>Hijmering</surname><given-names>N</given-names></name><name><surname>Gasparotto</surname><given-names>L</given-names></name><name><surname>van der Galien</surname><given-names>HT</given-names></name><name><surname>van Rijn</surname><given-names>RS</given-names></name><name><surname>Aronica</surname><given-names>E</given-names></name><name><surname>Kibbelaar</surname><given-names>R</given-names></name><name><surname>Heine</surname><given-names>VM</given-names></name><name><surname>Wesseling</surname><given-names>P</given-names></name><name><surname>Noske</surname><given-names>DP</given-names></name><name><surname>Vandertop</surname><given-names>WP</given-names></name><name><surname>de Jong</surname><given-names>D</given-names></name><name><surname>Pegtel</surname><given-names>DM</given-names></name><name><surname>Hackenberg</surname><given-names>M</given-names></name><name><surname>Wurdinger</surname><given-names>T</given-names></name><name><surname>Gerber</surname><given-names>A</given-names></name><name><surname>Koppers-Lalic</surname><given-names>D</given-names></name></person-group><year iso-8601-date="2023">2023</year><article-title>ALL-tRNAseq enables robust tRNA profiling in tissue samples</article-title><source>Genes &amp; Development</source><volume>37</volume><fpage>243</fpage><lpage>257</lpage><pub-id pub-id-type="doi">10.1101/gad.350233.122</pub-id><pub-id pub-id-type="pmid">36810209</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sharma</surname><given-names>U</given-names></name><name><surname>Conine</surname><given-names>CC</given-names></name><name><surname>Shea</surname><given-names>JM</given-names></name><name><surname>Boskovic</surname><given-names>A</given-names></name><name><surname>Derr</surname><given-names>AG</given-names></name><name><surname>Bing</surname><given-names>XY</given-names></name><name><surname>Belleannee</surname><given-names>C</given-names></name><name><surname>Kucukural</surname><given-names>A</given-names></name><name><surname>Serra</surname><given-names>RW</given-names></name><name><surname>Sun</surname><given-names>F</given-names></name><name><surname>Song</surname><given-names>L</given-names></name><name><surname>Carone</surname><given-names>BR</given-names></name><name><surname>Ricci</surname><given-names>EP</given-names></name><name><surname>Li</surname><given-names>XZ</given-names></name><name><surname>Fauquier</surname><given-names>L</given-names></name><name><surname>Moore</surname><given-names>MJ</given-names></name><name><surname>Sullivan</surname><given-names>R</given-names></name><name><surname>Mello</surname><given-names>CC</given-names></name><name><surname>Garber</surname><given-names>M</given-names></name><name><surname>Rando</surname><given-names>OJ</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Biogenesis and function of tRNA fragments during sperm maturation and fertilization in mammals</article-title><source>Science</source><volume>351</volume><fpage>391</fpage><lpage>396</lpage><pub-id pub-id-type="doi">10.1126/science.aad6780</pub-id><pub-id pub-id-type="pmid">26721685</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sharma</surname><given-names>U</given-names></name><name><surname>Sun</surname><given-names>F</given-names></name><name><surname>Conine</surname><given-names>CC</given-names></name><name><surname>Reichholf</surname><given-names>B</given-names></name><name><surname>Kukreja</surname><given-names>S</given-names></name><name><surname>Herzog</surname><given-names>VA</given-names></name><name><surname>Ameres</surname><given-names>SL</given-names></name><name><surname>Rando</surname><given-names>OJ</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Small RNAs are trafficked from the epididymis to developing mammalian sperm</article-title><source>Developmental Cell</source><volume>46</volume><fpage>481</fpage><lpage>494</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2018.06.023</pub-id><pub-id pub-id-type="pmid">30057273</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sharma</surname><given-names>U</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Paternal contributions to offspring health: role of sperm small rnas in intergenerational transmission of epigenetic information</article-title><source>Frontiers in Cell and Developmental Biology</source><volume>7</volume><elocation-id>215</elocation-id><pub-id pub-id-type="doi">10.3389/fcell.2019.00215</pub-id><pub-id pub-id-type="pmid">31681757</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shi</surname><given-names>J</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Tan</surname><given-names>D</given-names></name><name><surname>Zhang</surname><given-names>X</given-names></name><name><surname>Yan</surname><given-names>M</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Franklin</surname><given-names>R</given-names></name><name><surname>Shahbazi</surname><given-names>M</given-names></name><name><surname>Mackinlay</surname><given-names>K</given-names></name><name><surname>Liu</surname><given-names>S</given-names></name><name><surname>Kuhle</surname><given-names>B</given-names></name><name><surname>James</surname><given-names>ER</given-names></name><name><surname>Zhang</surname><given-names>L</given-names></name><name><surname>Qu</surname><given-names>Y</given-names></name><name><surname>Zhai</surname><given-names>Q</given-names></name><name><surname>Zhao</surname><given-names>W</given-names></name><name><surname>Zhao</surname><given-names>L</given-names></name><name><surname>Zhou</surname><given-names>C</given-names></name><name><surname>Gu</surname><given-names>W</given-names></name><name><surname>Murn</surname><given-names>J</given-names></name><name><surname>Guo</surname><given-names>J</given-names></name><name><surname>Carrell</surname><given-names>DT</given-names></name><name><surname>Wang</surname><given-names>Y</given-names></name><name><surname>Chen</surname><given-names>X</given-names></name><name><surname>Cairns</surname><given-names>BR</given-names></name><name><surname>Yang</surname><given-names>X-L</given-names></name><name><surname>Schimmel</surname><given-names>P</given-names></name><name><surname>Zernicka-Goetz</surname><given-names>M</given-names></name><name><surname>Cheloufi</surname><given-names>S</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Zhou</surname><given-names>T</given-names></name><name><surname>Chen</surname><given-names>Q</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>PANDORA-seq expands the repertoire of regulatory small RNAs by overcoming RNA modifications</article-title><source>Nature Cell Biology</source><volume>23</volume><fpage>424</fpage><lpage>436</lpage><pub-id pub-id-type="doi">10.1038/s41556-021-00652-7</pub-id><pub-id pub-id-type="pmid">33820973</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="software"><person-group person-group-type="author"><name><surname>Shields</surname><given-names>EJ</given-names></name></person-group><year iso-8601-date="2024">2024</year><data-title>LIDAR</data-title><version designator="43cd786">43cd786</version><source>GitHub</source><ext-link ext-link-type="uri" xlink:href="https://github.com/bonasio-lab/LIDAR">https://github.com/bonasio-lab/LIDAR</ext-link></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shigematsu</surname><given-names>M</given-names></name><name><surname>Honda</surname><given-names>S</given-names></name><name><surname>Loher</surname><given-names>P</given-names></name><name><surname>Telonis</surname><given-names>AG</given-names></name><name><surname>Rigoutsos</surname><given-names>I</given-names></name><name><surname>Kirino</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>YAMAT-seq: an efficient method for high-throughput sequencing of mature transfer RNAs</article-title><source>Nucleic Acids Research</source><volume>45</volume><elocation-id>e70</elocation-id><pub-id pub-id-type="doi">10.1093/nar/gkx005</pub-id><pub-id pub-id-type="pmid">28108659</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Su</surname><given-names>Z</given-names></name><name><surname>Wilson</surname><given-names>B</given-names></name><name><surname>Kumar</surname><given-names>P</given-names></name><name><surname>Dutta</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Noncanonical Roles of tRNAs: tRNA Fragments and Beyond</article-title><source>Annual Review of Genetics</source><volume>54</volume><fpage>47</fpage><lpage>69</lpage><pub-id pub-id-type="doi">10.1146/annurev-genet-022620-101840</pub-id><pub-id pub-id-type="pmid">32841070</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thompson</surname><given-names>DM</given-names></name><name><surname>Lu</surname><given-names>C</given-names></name><name><surname>Green</surname><given-names>PJ</given-names></name><name><surname>Parker</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>tRNA