<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.2 20190208//EN"  "JATS-archivearticle1-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">82281</article-id><article-id pub-id-type="doi">10.7554/eLife.82281</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Structural Biology and Molecular Biophysics</subject></subj-group><subj-group subj-group-type="heading"><subject>Biochemistry and Chemical Biology</subject></subj-group></article-categories><title-group><article-title>A pathogenic human Orai1 mutation unmasks STIM1-independent rapid inactivation of Orai1 channels</article-title></title-group><contrib-group><contrib contrib-type="author" equal-contrib="yes" id="author-197224"><name><surname>Yeung</surname><given-names>Priscilla S-W</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-5400-8639</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-288831"><name><surname>Yamashita</surname><given-names>Megumi</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-0196-0428</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-38503"><name><surname>Prakriya</surname><given-names>Murali</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-0781-4480</contrib-id><email>m-prakriya@northwestern.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf2"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/000e0be47</institution-id><institution>Department of Pharmacology, Northwestern University</institution></institution-wrap><addr-line><named-content content-type="city">Chicago</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Trebak</surname><given-names>Mohamed</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01an3r305</institution-id><institution>University of Pittsburgh</institution></institution-wrap><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Aldrich</surname><given-names>Richard W</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00hj54h04</institution-id><institution>The University of Texas at Austin</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><author-notes><fn fn-type="con" id="equal-contrib1"><label>†</label><p>These authors contributed equally to this work</p></fn></author-notes><pub-date publication-format="electronic" date-type="publication"><day>20</day><month>02</month><year>2023</year></pub-date><pub-date pub-type="collection"><year>2023</year></pub-date><volume>12</volume><elocation-id>e82281</elocation-id><history><date date-type="received" iso-8601-date="2022-07-29"><day>29</day><month>07</month><year>2022</year></date><date date-type="accepted" iso-8601-date="2023-02-10"><day>10</day><month>02</month><year>2023</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint at .</event-desc><date date-type="preprint" iso-8601-date="2022-08-15"><day>15</day><month>08</month><year>2022</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2022.08.12.503733"/></event></pub-history><permissions><copyright-statement>© 2023, Yeung, Yamashita et al</copyright-statement><copyright-year>2023</copyright-year><copyright-holder>Yeung, Yamashita et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-82281-v2.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-82281-figures-v2.pdf"/><abstract><p>Ca<sup>2+</sup> release-activated Ca<sup>2+</sup> (CRAC) channels are activated by direct physical interactions between Orai1, the channel protein, and STIM1, the endoplasmic reticulum Ca<sup>2+</sup> sensor. A hallmark of CRAC channels is fast Ca<sup>2+</sup>-dependent inactivation (CDI) which provides negative feedback to limit Ca<sup>2+</sup> entry through CRAC channels. Although STIM1 is thought to be essential for CDI, its molecular mechanism remains largely unknown. Here, we examined a poorly understood gain-of-function (GOF) human Orai1 disease mutation, L138F, that causes tubular aggregate myopathy. Through pairwise mutational analysis, we determine that large amino acid substitutions at either L138 or the neighboring T92 locus located on the pore helix evoke highly Ca<sup>2+</sup>-selective currents in the absence of STIM1. We find that the GOF phenotype of the L138 pathogenic mutation arises due to steric clash between L138 and T92. Surprisingly, strongly activating L138 and T92 mutations showed CDI in the absence of STIM1, contradicting prevailing views that STIM1 is required for CDI. CDI of constitutively open T92W and L138F mutants showed enhanced intracellular Ca<sup>2+</sup> sensitivity, which was normalized by re-adding STIM1 to the cells. Truncation of the Orai1 C-terminus reduced T92W CDI, indicating a key role for the Orai1 C-terminus for CDI. Overall, these results identify the molecular basis of a disease phenotype with broad implications for activation and inactivation of Orai1 channels.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>Orai1</kwd><kwd>STIM1</kwd><kwd>CRAC channels</kwd><kwd>inactivation</kwd><kwd>gating</kwd><kwd>store-operated calcium entry</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Human</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01 NS057499</award-id><principal-award-recipient><name><surname>Prakriya</surname><given-names>Murali</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01 NS115508</award-id><principal-award-recipient><name><surname>Prakriya</surname><given-names>Murali</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>F31NS101830</award-id><principal-award-recipient><name><surname>Yeung</surname><given-names>Priscilla S-W</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>A human Orai1 mutation linked to tubular myopathy activates Orai1 channels independently of STIM1 and unmasks calcium-dependent inactivation of Orai1 channels.