<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.2 20190208//EN"  "JATS-archivearticle1-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">78915</article-id><article-id pub-id-type="doi">10.7554/eLife.78915</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Biochemistry and Chemical Biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Tissue-specific mitochondrial HIGD1C promotes oxygen sensitivity in carotid body chemoreceptors</article-title></title-group><contrib-group><contrib contrib-type="author" equal-contrib="yes" id="author-296162"><name><surname>Timón-Gómez</surname><given-names>Alba</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-275017"><name><surname>Scharr</surname><given-names>Alexandra L</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-275018"><name><surname>Wong</surname><given-names>Nicholas Y</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275019"><name><surname>Ni</surname><given-names>Erwin</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-100177"><name><surname>Roy</surname><given-names>Arijit</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275020"><name><surname>Liu</surname><given-names>Min</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275021"><name><surname>Chau</surname><given-names>Julisia</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275022"><name><surname>Lampert</surname><given-names>Jack L</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-5367-7707</contrib-id><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275023"><name><surname>Hireed</surname><given-names>Homza</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275024"><name><surname>Kim</surname><given-names>Noah S</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con10"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275025"><name><surname>Jan</surname><given-names>Masood</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con11"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275026"><name><surname>Gupta</surname><given-names>Alexander R</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con12"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275027"><name><surname>Day</surname><given-names>Ryan W</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="fn" rid="con13"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-275028"><name><surname>Gardner</surname><given-names>James M</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con14"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-69244"><name><surname>Wilson</surname><given-names>Richard JA</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-9942-4775</contrib-id><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="other" rid="fund5"/><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con15"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-57101"><name><surname>Barrientos</surname><given-names>Antoni</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-9018-3231</contrib-id><email>abarrientos@med.miami.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund6"/><xref ref-type="fn" rid="con16"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-274468"><name><surname>Chang</surname><given-names>Andy J</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-1247-4794</contrib-id><email>Andy.Chang@ucsf.edu</email><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund8"/><xref ref-type="other" rid="fund7"/><xref ref-type="fn" rid="con17"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02dgjyy92</institution-id><institution>Department of Neurology, University of Miami</institution></institution-wrap><addr-line><named-content content-type="city">Miami</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/043mz5j54</institution-id><institution>Department of Physiology and Cardiovascular Research Institute, University of California, San Francisco</institution></institution-wrap><addr-line><named-content content-type="city">San Francisco</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03yjb2x39</institution-id><institution>Department of Physiology and Pharmacology, University of Calgary</institution></institution-wrap><addr-line><named-content content-type="city">Calgary</named-content></addr-line><country>Canada</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03yjb2x39</institution-id><institution>Hotchkiss Brain Institute, University of Calgary</institution></institution-wrap><addr-line><named-content content-type="city">Calgary</named-content></addr-line><country>Canada</country></aff><aff id="aff5"><label>5</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03yjb2x39</institution-id><institution>Alberta Children's Hospital Research Institute, University of Calgary</institution></institution-wrap><addr-line><named-content content-type="city">Calgary</named-content></addr-line><country>Canada</country></aff><aff id="aff6"><label>6</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/043mz5j54</institution-id><institution>Department of Surgery, University of California, San Francisco</institution></institution-wrap><addr-line><named-content content-type="city">San Francisco</named-content></addr-line><country>United States</country></aff><aff id="aff7"><label>7</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/043mz5j54</institution-id><institution>Diabetes Center, University of California, San Francisco</institution></institution-wrap><addr-line><named-content content-type="city">San Francisco</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Paterson</surname><given-names>David J</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/052gg0110</institution-id><institution>University of Oxford</institution></institution-wrap><country>United Kingdom</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Malhotra</surname><given-names>Vivek</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03kpps236</institution-id><institution>The Barcelona Institute of Science and Technology</institution></institution-wrap><country>Spain</country></aff></contrib></contrib-group><author-notes><fn fn-type="con" id="equal-contrib1"><label>†</label><p>These authors contributed equally to this work</p></fn></author-notes><pub-date publication-format="electronic" date-type="publication"><day>18</day><month>10</month><year>2022</year></pub-date><pub-date pub-type="collection"><year>2022</year></pub-date><volume>11</volume><elocation-id>e78915</elocation-id><history><date date-type="received" iso-8601-date="2022-03-24"><day>24</day><month>03</month><year>2022</year></date><date date-type="accepted" iso-8601-date="2022-10-17"><day>17</day><month>10</month><year>2022</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint at bioRxiv.</event-desc><date date-type="preprint" iso-8601-date="2021-10-05"><day>05</day><month>10</month><year>2021</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2021.10.04.463079"/></event></pub-history><permissions><copyright-statement>© 2022, Timón-Gómez, Scharr, Wong et al</copyright-statement><copyright-year>2022</copyright-year><copyright-holder>Timón-Gómez, Scharr, Wong et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-78915-v3.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-78915-figures-v3.pdf"/><abstract><p>Mammalian carotid body arterial chemoreceptors function as an early warning system for hypoxia, triggering acute life-saving arousal and cardiorespiratory reflexes. To serve this role, carotid body glomus cells are highly sensitive to decreases in oxygen availability. While the mitochondria and plasma membrane signaling proteins have been implicated in oxygen sensing by glomus cells, the mechanism underlying their mitochondrial sensitivity to hypoxia compared to other cells is unknown. Here, we identify HIGD1C, a novel hypoxia-inducible gene domain factor isoform, as an electron transport chain complex IV-interacting protein that is almost exclusively expressed in the carotid body and is therefore not generally necessary for mitochondrial function. Importantly, HIGD1C is required for carotid body oxygen sensing and enhances complex IV sensitivity to hypoxia. Thus, we propose that HIGD1C promotes exquisite oxygen sensing by the carotid body, illustrating how specialized mitochondria can be used as sentinels of metabolic stress to elicit essential adaptive behaviors.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>oxygen sensing</kwd><kwd>mitochondria</kwd><kwd>carotid body</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Human</kwd><kwd>Mouse</kwd><kwd>Rat</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100005202</institution-id><institution>Muscular Dystrophy Association</institution></institution-wrap></funding-source><award-id>Career Development Award 862896</award-id><principal-award-recipient><name><surname>Timón-Gómez</surname><given-names>Alba</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>UCSF Transplant T32 FAVOR Grant P0548805</award-id><principal-award-recipient><name><surname>Scharr</surname><given-names>Alexandra L</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100008069</institution-id><institution>University of California, San Francisco</institution></institution-wrap></funding-source><award-id>Physician-Scientist Scholars Program</award-id><principal-award-recipient><name><surname>Gardner</surname><given-names>James M</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000024</institution-id><institution>Canadian Institutes of Health Research</institution></institution-wrap></funding-source><award-id>Research Grant 201603PJT/366421</award-id><principal-award-recipient><name><surname>Wilson</surname><given-names>Richard JA</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000145</institution-id><institution>Alberta Innovates - Health Solutions</institution></institution-wrap></funding-source><award-id>Senior Scholar</award-id><principal-award-recipient><name><surname>Wilson</surname><given-names>Richard JA</given-names></name></principal-award-recipient></award-group><award-group id="fund6"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000057</institution-id><institution>National Institute of General Medical Sciences</institution></institution-wrap></funding-source><award-id>R35 Grant GM118141</award-id><principal-award-recipient><name><surname>Barrientos</surname><given-names>Antoni</given-names></name></principal-award-recipient></award-group><award-group id="fund7"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100008069</institution-id><institution>University of California, San Francisco</institution></institution-wrap></funding-source><award-id>Sandler Program for Breakthrough Biomedical Research New Frontier Award</award-id><principal-award-recipient><name><surname>Chang</surname><given-names>Andy J</given-names></name></principal-award-recipient></award-group><award-group id="fund8"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100008069</institution-id><institution>University of California, San Francisco</institution></institution-wrap></funding-source><award-id>Cardiovascular Research Institute</award-id><principal-award-recipient><name><surname>Chang</surname><given-names>Andy J</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>An atypical configuration of mitochondrial electron transport chain proteins may underlie the exquisite sensitivity of the carotid body to small decreases in oxygen availability.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>The carotid bodies (CBs), located at the bifurcation of the common carotid arteries, are the major chemoreceptor for blood oxygen in mammals (<xref ref-type="bibr" rid="bib11">De Castro, 1928</xref>; <xref ref-type="bibr" rid="bib29">Heymans et al., 1930</xref>). Within seconds of exposure to hypoxia (reduction in PaO<sub>2</sub> from 100 mmHg to below 80 mmHg), CB glomus cells signal to afferent nerves projecting to the brainstem to stimulate acute cardiorespiratory and/or arousal reflexes (<xref ref-type="bibr" rid="bib5">Black et al., 1971</xref>; <xref ref-type="bibr" rid="bib35">Lahiri and DeLaney, 1975a</xref>; <xref ref-type="bibr" rid="bib36">Lahiri and DeLaney, 1975b</xref>; <xref ref-type="bibr" rid="bib46">Neil and O’Regan, 1971</xref>; <xref ref-type="bibr" rid="bib68">Verna et al., 1975</xref>; reviewed in <xref ref-type="bibr" rid="bib10">Chang, 2017</xref>; <xref ref-type="bibr" rid="bib12">De Castro, 2009</xref>; <xref ref-type="bibr" rid="bib34">Kumar and Prabhakar, 2012</xref>; <xref ref-type="bibr" rid="bib47">Ortega-Sáenz and López-Barneo, 2020</xref>). These acute reflexes are essential for optimizing tissue oxygenation of vital organs, including the brain, heart, and kidneys. However, in chronic conditions such as sleep-disorder breathing, hypertension, chronic heart failure, airway constriction, and metabolic syndrome, the CB becomes hyperactive, leading to exaggerated responses to hypoxia and sympathetic overactivity. Under these pathological conditions, suppressing CB activity improves causal symptoms such as hypertension (<xref ref-type="bibr" rid="bib1">Abdala et al., 2012</xref>; <xref ref-type="bibr" rid="bib14">Del Rio et al., 2016</xref>; <xref ref-type="bibr" rid="bib22">Fletcher et al., 1992</xref>; <xref ref-type="bibr" rid="bib45">Narkiewicz et al., 2016</xref>), cardiac arrhythmias (<xref ref-type="bibr" rid="bib13">Del Rio et al., 2013</xref>; <xref ref-type="bibr" rid="bib40">Marcus et al., 2014</xref>), and insulin resistance (<xref ref-type="bibr" rid="bib52">Ribeiro et al., 2013</xref>; <xref ref-type="bibr" rid="bib54">Sacramento et al., 2017</xref>). Thus, understanding the fundamental mechanisms of oxygen sensing in the CB is of considerable scientific and medical importance.</p><p>In a long-standing model, acute oxygen sensing in the CB is proposed to be mediated by the mitochondrial electron transport chain (ETC) in glomus cells (<xref ref-type="bibr" rid="bib10">Chang, 2017</xref>; <xref ref-type="bibr" rid="bib31">Holmes et al., 2018</xref>; <xref ref-type="bibr" rid="bib47">Ortega-Sáenz and López-Barneo, 2020</xref>). In his discovery of the CB as a chemoreceptor in the 1920s, Corneille Heymans utilized cyanide to inhibit ETC complex IV (CIV) and mimic the effect of hypoxia (<xref ref-type="bibr" rid="bib30">Heymans, 1963</xref>). More recently, genetic approaches in mice found that knockout of two ETC subunit genes attenuates CB sensory activity: the mitochondrial respiratory chain complex I (CI) core subunit <italic>Ndufs2</italic> and the HIF2A-regulated mitochondrial respiratory chain CIV subunit <italic>Cox4i2</italic> (<xref ref-type="bibr" rid="bib20">Fernández-Agüera et al., 2015</xref>; <xref ref-type="bibr" rid="bib44">Moreno-Domínguez et al., 2020</xref>). <italic>Ndufs2</italic> is ubiquitously expressed and essential for CI activity, whereas <italic>Cox4i2</italic> expression is limited to several tissues, including the lung, placenta, heart, tongue, breast, and adipose tissue (<xref ref-type="bibr" rid="bib56">Shen et al., 2012</xref>; <xref ref-type="bibr" rid="bib67">Uhlén et al., 2015</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A–D</xref>). These results are accompanied by the observations that the ETC of glomus cells is more sensitive to hypoxia compared to other cell types (<xref ref-type="bibr" rid="bib7">Buckler and Turner, 2013</xref>; <xref ref-type="bibr" rid="bib15">Duchen and Biscoe, 1992a</xref>; <xref ref-type="bibr" rid="bib16">Duchen and Biscoe, 1992b</xref>; <xref ref-type="bibr" rid="bib23">Forster, 1968</xref>; <xref ref-type="bibr" rid="bib32">Jobsis, 1968</xref>) and the proposal that an unusual CIV contributes to oxygen sensitivity of the CB (<xref ref-type="bibr" rid="bib42">Mills and Jöbsis, 1970</xref>; <xref ref-type="bibr" rid="bib43">Mills and Jöbsis, 1972</xref>). However, given the breadth of <italic>Cox4i2</italic> expression, it remains unclear whether HIF2a regulation of <italic>Cox4i2</italic> is solely responsible for the exquisite sensitivity of glomus cell mitochondria to hypoxia compared to other tissues.</p><p>Here, we identify HIGD1C as a novel mitochondrial protein associated with ETC CIV that is almost exclusively expressed in the CB. HIGD1C is critical in mediating CB oxygen sensing and metabolic responses to hypoxia in mice. In heterologous cell culture, we demonstrate that HIGD1C regulates the activity and conformation of CIV, and when co-expressed with COX4I2, HIGD1C enhances the oxygen sensitivity of CIV to hypoxia. We propose that HIGD1C and COX4I2 comprise key components bestowing CB glomus cell mitochondria with their extreme oxygen sensitivity.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>HIGD1C is a novel mitochondrial protein expressed in CB glomus cells</title><p>CB sensory activity correlates with changes in ETC activity (<xref ref-type="bibr" rid="bib10">Chang, 2017</xref>; <xref ref-type="bibr" rid="bib31">Holmes et al., 2018</xref>; <xref ref-type="bibr" rid="bib47">Ortega-Sáenz and López-Barneo, 2020</xref>). Therefore, we sought to identify proteins that are specifically expressed in mitochondria in the CB and are highly sensitive to changes in oxygen availability. Using whole-genome expression data from RNAseq, we looked for genes encoding putative mitochondrial proteins that are overexpressed in the adult mouse CB compared to the adrenal medulla, a similar but less oxygen-sensitive tissue (<xref ref-type="bibr" rid="bib9">Chang et al., 2015</xref>). We found that three such genes, <italic>Higd1c, Cox4i2,</italic> and <italic>Ndufa4l2</italic>, were expressed at higher levels in the mouse CB (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). The expression of <italic>Cox4i2</italic> and <italic>Ndufa4l2</italic> in the CB is found in glomus cells and regulated by <italic>Hif2a</italic>, a hypoxia-inducible transcription factor critical for CB development and function (<xref ref-type="bibr" rid="bib39">Macias et al., 2018</xref>; <xref ref-type="bibr" rid="bib44">Moreno-Domínguez et al., 2020</xref>; <xref ref-type="bibr" rid="bib72">Zhou et al., 2016</xref>). We focused this study on <italic>Higd1c</italic> because it was the most differentially expressed of these genes and one of the top 10 most upregulated genes genome-wide in the mouse CB (<xref ref-type="bibr" rid="bib9">Chang et al., 2015</xref>). RT-qPCR analysis confirmed the enrichment of <italic>Higd1c</italic> as well as <italic>Ndufa4l2</italic> and <italic>Cox4i2</italic> mRNAs in the human CB (<xref ref-type="fig" rid="fig1">Figure 1B</xref>).</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title><italic>Higd1c</italic> expression in carotid body glomus cells is reduced in <italic>Higd1c</italic> CRISPR mutants.</title><p>(<bold>A</bold>) Expression of genes encoding atypical mitochondrial electron transport chain (ETC) subunits in mouse carotid body (CB) versus adrenal medulla (AM) (<xref ref-type="bibr" rid="bib9">Chang et al., 2015</xref>). RPKM, reads per kilobase of transcript, per million reads mapped. n = 3 cohorts of 10 animals each. Data as mean ± SEM. **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001 by two-way ANOVA with Sidak correction. (<bold>B</bold>) Expression of atypical ETC proteins in human CB and adrenal gland (AG). AG, one RNA sample of adrenal glands pooled from 62 individuals. CB, two RNA samples of CBs from two adults. Dotted line, 100% of <italic>GAPDH</italic> expression. Data as mean. (<bold>C</bold>) FLAG-tagged mouse and human HIGD1C (green) overexpressed in HEK293T cells co-localized with the mitochondrial marker HSP60 (red) by immunostaining. DAPI, nuclear marker. Scale bar, 10 µm. (<bold>D, E</bold>) BaseScope in situ hybridization of a wild-type C57BL/6J carotid bifurcation. (<bold>E</bold>) Boxed region from (<bold>D</bold>). SCG, superior cervical ganglion; CA, carotid arteries. Arrowheads, glomus cells. Arrows, SCG neurons. Scale bar, 100 µm (<bold>D</bold>), 10 µm (<bold>E</bold>). (<bold>F</bold>) Expression of <italic>Higd1c</italic> mRNA is reduced in CBs from <italic>Higd1c</italic> mutants measured by RT-qPCR. n = 3–6 samples. Each sample was prepared from 4 CBs/2 animals. Data as mean ± SEM. **p&lt;0.01 by two-way ANOVA with Sidak correction. (<bold>G, H</bold>) Immunostaining of CB glomus cells. TH, tyrosine hydroxylase. DAPI, nuclear marker. Scale bar, 50 µm. (<bold>I</bold>) Quantitation of TH+ cells found no significant differences between CBs from <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals of each allele or between alleles by two-way ANOVA with Sidak correction (p&gt;0.05). n = 5–7 CBs from 3-7 animals. Data as mean ± SEM.</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig1">Figure 1A, B, F, and I</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig1-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig1-v3.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Tissue expression of genes encoding select mitochondrial proteins implicated in carotid body oxygen sensing.</title><p>(<bold>A, B</bold>) Expression of <italic>Ndufs2</italic>, <italic>Cox4i2</italic>, and <italic>Higd1c</italic> in mouse tissues at different developmental stages by RNAseq from the Mouse ENCODE project (<xref ref-type="bibr" rid="bib56">Shen et al., 2012</xref>). RPKM, reads per kilobase of transcript, per million reads mapped. E, embryonic day. (<bold>C, D</bold>) Expression of <italic>NDUFS2</italic>, <italic>COX4I2</italic>, and <italic>HIGD1C</italic> in human tissues by RNAseq from the Human Protein Atlas (<xref ref-type="bibr" rid="bib67">Uhlén et al., 2015</xref>). nTPM, normalized protein-coding transcripts per million. nTPM values that exceed the maximum on the y-axis are denoted above the bars.</p><p><supplementary-material id="fig1s1sdata1"><label>Figure 1—figure supplement 1—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig1-figsupp1-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig1-figsupp1-v3.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 2.</label><caption><title>Generation of <italic>Higd1c</italic> CRISPR/Cas9 mutants.</title><p>(<bold>A</bold>) Schematic representation of mRNA transcripts of <italic>Higd1c</italic> and <italic>Mettl7a2</italic> and a fusion transcript spanning both genes named <italic>Methig1</italic>. Boxes denote exons. Arrow, <italic>Higd1c</italic> translational start site. Two sgRNAs targeting sequences upstream of exon 1 and within exon 3 (first coding exon) of <italic>Higd1c</italic> were injected together with <italic>Cas9</italic> mRNA into C57BL/6J embryos. Six founders were generated, from which eight alleles were identified by sequencing around the sgRNA target sites. Mutant alleles isolated included short indels around the sgRNA target sequence in exon 3 and deletions that spanned the regions between the two guides. FS, frameshift mutation. ø, no transcript or truncated transcript starting in exon 4. (<bold>B</bold>) Genotyping primers for large deletion and small indel <italic>Higd1c</italic> alleles. All mapped mutations abolish a restriction site for <italic>Kpn</italic>2I in exon 3. (<bold>C</bold>) PCR with P11/P8 primer pair used to genotype the large deletion <italic>Higd1c 3-1</italic> allele. PCR with P9/P8 primer pair followed by restriction digest with <italic>Kpn</italic>2I used to genotype small indels in exon 3. (<bold>D</bold>) Expected changes to the amino acid sequence of HIGD1C in mutant alleles.</p><p><supplementary-material id="fig1s2sdata1"><label>Figure 1—figure supplement 2—source data 1.</label><caption><title>Source gels for <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2C</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig1-figsupp2-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig1-figsupp2-v3.tif"/></fig><fig id="fig1s3" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 3.</label><caption><title>Expression of <italic>Higd1c</italic> in mouse tissues.</title><p>(<bold>A–D</bold>) RT-qPCR targeting <italic>Higd1c</italic> mRNA transcripts containing five exons (<bold>A, C</bold>) or four exons (<bold>B, D</bold>) in tissues from <italic>Higd1c 3-1<sup>+/+</sup></italic> and <italic>Higd1c 3-1<sup>-/-</sup></italic> animals. These mRNA isoforms differ from each other only in the first two exons that encode 5′ UTR; the four-exon isoform does not contain exon 2 (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A</xref>). <italic>Higd1c</italic> expression normalized to <italic>Actb</italic> encoding <inline-formula><mml:math id="inf1"><mml:mi>β</mml:mi></mml:math></inline-formula>-actin by template and day of the experiment. Dotted line, 1% of the carotid body (CB) expression level. AM, adrenal medulla; PG/NG/JG, petrosal ganglion/nodose ganglion/jugular ganglion; MO, medulla oblongata; Ctx, cerebral cortex; OB, olfactory bulb; SCG, superior cervical ganglion. For CB, n = 6/12 (<italic>Higd1c 3-1<sup>+/+</sup></italic>) and 5/10 (<italic>Higd1c 3-1<sup>-/-</sup></italic>) samples/animals with four CBs from two animals pooled per sample (<bold>A, B</bold>). For all others, n = 5/5 or 6/6 samples/animals (<bold>A–D</bold>). Data as mean and SEM. ****p&lt;0.0001 by two-way ANOVA with Sidak correction. Because <italic>Actb</italic> expression can vary between tissues, we used <italic>Higd1c 3-1<sup>-/-</sup></italic> tissues carrying a deletion that abolishes one primer target site as a negative control for <italic>Higd1c</italic> expression.</p><p><supplementary-material id="fig1s3sdata1"><label>Figure 1—figure supplement 3—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig1-figsupp3-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig1-figsupp3-v3.tif"/></fig><fig id="fig1s4" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 4.</label><caption><title><italic>Higd1c</italic> is expressed in carotid body glomus cells and kidney proximal tubules.</title><p>(<bold>A–E</bold>) BaseScope in situ hybridization to detect mRNA transcripts in adjacent sections of the carotid bifurcation from a <italic>Higd1c 5-3<sup>+/+</sup></italic> animal (<bold>A–C</bold>) and from <italic>Higd1c 3-1<sup>+/+</sup></italic> (<bold>D</bold>) and <italic>Higd1c 3-1<sup>-/-</sup></italic> (<bold>E</bold>) animals. <italic>dapB</italic> probes are negative controls that target bacterial genes (<bold>A</bold>). <italic>Ppib</italic> and <italic>Polr2a</italic> are positive control probes for mouse transcripts expressed ubiquitously (<bold>B</bold>). Probes that target transcripts for <italic>Higd1c</italic> and tyrosine hydroxylase (<italic>Th</italic>), a marker of glomus cells (<bold>C–E</bold>). The large deletion in the <italic>Higd1c 3-1</italic> allele removes the target sequence of BaseScope probes for <italic>Higd1c</italic> (<bold>E</bold>). Scale bar, 10 µm. (<bold>F</bold>) Staining of the kidney from a wild-type C57BL/6J (B6) animal with fluorescein-conjugated <italic>Lotus tetragonolobus</italic> lectin (LTL) that binds to the apical surface of proximal tubules and an antibody for CD31, a marker of endothelial cells. DAPI, nuclear marker. Scale bar, 50 µm. (<bold>G–J</bold>) BaseScope in situ hybridization to detect mRNA transcripts in sections of the kidney from a wild-type C57BL/6J (B6) animal (<bold>G–I</bold>) and from a <italic>Higd1c 3-1<sup>-/-</sup></italic> mutant (<bold>J</bold>). <italic>dapB</italic> probes are negative controls that target bacterial genes (<bold>G</bold>). <italic>Ppib</italic> and <italic>Polr2a</italic> are positive control probes for mouse transcripts expressed ubiquitously (<bold>H</bold>). Probes that target transcripts for <italic>Higd1c</italic> and tyrosine hydroxylase (<italic>Th</italic>), a marker of glomus cells (<bold>I, J</bold>). The large deletion in the <italic>Higd1c 301</italic> allele removes the target sequence of BaseScope probes for <italic>Higd1c</italic> (<bold>J</bold>). Scale bar, 10 µm. (<bold>K</bold>) Expression of <italic>Higd1c</italic> mRNA is reduced in kidneys from <italic>Higd1c</italic> mutants as measured by qRT-PCR. The target region of one primer of the primer pair is deleted in the <italic>Higd1c 3-1</italic> allele. n = 6 (<italic>3-1</italic>, <italic>5-3</italic>), 12 (<italic>1-1</italic>) kidneys from 6 and 12 animals, respectively. Data as mean ± SEM. ****p&lt;0.0001 by two-way ANOVA with Sidak correction.</p><p><supplementary-material id="fig1s4sdata1"><label>Figure 1—figure supplement 4—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4K</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig1-figsupp4-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig1-figsupp4-v3.tif"/></fig><fig id="fig1s5" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 5.</label><caption><title>Cellular and tissue expression of <italic>Higd1c</italic> in rodents and human.</title><p>(<bold>A</bold>) Expression of select mitochondrial electron transport chain (ETC) subunits by single-cell RNAseq of seven mouse glomus cells from a previously published dataset (<xref ref-type="bibr" rid="bib72">Zhou et al., 2016</xref>). Glomus cell 4 from this study was excluded from analysis because it had little to no expression of genes known to be expressed at high levels in mouse glomus cells, such as <italic>Olfr78</italic>, <italic>Epas1</italic>, <italic>Cox4i2</italic>, and <italic>Ndufa4l2</italic> (<xref ref-type="bibr" rid="bib9">Chang et al., 2015</xref>; <xref ref-type="bibr" rid="bib44">Moreno-Domínguez et al., 2020</xref>). RPKM, reads per kilobase of transcript, per million reads mapped. Data as median and interquartile interval. Dotted line, RPKM level corresponding to no reads. (<bold>B</bold>) Expression in total RNA from rat tissues by RT-qPCR of genes known to be expressed in the carotid body (CB). Two primer sets were used to detect <italic>Higd1c</italic> mRNA (1 = F1/R1, 2 = F1/R2). <italic>Kcnk3</italic> and <italic>Kcnk9</italic> encode TASK-1 and TASK-3 K<sup>+</sup> channels expressed in the CB and adrenal medulla. <italic>Olfr59</italic> is the rat ortholog of mouse <italic>Olfr78</italic>. n = 3 (CB-<italic>Th</italic>), 5 (CB-all other genes), 3 (all other tissues). Data as mean ± SEM. *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001 vs. CB and <italic>#</italic>p&lt;0.05 between adult and neonatal adrenal medulla by two-way ANOVA with Tukey’s test. (<bold>C</bold>) Expression in total RNA from human tissues by RT-qPCR of select mitochondrial ETC subunits and other genes known to be expressed in the CB. Unlike its expression in mice, the tyrosine hydroxylase gene <italic>TH</italic> is expressed in only a subset of glomus cells in the adult human CB (<xref ref-type="bibr" rid="bib18">Fagerlund et al., 2010</xref>; <xref ref-type="bibr" rid="bib48">Otlyga et al., 2021</xref>). The olfactory receptor gene <italic>OR51E2</italic> is the ortholog of mouse <italic>Olfr78</italic>, one of the most highly upregulated genes in the CB versus adrenal medulla in mice (<xref ref-type="bibr" rid="bib9">Chang et al., 2015</xref>). AG, one RNA sample of adrenal glands pooled from 62 males and females, 15–61 years old. CB, two RNA samples of carotid bodies from two transplant donors: a 55-year-old man and a 35-year-old woman. Dotted line, 100% of <italic>GAPDH</italic> expression. Data as the mean.</p><p><supplementary-material id="fig1s5sdata1"><label>Figure 1—figure supplement 5—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig1-figsupp5-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig1-figsupp5-v3.tif"/></fig></fig-group><p><italic>Higd1c</italic> is a novel member of the HIG1 hypoxia-inducible domain gene family that also includes <italic>Higd1a</italic>, <italic>Higd1b</italic>, and <italic>Higd2a. Higd1a</italic> and <italic>Higd2a</italic>, the mammalian orthologs of the yeast respiratory supercomplex factors 1 and 2 (<italic>Rcf1</italic> and <italic>Rcf2</italic>), encode mitochondrial proteins that promote the biogenesis of ETC complexes and their assembly into supercomplexes (<xref ref-type="bibr" rid="bib64">Timón-Gómez et al., 2020a</xref>). To determine the subcellular localization of HIGD1C, we overexpressed FLAG-tagged HIGD1C in HEK293T cells and observed that it co-localizes with the mitochondrial marker HSP60, suggesting that HIGD1C is targeted to mitochondria like HIGD1A and HIGD2A (<xref ref-type="fig" rid="fig1">Figure 1C</xref>).</p><p>Compared to mitochondrial ETC genes previously implicated in CB oxygen sensing (<italic>Ndufs2</italic> and <italic>Cox4i2</italic>), mRNA transcripts for <italic>Higd1c</italic> are minimally detected across mouse and human tissues, with the exception of the mouse kidney (<xref ref-type="bibr" rid="bib2">An et al., 2011</xref>; <xref ref-type="bibr" rid="bib56">Shen et al., 2012</xref>; <xref ref-type="bibr" rid="bib67">Uhlén et al., 2015</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A–D</xref>). We found that <italic>Higd1c</italic> is expressed at 30–600,000-fold higher levels in the CB than in other mouse tissues (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A–D</xref>, <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3A–D</xref>). Within the CB, glomus cells sense hypoxia to stimulate afferent nerves to increase ventilation <xref ref-type="bibr" rid="bib34">Kumar and Prabhakar, 2012</xref>. In situ hybridization showed that <italic>Higd1c</italic> mRNA was localized in the same cells as mRNA for <italic>Th</italic>, a marker of glomus cells (<xref ref-type="fig" rid="fig1">Figure 1D and E</xref>, <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4A–D</xref>), validating single-cell RNAseq findings (<xref ref-type="bibr" rid="bib72">Zhou et al., 2016</xref>; <xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5A</xref>). In the rat, <italic>Higd1c</italic> was also expressed at higher levels in the CB compared to the neonatal and adult adrenal medulla and thoracic spinal cord, which contains a novel central oxygen sensor (<xref ref-type="bibr" rid="bib3">Barioni et al., 2022</xref>; <xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5B</xref>). Additionally, we confirmed the expression of <italic>Higd1c</italic> mRNA in mouse kidney proximal tubules as previously reported (<xref ref-type="bibr" rid="bib61">Suganthan et al., 2014</xref>; <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4F–I</xref>). These results indicate that <italic>Higd1c</italic> is enriched in a population of cells in the CB essential for oxygen sensing.