cleavage is a conserved response to oxidative stress in eukaryotes</article-title><source>RNA</source><volume>14</volume><fpage>2095</fpage><lpage>2103</lpage><pub-id pub-id-type="doi">10.1261/rna.1232808</pub-id><pub-id pub-id-type="pmid">18719243</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thompson</surname><given-names>DM</given-names></name><name><surname>Parker</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>The RNase Rny1p cleaves tRNAs and promotes cell death during oxidative stress in <italic>Saccharomyces cerevisiae</italic></article-title><source>The Journal of Cell Biology</source><volume>185</volume><fpage>43</fpage><lpage>50</lpage><pub-id pub-id-type="doi">10.1083/jcb.200811119</pub-id><pub-id pub-id-type="pmid">19332891</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tosar</surname><given-names>JP</given-names></name><name><surname>Gámbaro</surname><given-names>F</given-names></name><name><surname>Darré</surname><given-names>L</given-names></name><name><surname>Pantano</surname><given-names>S</given-names></name><name><surname>Westhof</surname><given-names>E</given-names></name><name><surname>Cayota</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Dimerization confers increased stability to nucleases in 5’ halves from glycine and glutamic acid tRNAs</article-title><source>Nucleic Acids Research</source><volume>46</volume><fpage>9081</fpage><lpage>9093</lpage><pub-id pub-id-type="doi">10.1093/nar/gky495</pub-id><pub-id pub-id-type="pmid">29893896</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Upton</surname><given-names>HE</given-names></name><name><surname>Ferguson</surname><given-names>L</given-names></name><name><surname>Temoche-Diaz</surname><given-names>MM</given-names></name><name><surname>Liu</surname><given-names>XM</given-names></name><name><surname>Pimentel</surname><given-names>SC</given-names></name><name><surname>Ingolia</surname><given-names>NT</given-names></name><name><surname>Schekman</surname><given-names>R</given-names></name><name><surname>Collins</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Low-bias ncRNA libraries using ordered two-template relay: Serial template jumping by a modified retroelement reverse transcriptase</article-title><source>PNAS</source><volume>118</volume><elocation-id>e2107900118</elocation-id><pub-id pub-id-type="doi">10.1073/pnas.2107900118</pub-id><pub-id pub-id-type="pmid">34649994</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>H</given-names></name><name><surname>Huang</surname><given-names>R</given-names></name><name><surname>Li</surname><given-names>L</given-names></name><name><surname>Zhu</surname><given-names>J</given-names></name><name><surname>Li</surname><given-names>Z</given-names></name><name><surname>Peng</surname><given-names>C</given-names></name><name><surname>Zhuang</surname><given-names>X</given-names></name><name><surname>Lin</surname><given-names>H</given-names></name><name><surname>Shi</surname><given-names>S</given-names></name><name><surname>Huang</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>CPA-seq reveals small ncRNAs with methylated nucleosides and diverse termini</article-title><source>Cell Discovery</source><volume>7</volume><elocation-id>25</elocation-id><pub-id pub-id-type="doi">10.1038/s41421-021-00265-2</pub-id><pub-id pub-id-type="pmid">33867522</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Watkins</surname><given-names>CP</given-names></name><name><surname>Zhang</surname><given-names>W</given-names></name><name><surname>Wylder</surname><given-names>AC</given-names></name><name><surname>Katanski</surname><given-names>CD</given-names></name><name><surname>Pan</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>A multiplex platform for small RNA sequencing elucidates multifaceted tRNA stress response and translational regulation</article-title><source>Nature Communications</source><volume>13</volume><elocation-id>2491</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-022-30261-3</pub-id><pub-id pub-id-type="pmid">35513407</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yamasaki</surname><given-names>S</given-names></name><name><surname>Ivanov</surname><given-names>P</given-names></name><name><surname>Hu</surname><given-names>GF</given-names></name><name><surname>Anderson</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Angiogenin cleaves tRNA and promotes stress-induced translational repression</article-title><source>The Journal of Cell Biology</source><volume>185</volume><fpage>35</fpage><lpage>42</lpage><pub-id pub-id-type="doi">10.1083/jcb.200811106</pub-id><pub-id pub-id-type="pmid">19332886</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Zhang</surname><given-names>X</given-names></name><name><surname>Shi</surname><given-names>J</given-names></name><name><surname>Tuorto</surname><given-names>F</given-names></name><name><surname>Li</surname><given-names>X</given-names></name><name><surname>Liu</surname><given-names>Y</given-names></name><name><surname>Liebers</surname><given-names>R</given-names></name><name><surname>Zhang</surname><given-names>L</given-names></name><name><surname>Qu</surname><given-names>Y</given-names></name><name><surname>Qian</surname><given-names>J</given-names></name><name><surname>Pahima</surname><given-names>M</given-names></name><name><surname>Liu</surname><given-names>Y</given-names></name><name><surname>Yan</surname><given-names>M</given-names></name><name><surname>Cao</surname><given-names>Z</given-names></name><name><surname>Lei</surname><given-names>X</given-names></name><name><surname>Cao</surname><given-names>Y</given-names></name><name><surname>Peng</surname><given-names>H</given-names></name><name><surname>Liu</surname><given-names>S</given-names></name><name><surname>Wang</surname><given-names>Y</given-names></name><name><surname>Zheng</surname><given-names>H</given-names></name><name><surname>Woolsey</surname><given-names>R</given-names></name><name><surname>Quilici</surname><given-names>D</given-names></name><name><surname>Zhai</surname><given-names>Q</given-names></name><name><surname>Li</surname><given-names>L</given-names></name><name><surname>Zhou</surname><given-names>T</given-names></name><name><surname>Yan</surname><given-names>W</given-names></name><name><surname>Lyko</surname><given-names>F</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Zhou</surname><given-names>Q</given-names></name><name><surname>Duan</surname><given-names>E</given-names></name><name><surname>Chen</surname><given-names>Q</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Dnmt2 mediates intergenerational transmission of paternally acquired metabolic disorders through sperm small non-coding RNAs</article-title><source>Nature Cell Biology</source><volume>20</volume><fpage>535</fpage><lpage>540</lpage><pub-id pub-id-type="doi">10.1038/s41556-018-0087-2</pub-id><pub-id pub-id-type="pmid">29695786</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zheng</surname><given-names>G</given-names></name><name><surname>Qin</surname><given-names>Y</given-names></name><name><surname>Clark</surname><given-names>WC</given-names></name><name><surname>Dai</surname><given-names>Q</given-names></name><name><surname>Yi</surname><given-names>C</given-names></name><name><surname>He</surname><given-names>C</given-names></name><name><surname>Lambowitz</surname><given-names>AM</given-names></name><name><surname>Pan</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Efficient and quantitative high-throughput tRNA sequencing</article-title><source>Nature Methods</source><volume>12</volume><fpage>835</fpage><lpage>837</lpage><pub-id pub-id-type="doi">10.1038/nmeth.3478</pub-id><pub-id pub-id-type="pmid">26214130</pub-id></element-citation></ref></ref-list></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.77616.sa0</article-id><title-group><article-title>Editor's evaluation</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Chang</surname><given-names>Howard Y</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00f54p054</institution-id><institution>Stanford University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group></front-stub><body><p>This important study applies Ordered Two Template Relay sequencing (OTTR-seq) to characterize tRNA and tRNA fragments in yeast and mouse tissues. The authors benchmark OTTR-seq vs several other methods and show OTTR-seq allows unambiguous identification of tRNAs, tRNA fragments, and their modification patterns. Use of OTTR-seq revealed extensive tRNA cargos in mammalian sperms that have been postulated to transmit transgenerational information.