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Store-operated Ca<sup>2+</sup> release-activated Ca<sup>2+</sup> (CRAC) channels formed by the Orai1 protein mediate a wide range of Ca<sup>2+</sup>-dependent cellular processes including cell motility, proliferation, and differentiation (<xref ref-type="bibr" rid="bib35">Prakriya and Lewis, 2015</xref>; <xref ref-type="bibr" rid="bib8">Emrich et al., 2021</xref>). Orai1 channels open in response to release of endoplasmic reticulum (ER) Ca<sup>2+</sup> stores and function as an essential mechanism for Ca<sup>2+</sup> entry in most cells. The coupling of ER Ca<sup>2+</sup> stores to the opening of Orai1 channels is tightly controlled by the ER Ca<sup>2+</sup> sensor protein STIM1, which functions as the activating ligand for Orai1 channels (<xref ref-type="bibr" rid="bib35">Prakriya and Lewis, 2015</xref>). Orai1 channels consist of six subunits forming three layers of transmembrane domains (TMs), with the pore-lining TM1 domains encapsulated by the TM2/3 ring which is in turn surrounded by TM4 helices (<xref ref-type="bibr" rid="bib16">Hou et al., 2012</xref>). Although much of the early attention was focused on the pore-forming TM1 helix, it is increasingly clear that TMs 2–4 are not merely ‘bystanders’ intended for structural support for the pore, but instead play an active and crucial role in relaying the STIM1 binding signal from the peripheral C-terminus to open the channel gate (<xref ref-type="bibr" rid="bib50">Zhou et al., 2016</xref>; <xref ref-type="bibr" rid="bib13">Frischauf et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>; <xref ref-type="bibr" rid="bib45">Yeung et al., 2020</xref>; <xref ref-type="bibr" rid="bib39">Tiffner et al., 2021</xref>).</p><p>Several types of loss-of-function (LOF) mutations within Orai1 or STIM1 can block channel gating and abrogate store-operated Ca<sup>2+</sup> entry. In human patients, these defective channels have deadly consequences, causing severe combined immunodeficiency, autoimmunity, and ectodermal dysplasia (<xref ref-type="bibr" rid="bib10">Feske, 2010</xref>; <xref ref-type="bibr" rid="bib18">Lacruz and Feske, 2015</xref>), highlighting the essential role of Orai1 channels for immunity and host defense. In addition, many pathogenic gain-of-function (GOF) Orai1 mutations have also been identified that cause Orai1 to open independently of STIM1 (<xref ref-type="bibr" rid="bib31">Nesin et al., 2014</xref>; <xref ref-type="bibr" rid="bib9">Endo et al., 2015</xref>; <xref ref-type="bibr" rid="bib14">Garibaldi et al., 2016</xref>; <xref ref-type="bibr" rid="bib2">Böhm et al., 2017</xref>). The ensuing chronically elevated intracellular Ca<sup>2+</sup> levels in unstimulated cells causes a Stormorken-like syndrome with tubular aggregate myopathy (TAM) and additional accompanying symptoms specific to the individual mutations (<xref ref-type="bibr" rid="bib31">Nesin et al., 2014</xref>; <xref ref-type="bibr" rid="bib9">Endo et al., 2015</xref>; <xref ref-type="bibr" rid="bib14">Garibaldi et al., 2016</xref>; <xref ref-type="bibr" rid="bib2">Böhm et al., 2017</xref>). Potential pore opening mechanisms of several GOF human mutations have been proposed (<xref ref-type="bibr" rid="bib47">Zhang et al., 2011</xref>; <xref ref-type="bibr" rid="bib32">Palty et al., 2015</xref>; <xref ref-type="bibr" rid="bib43">Yamashita et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>; <xref ref-type="bibr" rid="bib3">Bulla et al., 2019</xref>; <xref ref-type="bibr" rid="bib39">Tiffner et al., 2021</xref>), but little is currently known about how the poorly characterized pathogenic human mutation, L138F, located in TM2 at the TM1-TM2/3 ring interface and linked to tubular aggregate myopathy causes constitutive channel activation (<xref ref-type="bibr" rid="bib9">Endo et al., 2015</xref>).</p><p>In addition to high Ca<sup>2+</sup>-selectivity and store-dependent activation, a key distinguishing feature of CRAC channels is fast Ca<sup>2+</sup>-dependent inactivation (CDI). CDI was first described in native CRAC currents of T-cells and mast cells (<xref ref-type="bibr" rid="bib15">Hoth and Penner, 1993</xref>; <xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>) and is now known to extend to all Orai isoforms (Orai1-3) when activated by STIM1 (<xref ref-type="bibr" rid="bib20">Lis et al., 2007</xref>). Fast CDI serves as an important feedback mechanism for restraining Orai channel activity, limiting Ca<sup>2+</sup> entry at hyperpolarized potentials and preventing cellular Ca<sup>2+</sup> overload (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>; <xref ref-type="bibr" rid="bib11">Fierro and Parekh, 1999</xref>). Consistent with this feedback role, mutations that limit CDI enhance the frequency of Ca<sup>2+</sup> oscillations and increase NFAT4 activation in HEK293 cells (<xref ref-type="bibr" rid="bib48">Zhang et al., 2019</xref>). Yet, despite efforts over the last two decades, the molecular mechanism of CDI is not understood. Based on the differential effects of fast and slow Ca<sup>2+</sup> buffers in T cells and mast cells, CDI is known to arise from Ca<sup>2+</sup> microdomains around individual Orai1 channels (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>; <xref ref-type="bibr" rid="bib11">Fierro and Parekh, 1999</xref>) with the Ca<sup>2+</sup> sensing site localized very close to the channel pore estimated to be ~3 nm or less from the pore (<xref ref-type="bibr" rid="bib51">Zweifach and Lewis, 1993</xref>). More recent studies have indicated an essential requirement for STIM1 in mediating CDI, with the inhibitory domain (ID) of STIM1 playing a key role in the inactivation process (<xref ref-type="bibr" rid="bib26">Mullins et al., 2009</xref>; <xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>). In particular, STIM1 mutants lacking the ID domain do not show CDI (<xref ref-type="bibr" rid="bib26">Mullins et al., 2009</xref>), and constitutively active Orai1 mutants such as V102C and P245L do not show CDI in the absence of STIM1, but CDI is restored following co-expression of these mutants with STIM1 (<xref ref-type="bibr" rid="bib23">McNally et al., 2012</xref>; <xref ref-type="bibr" rid="bib6">Derler et al., 2018</xref>). Within Orai1 itself, structure-function studies have implicated the N-terminus (<xref ref-type="bibr" rid="bib1">Bergsmann et al., 2011</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>; <xref ref-type="bibr" rid="bib48">Zhang et al., 2019</xref>), the C-terminus (<xref ref-type="bibr" rid="bib19">Lee et al., 2009</xref>) as well as the intracellular TM2-TM3 loop (<xref ref-type="bibr" rid="bib37">Srikanth et al., 2010</xref>) regions in CDI, but the identity of the Ca<sup>2+</sup> sensor, the location of the inactivation gate, and the precise role of STIM1 for CDI, including the possibility that it serves as the enigmatic Ca<sup>2+</sup> sensor, is poorly understood.