</p><p>To determine whether HIGD1C plays a role in CB oxygen sensing, we generated mutants in <italic>Higd1c</italic> by CRISPR/Cas9 in C57BL/6J mice. We isolated F0 mice that carried large deletions that span upstream sequences through the first coding exon and small indels in the first coding exon (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A–C</xref>). We characterized three alleles representing large deletions (<italic>3-1</italic>) and early frameshift mutations in both frames downstream of the start codon (<italic>1-1</italic> and <italic>5-3</italic>). The <italic>3-1</italic> allele was predicted to either produce no protein or a truncated protein missing the N-terminus while the <italic>1-1</italic> and <italic>5-3</italic> alleles were expected to make truncated proteins with early amino acid changes (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2D</xref>). For all three alleles, heterozygous <italic>Higd1c</italic> mutant mice were fertile, and homozygous mutants were viable and not underrepresented in the progeny (<xref ref-type="table" rid="table1">Table 1</xref>). The large deletion allele <italic>3-1</italic> was used as a negative control in characterizing <italic>Higd1c</italic> expression by RT-qPCR and in situ hybridization because our primers and probes targeted a region that was deleted in this allele (<xref ref-type="fig" rid="fig1">Figure 1F</xref>, <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3A–D</xref>, <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4E and J</xref>). In <italic>1-1</italic> and <italic>5-3</italic> alleles, <italic>Higd1c</italic> mRNA levels were reduced by 40–90% in CBs and kidneys from <italic>Higd1c<sup>-/-</sup></italic> mutants compared to <italic>Higd1c<sup>+/+</sup></italic> animals (<xref ref-type="fig" rid="fig1">Figure 1F</xref>, <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4K</xref>). While we infer that all three alleles alter HIGD1C protein sequence, <italic>Higd1c 1-1</italic> and <italic>5-3</italic> alleles also have reduced levels of HIGD1C, perhaps due to nonsense-mediated mRNA decay.</p><table-wrap id="table1" position="float"><label>Table 1.</label><caption><title>Genotype distribution of progeny from <italic>Higd1c<sup>+/-</sup></italic> × <italic>Higd1c<sup>+/-</sup></italic>crosses.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="top"><italic>Higd1c</italic> allele</th><th align="left" valign="top">N</th><th align="left" valign="top" colspan="3">Frequency of genotype</th><th align="left" valign="top">Chi-square p-value</th></tr></thead><tbody><tr><td align="left" valign="top"/><td align="left" valign="top"/><td align="left" valign="top">+/+</td><td align="char" char="plus" valign="top">+/-</td><td align="char" char="." valign="top">-/-</td><td align="left" valign="top"/></tr><tr><td align="char" char="ndash" valign="top"><italic>3-1</italic></td><td align="char" char="." valign="top">125</td><td align="char" char="." valign="top">0.22</td><td align="char" char="." valign="top">0.48</td><td align="char" char="." valign="top">0.30</td><td align="char" char="." valign="top">0.344</td></tr><tr><td align="char" char="ndash" valign="top"><italic>1-1</italic></td><td align="char" char="." valign="top">233</td><td align="char" char="." valign="top">0.32</td><td align="char" char="." valign="top">0.43</td><td align="char" char="." valign="top">0.25</td><td align="char" char="." valign="top">0.028</td></tr><tr><td align="char" char="ndash" valign="top"><italic>5-3</italic></td><td align="char" char="." valign="top">78</td><td align="char" char="." valign="top">0.24</td><td align="char" char="." valign="top">0.53</td><td align="char" char="." valign="top">0.23</td><td align="char" char="." valign="top">0.891</td></tr></tbody></table></table-wrap></sec><sec id="s2-2"><title>HIGD1C mediates CB sensory and metabolic responses to hypoxia</title><p>To assess whether HIGD1C plays a role in CB oxygen sensing at the whole animal level, we performed whole-body plethysmography on awake, unanesthetized mice. A decrease in arterial blood oxygen stimulates the CB to signal the brainstem to increase ventilation within seconds (<xref ref-type="bibr" rid="bib10">Chang, 2017</xref>; <xref ref-type="bibr" rid="bib34">Kumar and Prabhakar, 2012</xref>; <xref ref-type="bibr" rid="bib47">Ortega-Sáenz and López-Barneo, 2020</xref>). <italic>Higd1c<sup>-/-</sup></italic> mutants of all three alleles had normal ventilation in normoxia but were similarly defective in the hypoxic ventilatory response (<xref ref-type="fig" rid="fig2">Figure 2A–D</xref>, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A–M</xref>). The defects observed in these <italic>Higd1c</italic> alleles were at least as severe as ablation or denervation of the CBs in rodents (<xref ref-type="bibr" rid="bib13">Del Rio et al., 2013</xref>; <xref ref-type="bibr" rid="bib58">Soliz et al., 2005</xref>). By contrast, <italic>Higd1c<sup>-/-</sup></italic> mice maintained robust ventilatory responses to hypercapnia comparable to <italic>Higd1c<sup>+/+</sup></italic> animals (<xref ref-type="fig" rid="fig2">Figure 2E–H</xref>, <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2A–J</xref>). These results suggest that <italic>Higd1c</italic> specifically regulates ventilatory responses to hypoxia.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Ventilatory responses of <italic>Higd1c</italic> mutants to hypoxia and hypercapnia.</title><p>(<bold>A–H</bold>) Respiratory rate (RR), tidal volume (TV), and minute ventilation (MV) (minute ventilation = respiratory rate × tidal volume) by whole-body plethysmography of unrestrained, unanesthetized <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> animals exposed to hypoxia (<bold>A–D</bold>) or hypercapnia (<bold>E–H</bold>). (<bold>D</bold>) Hypoxic response as the percentage change in hypoxia (10% O<sub>2</sub>) versus control (21% O<sub>2</sub>). (<bold>H</bold>) Hypercapnic response as the percentage change in hypercapnia (5% CO<sub>2</sub>) versus control (0% CO<sub>2</sub>). n = 11 (<italic>+/+</italic>), 11 (<italic>-/-</italic>) animals. Data as mean ± SEM. *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001 by two-way repeated-measures ANOVA with Sidak correction (<bold>A–C, E-G</bold>) or unpaired <italic>t</italic>-tests (<bold>D, H</bold>) with Holm–Sidak correction. Ventilatory parameters of <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals in normal air conditions (21% O<sub>2</sub> or 0% CO<sub>2</sub>) were not significantly different (p&gt;0.05). For the hypoxic response (<bold>D</bold>), Cohen’s <italic>d</italic> = 1.24 (RR), 1.20 (TV), 2.13 (MV).</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig2">Figure 2</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig2-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig2-v3.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Ventilatory responses of <italic>Higd1c</italic> mutants to hypoxia.</title><p>Respiratory rate (RR), tidal volume (TV), and minute ventilation (MV) (minute ventilation = respiratory rate × tidal volume) by whole-body plethysmography of unrestrained, unanesthetized <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals. (<bold>A–C</bold>) Time course of experiments on <italic>Higd1c 1-1</italic> allele showing periods of normoxia (Nox, yellow) and hypoxia (Hox, blue). (<bold>D–K</bold>) Ventilation of <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals of <italic>3-1</italic> (<bold>D–G</bold>) and <italic>5-3</italic> alleles (<bold>H–K</bold>) exposed to hypoxia. Hypoxic response as the percentage change in hypoxia (10% O<sub>2</sub>) versus control (21% O<sub>2</sub>) (<bold>G, K</bold>). Ventilatory parameters of <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals in normal air conditions (21% O<sub>2</sub>) are not significantly different (p&gt;0.05). *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001 by two-way repeated-measures ANOVA with Sidak correction (<bold>D–F, H–J</bold>) or unpaired <italic>t</italic>-tests (<bold>G, K</bold>) with Holm–Sidak correction. (<bold>G</bold>) Cohen’s <italic>d</italic> = 1.06 (RR), 1.39 (TV), 1.70 (MV). (<bold>K</bold>) Cohen’s <italic>d</italic> = 1.47 (RR), 1.47 (TV), 1.68 (MV). (<bold>L, M</bold>) Comparison of the hypoxic response of all three alleles of <italic>Higd1c<sup>+/+</sup></italic> (<bold>L</bold>) and <italic>Higd1c<sup>-/-</sup></italic> (<bold>M</bold>) animals. No significant differences were found for any parameter between the alleles by one-way ANOVA with Tukey’s test (p&gt;0.05). (<bold>A–M</bold>) n = 11 (<italic>1-1<sup>+/+</sup></italic>), 11 (<italic>1-1<sup>-/-</sup></italic>), 9 (<italic>3-1<sup>+/+</sup></italic>), 12 (<italic>3-1<sup>-/-</sup></italic>), 11 (<italic>5-3<sup>+/+</sup></italic>), 9 (<italic>5-3<sup>-/-</sup></italic>) animals. Data as mean ± SEM.</p><p><supplementary-material id="fig2s1sdata1"><label>Figure 2—figure supplement 1—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig2-figsupp1-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig2-figsupp1-v3.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Ventilatory responses of <italic>Higd1c</italic> mutants to hypercapnia.</title><p>Respiratory rate (RR), tidal volume (TV), and minute ventilation (MV) (minute ventilation = respiratory rate × tidal volume) by whole-body plethysmography of unrestrained, unanesthetized <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals. (<bold>A–H</bold>) Ventilation of <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals of <italic>3-1</italic> (<bold>A–D</bold>) and <italic>5-3</italic> alleles (<bold>E–H</bold>) exposed to hypercapnia. Hypercapnic response as the percentage change in hypercapnia (5% CO<sub>2</sub>) versus control (0% CO<sub>2</sub>) (<bold>D, H</bold>). Ventilatory parameters in control and hypercapnia and hypercapnic responses of <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals were not significantly different (p&gt;0.05). ****p&lt;0.0001 by two-way repeated-measures ANOVA with Sidak correction (<bold>A–C, E–G</bold>) or unpaired <italic>t</italic>-tests (<bold>D, H</bold>) with Holm–Sidak correction. (<bold>I, J</bold>) Comparison of the hypercapnic response of all three alleles of <italic>Higd1c<sup>+/+</sup></italic> (<bold>I</bold>) and <italic>Higd1c<sup>-/-</sup></italic> (<bold>J</bold>) animals. No significant differences were found for any parameter between the alleles by one-way ANOVA with Tukey’s test (p&gt;0.05). (<bold>A–J</bold>) n = 11 (<italic>1-1<sup>+/+</sup></italic>), 11 (<italic>1-1<sup>-/-</sup></italic>), 9 (<italic>3-1<sup>+/+</sup></italic>), 12 (<italic>3-1<sup>-/-</sup></italic>), 11 (<italic>5-3<sup>+/+</sup></italic>), 9 (<italic>5-3<sup>-/-</sup></italic>) animals. Data as mean ± SEM.</p><p><supplementary-material id="fig2s2sdata1"><label>Figure 2—figure supplement 2—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig2-figsupp2-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig2-figsupp2-v3.tif"/></fig></fig-group><p>Because <italic>Higd1c</italic> was expressed at low levels in the petrosal ganglion and brainstem downstream of the CB in the neuronal circuit (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3A and B</xref>), the reduction in hypoxic ventilatory response in <italic>Higd1c<sup>-/-</sup></italic> mice was most likely due to loss of HIGD1C activity in the CB. When we examined the CB, the number of TH-positive glomus cells from <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals was not significantly different for all three alleles (<xref ref-type="fig" rid="fig1">Figure 1G–I</xref>), and there were no gross morphological abnormalities in mutant CBs. Thus, it is unlikely that the hypoxic ventilatory response defect observed in <italic>Higd1c<sup>-/-</sup></italic> mutants is due to a loss of glomus cells.</p><p>Next, we measured the integrated sensory output from the CB at the level of the carotid sinus nerve (CSN), the nerve that transduces signals from the CB to the brainstem (<xref ref-type="bibr" rid="bib34">Kumar and Prabhakar, 2012</xref>). Baseline CSN activity was similar between <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> tissues (<xref ref-type="fig" rid="fig3">Figure 3A–C</xref>). As oxygen levels were decreased, CSN activity increased in a dose-dependent manner in <italic>Higd1c 1-1<sup>+/+</sup></italic> tissue (<xref ref-type="fig" rid="fig3">Figure 3A and D</xref>). However, while this response to hypoxia was attenuated in CSNs from <italic>Higd1c 1-1<sup>-/-</sup></italic> mutants (<xref ref-type="fig" rid="fig3">Figure 3B and D</xref>), the response to high CO<sub>2</sub>/H<sup>+</sup> was unaffected (<xref ref-type="fig" rid="fig3">Figure 3A–D</xref>). Thus, we conclude that HIGD1C specifically mediates oxygen sensing at the level of the whole CB organ.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title><italic>Higd1c</italic> mutants have defects in carotid body sensory responses to hypoxia.</title><p>(<bold>A, B</bold>) Representative traces of carotid sinus nerve (CSN) activity from <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> tissue preparations exposed to hypoxia (PO<sub>2</sub> ~ 80, 60, and 40 mmHg) or hypercapnia (PCO<sub>2</sub> ~ 60 mmHg) normalized to activity at t = 0. (<bold>C, D</bold>) CSN activity in <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> tissues at baseline (<bold>C</bold>) and in hypoxia and hypercapnia (<bold>D</bold>). Activity in hypoxia and hypercapnia normalized to baseline (<bold>D</bold>). n = 7/5 (<italic>+/+</italic>), 10/6 (<italic>-/-</italic>) preparations/animals. AU, arbitrary units. Data as box plots showing median and interquartile interval. **p&lt;0.01, ***o&lt;0.001 by Mann–Whitney <italic>U</italic>-test with Holm–Sidak correction. (<bold>E, F</bold>) Individual traces of GCaMP fluorescence of glomus cells from <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> animals, in response to low pH (6.8), hypoxia (PO<sub>2</sub> ~ 50 and 25 mmHg), high KCl (40 mM), and cyanide (CN, 1 mM). Data normalized to fluorescence at t = 0 s. Z stacks were collected every 45 s. (<bold>G, H</bold>) Peak (<bold>G</bold>) and mean (<bold>H</bold>) GCaMP calcium responses (F/F0) of glomus cells from <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> animals. n = 296/4/3 (+/+), 201/4/3 (-/-) for pH 6.8, 312/5/4 (+/+), 214/5/4 (-/-) for all other stimuli. n as glomus cells/CBs/animals. Data as box plots showing median and interquartile interval. *p&lt;0.05, ****p&lt;0.0001 by Mann–Whitney <italic>U</italic>-test with Holm–Sidak correction.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig3">Figure 3C, D, G and H</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig3-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig3-v3.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Calcium responses of <italic>Higd1c 1-1</italic> glomus cells to hypoxia.</title><p>(<bold>A</bold>) Time course of GCaMP fluorescence of glomus cells from <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals, in response to low pH (6.8), hypoxia (PO<sub>2</sub> ~ 50 and 25 mmHg), high KCl (40 mM), and cyanide (CN, 1 mM). Data normalized to fluorescence at t = 0 s. Z stacks were collected every 45 s. Data as median and interquartile interval. (<bold>B, C</bold>) Scatter plot of peak responses individual glomus cells to two levels of hypoxia (PO<sub>2</sub> ~ 50 and 25 mmHg) in carotid bodies (CBs) from <italic>Higd1c<sup>+/+</sup></italic> (<bold>A</bold>) and <italic>Higd1c<sup>-/-</sup></italic> (<bold>B</bold>) animals. Strong responders with F/F0 &gt; 1.5 gated by dashed lines. (<bold>D</bold>) Fraction of cells responding to mild hypoxia (PO<sub>2</sub> ~ 50 mmHg) with peak F/F0 above the threshold on the x-axis. ***p&lt;0.001 by <italic>Z</italic>-test of proportions. (<bold>E</bold>) Fraction of cells that respond to hypoxia (PO<sub>2</sub> ~ 50 and/or 25 mmHg) as subdivided in (<bold>A</bold>) and (<bold>B</bold>). ****p&lt;0.0001 by Chi-square test. n = 296/4/3 (+/+), 201/4/3 (-/-) cells/CBs/animals.</p><p><supplementary-material id="fig3s1sdata1"><label>Figure 3—figure supplement 1—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig3-figsupp1-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig3-figsupp1-v3.tif"/></fig></fig-group><p>Because <italic>Higd1c</italic> was expressed in glomus cells (<xref ref-type="fig" rid="fig1">Figure 1D and E</xref>), we evaluated whether <italic>Higd1c</italic> mutants were also defective in the sensory responses of these oxygen-sensitive cells. Glomus cells exhibit acute calcium transients in response to stimuli, which can be visualized by the genetically encoded calcium indicator GCaMP3 (<xref ref-type="bibr" rid="bib9">Chang et al., 2015</xref>). We found that glomus cells from <italic>Higd1c 1-1<sup>-/-</sup></italic> mutants mounted a weaker calcium response to hypoxia than those from <italic>Higd1c 1-1<sup>+/+</sup></italic> animals, with fewer glomus cells responding strongly to both levels of hypoxia (<xref ref-type="fig" rid="fig3">Figure 3E–H</xref>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–E</xref>). Low pH and high KCl modulate the activity of ion channels on the plasma membrane of glomus cells thought to act downstream of mitochondria in CB oxygen sensing (<xref ref-type="bibr" rid="bib8">Buckler, 2015</xref>; <xref ref-type="bibr" rid="bib38">Lu et al., 2013</xref>). In contrast to hypoxia, glomus cells from <italic>Higd1c 1-1<sup>-/-</sup></italic> mutants were not significantly different from <italic>Higd1c 1-1<sup>+/+</sup></italic> animals in their calcium response to low pH or high KCl compared to glomus cells from <italic>Higd1c 1-1<sup>-/-</sup></italic> animals (<xref ref-type="fig" rid="fig3">Figure 3E–H</xref>). Calcium responses to cyanide, a potent ETC CIV inhibitor, were also similar between <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> glomus cells (<xref ref-type="fig" rid="fig3">Figure 3E–H</xref>), suggesting that strong ETC inhibition is still able to trigger sensory responses in glomus cells mutated in <italic>Higd1c</italic> like other mutants with defects in CB oxygen sensing (<xref ref-type="bibr" rid="bib50">Peng et al., 2020</xref>; <xref ref-type="bibr" rid="bib49">Peng et al., 2019</xref>). Together, these results show that HIGD1C contributes specifically to glomus cell responses to hypoxia.</p><p>To determine whether HIGD1C modulates oxygen sensitivity of mitochondria in glomus cells, we used rhodamine 123 (Rh123) to image the inner mitochondrial membrane (IMM) potential generated by ETC activity. Hypoxia inhibits ETC activity, leading to a decrease in IMM potential and an increase in Rh123 fluorescence (<xref ref-type="bibr" rid="bib51">Perry et al., 2011</xref>). <italic>Higd1c 1-1<sup>-/-</sup></italic> glomus cells had an attenuated response to hypoxia and a higher percentage of cells that responded poorly to FCCP, a potent uncoupler of oxidative phosphorylation that depolarizes the IMM (<xref ref-type="fig" rid="fig4">Figure 4A–C</xref>, <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A and B</xref>). The weaker response of <italic>Higd1c 1-1<sup>-/-</sup></italic> glomus cells to FCCP was evident even when FCCP was presented as the first stimulus (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1C</xref>), suggesting that the IMM is less polarized at baseline in mutant glomus cells. This idea is also supported by the observation that in glomus cells that had a strong FCCP response &gt; 0.2, Rh123 fluorescence was greater in <italic>Higd1c 1-1<sup>-/-</sup></italic> glomus cells in normoxia (PO<sub>2</sub> = 100 mmHg) (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). Nevertheless, the increase in fluorescence in hypoxia (PO<sub>2</sub> &lt; 80 mmHg) was smaller than in <italic>Higd1c 1-1<sup>+/+</sup></italic> glomus cells (<xref ref-type="fig" rid="fig4">Figure 4E and F</xref>). This pattern of weaker ETC activity in normoxia that cannot be suppressed further in hypoxia seen in <italic>Higd1c 1-1<sup>-/-</sup></italic> glomus cells resembles that of acute CII inhibition on CB sensory activity (<xref ref-type="bibr" rid="bib62">Swiderska et al., 2021</xref>). In <italic>Higd1c 1-1<sup>+/+</sup></italic> CBs, we found that vascular cells, which are less oxygen-sensitive than glomus cells, had a left-shifted IMM potential response to hypoxia (<xref ref-type="fig" rid="fig4">Figure 4G–I</xref>), indicating that our hypoxic stimulus was in an appropriate range to detect the enhanced oxygen sensitivity of the CB over other cell types. These results demonstrate that HIGD1C enhances ETC inhibition by hypoxia in glomus cells, a response linked to CB sensory activity (<xref ref-type="bibr" rid="bib10">Chang, 2017</xref>; <xref ref-type="bibr" rid="bib31">Holmes et al., 2018</xref>; <xref ref-type="bibr" rid="bib47">Ortega-Sáenz and López-Barneo, 2020</xref>).</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>HIGD1C regulates the hypoxic response of the electron transport chain in carotid body glomus cells.</title><p>(<bold>A</bold>) Fluorescence of a whole-mount carotid body (CB) loaded with rhodamine 123 (Rh123), a dye sensitive to changes in mitochondrial inner membrane potential, under quenching conditions. Arrowheads, glomus cell clusters; asterisk, vasculature. Scale bar, 50 µm. Rh123 fluorescence of glomus cells in <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> CBs measured in response to hypoxia (PO<sub>2</sub> &lt; 80 mmHg), cyanide (1 mM), and FCCP (2 μM). (<bold>B</bold>) Rh123 response to hypoxia for all glomus cells quantified. Dashed line, fluorescence at the start of stimulus. n = 291/3/3 (+/+), 312/3/3 (-/-) glomus cells/CBs/animals. Data presented as the median and interquartile interval. ****p&lt;0.0001 by Mann–Whitney <italic>U-</italic>test with Holm–Sidak correction. (<bold>C</bold>) Fraction of glomus cells that responded to FCCP at different ΔF/F. n = 291/3/3 (+/+), 312/3/3 (-/-) glomus cells/CBs/animals. *p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001 by <italic>Z</italic>-test of proportions. (<bold>D–F</bold>) Rh123 response to hypoxia for glomus cells with FFCP responses of ΔF/<italic>F</italic> &gt; 0.2. Dashed line, fluorescence at the start of stimulus. n = 98/3/3 (+/+), 102/3/3 (-/-) glomus cells/CBs/animals. Data presented as the median and interquartile interval or box plots. **p&lt;0.01, ***p&lt;0.001, ****p&lt;0.0001 by Mann–Whitney <italic>U</italic>-test with Holm–Sidak correction. (<bold>G–I</bold>) Rh123 fluorescence of vascular cells in the CB compared to glomus cells with FCCP responses of ΔF/<italic>F</italic> &gt; 0.2. n = 98/3/3 (+/+) glomus cells/CBs/animals, 49/3/3 (+/+) vascular cells/CBs/animals. Data presented as the median and interquartile interval or box plots. *p&lt;0.05, **p&lt;0.01, ****p&lt;0.0001 by Mann–Whitney <italic>U</italic>-test with Holm–Sidak correction.</p><p><supplementary-material id="fig4scode1"><label>Figure 4—source code 1.</label><caption><title>Source code for R analysis for <xref ref-type="fig" rid="fig4">Figure 4</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig4-code1-v3.zip"/></supplementary-material></p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig4">Figure 4B–I</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig4-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig4-v3.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Metabolic responses of <italic>Higd1c 1-1</italic> glomus cells to hypoxia.</title><p>(<bold>A, B</bold>) Time course of recording chamber PO<sub>2</sub> (blue line) and glomus cell Rh123 fluorescence of cells in <italic>Higd1c 1-1<sup>+/+</sup></italic> (black line) and <italic>Higd1c 1-1<sup>-/-</sup></italic> (gray line) carotid bodies (CBs) in response to hypoxia (PO<sub>2</sub> &lt; 80 mmHg). Data from all glomus cells (<bold>A</bold>) or only glomus cells with responses to FFCP (2 μM) at ΔF/<italic>F</italic> &gt; 0.2 (<bold>B</bold>). Dashed black line, fluorescence at the start of stimulus; dashed blue line, normoxic PO<sub>2</sub> = 100 mmHg comparable to well-oxygenated arterial blood. n = 291/3/3 (+/+), 312/3/3 (-/-) glomus cells/CBs/animals (<bold>A</bold>) and 98/3/3 (+/+), 102/3/3 (-/-) glomus cells/CBs/animals (<bold>B</bold>). Data presented as the median and interquartile interval. ***p&lt;0.001, ****p&lt;0.0001 between <italic>Higd1c 1-1<sup>+/+</sup></italic> and <italic>Higd1c 1-1<sup>-/-</sup></italic> by Mann–Whitney <italic>U</italic>-test with Holm–Sidak correction. (<bold>C</bold>) Fraction of glomus cells that responded to FCCP at different ΔF/F thresholds when FCCP (2 μM) is presented as the first stimulus. n = 608/6/6 (+/+), 503/5/5 (-/-) glomus cells/CBs/animals. ****p&lt;0.0001 by <italic>Z</italic>-test of proportions.</p><p><supplementary-material id="fig4s1sdata1"><label>Figure 4—figure supplement 1—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig4-figsupp1-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig4-figsupp1-v3.tif"/></fig></fig-group></sec><sec id="s2-3"><title>HIGD1C associates with and regulates ETC complex IV activity</title><p>To assess the role of HIGD1C in ETC function, we overexpressed FLAG-tagged human or mouse HIGD1C in HEK293T cells and performed biochemical and metabolic studies of mitochondria. In wild-type HEK293T cells, <italic>HIGD1C</italic> mRNA was expressed at very low levels (3 × 10<sup>–6</sup> the level of <italic>GAPDH</italic> by RT-qPCR). Overexpressed FLAG-tagged HIGD1C associated with ETC CIV and cytochrome <italic>c</italic> (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A–C</xref>). Notably, HIGD1C overexpression severely reduced the abundance of ETC supercomplexes, and supercomplexes that did assemble contained only traces of <italic>in-gel</italic> CIV activity (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1D and E</xref>). These defects in supercomplex formation correlated with a decrease in CIV enzymatic activity (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1F and G</xref>) and oxygen consumption rate (OCR) (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1H and I</xref>).</p><p>Because HIGD1C is most similar to HIGD1A and HIGD2A, we overexpressed HIGD1C in <italic>HIGD1A</italic>-KO and <italic>HIGD2A</italic>-KO HEK293T cell lines to determine whether it could rescue ETC defects of these KO cell lines (<xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref>). As in wild-type cells, HIGD1C associated with CIV and cytochrome <italic>c</italic> in <italic>HIGD1A-KO</italic> and <italic>HIGD2A-</italic>KO mutant cells (<xref ref-type="fig" rid="fig5">Figure 5A and B</xref>, <xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2A–D</xref>, <xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3A–C</xref>). Unlike HIGD1A, HIGD1C did not associate with CIII and could not rescue defects in the assembly of supercomplexes in either <italic>HIGD1A</italic>-KO or <italic>HIGD2A-</italic>KO cells (<xref ref-type="fig" rid="fig5">Figure 5C</xref>, <xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2E</xref>, <xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3D</xref>; <xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref>). Strikingly, however, HIGD1C overexpression restored CIV activity in <italic>HIGD1A</italic>-KO, but not <italic>HIGD2A-</italic>KO cells (<xref ref-type="fig" rid="fig5">Figure 5D</xref>, <xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2F</xref>, <xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3E and F</xref>). This could be due to non-overlapping activities of HIGD1C and HIGD2A and/or more severe defects in CIV assembly in <italic>HIGD2A</italic>-KO cells (<xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3D</xref>). Instead of acting as a CIV assembly factor as HIGD2A, HIGD1C could play a regulatory role in modulating CIV activity like HIGD1A (<xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref>). Supporting this idea, we observed that cellular respiration at the overall ETC level was also restored by HIGD1C overexpression in <italic>HIGD1A</italic>-KO cells (<xref ref-type="fig" rid="fig5">Figure 5E and F</xref>). Overexpression of mouse HIGD1C induced a weaker rescue of CIV activity than human HIGD1C, likely due to disruption of species-specific associations between ETC subunits (<xref ref-type="fig" rid="fig5">Figure 5D</xref>, <xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2F</xref>). Nonetheless, mouse HIGD1C fully rescued mitochondrial oxygen consumption due to the spare respiratory capacity of the ETC (<xref ref-type="fig" rid="fig5">Figure 5E and F</xref>). These rescue experiments show that HIGD1C is not involved in ETC complex or supercomplex biogenesis, but similarly to HIGD1A, it can interact with CIV to regulate its activity.</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>HIGD1C is a mitochondrial protein that associates with the electron transport chain complex IV and regulates cellular respiration.</title><p><italic>HIGD1A</italic>-KO HEK293T cells overexpressing FLAG-tagged human or mouse HIGD1C and/or COX4 isoforms. EV, empty vector; HIGD1C, human HIGD1C; Higd1c, mouse HIGD1C. (<bold>A</bold>) BN-PAGE and immunoblots using antibodies for FLAG and the complex IV subunit COX5B. SDHA is used as a loading control. (<bold>B</bold>) Co-immunoprecipitation using a FLAG antibody followed by SDS-PAGE and immunoblot using antibodies for FLAG and subunits of complex I (NDUFA9), complex II (SDHA), complex III (CORE2, UQCRB), complex IV (COX1, COX4I1, COX5B), and cytochrome <italic>c</italic>. (<bold>C</bold>) Electron transport chain (ETC) complexes and supercomplexes extracted with DDM and digitonin, respectively, detected by BN-PAGE and immunoblotting. (<bold>A–C</bold>) All gels and blots were repeated three times. (<bold>D</bold>) Complex IV enzymatic activity assay. n = 3. *p&lt;0.05, ***p&lt;0.001, ****p&lt;0.0001 vs. WT by one-way ANOVA with Dunnett’s test. +p&lt;0.05, ++p&lt;0.01, +++p&lt;0.001, ++++p&lt;0.0001 vs. <italic>HIGD1A</italic>-KO+EV by one-way ANOVA with Dunnett’s test. Gray symbol indicates p=0.06. (<bold>E, F</bold>) Polarographic assessment in digitonin-permeabilized cells of KCN-sensitive oxygen consumption driven by succinate and glycerol-3-phosphate, in the presence or absence of ADP (basal respiration and phosphorylating), oligomycin (resting), and the uncoupler CCCP (uncoupled). Respiratory control ratio (<bold>F</bold>) of measurements performed in (<bold>E</bold>). n = 3. Data as mean ± SEM. *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001 vs. <italic>HIGD1A-</italic>KO+EV by two-way ANOVA with Dunnett’s test.</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Source blots for <xref ref-type="fig" rid="fig5">Figure 5A–C</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig5-data1-v3.zip"/></supplementary-material></p><p><supplementary-material id="fig5sdata2"><label>Figure 5—source data 2.</label><caption><title>Source data for <xref ref-type="fig" rid="fig5">Figure 5D–F</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig5-data2-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig5-v3.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>HIGD1C overexpression in wild-type HEK293T cells inhibits complex IV (CIV) activity.</title><p>HEK293T cells overexpressing FLAG-tagged human or mouse HIGD1C or/and COX4I1/I2 isoforms. EV, empty vector; HIGD1C, human HIGD1C; Higd1c, mouse HIGD1C. (<bold>A</bold>) SDS-PAGE and immunoblot using FLAG antibody to detect overexpression of different proteins. (<bold>B</bold>) SDS-PAGE and immunoblots using antibodies for FLAG and ETC subunits. (<bold>C</bold>) Co-immunoprecipitation using a FLAG antibody followed by SDS-PAGE and immunoblotting. (<bold>D</bold>) BN-PAGE and immunoblotting from purified mitochondria extracted with DDM to analyze electron transport chain (ETC) complexes. (<bold>E</bold>) Mitochondrial extracts solubilized with digitonin and analyzed by immunoblotting against antibodies for ETC complexes I, II, III, and IV or by <italic>in-gel</italic> activity assays. (<bold>A–D</bold>) All gels and blots were repeated three times. (<bold>E</bold>) <italic>In-gel</italic> experiments were performed twice. (<bold>F, G</bold>) Spectrophotometric measurement of CIV (<bold>F</bold>) or citrate synthase (<bold>G</bold>) activities in whole-cell extracts. Enzyme activities are expressed as a fraction of WT values. n = 3. Data as mean ± SEM. *p&lt;0.05, ***p&lt;0.001 by one-way ANOVA with Dunnett’s test. *p-value vs. WT, +p-value vs. WT + HIGD1C, #p-value vs. WT + Higd1c. (<bold>H, I</bold>) Polarographic assessment in digitonin-permeabilized cells of KCN-sensitive oxygen consumption driven by succinate and glycerol-3-phosphate, in the presence or absence of ADP, oligomycin, and the uncoupler CCCP. n = 3. Respiratory control ratio of the measurements performed in (<bold>H</bold>) (<bold>I</bold>). Data as mean ± SEM. *p&lt;0.05, *p&lt;0.01, ****p&lt;0.0001 by one-way ANOVA with Dunnett’s test compared to WT.</p><p><supplementary-material id="fig5s1sdata1"><label>Figure 5—figure supplement 1—source data 1.</label><caption><title>Source gels and blots for <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A–E</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig5-figsupp1-data1-v3.zip"/></supplementary-material></p><p><supplementary-material id="fig5s1sdata2"><label>Figure 5—figure supplement 1—source data 2.</label><caption><title>Source data for <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1F–I</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig5-figsupp1-data2-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig5-figsupp1-v3.tif"/></fig><fig id="fig5s2" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 2.</label><caption><title>HIGD1C regulates complex IV (CIV) activity in <italic>HIGD1A</italic>-KO HEK293T cells.</title><p><italic>HIGD1A-</italic>KO cells overexpressing FLAG-tagged human or mouse HIGD1C or/and COX4I1/I2 isoforms. EV, empty vector; HIGD1C, human HIGD1C; Higd1c, mouse HIGD1C. (<bold>A</bold>) SDS-PAGE and immunoblots detecting FLAG and electron transport chain (ETC) subunits. (<bold>B</bold>) SDS-PAGE and immunoblot using FLAG antibody to detect overexpression of the different proteins. (<bold>C</bold>) SDS-PAGE and immunoblot using COX4I1 and COX4I2 antibodies to detect gene knockdown and overexpression, respectively. (<bold>D</bold>) Co-immunoprecipitation using anti-FLAG antibody conjugated agarose beads followed by SDS-PAGE and immunoblotting. (<bold>E</bold>) BN-PAGE and immunoblotting using purified mitochondria solubilized with DDM or digitonin to analyze ETC complexes and supercomplexes, respectively. ** indicates the accumulation of cytochrome <italic>c</italic> in an unidentified subcomplex. (<bold>A–E</bold>) All gels and blots were repeated three times. (<bold>F</bold>) Citrate synthase activity measured by polarography in whole-cell extracts and expressed as a fraction of WT values. n = 3. Data as mean ± SEM.</p><p><supplementary-material id="fig5s2sdata1"><label>Figure 5—figure supplement 2—source data 1.</label><caption><title>Source blots for <xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2A–E</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig5-figsupp2-data1-v3.zip"/></supplementary-material></p><p><supplementary-material id="fig5s2sdata2"><label>Figure 5—figure supplement 2—source data 2.</label><caption><title>Source data for <xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2F</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig5-figsupp2-data2-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig5-figsupp2-v3.tif"/></fig><fig id="fig5s3" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 3.</label><caption><title>HIGD1C overexpression in <italic>HIGD2A</italic>-KO HEK293T cells does not rescue electron transport chain (ETC) defects.