</p></body></sub-article><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.77616.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Chang</surname><given-names>Howard Y</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00f54p054</institution-id><institution>Stanford University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Lowe</surname><given-names>Todd M</given-names></name><role>Reviewer</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03s65by71</institution-id><institution>University of California, Santa Cruz</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text id="sa2-box1"><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;Deep sequencing of yeast and mouse tRNAs and tRNA fragments using OTTR&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and James Manley as the Senior Editor. The following individual involved in review of your submission have agreed to reveal their identity: Todd M Lowe (Reviewer #2).</p><p>The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.</p><p>Essential Revisions:</p><p>1) Better comparison of OTTR to existing methods, such as YAMAT-seq and Mim-tRNA seq. Primary data of Is the measurement of full length tRNA quantitative? The authors observe that the fraction of full length tRNAs measured compared to RT stops is high, like in YAMAT-seq and mim-tRNA-seq. One possibility that the authors detect a high fraction of full length tRNAs is because cDNA products resulting from RT stops are systematically not detected, perhaps due to template switching being prevented by the cDNA template still annealed to the tRNA. YAMAT-seq is notorious in overemphasizing full-length tRNA as only the full-length cDNA product of tRNA is PCR-amplified and sequenced. Mim-tRNA-seq on the other hand, showed that the entire cDNA products BEFORE PCR amplification are indeed mostly full-length. The authors need to show primary data of the cDNA libraries before PCR amplification to justify this claim. In addition, the authors should show without PCR amplification that the OTTR RT is indeed superior in reading through e.g. yeast tRNAPhe yW37 modification (reported in 1C) compared to TGIRT and the thermostable superscript IV used in other recent tRNA-seq protocols.</p><p>2) Demonstrate better that OTTR actually distinguishes between 3' tRNA fragment and RT stops. Sequencing reads mapping only to the 3' half are interpreted as fragments.</p><p>This is confusing because the method implied that only full length products can be amplified in libraries. The cause and confirmation of the 3' fragments need to be better substantiated.</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>Gustafsson et al. describe an application of the recently developed OTTR library prep method to tRNA and tRNA fragments. They present characterization of tRNA-sequencing results from yeast and mouse testis/spermatozoa. The authors claim a significant improvement in the detection of full length tRNAs compared to other techniques; importantly, the authors further focus on the detection of tRNA fragments which are biologically important, but systematically under-detected by existing techniques. The authors show that OTTR detects select tRNA fragments better than a couple of commercial kits. This reviewer shares the author's enthusiasm about the importance of detecting tRNA fragments, especially 3' tRNA fragments, and further share their enthusiasm about the potential for OTTR. However, it is unclear that using OTTR towards the study of tRNA and tRNA fragments is a substantive advance over the several protocols published in the last 3 years. If the authors can more substantively demonstrate how OTTR compares to other methods quantitatively and include additional controls for sequencing results, this could be a method of great utility.</p><p>1. Figure 1: Is the measurement of full length tRNA quantitative? The authors observe that the fraction of full length tRNAs measured compared to RT stops is high, like in YAMAT-seq and mim-tRNA-seq. One possibility that the authors detect a high fraction of full length tRNAs is because cDNA products resulting from RT stops are systematically not detected, perhaps due to template switching being prevented by the cDNA template still annealed to the tRNA. YAMAT-seq is notorious in overemphasizing full-length tRNA as only the full-length cDNA product of tRNA is PCR-amplified and sequenced. Mim-tRNA-seq on the other hand, showed that the entire cDNA products BEFORE PCR amplification are indeed mostly full-length. The authors need to show primary data of the cDNA libraries before PCR amplification to justify this claim. In addition, the authors should show without PCR amplification that the OTTR RT is indeed superior in reading through e.g. yeast tRNAPhe yW37 modification (reported in 1C) compared to TGIRT and the thermostable superscript IV used in other recent tRNA-seq protocols.</p><p>2. Figure 1: The relative quantification of individual tRNAs needs to be done for reporting any new tRNA-seq method. At the least the authors should compare the yeast OTTR results with that from the mim-tRNA-seq paper.</p><p>3. Figure 2: 2A and B show that Lys-CTT has starts near the anticodon loop at t6A, indicating fragments. But this effect is eliminated by trm1 deletion. An alternative from 5' fragments is that the RT reinitiates downstream of a stop induced by a m22G or t6A modification.</p><p>4. RNA and read lengths appear inconsistent. First, from figure 1A, is miRvana the best source for capturing small tRNA fragments? More 30-nt material is retained with gel purification. Further, the insert sizes between figures 1A, 3B and 4A are confusing. 1A suggests majority full length tRNA, while figures 3B and 4A crop out this size of read, preventing comparison of relative levels of fragment and full length tRNA. Additionally, figure 1C suggests that Serine and leucine tRNAs are not captured faithful as full length. This could be due to these tRNAs being type II (~90nt long) but sequenced with only 75bp Illumina reads.</p><p>5. Can OTTR actually distinguish between 3' tRNA fragment and RT stops? Figure 1B is the strongest evidence to distinguish, and my reading is that reads mapping only to the 3' half must be fragments since this method doesn't suffer from RT stops. This reasoning is insufficient to interpret 3' fragments in unknown biological systems, which severely limits the utility of this exciting approach.</p><p>6. The biological advances of this work are unclear. The primary biological discovery presented is that the suite of small RNAs in mouse testis/sperm is different from previous measurements. Even for this result no Northern blot validation is provided for the OTTR data.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>The experimental design for this study was effective in choice of samples and treatments compared. Use of both yeast and mammalian samples that had been previously analyzed was a wise choice by which to observe tRNA pool complexity and misincorporations caused by modifications. We also appreciate the use of tRAX software, which specifically deals with the complexity of misincorporations caused by tRNA modifications, tRNA mapping ambiguity, and differential expression (full disclosure: developed in the Lowe lab). The use of trm1 mutants, inducible RNY1 overexpression, and PNK treatment were all effective experimental contexts showing the relative performance of the various sequencing methods tested. Some readers may feel the study was a bit limited in scope in that it did not do direct sample comparisons with the other leading methods for analyzing full length tRNAs (DM-tRNA-seq, mim-tRNA-seq and/or YAMAT-seq), relying instead on data previously published by other groups. However, in the authors' prior studies, they focused heavily on tRNA fragments in the mouse germline and utilized traditional small RNA-seq methods like TruSeq, which yielded very high-profile results based on high abundance of 5' halves of only a handful of tRNAs. This new study successfully argues the importance of re-examining those prior results given the effectiveness of this new generation of sequencing methods. OTTR-seq is arguably at the front of these newer methods, given its flexibility to measure both tRNAs and tRNA-derived small RNAs at the same time, both in terms of abundance and the misincorporations caused by Watson-Crick face interfering modifications. If all future tRNA-seq studies used OTTR-seq (or equally well performing methods), the tRNA field would take a major step forward.