</p><p>In this study, we addressed the molecular mechanism by which the pathogenic Orai1 mutation L138F causes constitutive channel activation. Our results indicate that L138F activates Orai1 due to steric clash with the TM1 residue T92 in the neighboring channel subunit. Consistent with this functional interaction, introduction of large amino acids (Leu, Phe, Trp) at T92 also produce very large, constitutively open Orai1 channels with high Ca<sup>2+</sup> selectivity. Uniquely, both L138F and T92W channels show CDI in the absence of STIM1, indicating that CDI is an intrinsic feature of Orai1 channels. However, CDI of constitutively active T92W channels exhibits higher intracellular Ca<sup>2+</sup> sensitivity resulting in high levels of constitutive inactivation. This altered Ca<sup>2+</sup> sensitivity of T92W Orai1 is ‘normalized’ to that of WT Orai1 channels by STIM1. Together, these findings identify a molecular phenotype with broad implications for activation and inactivation of Orai1 channels.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>The TAM-linked human Orai1 L138F mutation opens the pore via steric clash with TM1</title><p>The pathogenic Orai1 L138F mutation located in TM2 was identified using whole exome sequencing in a Japanese family with tubular aggregate myopathy (TAM) and was found to mediate STIM1-independent Ca<sup>2+</sup> entry (<xref ref-type="bibr" rid="bib9">Endo et al., 2015</xref>; <xref ref-type="bibr" rid="bib13">Frischauf et al., 2017</xref>). To address the molecular mechanism of constitutive channel activation in this mutant, we overexpressed L138F Orai1 in HEK293-H cells in the absence of STIM1 and analyzed Orai1 currents by whole-cell patch-clamping. These experiments showed the presence of L138F Orai1 currents even in the absence of STIM1 co-expression. The current was consistent with Orai1 channels based on an inwardly rectifying current-voltage relationship with a reversal potential of 53.5±2.5 mV in 20 mM Ca<sup>2+</sup> Ringer’s solution, permeation of Na<sup>+</sup> ions in divalent-free solutions, and blockade by µM concentrations of La<sup>3+</sup> (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Co-expression of L138F Orai1 with STIM1 resulted in store-dependent activation of Orai1 currents much larger than those evoked by L138F Orai1 alone, indicating that STIM1 can substantively enhance and further gate the activity of this mutant following store depletion (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A and B</xref>). Interestingly, unlike many other constitutively open Orai1 mutants (<xref ref-type="bibr" rid="bib50">Zhou et al., 2016</xref>; <xref ref-type="bibr" rid="bib13">Frischauf et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>), Orai1 L138F showed a much larger Na<sup>+</sup> current compared to its Ca<sup>2+</sup> current (<xref ref-type="fig" rid="fig1">Figure 1A</xref>) (ratio of I<sub>Na</sub>/I<sub>Ca</sub> was 16.1±1.9 (n=13 cells) for L138F compared to 3.5±0.6 (n=10 cells) for WT Orai1 gated by STIM1). Further, following whole-cell break-in, L138F currents exhibited rapid rundown during the first 20–30 s (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). As discussed later in the paper, we believe these features are due to accumulation of calcium-dependent inactivation which limits the amplitude of the Ca<sup>2+</sup> current and causes Ca<sup>2+</sup> current rundown during hyperpolarizing pulses (see below).</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>The GOF activity of L138 mutants depends on the size and shape of the introduced side chain.</title><p>(<bold>A</bold>) Time course of the constitutively active L138F Orai1 current in the absence of STIM1. The trace shows a recording from a HEK293 cell expressing L138F Orai1. At whole-cell break-in (t=0 s), a large standing inward Ca<sup>2+</sup> current in 20 mM Ca<sup>2+</sup> external solution is observed which decreases in amplitude over the first 50 s due to current rundown. Replacing the standard external Ringer’s solution with a divalent-free (DVF) solution reveals a large Na<sup>+</sup> current. The current-voltage (I-V) plots from voltage ramps (–100 mV to +100 mV) are shown on the right. (<bold>B</bold>) Side-view of TM2 residue L210 (hOrai1 L138, red) in the dOrai crystal structure (PDB ID: 4HKR). For simplicity, only two TM1 helices (blue) and two TM2 helices (grey) are shown. Human Orai1 numbering is shown in parentheses. (<bold>C</bold>) Atomic packing analysis of dOrai (PDB ID: 4HKR) showing a heat map of contacts of made by TM2 towards TM1 at the TM2/3 ring-TM1 interface. TM3 is shown in grey and TM4 is hidden for clarity. Residues are colored based on the heat map scale shown on the left that indexes the number of contacts (<xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>). In the bottom panel, TMs 1 and 2 are shown as ribbons, with TM2 residues that face TM1 shown in spheres colored according to the number of contacts made with TM1. Residue T92 is shown in green to highlight its proximity to L138. (<bold>D–E</bold>) Current densities of L138 mutants in the absence of STIM1 co-expression plotted against amino acid side-chain surface area and hydrophobicity. L138F/Y channels are open even without STIM1 while small and flexible substitutions produce loss-of-function channels that cannot be gated by STIM1. Green shading on these plots highlight the GOF mutants L138F and L138Y. Grey dots denote amino acids (charged or Pro/Gly) which have the potential to disrupt the helical structure of TM2. N=4–7 cells. Values are mean ± S.E.M. The intracellular solution used was the standard internal solution with 8 mM BAPTA as the Ca<sup>2+</sup> buffer (see Materials and methods).