</title><p><italic>HIGD2A-</italic>KO cells overexpressing FLAG-tagged human or mouse HIGD1C. EV, empty vector; HIGD1C, human HIGD1C; Higd1c, mouse HIGD1C. (<bold>A</bold>) SDS-PAGE and immunoblots using FLAG and ETC subunits. (<bold>B</bold>) BN-PAGE of digitonin-permeabilized purified mitochondria and immunoblot using anti-FLAG and anti-COX5B antibodies, and anti-SDHA as a loading control. (<bold>C</bold>) Co-immunoprecipitation using anti-FLAG antibody-conjugated agarose beads followed by SDS-PAGE and immunoblotting. (<bold>D</bold>) BN-PAGE and immunoblotting using purified mitochondria solubilized with DDM or digitonin to analyze ETC complexes and supercomplexes, respectively. (<bold>A–D</bold>) All gels and blots were repeated three times. (<bold>E, F</bold>) Complex IV (CIV) and citrate synthase activities analyzed by polarography in whole-cell extracts. Enzyme activities are expressed as a fraction of WT values. n = 3. Data as mean ± SEM. ****p&lt;0.0001 by one-way ANOVA with Dunnett’s test. ****p&lt;0.0001 vs. WT, ++++p&lt;0.0001 vs. <italic>HIGD2A</italic>-KO+EV by one-way ANOVA with Dunnett’s test.</p><p><supplementary-material id="fig5s3sdata1"><label>Figure 5—figure supplement 3—source data 1.</label><caption><title>Source blots for <xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3A–D</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig5-figsupp3-data1-v3.zip"/></supplementary-material></p><p><supplementary-material id="fig5s3sdata2"><label>Figure 5—figure supplement 3—source data 2.</label><caption><title>Source data for <xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3E and F</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig5-figsupp3-data2-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig5-figsupp3-v3.tif"/></fig></fig-group><p>HIGD1C could modulate CIV activity by (1) mediating the formation of an electron-transfer bridge between ETC CIII and IV and/or (2) changing the structure around the active center of the enzyme. The former possibility is unlikely because overexpression of HIGD1C in <italic>HIGD1A-</italic>KO cells did not increase the levels of cytochrome <italic>c</italic> present in ETC supercomplexes compared to control cell lines (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2E</xref>). The CIV active center that reduces oxygen to water in the terminal step of the ETC is located in subunit 1 (COX1) and formed by a binuclear heme-copper center (heme <italic>a</italic><sub>3</sub>-Cu<sub>B</sub>) (<xref ref-type="bibr" rid="bib63">Timón-Gómez et al., 2018</xref>). To analyze the environment around the CIV active center, we measured UV/Vis absorption spectra of total cytochromes extracted from purified mitochondria. The absence of HIGD1A produced a blue shift in the peak of heme <italic>a+a3</italic> absorbance from 603 nm to 599 nm (<xref ref-type="fig" rid="fig6">Figure 6A</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A</xref>) that is associated with changes around the CIV heme <italic>a</italic> centers (<xref ref-type="bibr" rid="bib55">Shapleigh et al., 1992</xref>). Previous studies showed that adding excess recombinant HIGD1A to highly purified oxidized CIV increases CIV activity twofold and changes the conformation around the heme <italic>a</italic> center (<xref ref-type="bibr" rid="bib28">Hayashi et al., 2015</xref>), suggesting that HIGD1A levels modulate CIV activity. Here, the spectral shift observed in the <italic>HIGD1A</italic>-KO cell line was completely restored by expressing HIGD1A (<xref ref-type="fig" rid="fig6">Figure 6A</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A</xref>). While the wavelength at the peak appeared to be restored by human HIGD1C, expression of human or mouse HIGD1C generated a broader peak, probably due to the existence of a mixed population of the enzyme, to partially restore the spectral shift (<xref ref-type="fig" rid="fig6">Figure 6A–D</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A–C</xref>). A blue shift in the wavelength at the peak was apparent in <italic>HIGD1A</italic>-KO cells overexpressing the mouse HIGD1C alone or human HIGD1C and COX4I2 together (<xref ref-type="fig" rid="fig6">Figure 6A–D</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A–C</xref>), suggesting that the atypical CIV subunit COX4I2 expressed in the CB (<xref ref-type="fig" rid="fig1">Figure 1A and B</xref>, <xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5A and C</xref>) can modify the effect of HIGD1C overexpression. In addition, this spectral shift resembled the unusual absorbance spectrum of cytochromes found in the CB (<xref ref-type="bibr" rid="bib60">Streller et al., 2002</xref>). These results suggest that interaction of HIGD1C with CIV can alter the active site and activity of CIV.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>HIGD1C alters complex IV (CIV) conformation and increases CIV sensitivity to hypoxia.</title><p>(<bold>A</bold>) Differential spectra (reduced minus oxidized) of total mitochondrial cytochromes measured by spectrophotometry. The absorbance of cytochromes extracted from purified mitochondria was measured from 450 to 650 nm. (<bold>B</bold>) Relative peak height of heme <italic>a + a3</italic> normalized by cytochrome <italic>b</italic> peak as the ratio of wild-type (WT). n = 3. Data as mean ± SEM. **p&lt;0.01 vs. WT by one-way ANOVA with Dunnett’s test. (<bold>C, D</bold>) Relative peak area (<bold>C</bold>) and peak base width (<bold>D</bold>) of <italic>a + a<sub>3</sub></italic> as the ratio of WT. n = 3. Data as mean ± SEM. *p&lt;0.05, **p&lt;0.01 vs. WT by one-way ANOVA with Dunnett’s test. (<bold>E</bold>) Ascorbate/TMPD-dependent oxygen consumption in normoxia (Nox, PO<sub>2</sub> ~ 150 mmHg) and hypoxia (Hox, PO<sub>2</sub> ~ 25 mmHg) by high-resolution respirometry. Ratio of hypoxic/normoxic oxygen consumption. n = 5–8. Data as the median and interquartile interval. **p&lt;0.01 vs. WT by Kruskal–Wallis test with Dunn’s test. (<bold>F</bold>) Mitochondrial oxygen affinity (p50<sub>mito</sub>) values derived from full oxygen consumption curve in intact cells from normoxia (PO<sub>2</sub> ~ 150 mmHg) to anoxia (PO<sub>2</sub> = 0 mmHg) by high-resolution respirometry. n = 4. Data as mean ± SEM. **p&lt;0.01, ***p&lt;0.001 vs. WT by one-way ANOVA with Dunnett’s test.</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig6">Figure 6B–F</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig6-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig6-v3.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>HIGD1C regulates complex IV (CIV) conformation and oxygen sensitivity in <italic>HIGD1A</italic>-KO HEK293T cells.</title><p>(<bold>A</bold>) Differential spectra (reduced minus oxidized) of total mitochondrial cytochromes measured by spectrophotometry. The absorbance of cytochromes extracted from purified mitochondria was measured from 450 to 650 nm. The panel on the left is a ×2.5 magnification on the x-axis of the indicated portion of the graph. The gray vertical line indicates the wild-type heme <italic>a + a<sub>3</sub></italic> peak at 603 nm. The green vertical line marks the 599 nm wavelength, towards which some of the heme <italic>a + a<sub>3</sub></italic> peaks are shifted. (<bold>B, C</bold>) Relative peak height of heme <italic>a + a<sub>3</sub></italic> (<bold>B</bold>) or cytochrome <italic>b</italic> (<bold>C</bold>) shown as the ratio of WT. n = 3. Data as mean ± SEM. *p&lt;0.05 vs, WT by one-way ANOVA with Dunnett’s test. (<bold>D</bold>) Ascorbate/TMPD-dependent oxygen consumption in normoxia (Nox, PO<sub>2</sub> ~ 150 mmHg) and hypoxia (Hox, PO<sub>2</sub> ~ 25 mmHg) by high-resolution respirometry. n = 5–8. Data as median and interquartile interval. No <italic>HIGD1A</italic>-KO cell lines were significantly different from WT by Kruskal–Wallis test with Dunn’s test (p&gt;0.05). (<bold>E</bold>) Representative traces of oxygen kinetics (JO<sub>2</sub>/Jmax) as a function of oxygen concentration in the low oxygen range by high-resolution respirometry.</p><p><supplementary-material id="fig6s1sdata1"><label>Figure 6—figure supplement 1—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1B–D</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-78915-fig6-figsupp1-data1-v3.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig6-figsupp1-v3.tif"/></fig></fig-group></sec><sec id="s2-4"><title>HIGD1C and COX4I2 enhance the sensitivity of ETC complex IV to hypoxia</title><p>To determine whether HIGD1C can modify the sensitivity of ETC to hypoxia, we measured respiration of <italic>HIGD1A</italic>-KO cells overexpressing atypical CIV proteins found in glomus cells (<xref ref-type="bibr" rid="bib72">Zhou et al., 2016</xref>; <xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5A</xref>). Because CIV activity alone is sufficient to recapitulate the enhanced oxygen sensitivity of the intact ETC in glomus cells (<xref ref-type="bibr" rid="bib7">Buckler and Turner, 2013</xref>), we used an artificial electron donor system to isolate cytochrome <italic>c</italic>-CIV activity and measured oxygen consumption. This approach allowed us to bypass CIII assembly defects of <italic>HIGD1A-</italic>KO cells that contribute to defects in total respiration and measure CIV activity derived from the cyanide-dependent component of total respiration (<xref ref-type="fig" rid="fig5">Figure 5D and E</xref>; <xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref>). Co-expression of HIGD1C and COX4I2 in <italic>HIGD1A</italic>-KO cells, which better models the ETC composition in the CB (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5A and C</xref>), decreased CIV-dependent respiration in hypoxia more than wild-type and other cell lines, including one overexpressing HIGD1C alone (<xref ref-type="fig" rid="fig6">Figure 6E</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1D</xref>). This condition also increased the oxygen pressure at half-maximal respiration (p50<sub>mito</sub>), suggesting a reduction in oxygen affinity (<xref ref-type="fig" rid="fig6">Figure 6F</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1E</xref>). In <italic>HIGD1A</italic>-KO cells, overexpression of COX4I2 alone decreased p50<sub>mito</sub>, but additional expression of HIGD1C further modified the JO<sub>2</sub>/Jmax curve to increase p50<sub>mito</sub> over wild-type (<xref ref-type="fig" rid="fig6">Figure 6F</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1E</xref>). These results demonstrate that co-overexpression of HIGD1C and COX4I2, two atypical mitochondrial ETC proteins expressed in CB glomus cells that mediate oxygen sensing (<xref ref-type="bibr" rid="bib44">Moreno-Domínguez et al., 2020</xref>), can confer hypersensitivity to hypoxia in HEK293T cells. Therefore, the COX4I2-containing CIV, and its regulation by HIGD1C, emerge as necessary and sufficient factors to promote oxygen sensing by CB glomus cells.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Previous studies found that mouse knockouts in specific CI (<italic>Ndufs2</italic>) and CIV (<italic>Cox4i2</italic>) subunits exhibit defects in CB sensory and metabolic responses to hypoxia (<xref ref-type="bibr" rid="bib20">Fernández-Agüera et al., 2015</xref>; <xref ref-type="bibr" rid="bib44">Moreno-Domínguez et al., 2020</xref>), phenocopying the effect of drugs that inhibit these ETC complexes. However, these subunits are expressed in multiple tissues in addition to the CB. Here, we identified HIGD1C as a novel mitochondrial CIV protein expressed almost exclusively in CB glomus cells that is essential for oxygen sensing by the CB (summarized in <xref ref-type="fig" rid="fig7">Figure 7A and B</xref>). We found that HIGD1C interacts with CIV to alter the conformation of its enzymatic active center. In the absence of HIGD1A, co-overexpression of HIGD1C and COX4I2 increased oxygen sensitivity of CIV in HEK293T cells (<xref ref-type="fig" rid="fig6">Figure 6E</xref>), and overexpression of COX4I2 increased the stability of HIGD1C (<xref ref-type="fig" rid="fig5s2">Figure 5—figure supplement 2B</xref>). Since COX4I1, the ubiquitously expressed COX4 subunit, associates with HIGD1A in CIV assembly (<xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref>), the alternative COX4I2 subunit may assemble with HIGD1C. In opposition to its effect in <italic>HIGD1A</italic>-KO cells, COX4I2 overexpression in the presence of HIGD1A in WT cells decreases HIGD1C abundance, suggesting that HIGD1A and HIGD1C interact with CIV in the same domains (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A</xref>). These results indicate that coalitions of different CIV proteins may assemble under varying conditions and perform distinct physiological functions.</p><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>A model for oxygen sensing by mitochondria of carotid body glomus cells.</title><p>(<bold>A</bold>) In this simplified scheme, NADH produced by the Krebs cycle transfers electrons to CI to initiate the electron transport chain (ETC). FADH<sub>2</sub> produced by succinate metabolism can also initiate the ETC by donating electrons to CII. In the terminal step of the ETC, complex IV (CIV) transfers electrons to oxygen. Cyanide inhibits the transfer of electrons to oxygen by binding to heme a<sub>3</sub> in CIV to mimic the effect of hypoxia on the ETC. Hypoxia and cyanide reduce flux through the ETC, increasing the production of reactive oxygen species (ROS) and lactate that are proposed to signal to downstream targets for neurotransmission in glomus cells (<xref ref-type="bibr" rid="bib10">Chang, 2017</xref>; <xref ref-type="bibr" rid="bib31">Holmes et al., 2018</xref>; <xref ref-type="bibr" rid="bib47">Ortega-Sáenz and López-Barneo, 2020</xref>). HIGD1 and COX4 are ETC proteins that associate with CIV. Q, coenzyme Q; C, cytochrome <italic>c</italic>. (<bold>B</bold>) In most cells, CIV contains HIGD1A and COX4I1 proteins that form an early-assembly module during CIV biogenesis (<xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref>). Glomus cells express alternative isoforms of HIGD1A and COX4I2 called HIGD1C and COX4I2, respectively (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5A</xref>). The combination of HIGD1C and COX4I2 increases the sensitivity of CIV to hypoxia at the level of oxygen consumption (relative activity levels denoted). Because mouse knockouts in <italic>Higd1c</italic> and <italic>Cox4i2</italic> are defective in carotid body oxygen sensing (<xref ref-type="fig" rid="fig2">Figures 2</xref>—<xref ref-type="fig" rid="fig4">4</xref> <xref ref-type="bibr" rid="bib44">Moreno-Domínguez et al., 2020</xref>) and HIGD1C and COX4I2 overexpression in HEK293T cells enhances oxygen sensitivity of the ETC to hypoxia (<xref ref-type="fig" rid="fig6">Figure 6E and F</xref>), we propose that these CIV-associated proteins are necessary and sufficient for oxygen sensing by carotid body glomus cells.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-fig7-v3.tif"/></fig><p>HIGD1C is evolutionarily closer to HIGD1A than to HIGD2A (<xref ref-type="bibr" rid="bib64">Timón-Gómez et al., 2020a</xref>), which could explain why in normoxic conditions HIGD1C is able to substitute for HIGD1A function partially but not for HIGD2A (<xref ref-type="fig" rid="fig5">Figure 5D and E</xref>, <xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3E</xref>). Unlike HIGD1A and HIGD2A, HIGD1C does not perform any apparent role in assembling the ETC complexes or supercomplexes (<xref ref-type="fig" rid="fig5">Figure 5C</xref>, <xref ref-type="fig" rid="fig5s3">Figure 5—figure supplement 3D</xref>). HIGD1C interacts with cytochrome <italic>c</italic> and CIV (<xref ref-type="fig" rid="fig5">Figure 5A and B</xref>) and, like HIGD1A, promotes CIV enzymatic activity in normoxia (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). However, whereas HIGD1A is a positive regulator of CIV (<xref ref-type="bibr" rid="bib28">Hayashi et al., 2015</xref>), our data indicate that HIGD1C serves as a negative modulator of CIV activity or is less efficient than HIGD1A in promoting CIV activity under limiting oxygen conditions (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). Importantly, HIGD1C does not act in a CIV formed by standard subunits but in a CIV containing atypical tissue-specific isoforms known to be regulated by hypoxia, such as COX4I2, because increased sensitivity of the ETC to hypoxia is apparent only when both HIGD1C and COX4I2 are overexpressed (<xref ref-type="fig" rid="fig6">Figure 6E and F</xref>).</p><p>Our data allow us to conclude that the interaction of HIGD1C with hypoxic CIV containing atypical subunits results in an oxygen-sensing cytochrome <italic>c</italic> oxidase enzyme in CB glomus cells. However, while we demonstrated here that HIGD1C and COX4I2 are sufficient to confer oxygen sensitivity to CIV in HEK293T cells, additional components are likely to be required to fully reconstitute the oxygen sensitivity of CB glomus cells. Other proteins upregulated in glomus cells, such as the atypical CIV subunits NDUFA4L2 and COX8B and the glycolytic enzyme PCX (<xref ref-type="bibr" rid="bib9">Chang et al., 2015</xref>; <xref ref-type="bibr" rid="bib44">Moreno-Domínguez et al., 2020</xref>), are attractive candidates for further study to determine their potential contribution to CB oxygen sensing. The expression of three atypical CIV subunits in the CB correlates with the sufficiency of CIV alone to recapitulate the unusual oxygen dose response of the ETC in glomus cells (<xref ref-type="bibr" rid="bib7">Buckler and Turner, 2013</xref>), suggesting that CIV is key for CB oxygen sensing. Future studies of oxygen consumption by mitochondria of glomus cells, when feasible, will further illuminate the roles of these proteins in CB oxygen sensing. While our study addresses CB oxygen sensing at the level of the oxygen sensor, how changes in ETC caused by HIGD1C and COX4I2 alter metabolic signaling by reactive oxygen species (ROS), lactate, and adenosine phosphates in hypoxia to regulate downstream G protein-coupled receptors and ion channels that stimulate neurotransmission remain to be elucidated (<xref ref-type="fig" rid="fig7">Figure 7A</xref>; <xref ref-type="bibr" rid="bib10">Chang, 2017</xref>; <xref ref-type="bibr" rid="bib17">Evans, 2019</xref>; <xref ref-type="bibr" rid="bib31">Holmes et al., 2018</xref>; <xref ref-type="bibr" rid="bib47">Ortega-Sáenz and López-Barneo, 2020</xref>).</p><p>CIV is the only ETC complex known to contain subunits that are tissue-specific and/or regulated by development, physiological changes (hypoxia and low glucose), and diseases (cancer, ischemia/reperfusion injury, and sepsis) (<xref ref-type="bibr" rid="bib57">Sinkler et al., 2017</xref>; <xref ref-type="bibr" rid="bib64">Timón-Gómez et al., 2020a</xref>). For example, COX4I2 is upregulated in hypoxia in general and promotes hypoxic pulmonary vasoconstriction in the lung (<xref ref-type="bibr" rid="bib57">Sinkler et al., 2017</xref>; <xref ref-type="bibr" rid="bib59">Sommer et al., 2017</xref>). <italic>Higd1c</italic> does not appear to be expressed in the lung at appreciable levels (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3C and D</xref>), and the hypoxic response of the CB is faster than that of pulmonary arterial smooth muscle (seconds vs. minutes). In addition to the CB, <italic>Higd1c</italic> is expressed in kidney proximal tubules (<xref ref-type="bibr" rid="bib61">Suganthan et al., 2014</xref>; <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4G–J</xref>). Compared to other nephron segments, the proximal tubules have the highest oxygen demand, exhibit greater ETC sensitivity to hypoxia, and are most susceptible to ischemia/reperfusion injury (<xref ref-type="bibr" rid="bib27">Hall et al., 2009</xref>). We speculate that HIGD1C modulates ETC activity and matches oxygen utilization to physiological function not only in the CB but in oxygen-sensitive cells in other organs. Due to imaging resolution limitations, our in situ hybridization results do not rule out the possibility that in the CB <italic>Higd1c</italic> is expressed in both glomus cells and sustentacular glial-like cells that ensheath them (<xref ref-type="fig" rid="fig1">Figure 1D and E</xref>), as these cell types are proposed to cooperate to promote sensory signaling (<xref ref-type="bibr" rid="bib37">Leonard et al., 2018</xref>). Determining how HIGD1C and other atypical CIV proteins work together in the CB to mediate oxygen sensing will help us better understand how tissue- and condition-specific CIV subunits contribute to physiological function and disease and allow us to potentially target these proteins to treat diseases characterized by CB dysfunction.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Mice</title><p>All animals were maintained in a barrier facility at 22–23°C with a 12 hr light/dark cycle and allowed ad libitum access to food and water. C57BL/6J (JAX) was used as the wild-type strain. Other mouse strains obtained from repositories were Th-Cre driver: B6.FVB(Cg)-<italic>Tg(Th-cre)<sup>FI172Gsat</sup></italic>/Mmucd (MMRRC) (<xref ref-type="bibr" rid="bib26">Gong et al., 2007</xref>) and ROSA-GCaMP3: B6;129S-<italic>Gt(ROSA)26Sor<sup>tm38(CAG-GCaMP3)Hze</sup></italic>/J (JAX) (<xref ref-type="bibr" rid="bib71">Zariwala et al., 2012</xref>). Adult animals of both sexes from multiple litters were used in all experiments. <italic>Higd1c</italic> mutant strains were generated in this study by CRISPR/Cas9 gene editing. <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals were generated from crosses between <italic>Higd1c<sup>+/-</sup></italic> parents. All experiments with animals were approved by the Institutional Animal Care and Use Committees at the University of California, San Francisco (AN183237-03), and the University of Calgary (AC16-0204).</p></sec><sec id="s4-2"><title>Human tissue</title><p>For human tissue, CB bifurcations were procured from research-consented, deidentified organ transplant donors through a collaboration with the UCSF VITAL Core (<ext-link ext-link-type="uri" xlink:href="https://surgeryresearch.ucsf.edu/laboratories-research-centers/vital-core.aspx">https://surgeryresearch.ucsf.edu/laboratories-research-centers/vital-core.aspx</ext-link>) and designated as non-human subjects research specimens by the UCSF IRB.</p></sec><sec id="s4-3"><title>Human cell lines and cell culture conditions</title><p>Human HEK293T embryonic kidney cells (CRL-3216, RRID<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:CVCL-0063">:CVCL-0063</ext-link>) were obtained from ATCC. Cells were cultured in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 1 mM sodium pyruvate, and 50 mg/ml uridine at 37°C under 5% CO<sub>2</sub>. Cell lines were routinely analyzed for mycoplasma contamination.</p></sec><sec id="s4-4"><title>Transgenic mice</title><p><italic>Higd1c</italic> mutants were generated by injecting C57BL/6J embryos with in vitro transcribed sgRNA-1 and sgRNA-2 (10 ng/µl each) together with <italic>Cas9</italic> mRNA (50 ng/µl) and transferring injected embryos to pseudo-pregnant CD-1 females. Six founders were born and bred to C57BL/6J animals to isolate individual mutations transmitted through the germline, and sequences around sgRNA targets were PCR amplified and sequenced to identify mutations (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A–C</xref>). <italic>Higd1c</italic> mutant lines were maintained by breeding <italic>Higd1c<sup>+/-</sup></italic>animals to each other.</p></sec><sec id="s4-5"><title>RNA purification and RT-qPCR</title><p>For mouse CB and kidney tissue, animals were anesthetized with isoflurane and decapitated, and tissues were dissected immediately. For all other tissues, animals were anesthetized and exsanguinated by perfusing PBS through the heart before decapitation and dissection. For human tissue, CB bifurcations were stored and transported in Belzer UW Cold Storage Solution (Bridge to Life) on ice. CBs were then dissected in UW Solution within 18 hr after harvest. After dissection, tissues were transferred to RNAprotect Tissue Reagent (QIAGEN) and stored at 4°C. For CB, kidney, adrenal gland, and all neuronal tissues, tissue pieces were disrupted and homogenized in a guanidine-isothiocyanate lysis buffer (Buffer RLT, QIAGEN) using a glass tissue grinder (Corning), followed by a 23-gauge needle and syringe, and purified by silica-membrane columns using the RNeasy Micro Kit (QIAGEN). For heart, liver, lung, and spleen, tissue pieces were ground using a glass tissue grinder in TRIzol (Invitrogen), and RNA was purified by acid guanidinium thiocyanate-phenol-chloroform extraction followed by isopropanol precipitation. For cell culture, cells were pelleted and resuspended in Buffer RLT before RNA purification using columns. RNA quality was assessed by visualizing 28S and 18S rRNA by agarose gel electrophoresis, and RNA concentration was measured with a Nanodrop ND-1000 Spectrophotometer (Thermo). RNA was stored at –80°C.</p><p>Two-step RT-qPCR was performed. First, purified total RNA was synthesized into cDNA:RNA hybrids with Maxima H Minus Reverse Transcriptase (Thermo) and primed using equal amounts of oligo(dT)15 primers (Promega) and random hexamers (Thermo). RNasin Plus RNase Inhibitor (Promega) was also added to the mixture. Next, qPCR was performed using PowerUp SYBR Green Master Mix (Applied Biosystems), at 10 µl reaction volume, following the manufacturer’s instructions. Three technical replicates were performed for each reaction and plated in TempPlate 384-well PCR plates (USA Scientific). Sample plates were run using a QuantStudio 5 Real-Time PCR System (Applied Biosystems) using a 40-cycle amplification protocol.</p><p>QuantStudio software was used to calculate threshold cycle (Ct) values. Undetermined Ct values were set to Ct = 40. Ct values were averaged for all technical replicates for each biological sample and normalized to either <italic>Actb</italic> or to <italic>GAPDH</italic>, using the ΔCt method.</p></sec><sec id="s4-6"><title>BaseScope in situ hybridization</title><p>Animals were anesthetized with isoflurane, decapitated, and dissected. Tissue was fixed in RNase-free 4% PFA/PBS overnight at 4°C and equilibrated serially in 10% sucrose/PBS for &gt;1 hr, 20% sucrose/PBS for &gt;2 hr, and 30% sucrose/PBS overnight, all at 4°C. Tissue was then embedded in O.C.T. (TissueTek) and stored at –80°C. The tissue was sectioned at 10 μm using a Leica CM3050S cryostat and stored at –80°C.</p><p>Following the BaseScope protocol for fixed frozen sections, slides were baked for 50 min at 60°C and post-fixed with 10% neutral-buffered saline for 15 min at 60°C. This was followed by target retrieval for 5 min at 100°C and protease III treatment for 30 min at 40°C. Using the BaseScope Duplex Detection Reagent kit (Advanced Cell Diagnostics, 323810), subsequent steps of hybridization and detection followed the vendor’s protocol. Probes are listed in <xref ref-type="table" rid="table2">Table 2</xref>. The probe set for <italic>Higd1c</italic> was custom-designed to target only the first two exons of <italic>Higd1c</italic>. For detection of <italic>Th</italic> mRNA, amplification steps 7 and 8 were reduced from 30 min and 15 min, respectively, to 15 min and 7.5 min for some samples. Images were collected on a Nikon Ti widefield inverted microscope using a DS-Ri2 color camera. Two sets of experiments were performed on tissues from C57BL/6J (2), <italic>Higd1c<sup>+/+</sup></italic> (3), and <italic>Higd1c<sup>-/-</sup></italic> (2) animals (<xref ref-type="fig" rid="fig1">Figure 1D and E</xref>, <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4A–E,G–J</xref>).</p><table-wrap id="table2" position="float"><label>Table 2.</label><caption><title>Reagents and resources.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Reagent or resource</th><th align="left" valign="bottom">Source</th><th align="left" valign="bottom">Identifier</th></tr></thead><tbody><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>Mouse strains</bold></td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">C57BL/6J (wild-type)</td><td align="left" valign="bottom">JAX</td><td align="char" char="." valign="bottom">000664</td></tr><tr><td align="left" valign="bottom">B6.FVB(Cg)-<italic>Tg(Th-cre)<sup>FI172Gsat</sup></italic>/Mmucd</td><td align="left" valign="bottom">MMRRC</td><td align="char" char="hyphen" valign="bottom">031029-UCD</td></tr><tr><td align="left" valign="bottom">B6;129S-<italic>Gt(ROSA)26Sor<sup>tm38(CAG-GCaMP3)Hze</sup></italic>/J</td><td align="left" valign="bottom">JAX</td><td align="char" char="." valign="bottom">014538</td></tr><tr><td align="left" valign="bottom">B6.<italic>Higd1c 3-1</italic></td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">B6.<italic>Higd1c 1-1</italic></td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">B6.<italic>Higd1c 5-3</italic></td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>sgRNA primers (target sequence in bold</bold>)</td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">sgRNA-1 (forward): TAATACGACTCACTATA<bold>GGGAGTCTCTCGATTTCCGG</bold>GTTTTAGAGCTAGAA</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">sgRNA-2 (forward): TAATACGACTCACTATAGG<bold>CTGATTTAAGGAGTGAGTGC</bold>GTTTTAGAGCTAGAA</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">sgRNA (reverse, common): AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTA<break/>GCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>Genotyping primers</bold></td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic>-P8: GTCAGGTGGCCCCTGATGAAA</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic>-P9: GTGCACGAGCAGACTGGTTCT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic>-P11: GGATATCACAGCCACAGAGGACG</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>Mouse qPCR primers</bold></td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Actb</italic>-F: AGCCATGTACGTAGCCATCC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Actb</italic>-R: GCCATCTCTTGCTCGAAGTC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic> (5 exon)-F: CACGTACAAGGGCTGCATGG</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic> (5 exon)-R: ACCTAGAGTCACGGCTCCC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic> (4 exon)-F: CCAGCACGTACAAGAGAGAAA</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic> (4 exon)-R: ACGTGGATGAGATGAAGGGAC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>Rat qPCR primers</bold></td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>GADPH</italic>-F: CAAGTTCAACGGCACAGTCAAG</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib33">Kim et al., 2011</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>GADPH</italic>-R: ACATACTCAGCACCAGCATCAC</td><td align="char" char="." valign="bottom"><xref ref-type="bibr" rid="bib33">Kim et al., 2011</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic>-F1: CCTGTGCTGATCAAAGAGCA</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic>-R1: CTGACCACTCATCTGAAGAC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic>-R2: CTGCTGACCACTCATCTGAA</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Kcnk3</italic>-F: GCAGAAGCCGCAGGAGTTC</td><td align="char" char="." valign="bottom"><xref ref-type="bibr" rid="bib33">Kim et al., 2011</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Kcnk3</italic>-R: GCCCGCACAGTTGGAGATTTAG</td><td align="char" char="." valign="bottom"><xref ref-type="bibr" rid="bib33">Kim et al., 2011</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Kcnk9</italic>-F: CGGTGCCTTCCTCAATCTTGTG</td><td align="char" char="." valign="bottom"><xref ref-type="bibr" rid="bib33">Kim et al., 2011</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Kcnk9</italic>-R: TGGTGCCTCTTGCGACTCTG</td><td align="char" char="." valign="bottom"><xref ref-type="bibr" rid="bib33">Kim et al., 2011</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Th</italic>-F: TCGGAAGCTGATTGCAGAGA</td><td align="char" char="." valign="bottom"><xref ref-type="bibr" rid="bib19">Feng et al., 2020</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Th</italic>-R: TTCCGCTGTGTATTCCACATG</td><td align="char" char="." valign="bottom"><xref ref-type="bibr" rid="bib19">Feng et al., 2020</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Olr59</italic>-F: TCATTCACGCTCTCTCAGCA</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib69">von der Weid et al., 2015</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Olr59</italic>-R: CCATGCCGATTTGGACTGTT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib69">von der Weid et al., 2015</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>Human qPCR primers</bold></td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>GADPH</italic>-F: ACCACAGTCCATGCCATCAC</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib41">Maßberg et al., 2016</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>GADPH</italic>-R: TCCCACCACCCTGTTGCTGTA</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib41">Maßberg et al., 2016</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD1A</italic>-F1: CAACAGACACAGGTGTTTCC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD1A</italic>-R1: CAATTGCTGCAAAACCCGCT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD2A</italic>-F: GCCCCACTGTTTACAGGAAT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD2A</italic>-R: GCGCATCATGAGCTGAGAG</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD1C</italic>-F: GAAGGCCAATTATCCCGACT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD1C</italic>-R: GCTTGTAAAGACCACAGGAC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>COX4I1</italic>-F: CAAGCGAGCAATTTCCACCT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>COX4I1</italic>-R: CCTTCTCCTTCAATGCCTTC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>COX4I2</italic>-F: GAGGGATGCACAGCTCAGAA</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>COX4I2</italic>-R: CTTCTCCTTCTCCTTCAGGG</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>NDUFA4L2</italic>-F: GATGATCGGCTTAATCTGCC</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>NDUFA4L2</italic>-R: GTATTGGTCATTGGGGCTCA</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>TH</italic>-F: GCTGGACAAGTGTCATCACCTG</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">HP234519</td></tr><tr><td align="left" valign="bottom"><italic>TH</italic>-R: CCTGTACTGGAAGGCGATCTCA</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">HP234519</td></tr><tr><td align="left" valign="bottom"><italic>OR51E2</italic>-F2: TCATCCCATTGTGCGTGTTG</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>OR51E2</italic>-R2: CACCCGTGTTCTGATCTGTTTG</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>BaseScope in situ hybridization probes</bold></td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">BA-Mm-<italic>Higd1c</italic>-2zz-st</td><td align="left" valign="bottom">ACD</td><td align="char" char="." valign="bottom">862241</td></tr><tr><td align="left" valign="bottom">BA-Mm-<italic>Th</italic>-3EJ-C2</td><td align="left" valign="bottom">ACD</td><td align="char" char="hyphen" valign="bottom">854771-C2</td></tr><tr><td align="left" valign="bottom"><italic>dapB</italic>-1ZZ-C1/<italic>dapB</italic>-1ZZ-C2</td><td