</p><p>Aside from easily addressed issues with figures, the only serious confusion that needs to be addressed is the assessment or interpretation of &quot;early termination&quot; sequencing reads. An analysis of premature termination was shown in Figure 1, yet by our understanding, OTTR-seq must reach the end of its RNA template to &quot;jump&quot; to the second adapter, in order to be sequenced (unlike TruSeq or DM-tRNA-seq, which allows the second linker to be added after premature termination of cDNA synthesis). Thus, this may actually be analysis of slightly shortened RNA molecules due to RNA degradation or exonucleases, not premature cDNA extension. This distinction should be clarified in the manuscript for all methods discussed, as other methods such as NEBNext and ARM-seq also do not produce any sequencing reads for early-termination products (both adapters are ligated on to the RNA at the very beginning).</p><p>Overall, this is a convincing first study profiling an important new method that will clearly improve our ability to measure and understand tRNA dynamics and complexity in the cell.</p><p>We found quite a few technical issues that need to be addressed, particularly with the figures, but also with other missing details. We believe the results are sound, but in the manuscript's unpolished data presentation state, it was often difficult or frustrating to try to follow the analyses. We hope these suggestions are helpful in strengthening the clarity and overall impact of the study.</p><p>In general, figure axes need to be systematically fixed throughout. Often axes labels are missing or not explained, or the formatting makes them unreadable or overlapping the graphs.</p><p>Supplemental Table S1 appears to be missing, making it difficult to find the datasets produced in this study.</p><p>What are the accession numbers of the data analyzed from prior studies? Others will not be able to reproduce/verify these external data analyses without full details in the methods.</p><p>Failed replicate: For the data shown in Figure 2D (yeast, full length tRNA mismatch data), there are 2 biological WT replicates, but only 1 valid biological Trm1(-/-) replicate (we checked, the other replicate had almost no reads in the deposited data file and was essentially a failed library). The single replicate did support the observations in the paper that the Trm1(-/-) leads to loss of misincorporation at position 26, so no serious concern with the results, but there should be a note that the second replicate essentially failed (and that failed sample removed from GEO).</p><p>Question regarding size selections: Figure 1A shows a wide size range, even after gel-purification, which is attributed to RNA fragmentation. However, shouldn't the second gel purification at the cDNA stage (to remove dimers), remove the short fragments (and at this stage, it's DNA, so should not fragment). This suggests a potential issue with gel sizing. Perhaps the authors can clarify why so many short reads are still found after two rounds of sizing (the second at the cDNA stage).</p><p>Concern with definition of &quot;full-length&quot; tRNA reads and early termination: we suggest the cutoff for counting a full-length read is too strict. It appears that if the read doesn't extend ALL the way to position 1 it is deemed a &quot;partial-length&quot; read. For example, with how the OTTR enzyme works, some of these &quot;partial-length&quot; reads ending near the 5' end of the tRNA are probably bioinformatic artifacts (where the additional 5'nt in the OTTR reads were skipped and thus a trimming of the 1st base in the tRNA sequence). With how we understand OTTR works, it should NOT jump to the other adapter in the case of a stop due to a tRNA modification. It could be that these truncated tRNAs are in fact being degraded and the reads are reflective of those intermediate degradation products, instead of due to modifications causing pre-mature stops. This is a very important point to address carefully, as the community may be led to believe, incorrectly, that OTTR produces reads with early RT ends.</p><p>With this issue in mind, Figures 1B-1F are probably no longer justified or should be moved to the Supplement (after re-interpreting the results) because the cause of the shorter reads for OTTR-seq is ambiguous (purification issues, degradation during the library prep?). If new graphs like these are created here or elsewhere, axes need to be labeled.</p><p>Case in point: In Figures 2A and 2B, many of the strongest known &quot;stop&quot;-inducing modifications do NOT appear to cause drop-offs (early termination) of reads. This should have been a huge red flag that shorter OTTR-seq reads are NOT caused by early RT termination. To be clear, the RT reaction *may* be stopped, but you will NOT see those reads in the OTTR-seq output, because you will not have a second adapter added on to the end, required for PCR amplification.</p><p>In Figure 2C-2F, these plots actually aren't that helpful because there is way too much data shown. No axes labels in 2D-2F are large enough to read. Everything is packed in, thus making it too busy and hard to understand. The comparison of 2C to 2D is very difficult because they are different sizes. The color labeling of the tRNAs is not useful at this small scale. 2D could be shown in a box plot, showing lack of misincorporation at just this position across most tRNAs. The tRNA position these diamonds correspond to is not useful unless modifications are labeled and lined up in the same (legible) figure. 2F, which has the bulk of the modification information, is very very difficult to get useful information from, as it's unclear exactly what it's showing.</p><p>We highly recommend just using the corresponding tRAX output files which show the results much more cleanly and clearly – here is how much clearer this data could be displayed, just by using the default output files in tRAX:</p><p>https://www.dropbox.com/s/tlea5q66ng5jbu1/Figre2C-F-from-tRAX.pdf?dl=0</p><p>Fairness in tRF sequencing method comparisons: All of the direct abundance comparisons with other methods are ones that do NOT involve PNK or AlkB treatment prior to library generation. This is going to lead to VASTLY different tRF/tDR pools due to these factors alone. Thus, this is something of a straw-man comparison because more quantitative tDR sequencing methods have been in use (ARM-seq/PANDORA-seq) that would be more fair comparisons to the current state-of-the-art. We do not recommend removing this data or the comparisons, but we do believe that these differences in library prep (with &quot;pre-2015&quot; technology) should be clearly represented as weaker than other existing methods not tested. There was acknowledgement that newer methods like mim-tRNA-seq give roughly as good performance as OTTR-seq, but the same should be mentioned that newer tDR/tRF sequencing methods get much closer to OTTR-seq than those done in this study. That said, OTTR-seq gives you the best of both full-length and tDR/tRF sequencing in one go – which is really the quality that makes it outshine all other methods, from our perspective (which is not emphasized enough in our humble opinion).</p><p>While comparing across multiple types of other kinds of sequencing (experiments not carried out in this study), is it fair to make these comparisons when the data is also from multiple source types (Figure S2)? YAMAT and Hydro-seq are thrown into the same context of the other sequencing library preps under the umbrella of &quot;extensive premature RT terminations&quot;, however, Hydro-tRNA-seq and ARM-seq can't produce sequencing reads with RT stops since they ligate 5' and 3' adapters prior to RT. YAMAT is given the appearance that it reads through tRNAs, but again, it only reads through the ones where the RT reaches the 5' adapter (thus you can't measure the true rate of RT stops because those stops, which do happen, are never observed in the seq data). The only library preps that could show RT-stops in this collection are QuantM and DM-tRNA-seq, from our understanding of the library prep protocols. Also, what exact data is being used here to assess these other methods? Some of these techniques have used both AlkB treated, and untreated. Did you use the AlkB+ samples in the datasets, or did you use -AlkB. This is never mentioned. All of these data sources and exactly which samples were used need to be specified clearly. These comparisons are extremely tricky, especially considering some of these methods were not designed to read full-length tRNAs, so doing direct comparisons and attributing differences to inefficient read-through of stops should be done with more care, separating the methods by their intended purposes.