</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>Mutational analysis and contact dots analysis of the Orai1 L138 locus.</title></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-82281-fig1-data1-v2.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig1-v2.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Analysis of L138 Orai1 currents in the presence of STIM1.</title><p>(<bold>A–B</bold>) Current densities of L138 mutants expressed with STIM1 are plotted against size chain size and hydrophobicity. Small and flexible substitutions produce LOF channels. Green, yellow, and red shading highlights GOF mutants, store-operated, and LOF mutants, respectively. N=4–7 cells for each point. Values are mean ± S.E.M. (<bold>C</bold>) Unlike WT Orai1, L138A and L138S mutants do are not activated by STIM1. In each case, the indicated Orai1 variant was expressed together with STIM1 and currents were recorded following dialysis of 8 mM intracellular BAPTA. (<bold>D</bold>) The L138E mutant cannot be gated by STIM1 but is strongly activated by Orai1 modulator 2-APB (50 μM). (<bold>E</bold>) There is no defect in L138A Orai1 interaction with CAD as measured by E-FRET between L138A Orai1-YFP and CFP-CAD, indicating that loss of gating in the L138A mutant is not due to lack of membrane expression or defect in interaction with STIM1. N=51–57 cells. Values are mean ± S.E.M.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig1-figsupp1-v2.tif"/></fig></fig-group><p>How does the L138F mutation cause constitutive channel activation? The crystal structure of <italic>Drosophila melanogaster</italic> Orai (dOrai) in its closed state (PDB ID: 4HKR) shows that L138, which is located on TM2, protrudes towards the non-pore-lining surface of TM1 (<xref ref-type="bibr" rid="bib16">Hou et al., 2012</xref>; <xref ref-type="fig" rid="fig1">Figure 1B</xref>). To understand how introduction of a bulky Phe at this position could affect channel structure, we used atomic packing analysis using a small-probe contact dots protocol to evaluate packing interactions of helical residues (<xref ref-type="bibr" rid="bib40">Word et al., 1999</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>). This analysis indicated that the majority of L138 contacts are with TM1 (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). In fact, of the 29 residues located in TM2, L138 displayed the highest number of contacts with TM1 (133 contacts; <xref ref-type="fig" rid="fig1">Figure 1C</xref>). H134, a residue critical to channel gating (<xref ref-type="bibr" rid="bib13">Frischauf et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>) showed the second highest number of TM1 contacts (125 contacts; <xref ref-type="fig" rid="fig1">Figure 1C</xref>). Each of these residues showed substantially more contacts than other residues on TM2, which on average only had 18 contacts with TM1 (<xref ref-type="supplementary-material" rid="fig1sdata1">Figure 1—source data 1</xref>). This position of L138 and its extensive interactions with TM1 suggested that replacing the native leucine with a bulkier phenylalanine would cause steric clash with TM1 and potentially alter the conformation of TM1.</p><p>To test this possibility, we mutated L138 to several other amino acids of different sizes and shapes to assess the contribution of steric effects at this residue. Mutation of L138 to large amino acids with benzene rings such as Phe and Tyr evoked constitutively open channels that conducted ions in the absence of STIM1, whereas mutation of L138 to smaller amino acids did not affect L138 activity (<xref ref-type="fig" rid="fig1">Figure 1D</xref>, see also <xref ref-type="supplementary-material" rid="fig1sdata1">Figure 1—source data 1</xref>). Hydrophobicity did not seem to be a significant factor in the GOF phenotype (<xref ref-type="fig" rid="fig1">Figure 1E</xref>). Interestingly, mutation of the Leu at 138 to His or Trp, which are both larger than Leu, also did not significantly increase baseline Orai1 mutant channel baseline activity (<xref ref-type="fig" rid="fig1">Figure 1D</xref>), indicating that the channel is more sensitive to a benzene ring than an imidazole ring at this position. These results indicate that the introduction of a large benzene ring at L138 likely leads to steric clash of the exogenous Phe or Tyr side-chains with residues in TM1 causing channel activation. All of the constitutively active L138 mutants showed significantly larger steady-state currents when co-expressed with STIM1, indicating that the constitutively open L138 mutants can be further gated by STIM1 (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>).