align="left" valign="bottom">ACD</td><td align="char" char="." valign="bottom">700141</td></tr><tr><td align="left" valign="bottom">Mm-<italic>Ppib</italic>-1ZZ</td><td align="left" valign="bottom">ACD</td><td align="char" char="." valign="bottom">701081</td></tr><tr><td align="left" valign="bottom">Mm-<italic>Polr2a</italic>-1ZZ-C2</td><td align="left" valign="bottom">ACD</td><td align="char" char="hyphen" valign="bottom">701101-C2</td></tr><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>Plasmids</bold></td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD1C</italic>-Myc-FLAG in pCMV6-Entry (human)</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">RC225015</td></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic>-Myc-FLAG in pCMV6-Entry (mouse)</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">MR220387</td></tr><tr><td align="left" valign="bottom"><italic>COX4I1</italic>-Myc-FLAG in pCMV6-Entry</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">RC209374</td></tr><tr><td align="left" valign="bottom"><italic>COX4I2</italic>-Myc-FLAG in pCMV6-Entry</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">RC209204</td></tr><tr><td align="left" valign="bottom">pCMV6-A-Entry-Hygro</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">PS100024</td></tr><tr><td align="left" valign="bottom">pCMV6-A-Entry-BSD</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">PS100022</td></tr><tr><td align="left" valign="bottom"><italic>HIGD1A-</italic>Myc-FLAG in pCMV6-A-Entry-Hygro</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD2A-</italic>Myc-FLAG in pCMV6-A-Entry-Hygro</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>HIGD1C</italic>-Myc-FLAG in pCMV6-A-Entry-Hygro (human)</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>Higd1c</italic>-Myc-FLAG in pCMV6-A-Entry-Hygro (mouse)</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>COX4I1</italic>-Myc-FLAG in pCMV6-A-Entry-BSD</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><italic>COX4I2</italic>-Myc-FLAG in pCMV6-A-Entry-BSD</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"/><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom"><bold>Primary antibodies/stains</bold></td><td align="left" valign="bottom"> </td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Mouse anti-DDK/FLAG</td><td align="left" valign="bottom">OriGene</td><td align="left" valign="bottom">TA50011</td></tr><tr><td align="left" valign="bottom">Mouse anti-HSP60</td><td align="left" valign="bottom">ECM Biosciences</td><td align="left" valign="bottom">HM-4381</td></tr><tr><td align="left" valign="bottom">Rabbit anti-TH</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab112</td></tr><tr><td align="left" valign="bottom">Rat anti-CD31</td><td align="left" valign="bottom">BD Pharmingen</td><td align="char" char="." valign="bottom">553370</td></tr><tr><td align="left" valign="bottom"><italic>Lotus tetragonolobus</italic> lectin-Fluorescein</td><td align="left" valign="bottom">Vector Labs</td><td align="left" valign="bottom">FL-1321</td></tr><tr><td align="left" valign="bottom">Mouse anti-ATP5A</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab14748</td></tr><tr><td align="left" valign="bottom">Mouse anti-β-ACTIN</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab8227</td></tr><tr><td align="left" valign="bottom">Mouse anti-CORE2</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab8227</td></tr><tr><td align="left" valign="bottom">Mouse anti-COX1</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab14705</td></tr><tr><td align="left" valign="bottom">Mouse anti-COX4I1</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab14744</td></tr><tr><td align="left" valign="bottom">Rabbit anti-COX4I2</td><td align="left" valign="bottom">Abnova</td><td align="left" valign="bottom">H00084701-M01</td></tr><tr><td align="left" valign="bottom">Mouse anti-COX5B</td><td align="left" valign="bottom">Santa Cruz</td><td align="left" valign="bottom">sc-374417</td></tr><tr><td align="left" valign="bottom">Mouse anti-β-TUBULIN</td><td align="left" valign="bottom">Sigma-Aldrich</td><td align="left" valign="bottom">C4585</td></tr><tr><td align="left" valign="bottom">Rabbit anti-UQCRB</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab122837</td></tr><tr><td align="left" valign="bottom">Mouse anti-NDUFA9</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab14713</td></tr><tr><td align="left" valign="bottom">Rabbit anti-NDUFB11</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab183716</td></tr><tr><td align="left" valign="bottom">Rabbit anti-SDHA</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">ab14715</td></tr><tr><td align="left" valign="bottom">Mouse anti-cytochrome <italic>c</italic></td><td align="left" valign="bottom">Santa Cruz</td><td align="left" valign="bottom">sc-13156</td></tr></tbody></table></table-wrap></sec><sec id="s4-7"><title>Immunostaining</title><p>Cultured cells on coverslips were fixed with 1% or 4% PFA/PBS for 10 min at 22°C and used immediately or stored in PBS at 4°C. Tissue was fixed in 4% PFA/PBS for 10 min at 22°C and equilibrated in 30% sucrose overnight at 4°C. Tissue was embedded in O.C.T. (TissueTek) and stored at –80°C. Sections were cut at 10 μm using a Leica CM3050S cryostat and stored at –80°C. Fixed cells or tissue sections were incubated with primary antibodies overnight at 4°C. Primary antibodies were mouse anti-DDK/FLAG, mouse anti-HSP60, rabbit anti-TH, and rat anti-CD31, all used at 1:500. For kidney sections, fluorescein-labeled <italic>Lotus tetragonolobus</italic> lectin (LTL) was added during the primary antibody treatment. Incubation with secondary antibodies (1:250) conjugated to either Alexa Fluor 488, Alexa Fluor 555 (Life Technologies), or Cy3 (Jackson ImmunoResearch) was 45 min at 22°C. Samples were then incubated with DAPI (1 ng/ml, Life Technologies) for 5 min at 22°C and mounted in Mowiol 4-88 (Polysciences) with DABCO (25 mg/ml, Sigma-Aldrich). Samples were imaged using a Leica SPE confocal microscope for cell culture and a Zeiss Axio Observer D1 widefield inverted microscope for tissue sections. Quantification of TH-positive cells was performed on 1/3 of the total CB using 1 of 3 sets of adjacent sections (<xref ref-type="fig" rid="fig1">Figure 1G–I</xref>).</p></sec><sec id="s4-8"><title>Whole-body plethysmography</title><p>Adult mice were removed from the housing room and placed in the procedure room for a minimum of 1 hr before starting the experiment to acclimate. Ventilation of unanesthetized, awake mice was measured using a commercial system for whole-body plethysmography (Scireq). Chamber pressure was detected by a pressure transducer and temperature and humidity by a sensor. These signals were integrated using IOX2 software (Scireq) to calculate the instantaneous flow rate. Baseline breathing was established during a period of at least 30 min in control gas. The baseline was followed by two hypoxic periods and one hypercapnic period, each lasting 5 min, interspersed with recovery periods of 10 min in control gas (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A–C</xref>). Gas mixtures for control, hypoxia, and hypercapnia were 21% O<sub>2</sub>/79% N<sub>2</sub>, 10% O<sub>2</sub>/90% N<sub>2</sub>, and 5% CO<sub>2</sub>/21% O<sub>2</sub>/79% N<sub>2</sub>, respectively (Airgas). The flow rate was held constant at 1.5 l/min by a flowmeter.</p><p>Breathing traces were collected, and ventilatory parameters were calculated by IOX2 software (Scireq). Breath inclusion criteria were set in the software to the following: (1) inspiratory time (0.07–1 s), (2) expiratory time (0.1–1 s), (3) tidal volume (0.05–0.8 ml), and (4) respiratory rate (10–320 breaths/ml). Data for all accepted breaths were exported and processed using a custom R script to calculate the average respiratory rate, tidal volume, and minute ventilation for each period. Trials were rejected if many accepted breaths occurred during periods of animal sniffing, grooming, or movement; we used a respiratory rate of 215 breaths/ml as a cutoff for inclusion of trials. A trial was rejected if any of the normoxic periods had an average respiratory rate that exceeded 215 breath/min (comparable to the mean of wild-type in hypoxia) in order to assess calm breathing and exclude artifacts from sniffing, grooming, and movement that correlated with high-frequency events above the ventilation in hypoxia. If a trial was rejected, the animal was retested on subsequent days, for up to four trials, until stable ventilation was reached in control normoxic periods. Data collection and analysis were automated using above inclusion/exclusion criteria. The percentage of experiments rejected between <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals by allele were not statistically significant by the <italic>Z</italic>-test of proportions (p=0.7039, 0.5353, and 0.7114 for <italic>1-1</italic>, <italic>3-1</italic>, and <italic>5-3</italic> alleles, respectively). Because the effect size could not be estimated and variance for <italic>Higd1c</italic> animals was unknown, no sample size determination was performed, but sample sizes were comparable to other published studies (<xref ref-type="bibr" rid="bib13">Del Rio et al., 2013</xref>; <xref ref-type="bibr" rid="bib44">Moreno-Domínguez et al., 2020</xref>; <xref ref-type="bibr" rid="bib58">Soliz et al., 2005</xref>).</p><p>We did not normalize tidal volume or minute ventilation to body weight because for the animals used in our study body weight did not correlate well with respiratory rate, tidal volume, or minute ventilation in wild-type or mutant animals in normoxia or hypoxia. Body weights of <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals were not significantly different by two-way ANOVA with Sidak correction (p=0.9905, 0.9255, and 0.9562 for <italic>1-1</italic>, <italic>3-1</italic>, and <italic>5-3</italic> alleles, respectively). Nevertheless, we verified that all differences that were statistically significant without normalizing by body weight were also significant if we normalized to body weight (p&lt;0.05). In addition to comparing mean values of ventilatory parameters, we showed the % change in the ventilatory parameters for each animal before and after hypoxia (‘Hypoxic response’), using each animal as its own control.</p></sec><sec id="s4-9"><title>Carotid sinus nerve recordings</title><p>Animals were heavily anesthetized with isoflurane and then decapitated (lower cervical level). The carotid bifurcation, including the CB, carotid sinus nerve (CSN), and superior cervical ganglion, was quickly isolated en bloc for in vitro perfusion as described previously (<xref ref-type="bibr" rid="bib53">Roy et al., 2012</xref>). The carotid bifurcation was then transferred to a dissection dish containing physiological saline (115 mM NaCl, 4 mM KCl, 24 mM NaHCO<sub>3</sub>, 2 mM CaCl<sub>2</sub>, 1.25 mM NaH<sub>2</sub>PO<sub>4</sub>, 1 mM MgSO<sub>4</sub>, 10 mM glucose, 12 mM sucrose) bubbling 95% O<sub>2</sub>/5% CO<sub>2</sub>. After 15–20 min, the isolated tissue was transferred to a recording chamber (AR; custom-made) with a built‐in waterfed heating circuit, and the common carotid artery was immediately cannulated for luminal perfusion with physiological saline equilibrated with 100 mmHg PO<sub>2</sub> and 35 mmHg PCO<sub>2</sub> (balance N<sub>2</sub>). After gross dissection, connective tissue was removed, and the CSN was carefully desheathed. The carotid sinus region was bisected. The occipital and internal and external carotid arteries were ligated, and small incisions were made on the internal and external carotid arteries to allow perfusate to exit. A peristaltic pump was used to set the perfusion rate at 7 ml/min, which was sufficient to maintain a constant pressure of 90–100 mmHg at the tip of the cannula. The perfusate was equilibrated with computer‐controlled gas mixtures using CO<sub>2</sub> and O<sub>2</sub> gas analyzers (CA-2A and PA1B, Sable Systems); a gas mixture of 100 mmHg PO<sub>2</sub> and 35 mmHg PCO<sub>2</sub> (balance N<sub>2</sub>) was used to start the experiments (yielding pH ∼ 7.4). Before reaching the cannula, the perfusate was passed through a bubble trap and heat exchanger. The temperature of the perfusate was measured continuously as it departed the preparation and maintained at 37 ± 0.5°C. The effluent from the chamber was recirculated.</p><p>Chemosensory discharge was recorded extracellularly from the whole desheathed CSN, which was placed on a platinum electrode and lifted into a thin film of paraffin oil. A reference electrode was placed close to the bifurcation. CSN activity was monitored using a differential AC amplifier (Model 1700, A‐M Systems) and a secondary amplifier (Model 440, Brownlee Precision). The neural activity was amplified, filtered (0.3–1 kHz), displayed on an oscilloscope, rectified, integrated (200 ms time constant), and stored on a computer using an analog‐to‐digital board (Digidata 1322A, Axon Instruments) and data acquisition software (Axoscope 9.0). Recording was only attempted in nerves that survived cleaning and desheathing. The presence of action potentials under baseline conditions was used as the only test of preparation viability; data was obtained from all preparations deemed viable according to this criterion.</p><p>The following protocol was used for all experiments: (1) the CB was perfused for 5 min with normoxia (100 mmHg PO<sub>2</sub>/35 mmHg PCO<sub>2</sub>) to determine baseline CSN activity; (2) neural responses were obtained by challenging the CB for 4 min with mild, moderate, and severe hypoxia (80, 60, and 40 mmHg PO<sub>2</sub>, respectively) interspersed with normoxia; and (3) a hypercapnic (60 mmHg PCO<sub>2</sub>) challenge was given for 4 min (<xref ref-type="fig" rid="fig3">Figure 3A and B</xref>).</p><p>Data were analyzed offline using custom software (<xref ref-type="bibr" rid="bib70">Wilson, 2022</xref>). CSN activity was divided into 60 s time bins, and the activity in each bin was rectified and summed (expressed as integrated neural discharge). The neural responses for different conditions in the protocol were normalized to the baseline (normoxic) condition. Data acquisition and CSN activity analysis were performed blinded to genotype.</p></sec><sec id="s4-10"><title>Calcium imaging</title><p><italic>Th-Cre<sup>Tg/+</sup>; ROSA-GCaMP3<sup>Tg/Tg</sup>; Higd1c<sup>+/+</sup></italic> and <italic>Th-Cre<sup>Tg/+</sup>; ROSA-GCaMP3<sup>Tg/Tg</sup>; Higd1c<sup>-/-</sup></italic> animals expressing GCaMP3 in glomus cells were generated, and CB was imaged as previously described (<xref ref-type="bibr" rid="bib9">Chang et al., 2015</xref>). Animals were anesthetized with isoflurane and decapitated. Carotid bifurcations were dissected and cleaned in PBS to keep only the CB attached to the bifurcation. The preparation was then incubated in a physiological buffer (115 mM NaCl, 5 mM KCl, 24 mM NaHCO<sub>3</sub>, 2 mM CaCl<sub>2</sub>, 1 mM MgCl<sub>2</sub>, 11 mM glucose) at 26°C in a tissue culture incubator with 5% CO<sub>2</sub> before transfer to the recording chamber for imaging.</p><p>At baseline, the CB was superfused by gravity at 5 ml/min with physiological buffer bubbling 95% O<sub>2</sub>/5% CO<sub>2</sub> in the reservoir to maintain PO<sub>2</sub> ~ 700 mmHg and pH 7.4 in the imaging chamber at 22°C. Buffer pH was lowered to 6.8 by reducing NaHCO<sub>3</sub> to 7 mM with equimolar substitution of NaCl while bubbling 95% O<sub>2</sub>/5% CO<sub>2</sub>. Two levels of hypoxia at PO<sub>2</sub> ~ 25 mmHg and 50 mmHg were generated by bubbling physiological buffer in the reservoir with 90% N<sub>2</sub>/5% O<sub>2</sub>/5% CO<sub>2</sub> and 95% N<sub>2</sub>/5% CO<sub>2</sub>, respectively. The preparation was sequentially stimulated with low pH and hypoxia for periods of 4.5 min each, with 3 min of recovery between stimuli. These were followed by KCl (40 mM) and CN (1 mM) for periods of 2.25 min each, with 4.5 min of recovery between stimuli (<xref ref-type="fig" rid="fig3">Figure 3E and F</xref>).</p><p>Imaging was performed on a Zeiss LSM 7 MP two-photon microscope with a Coherent Ultra II Chameleon laser and a sensitive gallium arsenide phosphide (GaAsP) detector. Preparations were excited at 960 nm, and emission was collected at 500–550 nm. Using a ×20 water immersion objective, we acquired Z-stacks at 2 µm intervals at a resolution of 1024 × 1024 pixels and up to 60–85 µm of tissue depth.</p><p>Regions of interest (ROIs) corresponding to individual glomus cells were identified and analyzed in ImageJ. All ROIs were included in the data. Fpre fluorescence was defined as the average fluorescence over the four frames immediately prior to the onset of the stimulus in the chamber. Mean and peak fluorescence were calculated over the duration when the stimulus was present in the imaging chamber. The ratio of Fstim/Fpre was calculated by dividing the mean and peak by Fpre just preceding the stimulus. Data acquisition and ROI analysis were carried out blinded to genotype.</p></sec><sec id="s4-11"><title>Metabolic imaging</title><p><italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c <sup>-/-</sup></italic> animals were anesthetized with isoflurane and decapitated. Carotid bifurcations were dissected and cleaned in PBS to keep only the CB attached to the bifurcation. The preparation was then incubated in 50 µg/ml rhodamine 123 (Thermo Fisher) in a physiological buffer (115 mM NaCl, 5 mM KCl, 24 mM NaHCO<sub>3</sub>, 2 mM CaCl<sub>2</sub>, 1 mM MgCl<sub>2</sub>, 11 mM glucose) at 26°C in a tissue culture incubator with 5% CO<sub>2</sub> for 30 min before transfer to the recording chamber for imaging.</p><p>At baseline, the CB was superfused by gravity at 5 ml/min with physiological buffer bubbling 95% O<sub>2</sub>/5% CO<sub>2</sub> in the reservoir to maintain PO<sub>2</sub> ~ 700 mmHg and pH 7.4 in the imaging chamber at 22°C. Hypoxia down to PO<sub>2</sub> ~ 10 mmHg was generated by bubbling physiological buffer in the reservoir with 95% N<sub>2</sub>/5% CO<sub>2</sub> for 7.5 min. PO<sub>2</sub> was measured using a Clark style oxygen sensor (OX-50, Unisense). After 6 min of baseline recording, the preparation was stimulated with hypoxia for a period of 7.5 min followed by 7.5 min of recovery between stimuli (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). This was followed by CN (1 mM) and FCCP (2 µM) for periods of 2.25 min each, with 7.5 min of recovery between stimuli. For control experiments with a single FCCP stimulus, the protocol was as follows: 6 min physiological buffer, 2.25 min FCCP (2 µM), and 6 min physiological buffer, all in buffer bubbled with 95% N<sub>2</sub>/5% CO<sub>2</sub>. Imaging and analysis methods were the same for both experimental protocols.</p><p>Imaging was performed on a Zeiss LSM 7 MP two-photon microscope with a Coherent Ultra II Chameleon laser and a sensitive gallium arsenide phosphide (GaAsP) detector. Preparations were excited at 960 nm, and emission was collected at 500–550 nm. Using a ×20 water immersion objective, we acquired Z-stacks at 2 µm intervals at a resolution of 1024 × 1024 pixels and up to 60–85 µm of tissue depth.</p><p>ROIs corresponding to individual glomus cells were identified and analyzed in ImageJ. All ROIs were included in the data except as indicated in specific analyses. We performed baseline subtraction after linear interpolation to account for a linear decrease in baseline fluorescence occurring over the time course of the experiment. First, the fluorescence trace of each ROI was smoothed using a three-point centered rolling average, and the baseline was calculated using linear interpolation between the inter-stimulus intervals. This baseline was then subtracted from the original traces. Fpre fluorescence was defined as the fluorescence immediately prior to the onset of the stimulus in the chamber. Mean and peak fluorescence were calculated over the duration when the stimulus was present in the imaging chamber. The ratio of Fstim/Fpre was calculated by dividing the mean and peak by Fpre just preceding the stimulus. Data acquisition and ROI analysis were carried out blinded to genotype.</p></sec><sec id="s4-12"><title>Stable cell line construction</title><p><italic>HIGD1C</italic>-Myc-DDK/FLAG constructs in pCMV6-Entry were cloned under the control of a CMV promoter in the pCMV6-A-Entry-Hygro plasmid, and COX4I1/COX4I2-Myc-DDK constructs in pCMV6-Entry were cloned in the pCMV6-A-Entry-BSD, using Sfg1 and Pme1 sites. 1–2 µg of vector DNA was mixed with 5 µl of Lipofectamine (Thermo Fisher) in OPTIMEM-I media (GIBCO) to transfect 1.5 × 10<sup>6</sup> cells according tothe manufacturer’s instructions. After 48 hr, media was supplemented with 200 µg/ml of hygromycin or 10 µg/ml of blasticidin and maintained for at least 21 days.</p></sec><sec id="s4-13"><title>Cell culture experimental conditions</title><p><italic>HIGD1A-</italic>KO and <italic>HIGD2A</italic>-KO cells were constructed in HEK293T using the TALEN technology as described in <xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref>. HEK293T cells were grown in 25 mM glucose DMEM (Life Technologies) supplemented with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 50 µg/ml uridine without antibiotics, at 37°C under 5% CO<sub>2</sub>. For metabolic imaging involving HEK293T cells, 10 mm glass coverslips were placed into 1.96 cm<sup>2</sup> wells and coated with 0.2 mg/ml poly-D-lysine for at least 2 hrat room temperature (RT). Two days before the experiment, 7.5 × 10<sup>4</sup> cells in 500 µl of cell media were seeded into each well. For hypoxia experiments, cell cultures were exposed to 1% O<sub>2</sub> for up to 24 hr, or as controls, to standard cell culture oxygen tension (18.6% O<sub>2</sub>). Experiments under controlled oxygen tensions were performed in a HypOxystation H35 (HypOxygen) to minimize undesired oxygen reperfusion. Routinely, cells were analyzed for mycoplasma contamination.</p></sec><sec id="s4-14"><title>Mitochondrial biochemistry</title><p>Mitochondrial fractions were obtained as previously described in <xref ref-type="bibr" rid="bib6">Bourens et al., 2014</xref>; <xref ref-type="bibr" rid="bib21">Fernández-Vizarra et al., 2010</xref>; <xref ref-type="bibr" rid="bib65">Timón-Gómez et al., 2020b</xref> from ten 80% confluent 15 cm plates or from 1 l of liquid culture. Whole-cell extracts were obtained from pelleted cells solubilized in RIPA buffer (25 mM Tris–HCl [pH 7.6], 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% SDS) with 1 mM PMSF for 20 min. Extracts were cleared after 5 min centrifugation at 15,000 rpm at 4°C.</p><p>Proteins were extracted from purified mitochondria in native conditions with either digitonin at a proportion of 1:2 of protein or with n-dodecyl-β-D-maltoside (DDM) at a concentration of 0.4%. Samples were incubated on ice for 10 min and pelleted at 10,000 × <italic>g</italic> for 30 min at 4°C. Samples were prepared for Blue Native Electrophoresis and/or Complex I and Complex IV <italic>in-gel</italic> activity (IGA) assays as described (<xref ref-type="bibr" rid="bib66">Timón-Gómez et al., 2020c</xref>). Immunoprecipitation of HIGD1C-Myc-DDK-tagged proteins was performed using 1 mg of mitochondria, extracted in 1.5 M aminocaproic acid, 50 mM Bis-Tris pH 7, 1% digitonin, 1 mM PMSF, and 8 µl of protease inhibitor cocktail (Sigma, P8340) for 10 min on ice. Samples were pelleted at 10,000 × <italic>g</italic> for 30 min at 4°C, and the extract (Ex) was incubated for 2–3 hr at 4°C with 30 µl of FLAG-conjugated beads (anti-DYDDDDDK beads, Sigma) or empty beads (Thermo Scientific), previously washed in PBS. Beads were washed five times in 1 ml of 1.5 M aminocaproic acid, 50 mM Bis-Tris (pH 7), 0.1% digitonin, and boiled for 5 min with 50 µl of Laemmli buffer two times to release bound material. Representative amounts of all fractions were loaded on 14% SDS-PAGE gels.</p></sec><sec id="s4-15"><title>Complex specific assay and oxygen consumption rate</title><p>Mitochondrial respiratory chain CIV activity was performed according to established methods (<xref ref-type="bibr" rid="bib4">Barrientos et al., 2009</xref>). Citrate synthase activity was used as a control. Enzymatic activities were expressed relative to the total amount of extracted protein.</p><p>OCR in normoxia was measured polarographically using a Clark-type electrode from Hansatech Instruments (Norfolk, UK) at 37°C. Approximately 2 × 10<sup>6</sup> cells were trypsinized and washed with PBS, and then resuspended in 0.5 ml of permeabilized-cell respiration buffer (PRB) containing 0.3 M mannitol, 10 mM KCl, 5 mM MgCl<sub>2</sub>, 0.5 mM EDTA, 0.5 mM EGTA, 1 mg/ml BSA, and 10 mM KH<sub>2</sub>PO<sub>4</sub> (pH 7.4) at 37°C, supplemented with 10 units of hexokinase. The cell suspension was immediately placed into the polarographic chamber to measure endogenous respiration. Digitonin permeabilization (0.02 mg/ml) was performed to assay substrate-driven respiration, using FADH-linked substrates (10 mM succinate plus 5 mM glycerol-3-phosphate) in the presence of 2.5 mM ADP (phosphorylation state). Oligomycin-driven ATP synthesis inhibition (0.75 µg/ml) was assayed to obtain the non-phosphorylating state. Maximal oxygen consumption was reached by successive addition of the uncoupler CCCP (up to 0.4 µM). 0.8 µM KCN was used to assess the mitochondrial specificity of the oxygen consumption measured, and values were normalized by total cell number.</p><p>High-resolution respirometry was used to determine mitochondrial oxygen consumption and ascorbate/TMPD-dependent respiration in normoxia and hypoxia. Measurements were performed in intact or digitonin-permeabilized cells, respectively, in an Oxygraph-2k (Oroboros Instruments, Austria). Assays were performed according to manufacturer’s SUIT protocols, using 2–4 × 10<sup>5</sup> cells washed with PBS and resuspended in Mir05 medium, and results were normalized by cell number. To analyze oxygen kinetics and determine the apparent Km (p50<sub>mito</sub>) for oxygen, we used the software Datlab 2 (Oroboros Instruments) by integrating a hyperbolic function of mitochondrial oxygen consumption and oxygen pressure during and transition from aerobic respiration to anoxia (<xref ref-type="bibr" rid="bib25">Gnaiger, 2001</xref>; <xref ref-type="bibr" rid="bib24">Gnaiger et al., 1995</xref>). For this purpose, intact cell respiration experiments were performed using 2 × 10<sup>6</sup> cells in a respiration medium containing 0.5 mM EGTA, 3 mM MgCl<sub>2</sub>, 60 mM K-lactobionate, 20 mM taurine, 10 mM KH<sub>2</sub>PO<sub>4</sub>, 20 mM HEPES, 110 mM sucrose, and 1 mg/ml BSA.</p></sec><sec id="s4-16"><title>Extraction of total mitochondrial cytochromes</title><p>8 mg of mitochondria were extracted with 330 mM KCl, 50 mM Tris–HCl (pH 7.5), and 10% potassium deoxycholate. Samples were mixed by inversion three times and pelleted for 15 min at 40,000 × <italic>g</italic> at 4°C. The clear supernatant was transferred to a new tube, and a final concentration of 2% potassium cholate was added. The extract was divided into two equal aliquots in 1 ml quartz cuvettes, and the baseline was established. Then, the reference aliquot was oxidized with potassium ferricyanide, and the other was reduced with a few grains of sodium dithionite. Differential reduced vs. oxidized spectrum was recorded from 450 to 650 nm.</p></sec><sec id="s4-17"><title>Statistical analysis</title><p>Data analysis and statistical tests were performed using Microsoft Excel, custom-written scripts in R, and GraphPad Prism software. All data are biological replicates. Group data were analyzed by the Shapiro–Wilk test to determine whether the data was normally distributed with the critical <italic>W</italic> value set at a 5% significance level. Normally distributed data are presented as mean ± standard error of the mean (SEM) and compared by one-way analysis of variance (ANOVA) followed by Tukey’s test or Holm–Sidak correction, two-way ANOVA followed by Tukey’s test for all pairwise comparisons or Sidak correction for multiple pairwise comparisons, or Dunnett’s test for multiple comparisons to a single group. For comparisons that included groups that did not fit the assumption of normal distribution, data are presented as median and interquartile interval and compared by Mann–Whitney <italic>U</italic>-tests followed by Holm–Sidak correction for multiple comparisons or Kruskal–Wallis test with Dunn’s test for multiple comparisons to a single group. For whole-body plethysmography experiments, 2/54 (hypoxia) and 7/54 (hypercapnia) data groups were not normally distributed (p&lt;0.05 by Shapiro–Wilk test). All significant differences found by parametric statistical tests were significant using nonparametric tests. The <italic>Z</italic>-test of proportions was used to compare the proportion of glomus cells with responses at different thresholds. Chi-square test was performed for analysis of Mendelian inheritance of <italic>Higd1c</italic> alleles and to determine whether the distributions of glomus cells responsive to different hypoxic stimuli were drawn from the same population. All tests were two-tailed. No statistical method was used to predetermine sample size.</p></sec><sec id="s4-18"><title>Materials availability</title><p>All unique/stable reagents generated in this article (plasmids, cell line, and mice) are available upon request from Andy Chang (Andy.Chang@ucsf.edu) and Antoni Barrientos (abarrientos@med.miami.edu) with a completed Materials Transfer agreement. Custom scripts used for analysis are available as source code or in a public repository (<xref ref-type="bibr" rid="bib70">Wilson, 2022</xref>).</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Data curation, Software, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Data curation, Software, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con4"><p>Formal analysis, Validation, Investigation, Visualization, Methodology</p></fn><fn fn-type="con" id="con5"><p>Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft</p></fn><fn fn-type="con" id="con6"><p>Validation, Investigation, Methodology, Writing - original draft</p></fn><fn fn-type="con" id="con7"><p>Validation, Investigation, Methodology</p></fn><fn fn-type="con" id="con8"><p>Formal analysis, Validation, Investigation, Methodology</p></fn><fn fn-type="con" id="con9"><p>Formal analysis, Validation, Investigation, Methodology</p></fn><fn fn-type="con" id="con10"><p>Investigation, Visualization, Methodology</p></fn><fn fn-type="con" id="con11"><p>Investigation, Visualization</p></fn><fn fn-type="con" id="con12"><p>Resources</p></fn><fn fn-type="con" id="con13"><p>Resources</p></fn><fn fn-type="con" id="con14"><p>Resources, Supervision, Methodology</p></fn><fn fn-type="con" id="con15"><p>Software, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing - review and editing</p></fn><fn fn-type="con" id="con16"><p>Resources, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn><fn fn-type="con" id="con17"><p>Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>Human subjects: For human tissue, CB bifurcations were procured from research-consented, de-identified organ transplant donors through a collaboration with the UCSF VITAL Core (https://surgeryresearch.ucsf.edu/laboratories-research-centers/vital-core.aspx) and designated as non-human subjects research specimens by the UCSF IRB.</p></fn><fn fn-type="other"><p>All experiments with animals were approved by the Institutional Animal Care and Use Committees at the University of California, San Francisco (AN183237-03) and the University of Calgary (AC16-0204).</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="transrepform"><label>Transparent reporting form</label><media xlink:href="elife-78915-transrepform1-v3.pdf" mimetype="application" mime-subtype="pdf"/></supplementary-material><supplementary-material id="mdar"><label>MDAR checklist</label><media xlink:href="elife-78915-mdarchecklist1-v3.pdf" mimetype="application" mime-subtype="pdf"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>Data generated or analyzed during this study are included in the manuscript. Previously published RNAseq datasets were deposited in GEO under accession codes GSE72166 and GSE76579.</p><p>The following previously published datasets were used:</p><p><element-citation publication-type="data" specific-use="references" id="dataset1"><person-group person-group-type="author"><name><surname>Chang</surname><given-names>AJ</given-names></name><name><surname>Ortega</surname><given-names>FE</given-names></name><name><surname>Riegler</surname><given-names>J</given-names></name><name><surname>Madison</surname><given-names>DV</given-names></name><name><surname>Krasnow</surname><given-names>MA</given-names></name></person-group><year iso-8601-date="2015">2015</year><data-title>Expression profile of mouse carotid body and adrenal medulla</data-title><source>NCBI Gene Expression Omnibus</source><pub-id pub-id-type="accession" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE72166">GSE72166</pub-id></element-citation></p><p><element-citation publication-type="data" specific-use="references" id="dataset2"><person-group person-group-type="author"><name><surname>Matsunami</surname><given-names>H</given-names></name><name><surname>Zhou</surname><given-names>T</given-names></name><name><surname>Chien</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2016">2016</year><data-title>Single cell transcriptome analysis of mouse carotid body glomus cells</data-title><source>NCBI Gene Expression Omnibus</source><pub-id pub-id-type="accession" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE76579">GSE76579</pub-id></element-citation></p></sec><ack id="ack"><title>Acknowledgements</title><p>We thank Peter Lee for technical assistance, Alex Diaz de Arce for assistance with RNAseq analysis, Kailyss Freeman and the UCSF VITAL Core for coordinating donor tissue, ACD Bio for BaseScope in situ hybridization, Blair Gainous, Pauline Colombier, Brian Black, and the CVRI Transgenic Mouse Core for guidance and technical support in generating <italic>Higd1c</italic> mutant mice, Chris Allen for use of his two-photon microscope and cryostat, Jeremy Reiter for use of his widefield microscope, and the UCSF Nikon Imaging Center for use of their confocal and widefield microscopes. We sincerely thank Donor Network West, and most importantly the organ donors and their families, who give this precious gift to further scientific research.