</p><p>Suggestions for improving Figure 3: Figure 3C could be presented more clearly with something like a stacked bar plot. It is hard to digest the changes with multiple bars for each isotype (just merge them unless a claim is made about a specific isotype/isodecoder). Additionally, it's not clear that the Y-axis metric being used (read count/1000) is the best for trying to compare these data across methods with such disparate scales. One can see that Gly has more reads in the NEB data than the others, but the other isotypes are very hard to compare at these scales (other than to see that they are different). 3D and 3E: Why is Fu_r1 shown as well as Fu_r2 (which look identical)?? And only Fu2018_r2 shown in 3C? (labeling inconsistency, BTW – 2018 included in one label but not the other). Figures 3D and 3E have axes that are impossible to read. Also, the Green/Red color coding for Starts and Stops seem to be backwards. RT-based sequencing reads &quot;Start&quot; at the 3' ends of tRNAs, and &quot;End&quot; towards the 5' end of the tRNA. These are labeled as being reads, so green should presumably be start, and red as stops. If instead you wish to present it in terms of tRNA coordinates (not the RT reaction which produces the read data), then the left most end would be green (start), and the right most would be red (stop) – this is counterintuitive because I (and most) know how cDNA reads are generated from RNA, but either way, Start as red and stop as green is really confusing.</p><p>Figure 3 and Supplemental Figure 4: Is this data using NEB with UMI? The NEB kit mentioned doesn't come with a UMI containing adapter, let alone two UMI containing adapters, as far as we know. Are these the adapters from the Fu 2018 protocol? If not, what are the adapters that are used? What size are the UMIs? This can greatly affect the amount of deduplication.</p><p>Suggestions for improving Figure 4: In Panel A, the different colored bars are nearly impossible to tell the difference between them. These would be better presented with another method. For Panel B, it is surprising so many ncRNAs are lumped into &quot;other&quot;. For a useful comparison, it would be helpful to break out at least snoRNAs and miRNAs (and possibly snRNAs), as the recovery rate of these other small RNAs directly affect competition with tRNAs, and they are processed in the cell differently. Panel C is confusing because the X-axis is numbered but the colors are for the different isotypes. What are the numbers on the x-axis for? (this extends to figures S4 and S6). In Panel D, the naming convention for the tRNAs is inconsistent with the other figures (e.g. &quot;Gly-GCC&quot; in Figure 4 vs &quot;tRNA-Gly-GCC&quot; in other figures). Exactly how were the plots in Figure 4 created? Were UMI used? Without legible scales, we are just looking at shapes, which can be deceiving for very high or low abundance tRFs/tDRs.</p><p>Figure S4 panel B it also appears that the 5' and 3' colors in the legend are flipped (?) – aside from this, it is very hard to gain useful information from Figure S4B, perhaps it could be presented in a better way?</p><p>Data Analysis Issues: We downloaded the submitted GEO data, and noted that the naming conventions in the datasets are very confusing (yeast_17_miRvana), instead of giving clear info about the actual sample (and we can't seem to find any metadata for these, had to guess, making reproducing the analyses extremely difficult). Additionally, we find the description of the methods for read processing incomplete. Again, it is unclear how long the UMIs used were. Any special parameters for read processing (trimming extra bases in OTTR-seq reads) are also omitted, again making it very difficult for others to reproduce the results.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.77616.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential Revisions:</p><p>1) Better comparison of OTTR to existing methods, such as YAMAT-seq and Mim-tRNA seq. Primary data of Is the measurement of full length tRNA quantitative? The authors observe that the fraction of full length tRNAs measured compared to RT stops is high, like in YAMAT-seq and mim-tRNA-seq. One possibility that the authors detect a high fraction of full length tRNAs is because cDNA products resulting from RT stops are systematically not detected, perhaps due to template switching being prevented by the cDNA template still annealed to the tRNA. YAMAT-seq is notorious in overemphasizing full-length tRNA as only the full-length cDNA product of tRNA is PCR-amplified and sequenced. Mim-tRNA-seq on the other hand, showed that the entire cDNA products BEFORE PCR amplification are indeed mostly full-length. The authors need to show primary data of the cDNA libraries before PCR amplification to justify this claim. In addition, the authors should show without PCR amplification that the OTTR RT is indeed superior in reading through e.g. yeast tRNAPhe yW37 modification (reported in 1C) compared to TGIRT and the thermostable superscript IV used in other recent tRNA-seq protocols.</p></disp-quote><p>See Introduction. We now compare OTTR systematically to all existing methods, presented visually in Figures S2-3, and described much more extensively in the Discussion. The only aspect of this comment that we have not addressed is the specific request to demonstrate superiority of OTTR RT in reading through modifications like yW37. The central issue with addressing this comment experimentally is that OTTR is a low input protocol – using higher inputs of starting material leads to biased capture of specific RNAs; keeping input levels roughly equimolar with primer concentration is essential for unbiased library construction – and so we do not have sufficient cDNA to visualize without amplification (we carry out size selection for libraries “blind,” based only on size markers). In Figure 5 we do show that despite its efficient capture of intact tRNAs even in untreated conditions, removing certain nucleotide modifications (via AlkB demethylation for relevant substrates, or genetically for others) improves capture of some tRNA species, highlighting that even for the OTTR enzyme, nucleotide modifications present a barrier to reverse transcription.</p><disp-quote content-type="editor-comment"><p>2) Demonstrate better that OTTR actually distinguishes between 3' tRNA fragment and RT stops. Sequencing reads mapping only to the 3' half are interpreted as fragments.</p><p>This is confusing because the method implied that only full length products can be amplified in libraries. The cause and confirmation of the 3' fragments need to be better substantiated.</p></disp-quote><p>The reviewer may be confusing the data for full length tRNA libraries (Figures1-2) and small RNA libraries (Figures3-4) in this paper. In the context of <italic>full length</italic> tRNA libraries we do not consider short products to be tRNA fragments: these are almost certainly premature RT termination products. Focusing on the 3’ reads interpreted as 3’ fragments: we have very clear evidence regarding the origin of these sequencing reads. For 3’ halves in <italic>small RNA libraries</italic> – which are the only context in which we interpret 3’ reads as “fragments” – the data in Figure S4A-B show a very clear distinction between the 3’ reads obtained before and after RNY1 expression. The former represent a mixture of tRNA degradation products presumably arising from RNA isolation and handling, along with any premature RT stops (which are almost certainly quite rare in these libraries; we find very few such 30-40 nt reads in libraries prepared from intact tRNAs). Importantly, these 3’ reads exhibit extensive heterogeneity in 5’ ends. Conversely, fragments isolated following RNY1 overexpression – where we confirm by Northern blotting that tRNAs are indeed extensively cleaved – exhibit precise 5’ ends, and as quantified using spike ins are at least 10X more abundant than the 3’ reads in no RNY1 conditions. We therefore argue that 3’ fragments are easily distinguishable from premature RT stops in OTTR datasets.</p><disp-quote content-type="editor-comment"><p>Reviewer #1 (Recommendations for the authors):</p><p>Gustafsson et al. describe an application of the recently developed OTTR library prep method to tRNA and tRNA fragments. They present characterization of tRNA-sequencing results from yeast and mouse testis/spermatozoa. The authors claim a significant improvement in the detection of full length tRNAs compared to other techniques; importantly, the authors further focus on the detection of tRNA fragments which are biologically important, but systematically under-detected by existing techniques. The authors show that OTTR detects select tRNA fragments better than a couple of commercial kits. This reviewer shares the author's enthusiasm about the importance of detecting tRNA fragments, especially 3' tRNA fragments, and further share their enthusiasm about the potential for OTTR. However, it is unclear that using OTTR towards the study of tRNA and tRNA fragments is a substantive advance over the several protocols published in the last 3 years. If the authors can more substantively demonstrate how OTTR compares to other methods quantitatively and include additional controls for sequencing results, this could be a method of great utility.