</p><p>Intriguingly, analysis of mutant channel activity in the presence of STIM1 co-expression revealed that substitutions of L138 to small amino acids (G/A/S/C/T) caused loss-of-function channels that are unable to be activated by STIM1 (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A–C</xref> and <xref ref-type="supplementary-material" rid="fig1sdata1">Figure 1—source data 1</xref>). Mutations of L138 to polar or charged residues (N/Q/R/E/K/H) also yielded Orai1 channels with reduced currents in the presence of STIM1 (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A, B, D</xref>). The loss of function in these channels is not due to protein misfolding or mistargeting as measurements of E-FRET between L138A Orai1 and YFP-tagged CRAC activation domain (CAD) showed no loss of CAD binding (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1E</xref>). Furthermore, L138E Orai1, which could not be gated by STIM1, could be strongly activated by the small molecule modulator, 2-APB, which is known to activate Orai3 and to a smaller extent Orai1 channels in the absence of STIM1 (<xref ref-type="bibr" rid="bib42">Yamashita et al., 2011</xref>), indicating that the L138E mutation disrupts the STIM1-specific gating pathway without affecting channel expression or ability to conduct currents (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>).</p><p>Taken together, the phenotypes of the different L138 mutants show that the only substitutions retaining WT-like store-operated behavior are those that have similar hydrophobicity as the endogenous Leu (V/I/W/M; <xref ref-type="fig" rid="fig1">Figure 1</xref>). From the pattern of the results, we can conclude that a medium/large sized hydrophobic residue is needed at position 138 at the TM1-TM2/3 ring interface to correctly relay STIM1-dependent gating signal to the pore. The GOF phenotype of L138F human mutation appears to be driven by steric clash between the introduced benzene ring in Phe with an unknown TM1 residue to evoke channel activation.</p></sec><sec id="s2-2"><title>A screen of potential partners on TM1 reveals an L138-T92 interaction</title><p>What is the residue on TM1 that clashes with L138F to cause channel activation? In the closed state structure of <italic>Drosophila</italic> Orai (<xref ref-type="bibr" rid="bib16">Hou et al., 2012</xref>), there are three residues on the non-pore-facing side of TM1 within 3 Å of L138 that could act as potential interaction partners for L138: S93 on the same subunit, A94 on the same subunit, and T92 from the neighboring subunit (<xref ref-type="fig" rid="fig2">Figure 2A</xref>; <xref ref-type="bibr" rid="bib16">Hou et al., 2012</xref>). We hypothesized that L138F likely causes constitutive channel activation via steric hindrance with one of these three residues. To address this hypothesis, we next examined whether relieving this clash by reducing the size of the opposing residue could relieve constitutive channel activity. To test this ‘rescue’ idea, we introduced a Gly at positions 92, 93, and 94 and asked if this reverses the GOF phenotype of L138F Orai1. We found that the A94G substitution did not alter the GOF phenotype of L138F (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). On the other hand, introduction of Gly at the T92 position in the T92G/L138F double mutant reversed the GOF phenotype and caused the channel to be no longer constitutively active (<xref ref-type="fig" rid="fig2">Figure 2B and C</xref>). T92G/L138F Orai1 channels could still be normally activated by STIM1 with the expected properties of Orai1 channels (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A</xref>) indicating that the Gly substitution at T92 is unlikely to grossly disrupt Orai1 structure and function. Finally, S93G/L138F channels showed an intermediate phenotype with less activity than L138F but still higher than WT (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). Together, the results from these rescue experiments suggest that the L138F Orai1 mutant is activated due to steric clash with either S93 on TM1 of the same subunit or T92 of the neighboring subunit.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Analysis of L138-TM1 double mutants indicates that L138 interacts with T92.</title><p>(<bold>A</bold>) Three views of L210 (hOrai1 L138, red) in the dOrai crystal structure (PDB ID: 4HKR) surrounded by the nearby TM1 residue T164 (hOrai1 T92, green) from a neighboring subunit, and S165 (hOrai1 S93, yellow) and A166 (hOrai1 A94, blue) from the same subunit. (<bold>B</bold>) The Orai1 L138F GOF phenotype is reversed by the glycine substitutions at T92 and S93, but not by a Gly substitution at A94. The bar graph plots the current density in the indicated mutants. (<bold>C</bold>) Time course and current-voltage relationships highlighting the reversal of the L138F GOF phenotype by T92G. The L138F single mutant trace and I-V plots are the same as those shown for L138F in <xref ref-type="fig" rid="fig1">Figure 1A</xref>. (<bold>D</bold>) Introduction of a Phe residue at T92, but not at A94 or S93 produces constitutively active GOF channels. This GOF phenotype of T92F is completely reversed by neutralizing the bulky Phe residue at 92 with a Gly substitution at L138. The bar graph shows the current densities in the indicated mutants. (<bold>E</bold>) Example traces of T92F or WT Orai1 currents expressed in the absence of STIM1. T92F evokes a constitutively active, Ca<sup>2+</sup>-selective current. (<bold>F–G</bold>) Loss of STIM1-mediated gating of L138G is reversed by a Phe substitution at T92 (L138G/T92F mutant), suggesting that the total size chain size at this locus is crucial for channel activation. N=4–6 cells. The intracellular solution used was the standard internal solution with 8 mM BAPTA as the Ca<sup>2+</sup> buffer (see Materials and methods). In panels B, D, and F, values are mean ± S.E.M. *p&lt;0.05 by one-way ANOVA followed by unpaired t-test between the indicated variants. **: p&lt;0.01 by unpaired t-test, ***: p&lt;0.001 by unpaired t-test.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Double mutants of L138 with neighboring TM1 residues reveals an interaction with T92.</title></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-82281-fig2-data1-v2.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>S93F and A94F mutations impede channel activation by STIM1.