</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Abdala</surname><given-names>AP</given-names></name><name><surname>McBryde</surname><given-names>FD</given-names></name><name><surname>Marina</surname><given-names>N</given-names></name><name><surname>Hendy</surname><given-names>EB</given-names></name><name><surname>Engelman</surname><given-names>ZJ</given-names></name><name><surname>Fudim</surname><given-names>M</given-names></name><name><surname>Sobotka</surname><given-names>PA</given-names></name><name><surname>Gourine</surname><given-names>AV</given-names></name><name><surname>Paton</surname><given-names>JFR</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Hypertension is critically dependent on the carotid body input in the spontaneously hypertensive rat</article-title><source>The Journal of Physiology</source><volume>590</volume><fpage>4269</fpage><lpage>4277</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2012.237800</pub-id><pub-id pub-id-type="pmid">22687617</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>An</surname><given-names>HJ</given-names></name><name><surname>Shin</surname><given-names>H</given-names></name><name><surname>Jo</surname><given-names>SG</given-names></name><name><surname>Kim</surname><given-names>YJ</given-names></name><name><surname>Lee</surname><given-names>JO</given-names></name><name><surname>Paik</surname><given-names>SG</given-names></name><name><surname>Lee</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The survival effect of mitochondrial Higd-1a is associated with suppression of cytochrome c release and prevention of caspase activation</article-title><source>Biochimica et Biophysica Acta</source><volume>1813</volume><fpage>2088</fpage><lpage>2098</lpage><pub-id pub-id-type="doi">10.1016/j.bbamcr.2011.07.017</pub-id><pub-id pub-id-type="pmid">21856340</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barioni</surname><given-names>NO</given-names></name><name><surname>Derakhshan</surname><given-names>F</given-names></name><name><surname>Tenorio Lopes</surname><given-names>L</given-names></name><name><surname>Onimaru</surname><given-names>H</given-names></name><name><surname>Roy</surname><given-names>A</given-names></name><name><surname>McDonald</surname><given-names>F</given-names></name><name><surname>Scheibli</surname><given-names>E</given-names></name><name><surname>Baghdadwala</surname><given-names>MI</given-names></name><name><surname>Heidari</surname><given-names>N</given-names></name><name><surname>Bharadia</surname><given-names>M</given-names></name><name><surname>Ikeda</surname><given-names>K</given-names></name><name><surname>Yazawa</surname><given-names>I</given-names></name><name><surname>Okada</surname><given-names>Y</given-names></name><name><surname>Harris</surname><given-names>MB</given-names></name><name><surname>Dutschmann</surname><given-names>M</given-names></name><name><surname>Wilson</surname><given-names>RJA</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Novel oxygen sensing mechanism in the spinal cord involved in cardiorespiratory responses to hypoxia</article-title><source>Science Advances</source><volume>8</volume><elocation-id>eabm1444</elocation-id><pub-id pub-id-type="doi">10.1126/sciadv.abm1444</pub-id><pub-id pub-id-type="pmid">35333571</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barrientos</surname><given-names>A</given-names></name><name><surname>Fontanesi</surname><given-names>F</given-names></name><name><surname>Díaz</surname><given-names>F</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Evaluation of the mitochondrial respiratory chain and oxidative phosphorylation system using polarography and spectrophotometric enzyme assays</article-title><source>Current Protocols in Human Genetics</source><volume>Chapter 19</volume><elocation-id>Unit19</elocation-id><pub-id pub-id-type="doi">10.1002/0471142905.hg1903s63</pub-id><pub-id pub-id-type="pmid">19806590</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Black</surname><given-names>AM</given-names></name><name><surname>McCloskey</surname><given-names>DI</given-names></name><name><surname>Torrance</surname><given-names>RW</given-names></name></person-group><year iso-8601-date="1971">1971</year><article-title>The responses of carotid body chemoreceptors in the cat to sudden changes of hypercapnic and hypoxic stimuli</article-title><source>Respiration Physiology</source><volume>13</volume><fpage>36</fpage><lpage>49</lpage><pub-id pub-id-type="doi">10.1016/0034-5687(71)90063-6</pub-id><pub-id pub-id-type="pmid">5112829</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bourens</surname><given-names>M</given-names></name><name><surname>Boulet</surname><given-names>A</given-names></name><name><surname>Leary</surname><given-names>SC</given-names></name><name><surname>Barrientos</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Human COX20 cooperates with SCO1 and SCO2 to mature COX2 and promote the assembly of cytochrome c oxidase</article-title><source>Human Molecular Genetics</source><volume>23</volume><fpage>2901</fpage><lpage>2913</lpage><pub-id pub-id-type="doi">10.1093/hmg/ddu003</pub-id><pub-id pub-id-type="pmid">24403053</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Buckler</surname><given-names>KJ</given-names></name><name><surname>Turner</surname><given-names>PJ</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Oxygen sensitivity of mitochondrial function in rat arterial chemoreceptor cells</article-title><source>The Journal of Physiology</source><volume>591</volume><fpage>3549</fpage><lpage>3563</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2013.257741</pub-id><pub-id pub-id-type="pmid">23671162</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Buckler</surname><given-names>KJ</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Task channels in arterial chemoreceptors and their role in oxygen and acid sensing</article-title><source>Pflugers Archiv</source><volume>467</volume><fpage>1013</fpage><lpage>1025</lpage><pub-id pub-id-type="doi">10.1007/s00424-015-1689-1</pub-id><pub-id pub-id-type="pmid">25623783</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chang</surname><given-names>AJ</given-names></name><name><surname>Ortega</surname><given-names>FE</given-names></name><name><surname>Riegler</surname><given-names>J</given-names></name><name><surname>Madison</surname><given-names>DV</given-names></name><name><surname>Krasnow</surname><given-names>MA</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Oxygen regulation of breathing through an olfactory receptor activated by lactate</article-title><source>Nature</source><volume>527</volume><fpage>240</fpage><lpage>244</lpage><pub-id pub-id-type="doi">10.1038/nature15721</pub-id><pub-id pub-id-type="pmid">26560302</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chang</surname><given-names>AJ</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Acute oxygen sensing by the carotid body: from mitochondria to plasma membrane</article-title><source>Journal of Applied Physiology</source><volume>123</volume><fpage>1335</fpage><lpage>1343</lpage><pub-id pub-id-type="doi">10.1152/japplphysiol.00398.2017</pub-id><pub-id pub-id-type="pmid">28819004</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>De Castro</surname><given-names>F</given-names></name></person-group><year iso-8601-date="1928">1928</year><article-title>Sur la structure et l’innervation du sinus carotidien de l’homme et des mammifères: nouveaux faits sur l’innervation et la fonction du glomus caroticum</article-title><source>Trav Lab Rech Biol</source><volume>25</volume><fpage>331</fpage><lpage>380</lpage></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>De Castro</surname><given-names>F</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>The discovery of sensory nature of the carotid bodies -- invited article</article-title><source>Advances in Experimental Medicine and Biology</source><volume>648</volume><fpage>1</fpage><lpage>18</lpage><pub-id pub-id-type="doi">10.1007/978-90-481-2259-2_1</pub-id><pub-id pub-id-type="pmid">19536460</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Del Rio</surname><given-names>R</given-names></name><name><surname>Marcus</surname><given-names>NJ</given-names></name><name><surname>Schultz</surname><given-names>HD</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Carotid chemoreceptor ablation improves survival in heart failure: rescuing autonomic control of cardiorespiratory function</article-title><source>Journal of the American College of Cardiology</source><volume>62</volume><fpage>2422</fpage><lpage>2430</lpage><pub-id pub-id-type="doi">10.1016/j.jacc.2013.07.079</pub-id><pub-id pub-id-type="pmid">24013056</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Del Rio</surname><given-names>R</given-names></name><name><surname>Andrade</surname><given-names>DC</given-names></name><name><surname>Lucero</surname><given-names>C</given-names></name><name><surname>Arias</surname><given-names>P</given-names></name><name><surname>Iturriaga</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Carotid body ablation abrogates hypertension and autonomic alterations induced by intermittent hypoxia in rats</article-title><source>Hypertension</source><volume>68</volume><fpage>436</fpage><lpage>445</lpage><pub-id pub-id-type="doi">10.1161/HYPERTENSIONAHA.116.07255</pub-id><pub-id pub-id-type="pmid">27381902</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Duchen</surname><given-names>MR</given-names></name><name><surname>Biscoe</surname><given-names>TJ</given-names></name></person-group><year iso-8601-date="1992">1992a</year><article-title>Mitochondrial function in type I cells isolated from rabbit arterial chemoreceptors</article-title><source>The Journal of Physiology</source><volume>450</volume><fpage>13</fpage><lpage>31</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.1992.sp019114</pub-id><pub-id pub-id-type="pmid">1432706</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Duchen</surname><given-names>MR</given-names></name><name><surname>Biscoe</surname><given-names>TJ</given-names></name></person-group><year iso-8601-date="1992">1992b</year><article-title>Relative mitochondrial membrane potential and [ ca2+ ] I in type I cells isolated from the rabbit carotid body</article-title><source>The Journal of Physiology</source><volume>450</volume><fpage>33</fpage><lpage>61</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.1992.sp019115</pub-id><pub-id pub-id-type="pmid">1432712</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Evans</surname><given-names>AM</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Ampk breathing and oxygen supply</article-title><source>Respiratory Physiology &amp; Neurobiology</source><volume>265</volume><fpage>112</fpage><lpage>120</lpage><pub-id pub-id-type="doi">10.1016/j.resp.2018.08.011</pub-id><pub-id pub-id-type="pmid">30243821</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fagerlund</surname><given-names>MJ</given-names></name><name><surname>Kåhlin</surname><given-names>J</given-names></name><name><surname>Ebberyd</surname><given-names>A</given-names></name><name><surname>Schulte</surname><given-names>G</given-names></name><name><surname>Mkrtchian</surname><given-names>S</given-names></name><name><surname>Eriksson</surname><given-names>LI</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>The human carotid body: expression of oxygen sensing and signaling genes of relevance for anesthesia</article-title><source>Anesthesiology</source><volume>113</volume><fpage>1270</fpage><lpage>1279</lpage><pub-id pub-id-type="doi">10.1097/ALN.0b013e3181fac061</pub-id><pub-id pub-id-type="pmid">20980909</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Feng</surname><given-names>Y</given-names></name><name><surname>Ma</surname><given-names>J</given-names></name><name><surname>Yuan</surname><given-names>L</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>β-methylphenylalanine exerts neuroprotective effects in a Parkinson’s disease model by protecting against tyrosine hydroxylase depletion</article-title><source>Journal of Cellular and Molecular Medicine</source><volume>24</volume><fpage>9871</fpage><lpage>9880</lpage><pub-id pub-id-type="doi">10.1111/jcmm.15571</pub-id><pub-id pub-id-type="pmid">32697044</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernández-Agüera</surname><given-names>MC</given-names></name><name><surname>Gao</surname><given-names>L</given-names></name><name><surname>González-Rodríguez</surname><given-names>P</given-names></name><name><surname>Pintado</surname><given-names>CO</given-names></name><name><surname>Arias-Mayenco</surname><given-names>I</given-names></name><name><surname>García-Flores</surname><given-names>P</given-names></name><name><surname>García-Pergañeda</surname><given-names>A</given-names></name><name><surname>Pascual</surname><given-names>A</given-names></name><name><surname>Ortega-Sáenz</surname><given-names>P</given-names></name><name><surname>López-Barneo</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Oxygen sensing by arterial chemoreceptors depends on mitochondrial complex I signaling</article-title><source>Cell Metabolism</source><volume>22</volume><fpage>825</fpage><lpage>837</lpage><pub-id pub-id-type="doi">10.1016/j.cmet.2015.09.004</pub-id><pub-id pub-id-type="pmid">26437605</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernández-Vizarra</surname><given-names>E</given-names></name><name><surname>Ferrín</surname><given-names>G</given-names></name><name><surname>Pérez-Martos</surname><given-names>A</given-names></name><name><surname>Fernández-Silva</surname><given-names>P</given-names></name><name><surname>Zeviani</surname><given-names>M</given-names></name><name><surname>Enríquez</surname><given-names>JA</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Isolation of mitochondria for biogenetical studies: an update</article-title><source>Mitochondrion</source><volume>10</volume><fpage>253</fpage><lpage>262</lpage><pub-id pub-id-type="doi">10.1016/j.mito.2009.12.148</pub-id><pub-id pub-id-type="pmid">20034597</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fletcher</surname><given-names>EC</given-names></name><name><surname>Lesske</surname><given-names>J</given-names></name><name><surname>Behm</surname><given-names>R</given-names></name><name><surname>Miller</surname><given-names>CC</given-names></name><name><surname>Stauss</surname><given-names>H</given-names></name><name><surname>Unger</surname><given-names>T</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Carotid chemoreceptors, systemic blood pressure, and chronic episodic hypoxia mimicking sleep apnea</article-title><source>Journal of Applied Physiology</source><volume>72</volume><fpage>1978</fpage><lpage>1984</lpage><pub-id pub-id-type="doi">10.1152/jappl.1992.72.5.1978</pub-id><pub-id pub-id-type="pmid">1601808</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Forster</surname><given-names>RE</given-names></name></person-group><year iso-8601-date="1968">1968</year><source>Proc Wates Foundation Symp on Arterial Chemoreceptors</source><volume>Vol. 115</volume><publisher-loc>Blackwell, Oxford</publisher-loc><publisher-name>Chemoreceptors</publisher-name></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gnaiger</surname><given-names>E</given-names></name><name><surname>Steinlechner-Maran</surname><given-names>R</given-names></name><name><surname>Méndez</surname><given-names>G</given-names></name><name><surname>Eberl</surname><given-names>T</given-names></name><name><surname>Margreiter</surname><given-names>R</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Control of mitochondrial and cellular respiration by oxygen</article-title><source>Journal of Bioenergetics and Biomembranes</source><volume>27</volume><fpage>583</fpage><lpage>596</lpage><pub-id pub-id-type="doi">10.1007/BF02111656</pub-id><pub-id pub-id-type="pmid">8746845</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gnaiger</surname><given-names>E</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Bioenergetics at low oxygen: dependence of respiration and phosphorylation on oxygen and adenosine diphosphate supply</article-title><source>Respiration Physiology</source><volume>128</volume><fpage>277</fpage><lpage>297</lpage><pub-id pub-id-type="doi">10.1016/s0034-5687(01)00307-3</pub-id><pub-id pub-id-type="pmid">11718759</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gong</surname><given-names>S</given-names></name><name><surname>Doughty</surname><given-names>M</given-names></name><name><surname>Harbaugh</surname><given-names>CR</given-names></name><name><surname>Cummins</surname><given-names>A</given-names></name><name><surname>Hatten</surname><given-names>ME</given-names></name><name><surname>Heintz</surname><given-names>N</given-names></name><name><surname>Gerfen</surname><given-names>CR</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Targeting Cre recombinase to specific neuron populations with bacterial artificial chromosome constructs</article-title><source>The Journal of Neuroscience</source><volume>27</volume><fpage>9817</fpage><lpage>9823</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.2707-07.2007</pub-id><pub-id pub-id-type="pmid">17855595</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hall</surname><given-names>AM</given-names></name><name><surname>Unwin</surname><given-names>RJ</given-names></name><name><surname>Parker</surname><given-names>N</given-names></name><name><surname>Duchen</surname><given-names>MR</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Multiphoton imaging reveals differences in mitochondrial function between nephron segments</article-title><source>Journal of the American Society of Nephrology</source><volume>20</volume><fpage>1293</fpage><lpage>1302</lpage><pub-id pub-id-type="doi">10.1681/ASN.2008070759</pub-id><pub-id pub-id-type="pmid">19470684</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hayashi</surname><given-names>T</given-names></name><name><surname>Asano</surname><given-names>Y</given-names></name><name><surname>Shintani</surname><given-names>Y</given-names></name><name><surname>Aoyama</surname><given-names>H</given-names></name><name><surname>Kioka</surname><given-names>H</given-names></name><name><surname>Tsukamoto</surname><given-names>O</given-names></name><name><surname>Hikita</surname><given-names>M</given-names></name><name><surname>Shinzawa-Itoh</surname><given-names>K</given-names></name><name><surname>Takafuji</surname><given-names>K</given-names></name><name><surname>Higo</surname><given-names>S</given-names></name><name><surname>Kato</surname><given-names>H</given-names></name><name><surname>Yamazaki</surname><given-names>S</given-names></name><name><surname>Matsuoka</surname><given-names>K</given-names></name><name><surname>Nakano</surname><given-names>A</given-names></name><name><surname>Asanuma</surname><given-names>H</given-names></name><name><surname>Asakura</surname><given-names>M</given-names></name><name><surname>Minamino</surname><given-names>T</given-names></name><name><surname>Goto</surname><given-names>Y</given-names></name><name><surname>Ogura</surname><given-names>T</given-names></name><name><surname>Kitakaze</surname><given-names>M</given-names></name><name><surname>Komuro</surname><given-names>I</given-names></name><name><surname>Sakata</surname><given-names>Y</given-names></name><name><surname>Tsukihara</surname><given-names>T</given-names></name><name><surname>Yoshikawa</surname><given-names>S</given-names></name><name><surname>Takashima</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Higd1a is a positive regulator of cytochrome c oxidase</article-title><source>PNAS</source><volume>112</volume><fpage>1553</fpage><lpage>1558</lpage><pub-id pub-id-type="doi">10.1073/pnas.1419767112</pub-id><pub-id pub-id-type="pmid">25605899</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heymans</surname><given-names>C</given-names></name><name><surname>Bouckaert</surname><given-names>JJ</given-names></name><name><surname>Dautreband</surname><given-names>L</given-names></name></person-group><year iso-8601-date="1930">1930</year><article-title>Sinus carotidien et reflexes respiratoires, II. influences repiratoires reflexes de l’acidose, de d’alcalose, de l’anhydride carbonique, de l’ion hydrogene et de l’anoxemie: sinus carotidiens et echanges respiratoires dans les poumons et au dela des poumons</article-title><source>Archives Internationales de Pharmacodynamie et de Therapie</source><volume>39</volume><fpage>400</fpage><lpage>408</lpage></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Heymans</surname><given-names>C</given-names></name></person-group><year iso-8601-date="1963">1963</year><article-title>A look at an old but still current problem</article-title><source>Annual Review of Physiology</source><volume>25</volume><fpage>1</fpage><lpage>14</lpage><pub-id pub-id-type="doi">10.1146/annurev.ph.25.030163.000245</pub-id><pub-id pub-id-type="pmid">13954329</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Holmes</surname><given-names>AP</given-names></name><name><surname>Ray</surname><given-names>CJ</given-names></name><name><surname>Coney</surname><given-names>AM</given-names></name><name><surname>Kumar</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Is carotid body physiological O2 sensitivity determined by a unique mitochondrial phenotype?</article-title><source>Frontiers in Physiology</source><volume>9</volume><elocation-id>562</elocation-id><pub-id pub-id-type="doi">10.3389/fphys.2018.00562</pub-id><pub-id pub-id-type="pmid">29867584</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Jobsis</surname><given-names>FF</given-names></name></person-group><year iso-8601-date="1968">1968</year><chapter-title>Section 3, respiration</chapter-title><person-group person-group-type="editor"><name><surname>Jobsis</surname><given-names>FF</given-names></name></person-group><source>In Handbook of Physiology</source><publisher-name>PlumX Metrics</publisher-name><fpage>1</fpage><lpage>109</lpage></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kim</surname><given-names>I</given-names></name><name><surname>Yang</surname><given-names>D</given-names></name><name><surname>Tang</surname><given-names>X</given-names></name><name><surname>Carroll</surname><given-names>JL</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Reference gene validation for qPCR in rat carotid body during postnatal development</article-title><source>BMC Research Notes</source><volume>4</volume><elocation-id>440</elocation-id><pub-id pub-id-type="doi">10.1186/1756-0500-4-440</pub-id><pub-id pub-id-type="pmid">22023793</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kumar</surname><given-names>P</given-names></name><name><surname>Prabhakar</surname><given-names>NR</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Peripheral chemoreceptors: function and plasticity of the carotid body</article-title><source>Comprehensive Physiology</source><volume>2</volume><fpage>141</fpage><lpage>219</lpage><pub-id pub-id-type="doi">10.1002/cphy.c100069</pub-id><pub-id pub-id-type="pmid">23728973</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lahiri</surname><given-names>S</given-names></name><name><surname>DeLaney</surname><given-names>RG</given-names></name></person-group><year iso-8601-date="1975">1975a</year><article-title>Relationship between carotid chemoreceptor activity and ventilation in the cat</article-title><source>Respiration Physiology</source><volume>24</volume><fpage>267</fpage><lpage>286</lpage><pub-id pub-id-type="doi">10.1016/0034-5687(75)90018-3</pub-id><pub-id pub-id-type="pmid">242050</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lahiri</surname><given-names>S</given-names></name><name><surname>DeLaney</surname><given-names>RG</given-names></name></person-group><year iso-8601-date="1975">1975b</year><article-title>Stimulus interaction in the responses of carotid body chemoreceptor single afferent fibers</article-title><source>Respiration Physiology</source><volume>24</volume><fpage>249</fpage><lpage>266</lpage><pub-id pub-id-type="doi">10.1016/0034-5687(75)90017-1</pub-id><pub-id pub-id-type="pmid">242049</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Leonard</surname><given-names>EM</given-names></name><name><surname>Salman</surname><given-names>S</given-names></name><name><surname>Nurse</surname><given-names>CA</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Sensory processing and integration at the carotid body tripartite synapse: neurotransmitter functions and effects of chronic hypoxia</article-title><source>Frontiers in Physiology</source><volume>9</volume><elocation-id>225</elocation-id><pub-id pub-id-type="doi">10.3389/fphys.2018.00225</pub-id><pub-id pub-id-type="pmid">29615922</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lu</surname><given-names>Y</given-names></name><name><surname>Whiteis</surname><given-names>CA</given-names></name><name><surname>Sluka</surname><given-names>KA</given-names></name><name><surname>Chapleau</surname><given-names>MW</given-names></name><name><surname>Abboud</surname><given-names>FM</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Responses of glomus cells to hypoxia and acidosis are uncoupled, reciprocal and linked to ASIC3 expression: selectivity of chemosensory transduction</article-title><source>The Journal of Physiology</source><volume>591</volume><fpage>919</fpage><lpage>932</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2012.247189</pub-id><pub-id pub-id-type="pmid">23165770</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Macias</surname><given-names>D</given-names></name><name><surname>Cowburn</surname><given-names>AS</given-names></name><name><surname>Torres-Torrelo</surname><given-names>H</given-names></name><name><surname>Ortega-Sáenz</surname><given-names>P</given-names></name><name><surname>López-Barneo</surname><given-names>J</given-names></name><name><surname>Johnson</surname><given-names>RS</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Hif-2Α is essential for carotid body development and function</article-title><source>eLife</source><volume>7</volume><elocation-id>e34681</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.34681</pub-id><pub-id pub-id-type="pmid">29671738</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Marcus</surname><given-names>NJ</given-names></name><name><surname>Del Rio</surname><given-names>R</given-names></name><name><surname>Schultz</surname><given-names>HD</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Central role of carotid body chemoreceptors in disordered breathing and cardiorenal dysfunction in chronic heart failure</article-title><source>Frontiers in Physiology</source><volume>5</volume><elocation-id>438</elocation-id><pub-id pub-id-type="doi">10.3389/fphys.2014.00438</pub-id><pub-id pub-id-type="pmid">25505417</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maßberg</surname><given-names>D</given-names></name><name><surname>Jovancevic</surname><given-names>N</given-names></name><name><surname>Offermann</surname><given-names>A</given-names></name><name><surname>Simon</surname><given-names>A</given-names></name><name><surname>Baniahmad</surname><given-names>A</given-names></name><name><surname>Perner</surname><given-names>S</given-names></name><name><surname>Pungsrinont</surname><given-names>T</given-names></name><name><surname>Luko</surname><given-names>K</given-names></name><name><surname>Philippou</surname><given-names>S</given-names></name><name><surname>Ubrig</surname><given-names>B</given-names></name><name><surname>Heiland</surname><given-names>M</given-names></name><name><surname>Weber</surname><given-names>L</given-names></name><name><surname>Altmüller</surname><given-names>J</given-names></name><name><surname>Becker</surname><given-names>C</given-names></name><name><surname>Gisselmann</surname><given-names>G</given-names></name><name><surname>Gelis</surname><given-names>L</given-names></name><name><surname>Hatt</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>The activation of OR51E1 causes growth suppression of human prostate cancer cells</article-title><source>Oncotarget</source><volume>7</volume><fpage>48231</fpage><lpage>48249</lpage><pub-id pub-id-type="doi">10.18632/oncotarget.10197</pub-id><pub-id pub-id-type="pmid">27374083</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mills</surname><given-names>E</given-names></name><name><surname>Jöbsis</surname><given-names>FF</given-names></name></person-group><year iso-8601-date="1970">1970</year><article-title>Simultaneous measurement of cytochrome A3 reduction and chemoreceptor afferent activity in the carotid body</article-title><source>Nature</source><volume>225</volume><fpage>1147</fpage><lpage>1149</lpage><pub-id pub-id-type="doi">10.1038/2251147a0</pub-id><pub-id pub-id-type="pmid">4313870</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mills</surname><given-names>E</given-names></name><name><surname>Jöbsis</surname><given-names>FF</given-names></name></person-group><year iso-8601-date="1972">1972</year><article-title>Mitochondrial respiratory chain of carotid body and chemoreceptor response to changes in oxygen tension</article-title><source>Journal of Neurophysiology</source><volume>35</volume><fpage>405</fpage><lpage>428</lpage><pub-id pub-id-type="doi">10.1152/jn.1972.35.4.405</pub-id><pub-id pub-id-type="pmid">4338562</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moreno-Domínguez</surname><given-names>A</given-names></name><name><surname>Ortega-Sáenz</surname><given-names>P</given-names></name><name><surname>Gao</surname><given-names>L</given-names></name><name><surname>Colinas</surname><given-names>O</given-names></name><name><surname>García-Flores</surname><given-names>P</given-names></name><name><surname>Bonilla-Henao</surname><given-names>V</given-names></name><name><surname>Aragonés</surname><given-names>J</given-names></name><name><surname>Hüttemann</surname><given-names>M</given-names></name><name><surname>Grossman</surname><given-names>LI</given-names></name><name><surname>Weissmann</surname><given-names>N</given-names></name><name><surname>Sommer</surname><given-names>N</given-names></name><name><surname>López-Barneo</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Acute O2 sensing through hif2α-dependent expression of atypical cytochrome oxidase subunits in arterial chemoreceptors</article-title><source>Science Signaling</source><volume>13</volume><elocation-id>615</elocation-id><pub-id pub-id-type="doi">10.1126/scisignal.aay9452</pub-id><pub-id pub-id-type="pmid">31848220</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Narkiewicz</surname><given-names>K</given-names></name><name><surname>Ratcliffe</surname><given-names>LEK</given-names></name><name><surname>Hart</surname><given-names>EC</given-names></name><name><surname>Briant</surname><given-names>LJB</given-names></name><name><surname>Chrostowska</surname><given-names>M</given-names></name><name><surname>Wolf</surname><given-names>J</given-names></name><name><surname>Szyndler</surname><given-names>A</given-names></name><name><surname>Hering</surname><given-names>D</given-names></name><name><surname>Abdala</surname><given-names>AP</given-names></name><name><surname>Manghat</surname><given-names>N</given-names></name><name><surname>Burchell</surname><given-names>AE</given-names></name><name><surname>Durant</surname><given-names>C</given-names></name><name><surname>Lobo</surname><given-names>MD</given-names></name><name><surname>Sobotka</surname><given-names>PA</given-names></name><name><surname>Patel</surname><given-names>NK</given-names></name><name><surname>Leiter</surname><given-names>JC</given-names></name><name><surname>Engelman</surname><given-names>ZJ</given-names></name><name><surname>Nightingale</surname><given-names>AK</given-names></name><name><surname>Paton</surname><given-names>JFR</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Unilateral carotid body resection in resistant hypertension: a safety and feasibility trial</article-title><source>JACC. Basic to Translational Science</source><volume>1</volume><fpage>313</fpage><lpage>324</lpage><pub-id pub-id-type="doi">10.1016/j.jacbts.2016.06.004</pub-id><pub-id pub-id-type="pmid">27766316</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Neil</surname><given-names>E</given-names></name><name><surname>O’Regan</surname><given-names>RG</given-names></name></person-group><year iso-8601-date="1971">1971</year><article-title>Efferent and afferent impulse activity recorded from few-fibre preparations of otherwise intact sinus and aortic nerves</article-title><source>The Journal of Physiology</source><volume>215</volume><fpage>33</fpage><lpage>47</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.1971.sp009456</pub-id><pub-id pub-id-type="pmid">5579666</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ortega-Sáenz</surname><given-names>P</given-names></name><name><surname>López-Barneo</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Physiology of the carotid body: from molecules to disease</article-title><source>Annual Review of Physiology</source><volume>82</volume><fpage>127</fpage><lpage>149</lpage><pub-id pub-id-type="doi">10.1146/annurev-physiol-020518-114427</pub-id><pub-id pub-id-type="pmid">31618601</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Otlyga</surname><given-names>D</given-names></name><name><surname>Tsvetkova</surname><given-names>E</given-names></name><name><surname>Junemann</surname><given-names>O</given-names></name><name><surname>Saveliev</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Immunohistochemical characteristics of the human carotid body in the antenatal and postnatal periods of development</article-title><source>International Journal of Molecular Sciences</source><volume>22</volume><elocation-id>15</elocation-id><pub-id pub-id-type="doi">10.3390/ijms22158222</pub-id><pub-id pub-id-type="pmid">34360987</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peng</surname><given-names>Y-J</given-names></name><name><surname>Makarenko</surname><given-names>VV</given-names></name><name><surname>Gridina</surname><given-names>A</given-names></name><name><surname>Chupikova</surname><given-names>I</given-names></name><name><surname>Zhang</surname><given-names>X</given-names></name><name><surname>Kumar</surname><given-names>GK</given-names></name><name><surname>Fox</surname><given-names>AP</given-names></name><name><surname>Prabhakar</surname><given-names>NR</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>H2S mediates carotid body response to hypoxia but not anoxia</article-title><source>Respiratory Physiology &amp; Neurobiology</source><volume>259</volume><fpage>75</fpage><lpage>85</lpage><pub-id pub-id-type="doi">10.1016/j.resp.2018.08.001</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peng</surname><given-names>YJ</given-names></name><name><surname>Gridina</surname><given-names>A</given-names></name><name><surname>Wang</surname><given-names>B</given-names></name><name><surname>Nanduri</surname><given-names>J</given-names></name><name><surname>Fox</surname><given-names>AP</given-names></name><name><surname>Prabhakar</surname><given-names>NR</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Olfactory receptor 78 participates in carotid body response to a wide range of low O2 levels but not severe hypoxia</article-title><source>Journal of Neurophysiology</source><volume>123</volume><fpage>1886</fpage><lpage>1895</lpage><pub-id pub-id-type="doi">10.1152/jn.00075.2020</pub-id><pub-id