</p><p>1. Figure 1: Is the measurement of full length tRNA quantitative? The authors observe that the fraction of full length tRNAs measured compared to RT stops is high, like in YAMAT-seq and mim-tRNA-seq. One possibility that the authors detect a high fraction of full length tRNAs is because cDNA products resulting from RT stops are systematically not detected, perhaps due to template switching being prevented by the cDNA template still annealed to the tRNA. YAMAT-seq is notorious in overemphasizing full-length tRNA as only the full-length cDNA product of tRNA is PCR-amplified and sequenced. Mim-tRNA-seq on the other hand, showed that the entire cDNA products BEFORE PCR amplification are indeed mostly full-length. The authors need to show primary data of the cDNA libraries before PCR amplification to justify this claim. In addition, the authors should show without PCR amplification that the OTTR RT is indeed superior in reading through e.g. yeast tRNAPhe yW37 modification (reported in 1C) compared to TGIRT and the thermostable superscript IV used in other recent tRNA-seq protocols.</p></disp-quote><p>This issue is broadly addressed in Figures S2-3, where we compare OTTR to a large number of published tRNA-focused sequencing protocols. The specific issue in RT readthrough of yW37 etc. is addressed in our response to Essential Revision 1, above.</p><disp-quote content-type="editor-comment"><p>2. Figure 1: The relative quantification of individual tRNAs needs to be done for reporting any new tRNA-seq method. At the least the authors should compare the yeast OTTR results with that from the mim-tRNA-seq paper.</p></disp-quote><p>Done as requested. Addressed in Figures S2-3.</p><disp-quote content-type="editor-comment"><p>3. Figure 2: 2A and B show that Lys-CTT has starts near the anticodon loop at t6A, indicating fragments. But this effect is eliminated by trm1 deletion. An alternative from 5' fragments is that the RT reinitiates downstream of a stop induced by a m22G or t6A modification.</p></disp-quote><p>I am not sure what is requested here. Our original contention was that these are premature RT stops (not RT reinitiation), not biological fragments, which I believe is roughly consistent with what the reviewer believes as well?</p><disp-quote content-type="editor-comment"><p>4. RNA and read lengths appear inconsistent. First, from figure 1A, is miRvana the best source for capturing small tRNA fragments? More 30-nt material is retained with gel purification. Further, the insert sizes between figures 1A, 3B and 4A are confusing. 1A suggests majority full length tRNA, while figures 3B and 4A crop out this size of read, preventing comparison of relative levels of fragment and full length tRNA. Additionally, figure 1C suggests that Serine and leucine tRNAs are not captured faithful as full length. This could be due to these tRNAs being type II (~90nt long) but sequenced with only 75bp Illumina reads.</p></disp-quote><p>Regarding the miRvana question: we find that, surprisingly, gel purification of full length tRNAs prior to cloning results in more tRNA fragmentation than does simple miRvana size selection. Although counterintuitive – why should more stringent size selection lead to more variable RNA lengths? – this has been seen by other investigators as well (via personal communication – not sure I can find a citation), and our empirical evidence is very clear on this point.</p><p>Regarding the insert sizes in Figures 1A vs 3B and 4A: Figures1-2 focus on full length tRNA sequencing libraries, while Figures3-4 focus on small RNA sequencing libraries. The size distributions reflect the intended goal of the dataset in question.</p><p>Finally, the serine and leucine comment is spot on – in new Figure S1B we show that serine and leucine tRNAs are underrepresented as a result of our use of 75 bp Illumina sequencing reads, which fail to read all the way through these longer tRNAs. This was an unfortunate oversight on our part, and is now noted in the revised manuscript.</p><disp-quote content-type="editor-comment"><p>5. Can OTTR actually distinguish between 3' tRNA fragment and RT stops? Figure 1B is the strongest evidence to distinguish, and my reading is that reads mapping only to the 3' half must be fragments since this method doesn't suffer from RT stops. This reasoning is insufficient to interpret 3' fragments in unknown biological systems, which severely limits the utility of this exciting approach.</p></disp-quote><p>See response to Essential Revision 2, above.</p><disp-quote content-type="editor-comment"><p>6. The biological advances of this work are unclear. The primary biological discovery presented is that the suite of small RNAs in mouse testis/sperm is different from previous measurements. Even for this result no Northern blot validation is provided for the OTTR data.</p></disp-quote><p>The presence of 3’ tRNA fragments in sperm was previously shown by Northern blotting by our group and the Chen group in 2018. The sncRNA payload of mature sperm is of extreme interest to a burgeoning paternal effect community and in our opinion is an extremely important insight. It will certainly be highly cited, anyway.</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>The experimental design for this study was effective in choice of samples and treatments compared. Use of both yeast and mammalian samples that had been previously analyzed was a wise choice by which to observe tRNA pool complexity and misincorporations caused by modifications. We also appreciate the use of tRAX software, which specifically deals with the complexity of misincorporations caused by tRNA modifications, tRNA mapping ambiguity, and differential expression (full disclosure: developed in the Lowe lab). The use of trm1 mutants, inducible RNY1 overexpression, and PNK treatment were all effective experimental contexts showing the relative performance of the various sequencing methods tested. Some readers may feel the study was a bit limited in scope in that it did not do direct sample comparisons with the other leading methods for analyzing full length tRNAs (DM-tRNA-seq, mim-tRNA-seq and/or YAMAT-seq), relying instead on data previously published by other groups. However, in the authors' prior studies, they focused heavily on tRNA fragments in the mouse germline and utilized traditional small RNA-seq methods like TruSeq, which yielded very high-profile results based on high abundance of 5' halves of only a handful of tRNAs. This new study successfully argues the importance of re-examining those prior results given the effectiveness of this new generation of sequencing methods. OTTR-seq is arguably at the front of these newer methods, given its flexibility to measure both tRNAs and tRNA-derived small RNAs at the same time, both in terms of abundance and the misincorporations caused by Watson-Crick face interfering modifications. If all future tRNA-seq studies used OTTR-seq (or equally well performing methods), the tRNA field would take a major step forward.</p><p>Aside from easily addressed issues with figures, the only serious confusion that needs to be addressed is the assessment or interpretation of &quot;early termination&quot; sequencing reads. An analysis of premature termination was shown in Figure 1, yet by our understanding, OTTR-seq must reach the end of its RNA template to &quot;jump&quot; to the second adapter, in order to be sequenced (unlike TruSeq or DM-tRNA-seq, which allows the second linker to be added after premature termination of cDNA synthesis). Thus, this may actually be analysis of slightly shortened RNA molecules due to RNA degradation or exonucleases, not premature cDNA extension. This distinction should be clarified in the manuscript for all methods discussed, as other methods such as NEBNext and ARM-seq also do not produce any sequencing reads for early-termination products (both adapters are ligated on to the RNA at the very beginning).</p><p>Overall, this is a convincing first study profiling an important new method that will clearly improve our ability to measure and understand tRNA dynamics and complexity in the cell.