</title><p>(<bold>A</bold>) The T92G/L138F Orai1 double mutant can be gated and activated by STIM1. The left panel shows currents from the double mutant in the presence or absence of STIM1 co-expression, the right panel an example trace of T92G/L138F Orai1 currents in the presence of STIM1. Orai1 current is activated gradually following store depletion and shows the classic properties of Orai1 channels. N=3 cells. (<bold>B</bold>) Average current densities of S93F and A94F Orai1 channels expressed with STIM1. S93F and A94F Orai1 are non-functional even when co-expressed with STIM1. N=4 cells. Values are mean ± S.E.M. *: p&lt;0.05 by unpaired t-test.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig2-figsupp1-v2.tif"/></fig></fig-group><p>If steric clash between L138F and T92 or S93 explains the GOF phenotype of L138F, we reasoned that introduction of large amino acids at these loci in Orai1 should also evoke GOF channels through steric clash with the endogenous L138 residue. We tested this hypothesis by mutating each of these three potential interaction sites on TM1 (A94, S93, and T92) sequentially to Phe, the same amino acid that evokes constitutive activation when introduced at L138 (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). This analysis indicated that only the mutation of T92 to Phe produced constitutively open channels (<xref ref-type="fig" rid="fig2">Figure 2D and E</xref>). By contrast, S93F and A94F mutant channels were not constitutively active, and in fact these mutations also impeded STIM1-mediated channel function (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1B</xref>). Importantly, as seen with the T92G/L138F rescue experiment, introduction of L138G in the strongly active T92F channel completely reversed its GOF phenotype (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). Thus, the most straightforward interpretation of these results is that the L138F mutation, and correspondingly, the T92F mutation evoke tonic channel activation due to steric clash between adjacent pairs of TM1 and TM2 helices.</p><p>As noted above, small amino acids at L138 lead to LOF channels that cannot be gated by STIM1. We therefore hypothesized that this loss of gating may be rescued by restoring contacts in this region by introducing a larger side-chain at T92. Consistent with this hypothesis, the introduction of a large aromatic amino acid, Phe, and T92 in a T92F/L138G double mutant fully restored STIM1-mediated gating (<xref ref-type="fig" rid="fig2">Figure 2F and G</xref>). Together, these results indicate that steric contacts between the pore helix and TM2 in this region of the channel are essential for channel gating and finely tuned to relay the STIM1-mediated conformational change to the pore formed by TM1.</p></sec><sec id="s2-3"><title>Large amino acids mutations at T92 cause strong activation of Orai1 channels</title><p>The results presented above indicate that T92F channels are tonically active due to steric clash between T92F and L138. To address whether the constitutive channel activity of T92F shares side-chain size dependence analogous to that seen at position L138 (<xref ref-type="fig" rid="fig1">Figure 1C</xref>), we mutated T92 to other large and small amino acids and analyzed the mutant Orai1 channel currents in the absence or presence of STIM1. We found that substituting larger amino acids at this position produced GOF channels with large Orai1 currents even in the absence of STIM1 co-expression (<xref ref-type="fig" rid="fig3">Figure 3A</xref> and <xref ref-type="supplementary-material" rid="fig3sdata1">Figure 3—source data 1</xref>), whereas mutants with small, polar substitutions (G/A/S/C) did not cause constitutive activity but instead retained store-operated behavior (<xref ref-type="fig" rid="fig3">Figure 3</xref>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). In general, amino acids with larger surface area (L/M/F/Y/W) produced much larger Orai1 currents (25–35 pA/pF) compared to amino acids with intermediate size (V/I/H) (5–10 pA/pF) (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). The largest constitutively active currents were seen with the Orai1 T92L/M/F/Y/W mutations, which produced Ca<sup>2+</sup>-selective currents with reversal potentials &gt;50 mV, similar to the highly active Orai1 H134A/C/S/T and ANSGA channels described previously (<xref ref-type="bibr" rid="bib50">Zhou et al., 2016</xref>; <xref ref-type="bibr" rid="bib13">Frischauf et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>). Consistent with the high baseline activity of these mutants, T92L/M/F/Y/W channels were not noticeably further activated following whole-cell break-in when co-expressed with STIM1 (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). Moreover, these T92 mutants displayed much larger Ca<sup>2+</sup> currents compared to L138F/Y channels, with current densities of 30–35 pA/pF vs 3–5 pA/pF, respectively (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig3">Figure 3</xref>). We hypothesize that the substantially larger tonic currents elicited by T92 mutations compared to L138 mutations may be related to the size of the endogenous residue at position 92. Because the side-chain surface area of Thr (140 Å<sup>2</sup>) is smaller than that of Leu (170 Å<sup>2</sup>), replacing T92 with bulky residues likely produces much greater degree of steric clash at the TM1-TM2 interface and therefore stronger channel activation than the complementary L138F substitution, where the native Leu is already quite large. Finally, like the charged substitutions at L138, Asp or Arg substitutions at T92 resulted in loss of function in the presence of STIM1 (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1B</xref>), indicating that introduction of a charge at this locus inhibits channel gating.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Large amino acid substitutions at T92 cause constitutive Orai1 activation.