pub-id-type="pmid">32208891</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Perry</surname><given-names>SW</given-names></name><name><surname>Norman</surname><given-names>JP</given-names></name><name><surname>Barbieri</surname><given-names>J</given-names></name><name><surname>Brown</surname><given-names>EB</given-names></name><name><surname>Gelbard</surname><given-names>HA</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Mitochondrial membrane potential probes and the proton gradient: a practical usage guide</article-title><source>BioTechniques</source><volume>50</volume><fpage>98</fpage><lpage>115</lpage><pub-id pub-id-type="doi">10.2144/000113610</pub-id><pub-id pub-id-type="pmid">21486251</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ribeiro</surname><given-names>MJ</given-names></name><name><surname>Sacramento</surname><given-names>JF</given-names></name><name><surname>Gonzalez</surname><given-names>C</given-names></name><name><surname>Guarino</surname><given-names>MP</given-names></name><name><surname>Monteiro</surname><given-names>EC</given-names></name><name><surname>Conde</surname><given-names>SV</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Carotid body denervation prevents the development of insulin resistance and hypertension induced by hypercaloric diets</article-title><source>Diabetes</source><volume>62</volume><fpage>2905</fpage><lpage>2916</lpage><pub-id pub-id-type="doi">10.2337/db12-1463</pub-id><pub-id pub-id-type="pmid">23530003</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Roy</surname><given-names>A</given-names></name><name><surname>Mandadi</surname><given-names>S</given-names></name><name><surname>Fiamma</surname><given-names>MN</given-names></name><name><surname>Rodikova</surname><given-names>E</given-names></name><name><surname>Ferguson</surname><given-names>EV</given-names></name><name><surname>Whelan</surname><given-names>PJ</given-names></name><name><surname>Wilson</surname><given-names>RJA</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Anandamide modulates carotid sinus nerve afferent activity via TRPV1 receptors increasing responses to heat</article-title><source>Journal of Applied Physiology</source><volume>112</volume><fpage>212</fpage><lpage>224</lpage><pub-id pub-id-type="doi">10.1152/japplphysiol.01303.2010</pub-id><pub-id pub-id-type="pmid">21903882</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sacramento</surname><given-names>JF</given-names></name><name><surname>Ribeiro</surname><given-names>MJ</given-names></name><name><surname>Rodrigues</surname><given-names>T</given-names></name><name><surname>Olea</surname><given-names>E</given-names></name><name><surname>Melo</surname><given-names>BF</given-names></name><name><surname>Guarino</surname><given-names>MP</given-names></name><name><surname>Fonseca-Pinto</surname><given-names>R</given-names></name><name><surname>Ferreira</surname><given-names>CR</given-names></name><name><surname>Coelho</surname><given-names>J</given-names></name><name><surname>Obeso</surname><given-names>A</given-names></name><name><surname>Seiça</surname><given-names>R</given-names></name><name><surname>Matafome</surname><given-names>P</given-names></name><name><surname>Conde</surname><given-names>SV</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Functional abolition of carotid body activity restores insulin action and glucose homeostasis in rats: key roles for visceral adipose tissue and the liver</article-title><source>Diabetologia</source><volume>60</volume><fpage>158</fpage><lpage>168</lpage><pub-id pub-id-type="doi">10.1007/s00125-016-4133-y</pub-id><pub-id pub-id-type="pmid">27744526</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shapleigh</surname><given-names>JP</given-names></name><name><surname>Hosler</surname><given-names>JP</given-names></name><name><surname>Tecklenburg</surname><given-names>MM</given-names></name><name><surname>Kim</surname><given-names>Y</given-names></name><name><surname>Babcock</surname><given-names>GT</given-names></name><name><surname>Gennis</surname><given-names>RB</given-names></name><name><surname>Ferguson-Miller</surname><given-names>S</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Definition of the catalytic site of cytochrome c oxidase: specific ligands of heme a and the heme a3-cub center</article-title><source>PNAS</source><volume>89</volume><fpage>4786</fpage><lpage>4790</lpage><pub-id pub-id-type="doi">10.1073/pnas.89.11.4786</pub-id><pub-id pub-id-type="pmid">1317571</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shen</surname><given-names>Y</given-names></name><name><surname>Yue</surname><given-names>F</given-names></name><name><surname>McCleary</surname><given-names>DF</given-names></name><name><surname>Ye</surname><given-names>Z</given-names></name><name><surname>Edsall</surname><given-names>L</given-names></name><name><surname>Kuan</surname><given-names>S</given-names></name><name><surname>Wagner</surname><given-names>U</given-names></name><name><surname>Dixon</surname><given-names>J</given-names></name><name><surname>Lee</surname><given-names>L</given-names></name><name><surname>Lobanenkov</surname><given-names>VV</given-names></name><name><surname>Ren</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>A map of the cis-regulatory sequences in the mouse genome</article-title><source>Nature</source><volume>488</volume><fpage>116</fpage><lpage>120</lpage><pub-id pub-id-type="doi">10.1038/nature11243</pub-id><pub-id pub-id-type="pmid">22763441</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sinkler</surname><given-names>CA</given-names></name><name><surname>Kalpage</surname><given-names>H</given-names></name><name><surname>Shay</surname><given-names>J</given-names></name><name><surname>Lee</surname><given-names>I</given-names></name><name><surname>Malek</surname><given-names>MH</given-names></name><name><surname>Grossman</surname><given-names>LI</given-names></name><name><surname>Hüttemann</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Tissue- and condition-specific isoforms of mammalian cytochrome c oxidase subunits: from function to human disease</article-title><source>Oxidative Medicine and Cellular Longevity</source><volume>2017</volume><elocation-id>1534056</elocation-id><pub-id pub-id-type="doi">10.1155/2017/1534056</pub-id><pub-id pub-id-type="pmid">28593021</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Soliz</surname><given-names>J</given-names></name><name><surname>Joseph</surname><given-names>V</given-names></name><name><surname>Soulage</surname><given-names>C</given-names></name><name><surname>Becskei</surname><given-names>C</given-names></name><name><surname>Vogel</surname><given-names>J</given-names></name><name><surname>Pequignot</surname><given-names>JM</given-names></name><name><surname>Ogunshola</surname><given-names>O</given-names></name><name><surname>Gassmann</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Erythropoietin regulates hypoxic ventilation in mice by interacting with brainstem and carotid bodies</article-title><source>The Journal of Physiology</source><volume>568</volume><fpage>559</fpage><lpage>571</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2005.093328</pub-id><pub-id pub-id-type="pmid">16051624</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sommer</surname><given-names>N</given-names></name><name><surname>Hüttemann</surname><given-names>M</given-names></name><name><surname>Pak</surname><given-names>O</given-names></name><name><surname>Scheibe</surname><given-names>S</given-names></name><name><surname>Knoepp</surname><given-names>F</given-names></name><name><surname>Sinkler</surname><given-names>C</given-names></name><name><surname>Malczyk</surname><given-names>M</given-names></name><name><surname>Gierhardt</surname><given-names>M</given-names></name><name><surname>Esfandiary</surname><given-names>A</given-names></name><name><surname>Kraut</surname><given-names>S</given-names></name><name><surname>Jonas</surname><given-names>F</given-names></name><name><surname>Veith</surname><given-names>C</given-names></name><name><surname>Aras</surname><given-names>S</given-names></name><name><surname>Sydykov</surname><given-names>A</given-names></name><name><surname>Alebrahimdehkordi</surname><given-names>N</given-names></name><name><surname>Giehl</surname><given-names>K</given-names></name><name><surname>Hecker</surname><given-names>M</given-names></name><name><surname>Brandes</surname><given-names>RP</given-names></name><name><surname>Seeger</surname><given-names>W</given-names></name><name><surname>Grimminger</surname><given-names>F</given-names></name><name><surname>Ghofrani</surname><given-names>HA</given-names></name><name><surname>Schermuly</surname><given-names>RT</given-names></name><name><surname>Grossman</surname><given-names>LI</given-names></name><name><surname>Weissmann</surname><given-names>N</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Mitochondrial complex IV subunit 4 isoform 2 is essential for acute pulmonary oxygen sensing</article-title><source>Circulation Research</source><volume>121</volume><fpage>424</fpage><lpage>438</lpage><pub-id pub-id-type="doi">10.1161/CIRCRESAHA.116.310482</pub-id><pub-id pub-id-type="pmid">28620066</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Streller</surname><given-names>T</given-names></name><name><surname>Huckstorf</surname><given-names>C</given-names></name><name><surname>Pfeiffer</surname><given-names>C</given-names></name><name><surname>Acker</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Unusual cytochrome a592 with low PO2 affinity correlates as putative oxygen sensor with rat carotid body chemoreceptor discharge</article-title><source>FASEB Journal</source><volume>16</volume><fpage>1277</fpage><lpage>1279</lpage><pub-id pub-id-type="doi">10.1096/fj.02-0166fje</pub-id><pub-id pub-id-type="pmid">12153998</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Suganthan</surname><given-names>RN</given-names></name><name><surname>Pratap</surname><given-names>SV</given-names></name><name><surname>Morita</surname><given-names>EH</given-names></name><name><surname>Shunnosuke</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Identification of a chimeric transcript formed by intergenic splicing of ubie2 and yghl1-4 in mouse</article-title><source>Int Res J Biological Sci</source><volume>3</volume><fpage>52</fpage><lpage>59</lpage></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Swiderska</surname><given-names>A</given-names></name><name><surname>Coney</surname><given-names>AM</given-names></name><name><surname>Alzahrani</surname><given-names>AA</given-names></name><name><surname>Aldossary</surname><given-names>HS</given-names></name><name><surname>Batis</surname><given-names>N</given-names></name><name><surname>Ray</surname><given-names>CJ</given-names></name><name><surname>Kumar</surname><given-names>P</given-names></name><name><surname>Holmes</surname><given-names>AP</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Mitochondrial succinate metabolism and reactive oxygen species are important but not essential for eliciting carotid body and ventilatory responses to hypoxia in the rat</article-title><source>Antioxidants</source><volume>10</volume><elocation-id>840</elocation-id><pub-id pub-id-type="doi">10.3390/antiox10060840</pub-id><pub-id pub-id-type="pmid">34070267</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Timón-Gómez</surname><given-names>A</given-names></name><name><surname>Nývltová</surname><given-names>E</given-names></name><name><surname>Abriata</surname><given-names>LA</given-names></name><name><surname>Vila</surname><given-names>AJ</given-names></name><name><surname>Hosler</surname><given-names>J</given-names></name><name><surname>Barrientos</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Mitochondrial cytochrome c oxidase biogenesis: recent developments</article-title><source>Seminars in Cell &amp; Developmental Biology</source><volume>76</volume><fpage>163</fpage><lpage>178</lpage><pub-id pub-id-type="doi">10.1016/j.semcdb.2017.08.055</pub-id><pub-id pub-id-type="pmid">28870773</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Timón-Gómez</surname><given-names>A</given-names></name><name><surname>Bartley-Dier</surname><given-names>EL</given-names></name><name><surname>Fontanesi</surname><given-names>F</given-names></name><name><surname>Barrientos</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2020">2020a</year><article-title>HIGD-driven regulation of cytochrome c oxidase biogenesis and function</article-title><source>Cells</source><volume>9</volume><elocation-id>12</elocation-id><pub-id pub-id-type="doi">10.3390/cells9122620</pub-id><pub-id pub-id-type="pmid">33291261</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Timón-Gómez</surname><given-names>A</given-names></name><name><surname>Garlich</surname><given-names>J</given-names></name><name><surname>Stuart</surname><given-names>RA</given-names></name><name><surname>Ugalde</surname><given-names>C</given-names></name><name><surname>Barrientos</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2020">2020b</year><article-title>Distinct roles of mitochondrial HIGD1A and HIGD2A in respiratory complex and supercomplex biogenesis</article-title><source>Cell Reports</source><volume>31</volume><elocation-id>107607</elocation-id><pub-id pub-id-type="doi">10.1016/j.celrep.2020.107607</pub-id><pub-id pub-id-type="pmid">32375044</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Timón-Gómez</surname><given-names>A</given-names></name><name><surname>Pérez-Pérez</surname><given-names>R</given-names></name><name><surname>Nyvltova</surname><given-names>E</given-names></name><name><surname>Ugalde</surname><given-names>C</given-names></name><name><surname>Fontanesi</surname><given-names>F</given-names></name><name><surname>Barrientos</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2020">2020c</year><article-title>Protocol for the analysis of yeast and human mitochondrial respiratory chain complexes and supercomplexes by blue native electrophoresis</article-title><source>STAR Protocols</source><volume>1</volume><elocation-id>100089</elocation-id><pub-id pub-id-type="doi">10.1016/j.xpro.2020.100089</pub-id><pub-id pub-id-type="pmid">32995753</pub-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Uhlén</surname><given-names>M</given-names></name><name><surname>Fagerberg</surname><given-names>L</given-names></name><name><surname>Hallström</surname><given-names>BM</given-names></name><name><surname>Lindskog</surname><given-names>C</given-names></name><name><surname>Oksvold</surname><given-names>P</given-names></name><name><surname>Mardinoglu</surname><given-names>A</given-names></name><name><surname>Sivertsson</surname><given-names>Å</given-names></name><name><surname>Kampf</surname><given-names>C</given-names></name><name><surname>Sjöstedt</surname><given-names>E</given-names></name><name><surname>Asplund</surname><given-names>A</given-names></name><name><surname>Olsson</surname><given-names>I</given-names></name><name><surname>Edlund</surname><given-names>K</given-names></name><name><surname>Lundberg</surname><given-names>E</given-names></name><name><surname>Navani</surname><given-names>S</given-names></name><name><surname>Szigyarto</surname><given-names>CAK</given-names></name><name><surname>Odeberg</surname><given-names>J</given-names></name><name><surname>Djureinovic</surname><given-names>D</given-names></name><name><surname>Takanen</surname><given-names>JO</given-names></name><name><surname>Hober</surname><given-names>S</given-names></name><name><surname>Alm</surname><given-names>T</given-names></name><name><surname>Edqvist</surname><given-names>PH</given-names></name><name><surname>Berling</surname><given-names>H</given-names></name><name><surname>Tegel</surname><given-names>H</given-names></name><name><surname>Mulder</surname><given-names>J</given-names></name><name><surname>Rockberg</surname><given-names>J</given-names></name><name><surname>Nilsson</surname><given-names>P</given-names></name><name><surname>Schwenk</surname><given-names>JM</given-names></name><name><surname>Hamsten</surname><given-names>M</given-names></name><name><surname>von Feilitzen</surname><given-names>K</given-names></name><name><surname>Forsberg</surname><given-names>M</given-names></name><name><surname>Persson</surname><given-names>L</given-names></name><name><surname>Johansson</surname><given-names>F</given-names></name><name><surname>Zwahlen</surname><given-names>M</given-names></name><name><surname>von Heijne</surname><given-names>G</given-names></name><name><surname>Nielsen</surname><given-names>J</given-names></name><name><surname>Pontén</surname><given-names>F</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Proteomics: tissue-based map of the human proteome</article-title><source>Science</source><volume>347</volume><elocation-id>1260419</elocation-id><pub-id pub-id-type="doi">10.1126/science.1260419</pub-id><pub-id pub-id-type="pmid">25613900</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Verna</surname><given-names>A</given-names></name><name><surname>Roumy</surname><given-names>M</given-names></name><name><surname>Leitner</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="1975">1975</year><article-title>Loss of chemoreceptive properties of the rabbit carotid body after destruction of the glomus cells</article-title><source>Brain Research</source><volume>100</volume><fpage>13</fpage><lpage>23</lpage><pub-id pub-id-type="doi">10.1016/0006-8993(75)90239-5</pub-id><pub-id pub-id-type="pmid">1182506</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>von der Weid</surname><given-names>B</given-names></name><name><surname>Rossier</surname><given-names>D</given-names></name><name><surname>Lindup</surname><given-names>M</given-names></name><name><surname>Tuberosa</surname><given-names>J</given-names></name><name><surname>Widmer</surname><given-names>A</given-names></name><name><surname>Col</surname><given-names>JD</given-names></name><name><surname>Kan</surname><given-names>C</given-names></name><name><surname>Carleton</surname><given-names>A</given-names></name><name><surname>Rodriguez</surname><given-names>I</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Large-Scale transcriptional profiling of chemosensory neurons identifies receptor-ligand pairs in vivo</article-title><source>Nature Neuroscience</source><volume>18</volume><fpage>1455</fpage><lpage>1463</lpage><pub-id pub-id-type="doi">10.1038/nn.4100</pub-id><pub-id pub-id-type="pmid">26322926</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="software"><person-group person-group-type="author"><name><surname>Wilson</surname><given-names>RJA</given-names></name></person-group><year iso-8601-date="2022">2022</year><data-title>Sympathetic-analyzer</data-title><version designator="20638d6e2">20638d6e2</version><source>GitHub</source><ext-link ext-link-type="uri" xlink:href="https://github.com/Wilson-lab-uofc/Sympathetic-Analyzer">https://github.com/Wilson-lab-uofc/Sympathetic-Analyzer</ext-link></element-citation></ref><ref id="bib71"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zariwala</surname><given-names>HA</given-names></name><name><surname>Borghuis</surname><given-names>BG</given-names></name><name><surname>Hoogland</surname><given-names>TM</given-names></name><name><surname>Madisen</surname><given-names>L</given-names></name><name><surname>Tian</surname><given-names>L</given-names></name><name><surname>De Zeeuw</surname><given-names>CI</given-names></name><name><surname>Zeng</surname><given-names>H</given-names></name><name><surname>Looger</surname><given-names>LL</given-names></name><name><surname>Svoboda</surname><given-names>K</given-names></name><name><surname>Chen</surname><given-names>T-W</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>A CRE-dependent gcamp3 reporter mouse for neuronal imaging in vivo</article-title><source>The Journal of Neuroscience</source><volume>32</volume><fpage>3131</fpage><lpage>3141</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.4469-11.2012</pub-id><pub-id pub-id-type="pmid">22378886</pub-id></element-citation></ref><ref id="bib72"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname><given-names>T</given-names></name><name><surname>Chien</surname><given-names>MS</given-names></name><name><surname>Kaleem</surname><given-names>S</given-names></name><name><surname>Matsunami</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Single cell transcriptome analysis of mouse carotid body glomus cells</article-title><source>The Journal of Physiology</source><volume>594</volume><fpage>4225</fpage><lpage>4251</lpage><pub-id pub-id-type="doi">10.1113/JP271936</pub-id><pub-id pub-id-type="pmid">26940531</pub-id></element-citation></ref></ref-list></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.78915.sa0</article-id><title-group><article-title>Editor's evaluation</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Paterson</surname><given-names>David J</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/052gg0110</institution-id><institution>University of Oxford</institution></institution-wrap><country>United Kingdom</country></aff></contrib></contrib-group></front-stub><body><p>The arterial chemoreceptors are the body's primary defense against hypoxia. In particular, the carotid body glomus cells (type 1) are highly sensitive to decreases in oxygen availability where the mitochondria and plasma membrane signaling proteins have been implicated in oxygen sensing by type 1 cells. Here, Chang and colleagues identified HIGD1C, a novel hypoxia-inducible gene domain factor isoform, is essential for carotid body oxygen sensing, where it enhances complex IV sensitivity to hypoxia. Discovery of this protein and its function brings back into focus the importance of how specialized mitochondria can act as sensors to metabolic stresses like hypoxia.</p></body></sub-article><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.78915.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Paterson</surname><given-names>David J</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/052gg0110</institution-id><institution>University of Oxford</institution></institution-wrap><country>United Kingdom</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Buckler</surname><given-names>Keith</given-names></name><role>Reviewer</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/052gg0110</institution-id><institution>University of Oxford</institution></institution-wrap><country>United Kingdom</country></aff></contrib><contrib contrib-type="reviewer"><name><surname>Wyatt</surname><given-names>Chris</given-names></name><role>Reviewer</role></contrib></contrib-group></front-stub><body><boxed-text id="sa2-box1"><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Decision letter after peer review:</bold></p><p>Thank you for sending your article entitled &quot;Tissue-specific mitochondrial HIGD1C promotes oxygen sensitivity in carotid body chemoreceptors&quot; for peer review at <italic>eLife</italic>. Your article is being evaluated by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation is being overseen by a Reviewing Editor and Vivek Malhotra as the Senior Editor.</p><p>I am detailing below the major revisions requested by the reviewers. The list appears to be long, but many of the concerns can be addressed by rewriting and clarifying the text. The full comments of the reviewers follow the list of major revisions requested.</p><p>Major concerns</p><p>1. Parts of the manuscript are difficult to follow re data presentation since the data are densely reported in places. Eg Figure 1 Figure supplement 2 on page 9 is virtually impossible to read.</p><p>2. A tighter introduction is required re references where credit should be given to the early studies showing that hypoxia excites CB and breathing and chemodenervation abolishes the breathing responses (eg Neil; Torrance; Lahiri should be given credit in para 1 on page 3).</p><p>3. Additionally, primary references should be given for statements of fact like …'Under these pathological conditions, suppressing CB activity improves causal symptoms such as hypertension (REF), cardiac arrhythmias (REF), and insulin resistance (REF) (Iturriaga, 2018)'. Credit must be given to the primary source, not a review.</p><p>4. p 4 'We found that three such genes, Higd1c, Cox4i2, and Ndufa4l2, were expressed at higher levels in the mouse CB (Figure 1A)'. Are you confident that this expression is only in type 1 cells and not type 2 cells?</p><p>5. Much of the data presented has used parametric statistics on n of 3/3 or 4/4 samples eg Figure 1 supp 3 page 10. Are these data normally distributed to support parametric use of stats? Please comment on the sample re biological replicates v technical replicates. How were the data treated here?</p><p>6. The gel on p26 panel B looks over run. Comment?</p><p>7. Aspects of the data are very convincing. Whilst this large body of work shows the putative role of HIGD1C in oxygen sensing, the relationship between this protein and the graded response of afferent nerve firing to physiological levels of hypoxia remains to be established to support an essential role for this signalling pathway in hypoxic chemotransduction. This limitation should be acknowledged. Please comment?</p><p>8. With respect to the effects of Higd1c KO on ventilation. Although all KO's appear to have a blunted ventilatory response to hypoxia, a ventilatory response remains none the less. This is particularly evident for the 1.1 KO as shown in the example trace in Figure 2 supplement 1 A where the second response to a hypoxic stimulus looks very similar between the KO and normal mouse. This is a somewhat disappointing result in that it may limit the conclusions that can be drawn from this study. One could have hoped that a Higd1c KO would either eliminate the response to hypoxia or had no effect at all. As this is a very important piece of evidence I want to ask for more detail regarding the data and methods.</p><p>9. Forgive me if I have misunderstood but in the methods section you state that &quot;we used a respiratory rate of 215 breaths/min (comparable to the mean of a wild type in hypoxia) as a cut off for inclusion in this study&quot;. It is unclear how this works. Are you rejecting recordings with RR in excess of this figure or below this figure? When are you making this decision, under normoxic conditions at the beginning of an experiment, under hypoxic conditions, or at any time in the recording? Can you clarify this point and indicate how often recordings were rejected by this criteria in the different mice?</p><p>10. Was there any notable difference in mouse behaviour between genotypes during plethysmography? Mice usually become much less active in hypoxia and basal metabolic rate goes down resulting in a fall in CO2 production and a drop in PaCO2 which leads to a fall in ventilation (hypoxic ventilatory decline: HVD). This often complicates the analysis/interpretation of responses to hypoxia. Over what time period do you measure changes in ventilation – over the entire period of exposure to hypoxia, at the peak? Or towards the end? Are changes in the rate of HVD influencing the comparison between KO and wt? Have you measured PaCO2 under hypoxic conditions? I would predict that it would be lower than under control conditions. Could you introduce a little CO2 in hypoxic conditions to try to neutralise this effect?</p><p>11. What happens if you do a sham switch (i.e. switch between two identical gasses/air), is there any startle response associated with just mechanically switching between two gas lines? If not what happens if you look specifically at the peak/early response to hypoxia before CO2 has much chance to fall?</p><p>12. Are Higd1c +/+ mice taken from your in house breeding programs generating Higd1c -/- mice or are they just off the shelf C57Bl/6J from Jax? If the latter how long are these mice held in your facility (under the same conditions as the KO mice) before being used?</p><p>13. In the methods section on nerve recordings you state that &quot;Preparations were exposed to a brief hypoxic challenge (PO2 = 60 mmHg) to determine viability; preparations that failed to show a clear increase in activity during this challenge were discarded&quot;. You are testing the hypothesis that Higd1c is important/essential for the generation of the response to hypoxia so why exclude data from preparations that lack a hypoxic response? This is just what you are looking for! I hope this is just a mistake in writing up the methods, BUT if this is really what was done then the whole nerve recording study could be invalid (depending on just what proportion of preparations were actually discarded). If you want some sort of test for viability of the preparation, which is a good idea, then there are many other stimuli one could choose instead that do not involve mitochondrial function e.g hypercapnia/acidosis, high potassium, acetyl choline, TASK channel inhibitors/respiratory stimulants.</p><p>14. One of the key issues regarding the role of alternative mitochondrial subunits in the carotid body is not simply that they may affect the maximal turnover rate of cytochrome oxidase but whether they alter the kinetic parameters defining sensitivity to hypoxia (i.e. Km, oxygen affinity, P50 ). To determine these really requires making a number of measurements at different PO2 including a zero point (anoxia). This could have been done for both nerve recordings and calcium measurements. Unfortunately it was not, so we are left with data from both of these experiments which demonstrates that the response to hypoxia is smaller in the KO but we have no idea whether these kinetic parameters have changed or not. The study would be a lot stronger if you could demonstrate a change in Km in the Higd1c KO.</p><p>15. It would appear from the results obtained with Rh123 and the weak responses to FCCP that there was inadequate loading of this dye to make good measurements of mitochondrial potential (ψM) in many of the cells studied. If you look at the paper by Biscoe and Duchen they were achieving a 100% increase in Rh125 fluorescence upon adding FCCP, Anoxia or CN, not 20%. The level of loading is critical with this dye in order to get it to work properly in the de-quench mode. In addition, to correct for differences in dye loading, responses to acute hypoxia should probably be normalised not only to the baseline but also to the response to FCCP. The smaller response to hypoxia in Higd1c -/- could simply reflect lower dye loading, with consequent lower dynamic response from Rh123 to change in mitochondrial potential, rather than any actual change in ψM.</p><p>16. The response to anoxia has not been tested which again confounds attempts to determine a P50 for mitochondrial depolarisation. I note that the rate of change in PO2 (Figure 4 suppl 1 A) is rather slow so some Rh123 may also leak out of the cell during the recording. Were any corrections applied for dye leakage?</p><p>17. In summary the interpretation of this data is equivocal. Higd1c -/- may take up Rh123 less avidly than wt but is this due to a lower resting ψM or something else? This experiment needs repeating extending loading time or Rh123 concentration until robust responses to FCCP can be recorded.</p><p>18. If you want to see if genotype affects resting ψM you would probably be better not working in the quench mode but either using much lower concentrations of Rh123 or another probe, e.g. TMRM, and loading for a longer period of time (until dye uptake reaches a steady state without any quenching occuring).</p><p>19. Data in Fig6-E shows &gt;= 40% inhibition of oxygen consumption under hypoxic conditions compared to normoxia in all HEK cell types studied. Given that the level of oxygen in hypoxia is stated to be 25 mmHg this is something of a surprise. The P50 for most cells is thought to be &lt; 1mmHg. Something is wrong here. If you are using an Oroboros Oxygraph (as stated in methods) it should be possible to measure oxygen consumption from air all the way down to zero oxygen and derive an exact P50 for each cell type. This should be done. This is a very important experiment that proports to show that it is the combination of Higd1c and Cox4I2 that generates the unusual sensitivity of complex IV towards oxygen. Philosophically I like this hypothesis. If true it would mark a major advance in this field, but I want to see some hard data with rigorously determined kinetic measurements!</p><p>20. It would be better in future if the calcium imaging studies could be performed using the same perfused preparation that the nerve recording experiments used. This would remove the requirement for equilibrating superfusate with 95% oxygen which is far from physiological and would allow the carotid body tissue to be perfused with physiologically relevant levels of oxygen. However, superfusion with hyperoxic solutions is considered standard in many systems and so additional experiments are not required at this time.</p><p>21. Expanding the study to see if HIGD1A is expressed in carotid bodies of multiple species would strengthen the paper. It would also be interesting to see if it is absent in the carotid bodies of guinea pigs which are not acutely oxygen sensitive. Furthermore, chromaffin cells in fetal adrenal medulla are oxygen-sensitive whereas mature chromaffin cells are not, it would be fascinating to see if HIGD1A expression changes during the maturation of chromaffin cells. These possibilities might be discussed.</p><p>22. Tidal volume changes with the weight of the animals. Tidal volume should be adjusted for the weights of the animals tested. If there are weight differences between knockouts and wildtype it can have profound effects on the data.</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>Understanding the precise intracellular signalling pathways underpinning hypoxic sensitivity in the carotid body chemoreceptor has been a major unsolved area in sensory neurophysiology. Early studies almost 60 years ago suggested the importance of a metabolic signal coupled to the mitchrondria, which could regulate intracellular calcium homeostasis and exocystosis of excitatory transmitter in type I glomus cells.</p><p>Using RNAseq this manuscript has identified a novel gene that encodes protein regulation of Complex IV in the carotid body response to hypoxia. Here the authors found HIGD1C, a novel hypoxia-inducible gene domain factor isoform, as an electron transport chain Complex IV-interacting protein was almost exclusively expressed in the carotid body. Using a combination molecular biology, protein chemistry, genetic knock-out, calcium imaging and respiratory measurements, the authors elegantly demonstrated the physiological utlility of HIGD1C being required for carotid body oxygen sensing via enhanced Complex IV sensitivity to hypoxia. Deletion of the gene massively attenuated the chemoreceptor response to hypoxia, whereas of expression of HIGD1C could recapitulate the increased oxygen sensitivity of Complex IV in HEK 293T cells, but not the response to hypercapnia.