</p><p>We found quite a few technical issues that need to be addressed, particularly with the figures, but also with other missing details. We believe the results are sound, but in the manuscript's unpolished data presentation state, it was often difficult or frustrating to try to follow the analyses. We hope these suggestions are helpful in strengthening the clarity and overall impact of the study.</p><p>In general, figure axes need to be systematically fixed throughout. Often axes labels are missing or not explained, or the formatting makes them unreadable or overlapping the graphs.</p></disp-quote><p>We have attempted to fix these issues throughout.</p><disp-quote content-type="editor-comment"><p>Supplemental Table S1 appears to be missing, making it difficult to find the datasets produced in this study.</p></disp-quote><p>Fixed.</p><disp-quote content-type="editor-comment"><p>What are the accession numbers of the data analyzed from prior studies? Others will not be able to reproduce/verify these external data analyses without full details in the methods.</p></disp-quote><p>Added as requested (Comparison to published datasets, Methods).</p><disp-quote content-type="editor-comment"><p>Failed replicate: For the data shown in Figure 2D (yeast, full length tRNA mismatch data), there are 2 biological WT replicates, but only 1 valid biological Trm1(-/-) replicate (we checked, the other replicate had almost no reads in the deposited data file and was essentially a failed library). The single replicate did support the observations in the paper that the Trm1(-/-) leads to loss of misincorporation at position 26, so no serious concern with the results, but there should be a note that the second replicate essentially failed (and that failed sample removed from GEO).</p></disp-quote><p>Altered as requested.</p><disp-quote content-type="editor-comment"><p>Question regarding size selections: Figure 1A shows a wide size range, even after gel-purification, which is attributed to RNA fragmentation. However, shouldn't the second gel purification at the cDNA stage (to remove dimers), remove the short fragments (and at this stage, it's DNA, so should not fragment). This suggests a potential issue with gel sizing. Perhaps the authors can clarify why so many short reads are still found after two rounds of sizing (the second at the cDNA stage).</p></disp-quote><p>We do not exactly understand why shorter reads persist through the double size selection. Our only hypothesis is that the persistence of short molecules through the second size selection step arises from the distribution of molecules of a given size during gel electrophoresis – eg if one were to run a pure 100 bp DNA on a gel and cut out the gel corresponding to 70-80 bp DNA, some subset of the 100 bp molecules would nonetheless be isolated as DNA migration through a gel results in a band which represents the center of a distribution. As far as the issue with double size selection, it is very clear in our data that a first size selection step counterintuitively leads to increased RNA fragmentation, and this has been informally confirmed by many of our colleagues. We feel the point is important to make here.</p><disp-quote content-type="editor-comment"><p>Concern with definition of &quot;full-length&quot; tRNA reads and early termination: we suggest the cutoff for counting a full-length read is too strict. It appears that if the read doesn't extend ALL the way to position 1 it is deemed a &quot;partial-length&quot; read. For example, with how the OTTR enzyme works, some of these &quot;partial-length&quot; reads ending near the 5' end of the tRNA are probably bioinformatic artifacts (where the additional 5'nt in the OTTR reads were skipped and thus a trimming of the 1st base in the tRNA sequence). With how we understand OTTR works, it should NOT jump to the other adapter in the case of a stop due to a tRNA modification. It could be that these truncated tRNAs are in fact being degraded and the reads are reflective of those intermediate degradation products, instead of due to modifications causing pre-mature stops. This is a very important point to address carefully, as the community may be led to believe, incorrectly, that OTTR produces reads with early RT ends.</p></disp-quote><p>This is related to the concern in Essential Revision 1, and addressed there: we would love to be able to show a gel of the cDNA from the first RT step, but the input levels for OTTR are so low that the cDNA in these gels is invisible.</p><disp-quote content-type="editor-comment"><p>With this issue in mind, Figures 1B-1F are probably no longer justified or should be moved to the Supplement (after re-interpreting the results) because the cause of the shorter reads for OTTR-seq is ambiguous (purification issues, degradation during the library prep?). If new graphs like these are created here or elsewhere, axes need to be labeled.</p><p>Case in point: In Figures 2A and 2B, many of the strongest known &quot;stop&quot;-inducing modifications do NOT appear to cause drop-offs (early termination) of reads. This should have been a huge red flag that shorter OTTR-seq reads are NOT caused by early RT termination. To be clear, the RT reaction *may* be stopped, but you will NOT see those reads in the OTTR-seq output, because you will not have a second adapter added on to the end, required for PCR amplification.</p></disp-quote><p>We would be willing to move these figures to the Supplement but it is our strong preference that they remain, with the new suitably modified text more extensively describing potential interpretations.</p><disp-quote content-type="editor-comment"><p>In Figure 2C-2F, these plots actually aren't that helpful because there is way too much data shown. No axes labels in 2D-2F are large enough to read. Everything is packed in, thus making it too busy and hard to understand. The comparison of 2C to 2D is very difficult because they are different sizes. The color labeling of the tRNAs is not useful at this small scale. 2D could be shown in a box plot, showing lack of misincorporation at just this position across most tRNAs. The tRNA position these diamonds correspond to is not useful unless modifications are labeled and lined up in the same (legible) figure. 2F, which has the bulk of the modification information, is very very difficult to get useful information from, as it's unclear exactly what it's showing.</p></disp-quote><p>We respectfully disagree with these comments. Highlighting aspects of genome-wide datasets typically includes showing individual examples of sequencing reads or of specific species (as in Figure 2A), and then showing the entire dataset in various summary figure panels (as in Figures 2C-D), and specific cross sections of the dataset (as in Figure 2F). We are unsure why the reviewer thinks that “it’s unclear exactly what [Figure 2F is] showing” – the figure legend makes it very clear? We actually feel Figure 2F precisely addresses the reviewer’s concern about Figures 2C-D being too dense, so this overall comment strikes us as a little bit self-contradictory?</p><disp-quote content-type="editor-comment"><p>We highly recommend just using the corresponding tRAX output files which show the results much more cleanly and clearly – here is how much clearer this data could be displayed, just by using the default output files in tRAX:</p><p>https://www.dropbox.com/s/tlea5q66ng5jbu1/Figre2C-F-from-tRAX.pdf?dl=0</p></disp-quote><p>We respectfully disagree that standard tRAX outputs are clearer – we find the dots too small, and the graph paper lines everywhere on some of the plots are distracting and make the data difficult to see. Our choices of visual presentation are more consistent with our preferences in terms of being able to visually absorb data.</p><disp-quote content-type="editor-comment"><p>Fairness in tRF sequencing method comparisons: All of the direct abundance comparisons with other methods are ones that do NOT involve PNK or AlkB treatment prior to library generation. This is going to lead to VASTLY different tRF/tDR pools due to these factors alone. Thus, this is something of a straw-man comparison because more quantitative tDR sequencing methods have been in use (ARM-seq/PANDORA-seq) that would be more fair comparisons to the current state-of-the-art. We do not recommend removing this data or the comparisons, but we do believe that these differences in library prep (with &quot;pre-2015&quot; technology) should be clearly represented as weaker than other existing methods not tested. There was acknowledgement that newer methods like mim-tRNA-seq give roughly as good performance as OTTR-seq, but the same should be mentioned that newer tDR/tRF sequencing methods get much closer to OTTR-seq than those done in this study. That said, OTTR-seq gives you the best of both full-length and tDR/tRF sequencing in one go – which is really the quality that makes it outshine all other methods, from our perspective (which is not emphasized enough in our humble opinion).