</title><p>(<bold>A–B</bold>) The current densities of T92 mutants in the absence of STIM1 plotted against side chain size and hydrophobicity, showing that bulky substitutions at T92 cause GOF channels. Plots show peak Orai1 currents recorded at –100 mV in HEK293 cells expressing the indicated Orai1 mutants. N=4–8 cells. Values are mean ± S.E.M. The green shaded areas denote residues that evoke GOF phenotypes. Grey dots denote amino acids (charged or Pro/Gly) which have the potential to disrupt the helical structure of TM2. (<bold>C</bold>) Example time course of T92W Orai1 current following whole-cell break-in at t=0 s in a cell expressing T92W Orai1 alone. The I-V graphs in 20 mM Ca<sup>2+</sup> and DVF solutions are shown the right. T92W Orai1 alone shows inward rectifying I-V curves with positive reversal potentials, similar to STIM1-activated WT Orai1 channels. (<bold>D</bold>) Example time course and I-V plots of T92W Orai1 with STIM1 co-expression (Orai1:STIM1=1:5 cDNA transfection ratio). STIM1 does not significantly boost the current amplitude of GOF T92W Orai1 channels, suggesting that this mutant is nearly fully active at baseline. The intracellular solution used was the standard internal solution with 8 mM BAPTA as the Ca<sup>2+</sup> buffer (see Materials and methods).</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Orai1 channel activity is correlated with side chain size at T92.</title></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-82281-fig3-data1-v2.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Analysis of T92 Orai1 mutant currents in the presence of STIM1.</title><p>(<bold>A–B</bold>) The current densities of T92 mutants with STIM1 co-expression plotted against size-chain size and hydrophobicity. Green, yellow, and red shading highlights GOF mutants, store-operated, and LOF mutants, respectively. Grey dots denote amino acids (charged or Pro/Gly) which have the potential to disrupt the helical structure of TM2. N=4–8 cells for each point. Values are mean ± S.E.M. N=5–8 cells. Values are mean ± S.E.M. ***: p&lt;0.001 by unpaired t-test.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig3-figsupp1-v2.tif"/></fig></fig-group></sec><sec id="s2-4"><title>L138 and T92 GOF mutations exhibit calcium-dependent fast inactivation in the absence of STIM1</title><p>Fast Ca<sup>2+</sup>-dependent inactivation (CDI) is a distinguishing feature of CRAC channels in which Ca<sup>2+</sup> flux through Orai1 at hyperpolarizing potentials (e.g. steps to –100 mV) causes negative feedback inhibition to inactivate channels on a timescale of tens to hundreds of milliseconds (<xref ref-type="bibr" rid="bib15">Hoth and Penner, 1993</xref>; <xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>; <xref ref-type="bibr" rid="bib11">Fierro and Parekh, 1999</xref>; <xref ref-type="bibr" rid="bib35">Prakriya and Lewis, 2015</xref>). In the presence of a weak chelator such as EGTA, WT Orai1 channels activated by STIM1 inactivate by ~50% during 300 ms steps to –100 mV (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). Fast CDI is regulated by a Ca<sup>2+</sup>-sensing site located very close to the channel pore, estimated to be only 3–4 nm away from the pore (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>). Although the molecular basis of CDI remains unclear, recent studies have suggested that CDI involves functional coupling of the inactivation domain (ID) of STIM1 (<xref ref-type="bibr" rid="bib4">Derler et al., 2009</xref>; <xref ref-type="bibr" rid="bib36">Scrimgeour et al., 2009</xref>; <xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>) with the inner pore residues 76–91 of Orai1 (<xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>). In line with the expected requirement for STIM1 for CDI, many GOF Orai1 mutants including H134A/S, V102C/A, and P245L do not inactivate in the absence of STIM1, but do so in the presence of STIM1 (<xref ref-type="bibr" rid="bib23">McNally et al., 2012</xref>; <xref ref-type="bibr" rid="bib50">Zhou et al., 2016</xref>; <xref ref-type="bibr" rid="bib6">Derler et al., 2018</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>).</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>L138F and T92W Orai1 mutants show CDI.</title><p>(<bold>A</bold>) Currents in response to hyperpolarizing voltage steps in STIM1-gated WT Orai1 channels in the presence of 10 mM EGTA in the internal solution. Hyperpolarizing voltage steps from –120 to –60 mV lasting 300ms were applied from a holding potential of + 30 mV. Replacing the extracellular 20 mM Ca<sup>2+</sup> Ringer’s solution with a DVF solution eliminates CDI, consistent with the known calcium dependence of CDI (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>). (<bold>B</bold>) Representative traces showing CDI of L138F Orai1 currents in a cell expressing L138F Orai1 alone. The intracellular solution contained 8 mM BAPTA. (<bold>C</bold>) Quantification of extent of inactivation (1−<italic>I</italic><sub><italic>ss</italic></sub><italic>/I</italic><sub><italic>peak</italic></sub>) of L138F GOF mutant channel without STIM1 with 8 mM BAPTA internal solution. (<bold>D</bold>) Representative traces of CDI of T92W Orai1 without STIM1 with an 8 mM BAPTA internal solution. (<bold>E</bold>) Quantification of extent of inactivation (1−<italic>I<sub>ss</sub></italic>/<italic>I<sub>peak</sub></italic>) of T92W Orai1 in the absence of STIM1. In both mutants, inactivation seen in 20 mM Ca<sup>2+</sup> is abolished in the presence of divalent-free (DVF) solution indicating that the inactivation requires conducting Ca<sup>2+</sup> ions. N=5–17 cells. Values are mean ± S.E.M.</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Analysis of STIM1-independent inactivation in L138 and T92 mutants.</title></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-82281-fig4-data1-v2.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Analysis of T92 mutant CDI.