</p><p>Whilst this large body of work shows the putative role of HIGD1C in oxygen sensing, the relationship between this protein and the graded response of afferent nerve firing to physiological levels of hypoxia remains to be established to support an essential role for this signalling pathway in hypoxic chemotransduction.</p><p>This is a large body of work supporting the idea that HIGD1C is required for hypoxic sensing in the mouse through the regulation complex IV. The experiments are well designed, complex and appear to have been carefully performed.</p><p>Specific comments for improvement:</p><p>Parts of the manuscript are difficult to follow re data presentation since the data are densely reported in places. Eg Figure 1 Figure supplement 2 on page 9 is virtually impossible to read.</p><p>A tighter introduction is required re references where credit should be given to the early studies showing that hypoxia excites CB and breathing and chemodenervation abolishes the breathing responses (eg Neil; Torrance; Lahiri should be given credit in para 1 on page 3).</p><p>Additionally, primary references should be given for statements of fact like …'Under these pathological conditions, suppressing CB activity improves causal symptoms such as hypertension (REF), cardiac arrhythmias (REF), and insulin resistance (REF) (Iturriaga, 2018)'. Credit must be given to the primary source, not a review.</p><p>p 4 'We found that three such genes, Higd1c, Cox4i2, and Ndufa4l2, were expressed at higher levels in the mouse CB (Figure 1A)'. Are you confident that this expression is only in type 1 cells and not type 2 cells?</p><p>Much of the data presented has used parametric statistics on n of 3/3 or 4/4 samples eg Figure 1 supp 3 page 10. Are these data normally distributed to support parametric use of stats? Please comment on the sample re biological replicates v technical replicates. How were the data treated here?</p><p>The gel on p26 panel B looks over run. Comment?</p><p>Aspects of the data are very convincing. Whilst this large body of work shows the putative role of HIGD1C in oxygen sensing, the relationship between this protein and the graded response of afferent nerve firing to physiological levels of hypoxia remains to be established to support an essential role for this signalling pathway in hypoxic chemotransduction. This limitation should be acknowledged. Please comment?</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>I have a number of major concerns about parts of this research which need to be addressed before I could comment on its conclusions and importance. Some of these may just require a better explanation or correction to the text (e.g. where there may be an ambiguity over how an experiment was conducted). Others may require further work</p><p>Major comments/Questions</p><p>General reporting of results</p><p>A very general comment I have about this paper is that numerous experiments, particularly in the latter half of this paper using HEK cells, have been conducted with an 'n' of only 3. I do not know what <italic>eLife</italic>s's normal expectations/requirements are but I would have thought that an 'n' of at least 4 or 5 independent observations should normally be required. Similarly, numerous gels/blots are presented without any indication of how often these types of experiments were repeated. This should be reported and the journal should have some policy over what is expected. To my mind there could be a substantial amount of further work that needs to be completed before this study could be formally published. Apart from this issue the statistics seem to have been done with suitable care and rigour.</p><p>Questions/suggested changes.</p><p>Plethysmography.</p><p>With respect to the effects of Higd1c KO on ventilation. Although all KO's appear to have a blunted ventilatory response to hypoxia, a ventilatory response remains none the less. This is particularly evident for the 1.1 KO as shown in the example trace in Figure 2 supplement 1 A where the second response to a hypoxic stimulus looks very similar between the KO and normal mouse. This is a somewhat disappointing result in that it may limit the conclusions that can be drawn from this study. One could have hoped that a Higd1c KO would either eliminate the response to hypoxia or had no effect at all. As this is a very important piece of evidence I want to ask for more detail regarding the data and methods.</p><p>Forgive me if I have misunderstood but in the methods section you state that &quot;we used a respiratory rate of 215 breaths/min (comparable to the mean of a wild type in hypoxia) as a cut off for inclusion in this study&quot;. It is unclear how this works. Are you rejecting recordings with RR in excess of this figure or below this figure? When are you making this decision, under normoxic conditions at the beginning of an experiment, under hypoxic conditions, or at any time in the recording? Can you clarify this point and indicate how often recordings were rejected by this criteria in the different mice?</p><p>Was there any notable difference in mouse behaviour between genotypes during plethysmography? Mice usually become much less active in hypoxia and basal metabolic rate goes down resulting in a fall in CO2 production and a drop in PaCO2 which leads to a fall in ventilation (hypoxic ventilatory decline: HVD). This often complicates the analysis/interpretation of responses to hypoxia. Over what time period do you measure changes in ventilation – over the entire period of exposure to hypoxia, at the peak? Or towards the end? Are changes in the rate of HVD influencing the comparison between KO and wt? Have you measured PaCO2 under hypoxic conditions? I would predict that it would be lower than under control conditions. Could you introduce a little CO2 in hypoxic conditions to try to neutralise this effect?</p><p>What happens if you do a sham switch (i.e. switch between two identical gasses/air), is there any startle response associated with just mechanically switching between two gas lines? If not what happens if you look specifically at the peak/early response to hypoxia before CO2 has much chance to fall?</p><p>Are Higd1c +/+ mice taken from your in house breeding programs generating Higd1c -/- mice or are they just off the shelf C57Bl/6J from Jax? If the latter how long are these mice held in your facility (under the same conditions as the KO mice) before being used?</p><p>Nerve fibre recordings and calcium recordings.</p><p>In the methods section on nerve recordings you state that &quot;Preparations were exposed to a brief hypoxic challenge (PO2 = 60 mmHg) to determine viability; preparations that failed to show a clear increase in activity during this challenge were discarded&quot;. You are testing the hypothesis that Higd1c is important/essential for the generation of the response to hypoxia so why exclude data from preparations that lack a hypoxic response? This is just what you are looking for! I hope this is just a mistake in writing up the methods, BUT if this is really what was done then the whole nerve recording study could be invalid (depending on just what proportion of preparations were actually discarded). If you want some sort of test for viability of the preparation, which is a good idea, then there are many other stimuli one could choose instead that do not involve mitochondrial function e.g hypercapnia/acidosis, high potassium, acetyl choline, TASK channel inhibitors/respiratory stimulants.</p><p>One of the key issues regarding the role of alternative mitochondrial subunits in the carotid body is not simply that they may affect the maximal turnover rate of cytochrome oxidase but whether they alter the kinetic parameters defining sensitivity to hypoxia (i.e. Km, oxygen affinity, P50 ). To determine these really requires making a number of measurements at different PO2 including a zero point (anoxia). This could have been done for both nerve recordings and calcium measurements. Unfortunately it was not, so we are left with data from both of these experiments which demonstrates that the response to hypoxia is smaller in the KO but we have no idea whether these kinetic parameters have changed or not. The study would be a lot stronger if you could demonstrate a change in Km in the Higd1c KO.</p><p>Rh123 experiments.</p><p>It would appear from the results obtained with Rh123 and the weak responses to FCCP that there was inadequate loading of this dye to make good measurements of mitochondrial potential (ψM) in many of the cells studied. If you look at the paper by Biscoe and Duchen they were achieving a 100% increase in Rh125 fluorescence upon adding FCCP, Anoxia or CN, not 20%. The level of loading is critical with this dye in order to get it to work properly in the de-quench mode. In addition, to correct for differences in dye loading, responses to acute hypoxia should probably be normalised not only to the baseline but also to the response to FCCP. The smaller response to hypoxia in Higd1c -/- could simply reflect lower dye loading, with consequent lower dynamic response from Rh123 to change in mitochondrial potential, rather than any actual change in ψM.</p><p>The response to anoxia has not been tested which again confounds attempts to determine a P50 for mitochondrial depolarisation. I note that the rate of change in PO2 (Figure 4 suppl 1 A) is rather slow so some Rh123 may also leak out of the cell during the recording. Were any corrections applied for dye leakage?</p><p>In summary the interpretation of this data is equivocal. Higd1c -/- may take up Rh123 less avidly than wt but is this due to a lower resting ψM or something else? This experiment needs repeating extending loading time or Rh123 concentration until robust responses to FCCP can be recorded.</p><p>If you want to see if genotype affects resting ψM you would probably be better not working in the quench mode but either using much lower concentrations of Rh123 or another probe, e.g. TMRM, and loading for a longer period of time (until dye uptake reaches a steady state without any quenching occuring).</p><p>CIV sensitivity to Hypoxia in HEK.</p><p>Data in Fig6-E shows &gt;= 40% inhibition of oxygen consumption under hypoxic conditions compared to normoxia in all HEK cell types studied. Given that the level of oxygen in hypoxia is stated to be 25 mmHg this is something of a surprise. The P50 for most cells is thought to be &lt; 1mmHg. Something is wrong here. If you are using an Oroboros Oxygraph (as stated in methods) it should be possible to measure oxygen consumption from air all the way down to zero oxygen and derive an exact P50 for each cell type. This should be done. This is a very important experiment that proports to show that it is the combination of Higd1c and Cox4I2 that generates the unusual sensitivity of complex IV towards oxygen. Philosophically I like this hypothesis. If true it would mark a major advance in this field, but I want to see some hard data with rigorously determined kinetic measurements!</p><p><italic>Reviewer #3 (Recommendations for the authors):</italic></p><p>This paper uses a range of techniques to demonstrate the presence of a novel protein (HIGD1C) that interacts with complex 4 of the mitochondrial electron transport chain. The authors demonstrate that this protein is required for hypoxic chemotransduction at the level of the whole animal (plethysmography), at the level of the in-vitro organ (carotid sinus nerve recordings) and at the level of the glomus cell (calcium imaging). The authors then go on to demonstrate that HIGD1C may interact and alter the sensitivity of complex 4 to hypoxia.</p><p>The authors are to be congratulated on a set of thorough physiological experiments that are then extended by detailed cellular respiration studies. Working with mouse carotid body tissue is incredibly challenging and the authors have done extremely well to get such high quality and valuable data.</p><p>The combination of genetic, physiological and cellular experiments make this an extremely compelling paper suitable for publication in <italic>eLife</italic>.</p><p>The question of why carotid body glomus cells are unusually sensitive to hypoxia has troubled researchers for decades. This paper makes an extremely compelling case for the expression of HIGD1C modulating complex 4 and thereby sensitizing it to hypoxia. The data seems strong and the paper is likely to have a major impact in the field of oxygen sensing.</p><p>There are several observations that would greatly strengthen the paper.</p><p>1. It would be better in future if the calcium imaging studies could be performed using the same perfused preparation that the nerve recording experiments used. This would remove the requirement for equilibrating superfusate with 95% oxygen which is far from physiological and would allow the carotid body tissue to be perfused with physiologically relevant levels of oxygen. However, superfusion with hyperoxic solutions is considered standard in many systems and so additional experiments are not required at this time.</p><p>2. Expanding the study to see if HIGD1C is expressed in carotid bodies of multiple species would strengthen the paper. It would also be interesting to see if it is absent in the carotid bodies of guinea pigs which are not acutely oxygen sensitive. Furthermore, chromaffin cells in fetal adrenal medulla are oxygen-sensitive whereas mature chromaffin cells are not, it would be fascinating to see if HIGD1C expression changes during the maturation of chromaffin cells. These possibilities might be discussed.</p><p>3. Tidal volume changes with the weight of the animals. Tidal volume should be adjusted for the weights of the animals tested. If there are weight differences between knockouts and wildtype it can have profound effects on the data.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.78915.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Major concerns</p><p>1. Parts of the manuscript are difficult to follow re data presentation since the data are densely reported in places. Eg Figure 1 Figure supplement 2 on page 9 is virtually impossible to read.</p></disp-quote><p>We strove to make the figures more legible in this revision. For example, we enlarged and redistributed the panels in Figure 1-figure supplement 2. We split the Figure 1-figure supplement 3 into two Figure supplements (Figure 1-figure supplements 3 and 5). In addition, we have now submitted full-page versions of figures that can be resized as needed.</p><disp-quote content-type="editor-comment"><p>2. A tighter introduction is required re references where credit should be given to the early studies showing that hypoxia excites CB and breathing and chemodenervation abolishes the breathing responses (eg Neil; Torrance; Lahiri should be given credit in para 1 on page 3).</p></disp-quote><p>We now reference the following primary papers for key early observations showing that carotid body stimulated afferent nerve activity and ventilation that can be abolished by chemo- denervation or carotid body ablation (p. 3):</p><p>De Castro F. (1928). Sur la structure et l'innervation du sinus carotidien de l'homme et des mammifères. Nouveaux faits sur l'innervation et la fonction du glomus caroticum. Trav. Lab. Rech. Biol. 25, 331–380</p><p>Heymans C., Bouckaert J. J., Dautrebande L. (1931). Au sujet du mecanisme de la bradycardie provoquée par la nicotine, la lobéline, le cyanure, le sulfure de sodium, les nitrites et la morphine, et de la bradycardie asphyxique. <italic>Arch. Int. Pharmacodyn.</italic> 41, 261–289</p><p>Neil and O’Regan, J Physiol, 1971, 215: 33-47</p><p>Black, McCloskey, and Torrance, Respir Physiol, 1971, 13: 36-49</p><p>Lahiri and DeLaney, Respir Physiol, 1975, 24: 249-266</p><p>Lahiri and DeLaney, Respir Physiol, 1975, 24:2 67-286</p><p>Verna, Roumy, and Leitner, Brain Res, 1975, 100: 13-23</p><p>We have also added this review of the history:</p><p>De Castro, F. (2009). The discovery of sensory nature of the carotid bodies--invited article. <italic>Adv Exp Med Biol, 648</italic>, 1-18</p><disp-quote content-type="editor-comment"><p>3. Additionally, primary references should be given for statements of fact like …'Under these pathological conditions, suppressing CB activity improves causal symptoms such as hypertension (REF), cardiac arrhythmias (REF), and insulin resistance (REF) (Iturriaga, 2018)'. Credit must be given to the primary source, not a review.</p></disp-quote><p>We now reference the primary sources for these observations (p. 3):</p><p>Hypertension</p><p>Fletcher et al., J Appl Physiol, 1992</p><p>Del Rio et al., Hypertension, 2016</p><p>Abdala et al., J Physiol, 2012</p><p>Narkiewiecz et al., 2016, JACC Basic Transl Sci</p><p>Cardiac arrhythmias</p><p>Marcus et al., 2014, J Physiol</p><p>Del Rio et al., 2013, J Am Coll Cardiol</p><p>Insulin resistance</p><p>Ribeiro et al., 2013, Diabetes</p><p>Sacramento et al., 2017, Diabetelogica</p><disp-quote content-type="editor-comment"><p>4. p 4 'We found that three such genes, Higd1c, Cox4i2, and Ndufa4l2, were expressed at higher levels in the mouse CB (Figure 1A)'. Are you confident that this expression is only in type 1 cells and not type 2 cells?</p></disp-quote><p>RNAseq of whole carotid body tissue (Figure 1A) cannot determine if the expression of these genes is restricted to any particular cell type. To overcome this, we performed duplex in situ hybridizations to show that <italic>Higd1c</italic> mRNA co-localizes with <italic>Th</italic> mRNA in type 1 cells (Figure 1D, E). Additional support comes from single-cell RNA studies that show high levels of expression of all three genes in glomus cells (Zhou et al., 2016, J Physiol). The pattern of gene expression of <italic>Cox4i2</italic> and <italic>Ndufa4l2</italic> we detected by in situ hybridization and immunostaining are consistent with the expression of these genes in type 1 cells (Zhou et al., 2016, J Physiol; Moreno-Dominguez et al., 2020, Sci Signal). To definitively show expression of <italic>Higd1c</italic> in only type 1 cells and not in both type 1 and type 2 cells in tissue sections is not possible because there is no antibody available for HIGD1C. We have added this limitation in the Discussion (p. 41) and raised the possibility that <italic>Higd1c</italic> could be expressed in both type 1 and type 2 cells, as both cell types have been proposed to work together in sensory signaling in hypoxia (Leonard et al., 2018, Front Physiol).</p><disp-quote content-type="editor-comment"><p>5. Much of the data presented has used parametric statistics on n of 3/3 or 4/4 samples eg Figure 1 supp 3 page 10. Are these data normally distributed to support parametric use of stats? Please comment on the sample re biological replicates v technical replicates. How were the data treated here?</p></disp-quote><p>All samples in the experiments presented were biological replicates, and all groups were analyzed by the Shapiro-Wilk test to check for normality before running parametric or non-parametric tests as appropriate (described in p. 59). We have increased the n (number of samples) to 5 or 6 samples per tissue for the RT-qPCR experiments in Figure 1-figure supplement 3 and checked for normality to justify the use of parametric tests.</p><disp-quote content-type="editor-comment"><p>6. The gel on p26 panel B looks over run. Comment?</p></disp-quote><p>This appearance is due to the large amount of mitochondria required to detect the mouse version of HIGD1C. This could be due to a reduced ability of mouse HIGD1C to assemble with human Complex IV proteins expressed endogenously by HEK293T cells.</p><disp-quote content-type="editor-comment"><p>7. Aspects of the data are very convincing. Whilst this large body of work shows the putative role of HIGD1C in oxygen sensing, the relationship between this protein and the graded response of afferent nerve firing to physiological levels of hypoxia remains to be established to support an essential role for this signalling pathway in hypoxic chemotransduction. This limitation should be acknowledged. Please comment?</p></disp-quote><p>We greatly appreciate the reviewer’s assessment of the quality of our data. We showed defects in the graded response of the carotid sinus nerve in <italic>Higd1c</italic> mutants to three physiological levels of hypoxia (PO<sub>2</sub>=80, 60, and 40 mmHg) in Figure 3A-D that stimulate carotid body sensory output and ventilation.</p><disp-quote content-type="editor-comment"><p>8. With respect to the effects of Higd1c KO on ventilation. Although all KO's appear to have a blunted ventilatory response to hypoxia, a ventilatory response remains none the less. This is particularly evident for the 1.1 KO as shown in the example trace in Figure 2 supplement 1 A where the second response to a hypoxic stimulus looks very similar between the KO and normal mouse. This is a somewhat disappointing result in that it may limit the conclusions that can be drawn from this study. One could have hoped that a Higd1c KO would either eliminate the response to hypoxia or had no effect at all. As this is a very important piece of evidence I want to ask for more detail regarding the data and methods.</p></disp-quote><p>Over the last several years, a nuanced view of oxygen sensing has emerged in which there are likely multiple sites beyond the carotid body and multiple molecules (even within the carotid body) involved in acute oxygen sensitivity (reviewed in Funk and Gourine, 2017, J Appl Physiol; Holmes et al., 2022, Front Physiol; Barioni et al., 2022, Sci Adv). The carotid body glomus cell mitochondrial electron transport chain is expected to be the most sensitive site, and we propose that HIGD1C is present almost exclusively in the carotid bodies when acting in combination with less exclusively (but by no means broadly) expressed ETC proteins such as COX4I2 and NDUFA4L2, is responsible for this heightened sensitivity.</p><p>With regards to multiple sites, while the carotid bodies are the major oxygen and likely the most sensitive chemoreceptors contributing to the HVR, we do not exclude a role for other oxygen-sensitive sites such as the aortic bodies, brainstem, and spinal cord (reviewed in Funk and Gourine, 2017, J Appl Physiol; Hodges and Forster, 2012, Neur Regen Res). Indeed, our recent work describes spinal oxygen sensors that can stimulate respiratory centers in the brainstem (Barioni et al., 2022, Sci Adv).</p><p>With regards to multiple molecules involved in acute oxygen sensitivity, please note Figure 3-figure supplement 1. In glomus cells from <italic>Higd1c<sup>+/+</sup></italic> animals, a plethora of cells respond strongly to both severe (PO<sub>2</sub>=25 mmHg) and less severe (PO<sub>2</sub>=50 mmHg) hypoxia, whereas cells from <italic>Higd1c<sup>-/-</sup></italic> mostly respond (though be it at reduced intensity) to only severe hypoxia. This parallels the data from carotid sinus nerve recordings in Figure 3A-D. These data suggest that other molecules are capable of partially subserving HIGD1C’s role in severe hypoxia.</p><p>With regards to the investigation of HVR in <italic>Higd1c<sup>-/-</sup></italic> animals, the magnitude of the defect in the hypoxic ventilatory response we report was at least as severe as in other rodent studies in which carotid bodies were denervated or ablated (Soliz et al., 2005, J Physiol; Del Rio et al., 2013, J Am Coll Cardiol). Moreover, the literature suggests that all experimental animal species show some degree of recovery of the HVR over time after carotid body resection or denervation when tested in an awake, unanesthetized state. Therefore, we might expect some degree of compensation by other sites/molecules in the absence of carotid body HIGD1C.</p><p>For the time course data in Figure 2-figure supplement 1A-C, please note that the last (third) challenge in Figure 2-figure supplement 1A-C is hypercapnia. The most pertinent panel is C, which shows minute ventilation (volume exchanged per minute=respiratory rate*tidal volume). Animals can increase ventilation by increasing either the respiratory rate, tidal volume, or both, and minute ventilation accounts for both respiratory rate and tidal volume changes. The difference between minute ventilation of <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals was apparent and consistent throughout the entire duration of hypoxic periods, including ramp periods from normoxia (21% O<sub>2</sub>) to hypoxia (10% O<sub>2</sub>). See Figure 2-figure supplement 1A-C with 30 s bins for normoxic (Nox, yellow) and hypoxic (Hox, blue) periods of the time course. Ramps (no color) were 1 min. Data are shown as mean and SEM.</p><p>We have replaced Figure 2-figure supplement 1A-C because they better illustrate the reduction in HVR.</p><disp-quote content-type="editor-comment"><p>9. Forgive me if I have misunderstood but in the methods section you state that &quot;we used a respiratory rate of 215 breaths/min (comparable to the mean of a wild type in hypoxia) as a cut off for inclusion in this study&quot;. It is unclear how this works. Are you rejecting recordings with RR in excess of this figure or below this figure? When are you making this decision, under normoxic conditions at the beginning of an experiment, under hypoxic conditions, or at any time in the recording? Can you clarify this point and indicate how often recordings were rejected by this criteria in the different mice?</p></disp-quote><p>We rejected trials where any of the normoxic periods had an average respiratory rate that exceeded 215 breath/min in order to assess calm breathing and exclude artefacts from sniffing, grooming, and movement that correlated with high-frequency events above the ventilation in hypoxia. Normoxic periods evaluated included the baseline at the beginning of the experiment as well as subsequent inter-stimulus normoxic periods. Ventilation in hypoxia was much more regular with few artefacts, and high frequency in hypoxia was not used as an exclusion criterion. We have now stated this exclusion criterion and our rationale more clearly in the Methods (p. 47).</p><p><xref ref-type="fig" rid="sa2fig1">Author response image 1</xref> shows the percentage of trials rejected by genotype (number of trials indicated on bars). The percent rejected between <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals by allele are not statistically significant by the <italic>z</italic> test of proportions (p=0.7039, 0.5353, and 0.7114 for <italic>1-1</italic>, <italic>3-1</italic>, and <italic>5-3</italic>, respectively). We have added these stats to the Methods (p. 47).</p><fig id="sa2fig1" position="float"><label>Author response image 1.</label><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-sa2-fig1-v3.tif"/></fig><disp-quote content-type="editor-comment"><p>10. Was there any notable difference in mouse behaviour between genotypes during plethysmography? Mice usually become much less active in hypoxia and basal metabolic rate goes down resulting in a fall in CO2 production and a drop in PaCO2 which leads to a fall in ventilation (hypoxic ventilatory decline: HVD). This often complicates the analysis/interpretation of responses to hypoxia. Over what time period do you measure changes in ventilation – over the entire period of exposure to hypoxia, at the peak? Or towards the end? Are changes in the rate of HVD influencing the comparison between KO and wt? Have you measured PaCO2 under hypoxic conditions? I would predict that it would be lower than under control conditions. Could you introduce a little CO2 in hypoxic conditions to try to neutralise this effect?</p></disp-quote><p>No behavioral differences between <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals during our whole-body plethysmography experiments were observed. Both genotypes became less active in hypoxia and exhibited more regular breathing.</p><p>To calculate the ventilation data for hypoxia, we first calculated the mean over the entire duration of both hypoxic stimulus periods (5 min each), and then we averaged the mean values of the two hypoxic periods. The 1-min ramp periods for the chamber to go from normoxia (21% O<sub>2</sub>) to hypoxia (10% O<sub>2</sub>) or vice versa were not included in calculations for either normoxia or hypoxia (see also time courses in response to item 8). From the time course data (see item 8), <italic>Higd1c<sup>-/-</sup></italic> mutants had lower ventilation at all time points in hypoxia and the ramp to hypoxia.</p><p>We agree with the reviewer that hypoxia will reduce PaCO<sub>2</sub>. On the one hand, hypoxia acts to attenuate ventilation by suppressing metabolism (reducing CO<sub>2</sub> production) and directly inhibiting neurons of the respiratory controller. On the other hand, this attenuation of ventilation is offset by central and peripheral oxygen chemoreceptors which excite the respiratory control system. In neonates, the oxygen chemoreceptors reduce but do not fully overcome the central suppressive effect of hypoxia; in adults, oxygen chemoreceptors are more potent and can fully overcome the hypoxic depression of neurons to cause a net increase in ventilation. Thus, in adults, hypoxia will cause a net reduction in PaCO<sub>2</sub>, a respiratory stimulant. As the HVR is lower in <italic>Higd1c<sup>-/-</sup></italic> animals, we would expect <italic>Higd1c<sup>-/-</sup></italic> to have a higher PaCO<sub>2</sub> in hypoxia than <italic>Higd1c<sup>+/+</sup></italic><sub>,</sub> providing more respiratory stimulant to <italic>Higd1c<sup>-/-</sup></italic> animals. Thus, the lower HVR during poikilocapnic hypoxia conditions in <italic>Higd1c<sup>-/-</sup></italic> compared to <italic>Higd1c<sup>+/+</sup></italic> is expected to <italic>underestimate</italic> the importance of HIGD1C to the hypoxic response at the level of the oxygen chemoreceptor.</p><p>We have not attempted to regulate PaCO<sub>2</sub> under hypoxic conditions in our mice. In large animals, blood gases can be monitored in real-time, allowing the use of feedback control to deliver appropriate CO<sub>2</sub> to maintain PaCO<sub>2</sub> at a constant level. This is not feasible in mice. Blood gas measurements in mice are terminal experiments that require many animals to get a single time point, more than we can breed and raise to adults in two months. In addition, collecting sufficient arterial blood for blood gas experiments in adult mice requires anesthesia, which alters the HVR, or installing carotid artery catheters in awake mice, which would ablate one carotid body.</p><p>Introducing a fixed level of CO<sub>2</sub> during hypoxia is sometimes performed to try to mitigate the reduction in PaCO<sub>2</sub> due to hyperventilation. However, such a maneuver is expected to (a) stimulate the carotid body in an oxygen chemoreceptor-dependent manner because of the multiplicative O<sub>2</sub> and CO<sub>2</sub> interaction at the carotid body, the mechanism for which is unknown, and (b) change the non-additive (likely hypoadditive) interaction between central and peripheral chemoreceptors which has not been carefully characterized in mice. Together, these effects are almost impossible to quantify. Rather than adding unknowns, we chose to opt for simplicity and perform our experiments under poikilocapnic hypoxia conditions that mimic high altitude (i.e., hypoxia without CO<sub>2</sub> supplementation). At high altitudes, carotid body oxygen sensing causes hyperventilation, and under these conditions, reducing oxygen sensing is expected to reduce ventilation.</p><disp-quote content-type="editor-comment"><p>11. What happens if you do a sham switch (i.e. switch between two identical gasses/air), is there any startle response associated with just mechanically switching between two gas lines? If not what happens if you look specifically at the peak/early response to hypoxia before CO2 has much chance to fall?</p></disp-quote><p>We did not observe any startle response associated with just switching between two identical gases. From the time course data (please see item 8), <italic>Higd1c<sup>-/-</sup></italic> mutants exhibited lower ventilation at all time points, including during the ramp and first points of hypoxia.</p><disp-quote content-type="editor-comment"><p>12. Are Higd1c +/+ mice taken from your in house breeding programs generating Higd1c -/- mice or are they just off the shelf C57Bl/6J from Jax? If the latter how long are these mice held in your facility (under the same conditions as the KO mice) before being used?</p></disp-quote><p><italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals were generated from crosses between <italic>Higd1c<sup>+/-</sup></italic> parents in our facility. We have added this detail to the Methods (p. 42).</p><disp-quote content-type="editor-comment"><p>13. In the methods section on nerve recordings you state that &quot;Preparations were exposed to a brief hypoxic challenge (PO2 = 60 mmHg) to determine viability; preparations that failed to show a clear increase in activity during this challenge were discarded&quot;. You are testing the hypothesis that Higd1c is important/essential for the generation of the response to hypoxia so why exclude data from preparations that lack a hypoxic response? This is just what you are looking for! I hope this is just a mistake in writing up the methods, BUT if this is really what was done then the whole nerve recording study could be invalid (depending on just what proportion of preparations were actually discarded). If you want some sort of test for viability of the preparation, which is a good idea, then there are many other stimuli one could choose instead that do not involve mitochondrial function e.g hypercapnia/acidosis, high potassium, acetyl choline, TASK channel inhibitors/respiratory stimulants.</p></disp-quote><p>We thank the Reviewer for pointing out this mistake. Dr. Roy, who performed these challenging experiments, typically gives rat preparations a PO<sub>2</sub>=60 mmHg hypoxic pre-challenge, but he no longer does this in mice because the preparation is too delicate. We have removed this statement in the Methods and described the current practice (p. 49): “Recording was only attempted in nerves that survived cleaning and desheathing. The presence of action potentials under baseline conditions was used as the only test of preparation viability; data were obtained from all preparations deemed viable according to this criterion.”</p><p>We have also updated the representative traces in Figure 3A and B with graphs that better represents the mean data.</p><disp-quote content-type="editor-comment"><p>14. One of the key issues regarding the role of alternative mitochondrial subunits in the carotid body is not simply that they may affect the maximal turnover rate of cytochrome oxidase but whether they alter the kinetic parameters defining sensitivity to hypoxia (i.e. Km, oxygen affinity, P50 ). To determine these really requires making a number of measurements at different PO2 including a zero point (anoxia). This could have been done for both nerve recordings and calcium measurements. Unfortunately it was not, so we are left with data from both of these experiments which demonstrates that the response to hypoxia is smaller in the KO but we have no idea whether these kinetic parameters have changed or not. The study would be a lot stronger if you could demonstrate a change in Km in the Higd1c KO.