</p></disp-quote><p>This is now addressed in Figures S2-3 and revised Results and Discussion.</p><disp-quote content-type="editor-comment"><p>While comparing across multiple types of other kinds of sequencing (experiments not carried out in this study), is it fair to make these comparisons when the data is also from multiple source types (Figure S2)? YAMAT and Hydro-seq are thrown into the same context of the other sequencing library preps under the umbrella of &quot;extensive premature RT terminations&quot;, however, Hydro-tRNA-seq and ARM-seq can't produce sequencing reads with RT stops since they ligate 5' and 3' adapters prior to RT. YAMAT is given the appearance that it reads through tRNAs, but again, it only reads through the ones where the RT reaches the 5' adapter (thus you can't measure the true rate of RT stops because those stops, which do happen, are never observed in the seq data). The only library preps that could show RT-stops in this collection are QuantM and DM-tRNA-seq, from our understanding of the library prep protocols. Also, what exact data is being used here to assess these other methods? Some of these techniques have used both AlkB treated, and untreated. Did you use the AlkB+ samples in the datasets, or did you use -AlkB. This is never mentioned. All of these data sources and exactly which samples were used need to be specified clearly. These comparisons are extremely tricky, especially considering some of these methods were not designed to read full-length tRNAs, so doing direct comparisons and attributing differences to inefficient read-through of stops should be done with more care, separating the methods by their intended purposes.</p></disp-quote><p>Addressed in Figures S2-3 and revised Results and Discussion.</p><disp-quote content-type="editor-comment"><p>Suggestions for improving Figure 3: Figure 3C could be presented more clearly with something like a stacked bar plot. It is hard to digest the changes with multiple bars for each isotype (just merge them unless a claim is made about a specific isotype/isodecoder). Additionally, it's not clear that the Y-axis metric being used (read count/1000) is the best for trying to compare these data across methods with such disparate scales. One can see that Gly has more reads in the NEB data than the others, but the other isotypes are very hard to compare at these scales (other than to see that they are different). 3D and 3E: Why is Fu_r1 shown as well as Fu_r2 (which look identical)?? And only Fu2018_r2 shown in 3C? (labeling inconsistency, BTW – 2018 included in one label but not the other). Figures 3D and 3E have axes that are impossible to read. Also, the Green/Red color coding for Starts and Stops seem to be backwards. RT-based sequencing reads &quot;Start&quot; at the 3' ends of tRNAs, and &quot;End&quot; towards the 5' end of the tRNA. These are labeled as being reads, so green should presumably be start, and red as stops. If instead you wish to present it in terms of tRNA coordinates (not the RT reaction which produces the read data), then the left most end would be green (start), and the right most would be red (stop) – this is counterintuitive because I (and most) know how cDNA reads are generated from RNA, but either way, Start as red and stop as green is really confusing.</p></disp-quote><p>We have removed the redundant Fu_2018 libraries from Figure 3D-E. As far as the axes on these figures, the goal of the figure panel is to show the “shape” of sequencing reads across the tRNA – the y axis could almost be considered arbitrary units in terms of the desired information transfer here. We do not think adding 6 point font “1000”s and so forth all over these graphs would improve the legibility of the figure. As for the red and green, the reviewer makes a reasonable point but correctly highlights the issue – we are using “start” and “stop” relative to the tRNA coordinate, while sequencing read starts and stops are inverted. As far as the red and green they were not actually chosen based on traffic signals, we apologize for this confusing choice – if the editors find this important we can change the color scheme but we feel it is a minor issue requiring substantial work to deal with and so have left the colors intact in this revised manuscript.</p><disp-quote content-type="editor-comment"><p>Figure 3 and Supplemental Figure 4: Is this data using NEB with UMI? The NEB kit mentioned doesn't come with a UMI containing adapter, let alone two UMI containing adapters, as far as we know. Are these the adapters from the Fu 2018 protocol? If not, what are the adapters that are used? What size are the UMIs? This can greatly affect the amount of deduplication.</p></disp-quote><p>Addressed in the revised Methods.</p><disp-quote content-type="editor-comment"><p>Suggestions for improving Figure 4: In Panel A, the different colored bars are nearly impossible to tell the difference between them. These would be better presented with another method. For Panel B, it is surprising so many ncRNAs are lumped into &quot;other&quot;. For a useful comparison, it would be helpful to break out at least snoRNAs and miRNAs (and possibly snRNAs), as the recovery rate of these other small RNAs directly affect competition with tRNAs, and they are processed in the cell differently. Panel C is confusing because the X-axis is numbered but the colors are for the different isotypes. What are the numbers on the x-axis for? (this extends to figures S4 and S6). In Panel D, the naming convention for the tRNAs is inconsistent with the other figures (e.g. &quot;Gly-GCC&quot; in Figure 4 vs &quot;tRNA-Gly-GCC&quot; in other figures). Exactly how were the plots in Figure 4 created? Were UMI used? Without legible scales, we are just looking at shapes, which can be deceiving for very high or low abundance tRFs/tDRs.</p></disp-quote><p>For Figure 4B, the goal is to focus on the tRNA and rRNA fragments, which increase in abundance following PNK treatment to resolve cyclic 2’-3’ phosphates produced by RNaseA/T family enzymes. snoRNAs and miRNAs in sperm are not subject to such cleavage. We have removed the x axis numbers in Figure 4C as requested. We have fixed the tRNA labeling in panel D as requested. We have clarified the data used throughout this figure, as requested. Finally, if the editors wish we can increase the font size on the panel D y axes but as mentioned above we think having lots of six point numbers showing on the number of panels here would be distracting, and we actually think the goal here is precisely to “just look at shapes”. For the reviewer’s information however these are among the more abundant tRFs in the Truseq and NEB datasets, as they exhibit such limited complexity (eg Figure 4C) that most other species are indeed very low abundance and extremely noisy-looking.</p><disp-quote content-type="editor-comment"><p>Figure S4 panel B it also appears that the 5' and 3' colors in the legend are flipped (?) – aside from this, it is very hard to gain useful information from Figure S4B, perhaps it could be presented in a better way?</p></disp-quote><p>Unclear why the reviewer thinks the colors are flipped here? We agree that this (now Figure S4D) is not easy to extract specific data points from, but the purpose of the figure is to show differences in complexity (eg sparse bars in the top panel compared to a forest of bars for OTTR) and bias towards specific tRNA ends (bars of both colors in OTTR). Which we believe is indeed communicated in the figure as it stands. Also, we cannot think of a better visualization for this point. The figure panel could be deleted but we feel it does add a tiny bit to the manuscript so prefer to keep it.</p><disp-quote content-type="editor-comment"><p>Data Analysis Issues: We downloaded the submitted GEO data, and noted that the naming conventions in the datasets are very confusing (yeast_17_miRvana), instead of giving clear info about the actual sample (and we can't seem to find any metadata for these, had to guess, making reproducing the analyses extremely difficult). Additionally, we find the description of the methods for read processing incomplete. Again, it is unclear how long the UMIs used were. Any special parameters for read processing (trimming extra bases in OTTR-seq reads) are also omitted, again making it very difficult for others to reproduce the results.</p></disp-quote><p>We have updated the metadata as requested, as well as attempting to make the dataset titles more intuitive.</p></body></sub-article></article>