</p></disp-quote><p>The main conclusion drawn from the calcium imaging and nerve recording experiments is that <italic>Higd1c<sup>-/-</sup></italic> mutants are defective in graded responses to hypoxia in the physiological range (Figure 3). These experiments were performed in intact tissue to measure the activity of as many glomus cells as possible and to preserve normal cell-cell interactions that promote sensory signaling. However, because these experiments were performed in intact tissue, the PO<sub>2</sub> experienced by individual glomus cells could not be accurately determined due to tissue heterogeneity. Thus, the PO<sub>2</sub> of the perfusion reflected the upper limit of an unknown lower range of PO<sub>2</sub> at the cellular level. Technically, anoxia is typically delivered in perfusion by adding a reducing agent like sodium dithionite to scavenge oxygen. However, such agents can also modify cell proteins and complicate the interpretation of results.</p><p>Furthermore, experiments at lower PO<sub>2</sub> would not be informative for nerve recordings because carotid sinus nerve activity does not increase (and can even decrease) once PO<sub>2</sub> is reduced below 30 mmHg (Fidone and Gonzalez, 1986, Handbook of Physiology, The Respiratory System; Hornbein et al., 1961, J Neurophysiol; Hornbein and Roos, 1963, J Physiol; Peng et al., 2020, J Neurophysiol). While intracellular calcium does continue to increase as PO<sub>2</sub> is decreased below 30 mmHg, the lack of correlation of this additional intracellular calcium to sensory output would make it difficult to interpret these experiments (Peng et al., 2020, J Neurophysiol). We chose to focus on a more physiological PO<sub>2</sub> range of 25-100 mmHg for carotid body sensory activity experiments, and in this range, <italic>Higd1c<sup>-/-</sup></italic> mutants have reduced sensitivity in their response to hypoxia (Figure 3).</p><p>We thank the reviewer for the suggestion to curve fit our glomus cell imaging data to derive KmO<sub>2</sub> values. Unfortunately, we do not have enough points in the near anoxic range to restrain a dose response curve for our current data. Dissociating large numbers of glomus cells to perform comprehensive studies at multiple oxygen levels is not feasible using adult mice, and thus, studies that report calcium and metabolic imaging from mouse glomus cells have not included this level of analysis (Fernandez-Augera et al., 2015, Cell Metab; Moreno-Dominguez et al., 2020, Sci Signal; Peng et al., 2020, J Neurophysiol, Peng et al., 2019, Respir Neurobiol Physiol; MacMillan et al., 2022, Commun Biol). The studies we have found that show derived KmO<sub>2</sub> values utilized neonatal rats, which have larger carotid bodies and are easier to dissociate (Landuaer et al., 1995, J Physiol; Buckler and Turner, 2013, J Physiol).</p><p>We agree that determining whether alternative mitochondrial subunits change the Km of oxygen on the mitochondrial electron transport chain in glomus cells is an important question. However, the ideal experiment to make direct oxygen measurements on large numbers of purified glomus cells using cellular oxygen consumption to reduce oxygen levels is not currently possible in the mouse. We have added this limitation to the Discussion (p. 40): “Future studies of oxygen consumption by mitochondria of glomus cells, when feasible, will further illuminate the roles of these proteins in carotid body oxygen sensing.” Nevertheless, we have now determined the contribution of atypical mitochondrial proteins to Km of oxygen on electron transport chain activity in cell culture, where we could obtain more abundant material for direct oxygen measurements. We found that expression of both HIGD1C and COX4I2 in <italic>HIGD1A</italic>-KO HEK293T cells increased the p50<sub>mito</sub> to enhance the sensitivity of the electron transport chain to hypoxia (see also response to item 19).</p><disp-quote content-type="editor-comment"><p>15. It would appear from the results obtained with Rh123 and the weak responses to FCCP that there was inadequate loading of this dye to make good measurements of mitochondrial potential (ψM) in many of the cells studied. If you look at the paper by Biscoe and Duchen they were achieving a 100% increase in Rh125 fluorescence upon adding FCCP, Anoxia or CN, not 20%. The level of loading is critical with this dye in order to get it to work properly in the de-quench mode.</p></disp-quote><p>It is difficult to directly compare our Rh123 experiments on intact mouse carotid bodies with experiments on dissociated rabbit glomus cells used in Biscoe and Duchen, 1992, J Physiol. We expect dye loading to be more heterogeneous in intact carotid bodies, compared to dissociated cells, due to the differential accessibility of different parts of the tissue to Rh123. We accounted for this heterogeneity by normalizing fluorescence to baseline. In addition, we do not know whether there are species-specific differences between mouse and rabbit or selection during dissociation and imaging for only a subset of glomus cells with better FCCP responses in Biscoe and Duchen. In developing our protocol, we tested multiple concentrations of Rh123 and incubation times, and increasing the time of dye loading did not increase baseline fluorescence, indicating we had reached a steady-state level of dye loading.</p><disp-quote content-type="editor-comment"><p>In addition, to correct for differences in dye loading, responses to acute hypoxia should probably be normalised not only to the baseline but also to the response to FCCP.</p></disp-quote><p>We are not confident that the FCCP response reflects a maximum mitochondrial membrane potential response against which the other responses could be normalized. FCCP was presented after both hypoxia and cyanide at the end of a long experiment, during which Rh123 fluorescence decreased over time.</p><disp-quote content-type="editor-comment"><p>The smaller response to hypoxia in Higd1c -/- could simply reflect lower dye loading, with consequent lower dynamic response from Rh123 to change in mitochondrial potential, rather than any actual change in ψM.</p></disp-quote><p>Because <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> carotid bodies were loaded with Rh123 under the same conditions and their morphologies and glomus cell counts were similar (Figure 1G-I), we do not believe that the smaller Rh123 responses of <italic>Higd1c<sup>-/-</sup></italic> glomus cells to hypoxia was due to poorer dye loading but likely due to a combination of a less polarized inner mitochondrial membrane at baseline and weaker response to hypoxia. In <italic>Higd1c<sup>-/-</sup></italic> glomus cells that had strong responses to FCCP comparable to <italic>Higd1c<sup>+/+</sup></italic>, the response to hypoxia was still weaker than <italic>Higd1c<sup>+/+</sup></italic> (Figure 4D-F). To resolve this, we performed additional experiments testing FCCP responses as the first stimulus in <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> carotid bodies and found that even under these more optimal conditions, there were smaller Rh123 responses to FCCP in <italic>Higd1c<sup>-/-</sup></italic> glomus cells (p. 24, Figure 4-figure supplement 1D). This suggests that there is a defect in ψM in normoxia in <italic>Higd1c<sup>-/-</sup></italic> glomus cells (see also response to item 17).</p><disp-quote content-type="editor-comment"><p>16. The response to anoxia has not been tested which again confounds attempts to determine a P50 for mitochondrial depolarisation. I note that the rate of change in PO2 (Figure 4 suppl 1 A) is rather slow so some Rh123 may also leak out of the cell during the recording. Were any corrections applied for dye leakage?</p></disp-quote><p>Yes, we did correct for dye leakage and bleaching by performing baseline subtraction with linear interpolation.</p><disp-quote content-type="editor-comment"><p>17. In summary the interpretation of this data is equivocal. Higd1c -/- may take up Rh123 less avidly than wt but is this due to a lower resting ψM or something else? This experiment needs repeating extending loading time or Rh123 concentration until robust responses to FCCP can be recorded.</p></disp-quote><p>We consider it likely that <italic>Higd1c<sup>-/-</sup></italic> glomus cells had weaker responses to FCCP due to a less polarized inner mitochondrial membrane. HIGD1C could affect the function of the electron transport chain at all oxygen levels. To help resolve this, we performed additional experiments on <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> carotid bodies, testing FCCP responses as a first stimulus to estimate differences in resting membrane potential while minimizing dye leakage and bleaching over time. Similar to when FCCP was presented as the third stimulus (Figure 4C), <italic>Higd1c<sup>-/-</sup></italic> glomus cells had smaller Rh123 responses to FCCP compared to <italic>Higd1c<sup>+/+</sup></italic> glomus cells (Figure 4-figure supplement 1D), consistent with a defect in ψM in normoxia in <italic>Higd1c<sup>-/-</sup></italic> glomus cells.</p><p>In developing our Rh123 imaging protocol, we tested several Rh123 concentrations up to 50 µg/ml. We did not want to increase the concentration further because Rh123 and other mitochondrial membrane potential dyes (TMRM and TMRE) begin to inhibit mitochondrial respiration at this concentration (Scaduto and Grotyohann, 1999, Biophys J). We also found empirically that extending the incubation time for dye loading did not improve the FCCP response.</p><disp-quote content-type="editor-comment"><p>18. If you want to see if genotype affects resting ψM you would probably be better not working in the quench mode but either using much lower concentrations of Rh123 or another probe, e.g. TMRM, and loading for a longer period of time (until dye uptake reaches a steady state without any quenching occuring).</p></disp-quote><p>To interpret imaging experiments with Rh123 and TMRM in non-quenching mode to measure resting ψM would require perfectly controlled and consistent dye loading and imaging conditions in order to compare absolute fluorescence differences. As far as we know, this has not been done in glomus cells, even using dissociated cell preparations. When performing two-photon imaging of intact carotid bodies, glomus cells are located at different depths and necessarily experience different illuminations, along with differences in exposure to Rh123 during loading. Therefore, we do not believe we can achieve the level of control necessary to draw a strong conclusion using Rh123 or TMRM in the non-quenching mode in intact tissue. We believe that testing FCCP responses by Rh123 imaging in quenching mode provides a reasonable assessment of the maximal response, especially if we deliver the stimulus at the beginning of the experiment when cells across preparations are likely to be in the most similar state (see responses to items 15-17).</p><disp-quote content-type="editor-comment"><p>19. Data in Fig6-E shows &gt;= 40% inhibition of oxygen consumption under hypoxic conditions compared to normoxia in all HEK cell types studied. Given that the level of oxygen in hypoxia is stated to be 25 mmHg this is something of a surprise. The P50 for most cells is thought to be &lt; 1mmHg. Something is wrong here. If you are using an Oroboros Oxygraph (as stated in methods) it should be possible to measure oxygen consumption from air all the way down to zero oxygen and derive an exact P50 for each cell type. This should be done. This is a very important experiment that proports to show that it is the combination of Higd1c and Cox4I2 that generates the unusual sensitivity of complex IV towards oxygen. Philosophically I like this hypothesis. If true it would mark a major advance in this field, but I want to see some hard data with rigorously determined kinetic measurements!</p></disp-quote><p>Thank you for this suggestion. We agree with the importance of deriving p50 values for <italic>HIGD1A-KO</italic> cells expressing different combinations of HIGD1C and COX4I2 to extend our data in Figure 6E and F. We performed additional experiments on these cell lines to calculate the P50 using an Oroboros Oxygraph as suggested. The new data shows that co-expression of HIGD1C and COX4I2 in <italic>HIGD1A</italic>-KO cells increased the mitochondrial oxygen affinity (p50<sub>mito</sub>) to reveal an enhanced response to hypoxia (p. 37, new Figure 6F and Figure 6—figure supplement 1E). Notice that in these assays, to calculate the p50<sub>mito</sub>, we measured endogenous whole cell respiration.</p><disp-quote content-type="editor-comment"><p>20. It would be better in future if the calcium imaging studies could be performed using the same perfused preparation that the nerve recording experiments used. This would remove the requirement for equilibrating superfusate with 95% oxygen which is far from physiological and would allow the carotid body tissue to be perfused with physiologically relevant levels of oxygen. However, superfusion with hyperoxic solutions is considered standard in many systems and so additional experiments are not required at this time.</p></disp-quote><p>We thank the reviewer for this suggestion, which we will strive to adopt in future calcium imaging experiments.</p><disp-quote content-type="editor-comment"><p>21. Expanding the study to see if HIGD1A is expressed in carotid bodies of multiple species would strengthen the paper. It would also be interesting to see if it is absent in the carotid bodies of guinea pigs which are not acutely oxygen sensitive. Furthermore, chromaffin cells in fetal adrenal medulla are oxygen-sensitive whereas mature chromaffin cells are not, it would be fascinating to see if HIGD1A expression changes during the maturation of chromaffin cells. These possibilities might be discussed.</p></disp-quote><p>We showed that <italic>Higd1c</italic> is expressed in the carotid bodies of both mouse and human. We appreciate the suggestion to expand the study to additional species, such as the poorly oxygen-sensitive guinea pig. We have added RT-qPCR data from the rat, another common animal model for carotid body studies. <italic>Higd1c</italic> was expressed at higher levels in the carotid body compared to adult and neonatal adrenal medulla and thoracic spinal cord, which contains a central oxygen sensor (Barioni et al., 2022, Sci Advances) (p. 6, Figure 1-figure supplement 4B). <italic>Higd1c</italic> expression in the adrenal medulla did not increase from neonate to adult. Testing expression in other species is beyond our capabilities at this time because of limited access to carotid body tissue.</p><disp-quote content-type="editor-comment"><p>22. Tidal volume changes with the weight of the animals. Tidal volume should be adjusted for the weights of the animals tested. If there are weight differences between knockouts and wildtype it can have profound effects on the data.</p></disp-quote><p>Body weights of <italic>Higd1c<sup>+/+</sup></italic> and <italic>Higd1c<sup>-/-</sup></italic> animals for all three <italic>Higd1c</italic> alleles were not significantly different by two-way ANOVA with Sidak correction (see <xref ref-type="fig" rid="sa2fig2">Author response image 2</xref>).</p><fig id="sa2fig2" position="float"><label>Author response image 2.</label><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-78915-sa2-fig2-v3.tif"/></fig><p>We did consider normalizing tidal volume and minute ventilation to body weight as suggested, but for the animals used in our study, body weight did not correlate well with respiratory rate, tidal volume, or minute ventilation in wild-type or mutant animals in normoxia or hypoxia. When plotted against body weight, only tidal volumes for <italic>3-1<sup>+/+</sup></italic> in normoxia and <italic>5-3<sup>+/+</sup></italic> in hypoxia had fitted regression lines with significantly non-zero slopes at p&lt;0.05. Nevertheless, we verified that all differences that are statistically significant (p&lt;0.05) without normalizing by body weight are also significant if we normalize to body weight. In addition to comparing mean values of ventilatory parameters, we showed the % change in the ventilatory parameters for each animal before and after hypoxia (“Hypoxic Response”), which we feel is the most appropriate presentation as it essentially uses each animal as its own control. We have added our rationale for not normalizing by body weight in the Methods (pp. 47-48).</p><disp-quote content-type="editor-comment"><p>Reviewer #1 (Recommendations for the authors):</p><p>Understanding the precise intracellular signalling pathways underpinning hypoxic sensitivity in the carotid body chemoreceptor has been a major unsolved area in sensory neurophysiology. Early studies almost 60 years ago suggested the importance of a metabolic signal coupled to the mitchrondria, which could regulate intracellular calcium homeostasis and exocystosis of excitatory transmitter in type I glomus cells.</p><p>Using RNAseq this manuscript has identified a novel gene that encodes protein regulation of Complex IV in the carotid body response to hypoxia. Here the authors found HIGD1C, a novel hypoxia-inducible gene domain factor isoform, as an electron transport chain Complex IV-interacting protein was almost exclusively expressed in the carotid body. Using a combination molecular biology, protein chemistry, genetic knock-out, calcium imaging and respiratory measurements, the authors elegantly demonstrated the physiological utlility of HIGD1C being required for carotid body oxygen sensing via enhanced Complex IV sensitivity to hypoxia. Deletion of the gene massively attenuated the chemoreceptor response to hypoxia, whereas of expression of HIGD1C could recapitulate the increased oxygen sensitivity of Complex IV in HEK 293T cells, but not the response to hypercapnia.</p><p>Whilst this large body of work shows the putative role of HIGD1C in oxygen sensing, the relationship between this protein and the graded response of afferent nerve firing to physiological levels of hypoxia remains to be established to support an essential role for this signalling pathway in hypoxic chemotransduction.</p><p>This is a large body of work supporting the idea that HIGD1C is required for hypoxic sensing in the mouse through the regulation complex IV. The experiments are well designed, complex and appear to have been carefully performed.</p></disp-quote><p>We thank the reviewer for recognizing the quality of our study.</p><disp-quote content-type="editor-comment"><p>Specific comments for improvement:</p><p>Parts of the manuscript are difficult to follow re data presentation since the data are densely reported in places. Eg Figure 1 Figure supplement 2 on page 9 is virtually impossible to read.</p></disp-quote><p>Please see response to item 1.</p><disp-quote content-type="editor-comment"><p>A tighter introduction is required re references where credit should be given to the early studies showing that hypoxia excites CB and breathing and chemodenervation abolishes the breathing responses (eg Neil; Torrance; Lahiri should be given credit in para 1 on page 3).</p></disp-quote><p>Please see response to item 2.</p><disp-quote content-type="editor-comment"><p>Additionally, primary references should be given for statements of fact like …'Under these pathological conditions, suppressing CB activity improves causal symptoms such as hypertension (REF), cardiac arrhythmias (REF), and insulin resistance (REF) (Iturriaga, 2018)'. Credit must be given to the primary source, not a review.</p></disp-quote><p>Please see response to item 3.</p><disp-quote content-type="editor-comment"><p>p 4 'We found that three such genes, Higd1c, Cox4i2, and Ndufa4l2, were expressed at higher levels in the mouse CB (Figure 1A)'. Are you confident that this expression is only in type 1 cells and not type 2 cells?</p></disp-quote><p>Please see response to item 4.</p><disp-quote content-type="editor-comment"><p>Much of the data presented has used parametric statistics on n of 3/3 or 4/4 samples eg Figure 1 supp 3 page 10. Are these data normally distributed to support parametric use of stats? Please comment on the sample re biological replicates v technical replicates. How were the data treated here?</p></disp-quote><p>Please see response to item 5.</p><disp-quote content-type="editor-comment"><p>The gel on p26 panel B looks over run. Comment?</p></disp-quote><p>Please see response to item 6.</p><disp-quote content-type="editor-comment"><p>Aspects of the data are very convincing. Whilst this large body of work shows the putative role of HIGD1C in oxygen sensing, the relationship between this protein and the graded response of afferent nerve firing to physiological levels of hypoxia remains to be established to support an essential role for this signalling pathway in hypoxic chemotransduction. This limitation should be acknowledged. Please comment?</p></disp-quote><p>Please see response to item 7.</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>I have a number of major concerns about parts of this research which need to be addressed before I could comment on its conclusions and importance. Some of these may just require a better explanation or correction to the text (e.g. where there may be an ambiguity over how an experiment was conducted). Others may require further work</p></disp-quote><p>We thank the reviewer for detailed assessment of our manuscript. We have tried to provide additional clarification as requested and performed additional experiments.</p><disp-quote content-type="editor-comment"><p>Major comments/Questions</p><p>General reporting of results</p><p>A very general comment I have about this paper is that numerous experiments, particularly in the latter half of this paper using HEK cells, have been conducted with an 'n' of only 3. I do not know what eLifes's normal expectations/requirements are but I would have thought that an 'n' of at least 4 or 5 independent observations should normally be required. Similarly, numerous gels/blots are presented without any indication of how often these types of experiments were repeated. This should be reported and the journal should have some policy over what is expected. To my mind there could be a substantial amount of further work that needs to be completed before this study could be formally published. Apart from this issue the statistics seem to have been done with suitable care and rigour.</p></disp-quote><p>For most quantitative data in cell culture, a minimum n=3 (independent replicates) is enough if there is not much variability, and we have tested for normality using the Shapiro-Wilk test to justify use of parametric statistical tests when appropriate. We increased the sample size for RT-PCR experiments to increase our confidence in those results. Please see also response to item 5 above.</p><p>All gels and blots were repeated 3 times, except for <italic>in-gel</italic> activity experiments in Figure 5-figure supplement 1E, which were performed twice. We added the number of replicates to figure legends as appropriate (Figure 5 and Figure 5-figure supplements 1-3). n values for data present in bar graphs were already reported in legends.</p><disp-quote content-type="editor-comment"><p>Questions/suggested changes.</p><p>Plethysmography.</p><p>With respect to the effects of Higd1c KO on ventilation. Although all KO's appear to have a blunted ventilatory response to hypoxia, a ventilatory response remains none the less. This is particularly evident for the 1.1 KO as shown in the example trace in Figure 2 supplement 1 A where the second response to a hypoxic stimulus looks very similar between the KO and normal mouse. This is a somewhat disappointing result in that it may limit the conclusions that can be drawn from this study. One could have hoped that a Higd1c KO would either eliminate the response to hypoxia or had no effect at all. As this is a very important piece of evidence I want to ask for more detail regarding the data and methods.</p></disp-quote><p>Please see response to item 8.</p><disp-quote content-type="editor-comment"><p>Forgive me if I have misunderstood but in the methods section you state that &quot;we used a respiratory rate of 215 breaths/min (comparable to the mean of a wild type in hypoxia) as a cut off for inclusion in this study&quot;. It is unclear how this works. Are you rejecting recordings with RR in excess of this figure or below this figure? When are you making this decision, under normoxic conditions at the beginning of an experiment, under hypoxic conditions, or at any time in the recording? Can you clarify this point and indicate how often recordings were rejected by this criteria in the different mice?</p></disp-quote><p>Please see response to item 9.</p><disp-quote content-type="editor-comment"><p>Was there any notable difference in mouse behaviour between genotypes during plethysmography? Mice usually become much less active in hypoxia and basal metabolic rate goes down resulting in a fall in CO2 production and a drop in PaCO2 which leads to a fall in ventilation (hypoxic ventilatory decline: HVD). This often complicates the analysis/interpretation of responses to hypoxia. Over what time period do you measure changes in ventilation – over the entire period of exposure to hypoxia, at the peak? Or towards the end? Are changes in the rate of HVD influencing the comparison between KO and wt? Have you measured PaCO2 under hypoxic conditions? I would predict that it would be lower than under control conditions. Could you introduce a little CO2 in hypoxic conditions to try to neutralise this effect?</p></disp-quote><p>Please see response to item 10.</p><disp-quote content-type="editor-comment"><p>What happens if you do a sham switch (i.e. switch between two identical gasses/air), is there any startle response associated with just mechanically switching between two gas lines? If not what happens if you look specifically at the peak/early response to hypoxia before CO2 has much chance to fall?</p></disp-quote><p>Please see response to item 11.</p><disp-quote content-type="editor-comment"><p>Are Higd1c +/+ mice taken from your in house breeding programs generating Higd1c -/- mice or are they just off the shelf C57Bl/6J from Jax? If the latter how long are these mice held in your facility (under the same conditions as the KO mice) before being used?</p></disp-quote><p>Please see response to item 12.</p><disp-quote content-type="editor-comment"><p>Nerve fibre recordings and calcium recordings.</p><p>In the methods section on nerve recordings you state that &quot;Preparations were exposed to a brief hypoxic challenge (PO2 = 60 mmHg) to determine viability; preparations that failed to show a clear increase in activity during this challenge were discarded&quot;. You are testing the hypothesis that Higd1c is important/essential for the generation of the response to hypoxia so why exclude data from preparations that lack a hypoxic response? This is just what you are looking for! I hope this is just a mistake in writing up the methods, BUT if this is really what was done then the whole nerve recording study could be invalid (depending on just what proportion of preparations were actually discarded). If you want some sort of test for viability of the preparation, which is a good idea, then there are many other stimuli one could choose instead that do not involve mitochondrial function e.g hypercapnia/acidosis, high potassium, acetyl choline, TASK channel inhibitors/respiratory stimulants.</p></disp-quote><p>Please see response to item 13.</p><disp-quote content-type="editor-comment"><p>One of the key issues regarding the role of alternative mitochondrial subunits in the carotid body is not simply that they may affect the maximal turnover rate of cytochrome oxidase but whether they alter the kinetic parameters defining sensitivity to hypoxia (i.e. Km, oxygen affinity, P50 ). To determine these really requires making a number of measurements at different PO2 including a zero point (anoxia). This could have been done for both nerve recordings and calcium measurements. Unfortunately it was not, so we are left with data from both of these experiments which demonstrates that the response to hypoxia is smaller in the KO but we have no idea whether these kinetic parameters have changed or not. The study would be a lot stronger if you could demonstrate a change in Km in the Higd1c KO.</p></disp-quote><p>Please see response to item 14.</p><disp-quote content-type="editor-comment"><p>Rh123 experiments.</p><p>It would appear from the results obtained with Rh123 and the weak responses to FCCP that there was inadequate loading of this dye to make good measurements of mitochondrial potential (ψM) in many of the cells studied. If you look at the paper by Biscoe and Duchen they were achieving a 100% increase in Rh125 fluorescence upon adding FCCP, Anoxia or CN, not 20%. The level of loading is critical with this dye in order to get it to work properly in the de-quench mode. In addition, to correct for differences in dye loading, responses to acute hypoxia should probably be normalised not only to the baseline but also to the response to FCCP. The smaller response to hypoxia in Higd1c -/- could simply reflect lower dye loading, with consequent lower dynamic response from Rh123 to change in mitochondrial potential, rather than any actual change in ψM.</p></disp-quote><p>Please see response to item 15.</p><disp-quote content-type="editor-comment"><p>The response to anoxia has not been tested which again confounds attempts to determine a P50 for mitochondrial depolarisation. I note that the rate of change in PO2 (Figure 4 suppl 1 A) is rather slow so some Rh123 may also leak out of the cell during the recording. Were any corrections applied for dye leakage?</p></disp-quote><p>Please see response to item 16.</p><disp-quote content-type="editor-comment"><p>In summary the interpretation of this data is equivocal. Higd1c -/- may take up Rh123 less avidly than wt but is this due to a lower resting ψM or something else? This experiment needs repeating extending loading time or Rh123 concentration until robust responses to FCCP can be recorded.</p></disp-quote><p>Please see response to item 17.</p><disp-quote content-type="editor-comment"><p>If you want to see if genotype affects resting ψM you would probably be better not working in the quench mode but either using much lower concentrations of Rh123 or another probe, e.g. TMRM, and loading for a longer period of time (until dye uptake reaches a steady state without any quenching occuring).</p></disp-quote><p>Please see response to item 18.</p><disp-quote content-type="editor-comment"><p>CIV sensitivity to Hypoxia in HEK.</p><p>Data in Fig6-E shows &gt;= 40% inhibition of oxygen consumption under hypoxic conditions compared to normoxia in all HEK cell types studied. Given that the level of oxygen in hypoxia is stated to be 25 mmHg this is something of a surprise. The P50 for most cells is thought to be &lt; 1mmHg. Something is wrong here. If you are using an Oroboros Oxygraph (as stated in methods) it should be possible to measure oxygen consumption from air all the way down to zero oxygen and derive an exact P50 for each cell type. This should be done. This is a very important experiment that proports to show that it is the combination of Higd1c and Cox4I2 that generates the unusual sensitivity of complex IV towards oxygen. Philosophically I like this hypothesis. If true it would mark a major advance in this field, but I want to see some hard data with rigorously determined kinetic measurements!</p></disp-quote><p>Please see response to item 19.</p><disp-quote content-type="editor-comment"><p>Reviewer #3 (Recommendations for the authors):</p><p>This paper uses a range of techniques to demonstrate the presence of a novel protein (HIGD1C) that interacts with complex 4 of the mitochondrial electron transport chain. The authors demonstrate that this protein is required for hypoxic chemotransduction at the level of the whole animal (plethysmography), at the level of the in-vitro organ (carotid sinus nerve recordings) and at the level of the glomus cell (calcium imaging). The authors then go on to demonstrate that HIGD1C may interact and alter the sensitivity of complex 4 to hypoxia.</p><p>The authors are to be congratulated on a set of thorough physiological experiments that are then extended by detailed cellular respiration studies. Working with mouse carotid body tissue is incredibly challenging and the authors have done extremely well to get such high quality and valuable data.</p><p>The combination of genetic, physiological and cellular experiments make this an extremely compelling paper suitable for publication in eLife.</p><p>The question of why carotid body glomus cells are unusually sensitive to hypoxia has troubled researchers for decades. This paper makes an extremely compelling case for the expression of HIGD1C modulating complex 4 and thereby sensitizing it to hypoxia. The data seems strong and the paper is likely to have a major impact in the field of oxygen sensing.</p></disp-quote><p>We appreciate the reviewer’s recognition of the challenges of performing carotid body experiments in mice, the quality of our data, and the impact of our findings to the field. Thank you!</p><disp-quote content-type="editor-comment"><p>There are several observations that would greatly strengthen the paper.</p><p>1. It would be better in future if the calcium imaging studies could be performed using the same perfused preparation that the nerve recording experiments used. This would remove the requirement for equilibrating superfusate with 95% oxygen which is far from physiological and would allow the carotid body tissue to be perfused with physiologically relevant levels of oxygen. However, superfusion with hyperoxic solutions is considered standard in many systems and so additional experiments are not required at this time.</p></disp-quote><p>Please see response to item 20.</p><disp-quote content-type="editor-comment"><p>2. Expanding the study to see if HIGD1C is expressed in carotid bodies of multiple species would strengthen the paper. It would also be interesting to see if it is absent in the carotid bodies of guinea pigs which are not acutely oxygen sensitive. Furthermore, chromaffin cells in fetal adrenal medulla are oxygen-sensitive whereas mature chromaffin cells are not, it would be fascinating to see if HIGD1C expression changes during the maturation of chromaffin cells. These possibilities might be discussed.</p></disp-quote><p>Please see response to item 21.</p><disp-quote content-type="editor-comment"><p>3. Tidal volume changes with the weight of the animals. Tidal volume should be adjusted for the weights of the animals tested. If there are weight differences between knockouts and wildtype it can have profound effects on the data.</p></disp-quote><p>Please see response to item 22.</p></body></sub-article></article>