</title><p>(<bold>A</bold>) Inactivation of the T92W Orai1 mutant is enhanced by raising extracellular Ca<sup>2+</sup> to 110 mM. The left panels show T92W Orai1 currents in response to hyperpolarizing voltage steps from –120 to –60 mV from a holding potential of +30 mV. The right graph summarizes the extent of CDI of T92W Orai1 in 20 and 110 mM external solutions. (<bold>B</bold>) Example traces showing inactivation seen in STIM1-gated WT and L138 or T92 mutant channels during a 100ms hyperpolarizing step from +30 mV to -100 mV. GOF mutants such as H134C typically do not inactivate without STIM1, but L138F and L138Y mutants show inactivation during the 100ms hyperpolarizing step with kinetics comparable to CDI of WT Orai1 channels. (<bold>C</bold>) Inactivation of T92 mutants is positively correlated with the side-chain surface area (S.A.) at this position. T92V shows slight potentiation similar other previously described GOF mutants, whereas T92W inactivates ~30% over the 100ms hyperpolarization step to –100 mV with kinetics similar to STIM1-gated channels. (<bold>D</bold>) T92W Orai1 is constitutively active and displays inactivation in STIM1/2 double knock-out HEK cells, indicating that the activation and inactivation of this mutant is not dependent on STIM. (<bold>E</bold>) As previously shown for the E106D Orai1 single mutant gated by STIM1 (<xref ref-type="bibr" rid="bib41">Yamashita et al., 2007</xref>), T92W/E106D Orai1 shows Ca<sup>2+</sup>-dependent block of Na<sup>+</sup> current in 20 mM external Ca<sup>2+</sup> and minimal inactivation in 110 mM Ca<sup>2+</sup> solution. Inactivation of the T92W mutant in 110 mM Ca<sup>2+</sup> solution with and without E106D. N=5–17 cells. Values are mean ± S.E.M. The intracellular solution used in all experiments here was the standard internal solution with 8 mM BAPTA as the Ca<sup>2+</sup> buffer (see Materials and methods).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig4-figsupp1-v2.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Kinetics of CDI in WT and T92W Orai1 channels.</title><p>(<bold>A–B</bold>) Examples of double-exponential fits of WT Orai1 voltage family traces. In cells with 10 mM EGTA as the internal solution, τ<sub>fast</sub> = 10 ± 1 ms and τ<sub>slow</sub> = 60 ± 8 ms at –100 mV (n=10 cells). (<bold>C–D</bold>) Examples of double-exponential fits of T92W Orai1 voltage family traces. In cells with 8 mM BAPTA as the internal solution, the inactivation time constants for T92W are: τ<sub>fast</sub> = 11 ± 1 ms and τ<sub>slow</sub> = 134 ± 16 ms (n=10 cells).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig4-figsupp2-v2.tif"/></fig></fig-group><p>Unexpectedly and in contrast to the behavior of those GOF mutants, we observed that L138F and T92W mutants exhibited time-dependent inactivation during hyperpolarizing steps in the absence of STIM1 (<xref ref-type="fig" rid="fig4">Figure 4B–E</xref>). In the presence of 8 mM intracellular BAPTA, hyperpolarizing steps between –60 and –120 mV caused rapid current decline in the Ca<sup>2+</sup> currents even in the absence of STIM1 (<xref ref-type="fig" rid="fig4">Figure 4B and D</xref>), with the current at end of a 300ms –120 mV voltage pulse declining by ~60% relative to the peak current at the beginning of the voltage step. In both mutants, inactivation was strongly reduced or absent in DVF solutions indicating that the inactivation is not mediated by Na<sup>+</sup> ions and suggesting strong divalent ion-dependence. Consistent with this interpretation, raising extracellular Ca<sup>2+</sup> concentration from 20 to 110 mM (isotonic Ca<sup>2+</sup> solution) significantly accelerated and increased the extent of T92W inactivation (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A</xref>). Hyperpolarizing the membrane potential to more negative potentials (e.g. –120 mV) accelerated inactivation in both mutants and increased its extent, mimicking the effects of raising extracellular Ca<sup>2+</sup>, suggesting that inactivation of these mutants strongly depends on the single-channel current amplitude. Paradoxically, CDI in the T92W mutant is greater in BAPTA-containing internal solutions compared to EGTA-containing solutions. This unexpected behavior is described and analyzed further below.</p><p>Two-component fits of the current decay of T92W Orai1 at –100 mV in the 20 mM Ca<sup>2+</sup> extracellular Ringer’s solution showed fast and slow τ values of 11±1ms and 134±16ms respectively, comparable to the kinetics of WT Orai1 CDI in the presence of STIM1 and with 10 mM EGTA as the internal buffer (τ<sub>fast</sub> = 10 ± 1 ms and τ<sub>slow</sub> = 60 ± 8 ms; <xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref>). Thus, the kinetics, divalent ion requirement, and dependence on driving force for Ca<sup>2+</sup> entry are all features qualitatively similar to CDI of CRAC channels gated by STIM1.</p><p>Interestingly, comparison of the extent of inactivation in the different constitutively active L138 and T92 mutants showed that CDI during the hyperpolarizing step is correlated with the size of the introduced side chain (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B and C</xref>). Specifically, although T92V was constitutively active, over the course of 100ms hyperpolarizing steps, this mutant showed no detectable inactivation but instead displayed potentiation similar to other previously described GOF mutations including V102C and H134 (<xref ref-type="bibr" rid="bib50">Zhou et al., 2016</xref>; <xref ref-type="bibr" rid="bib6">Derler et al., 2018</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>; <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B</xref>). By contrast, larger amino acid substitutions at T92 increased inactivation with T92W exhibiting the largest amount of inactivation over the –100 mV hyperpolarizing step (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1C</xref>). This interesting finding implies that like activation of the GOF L138F and T92W channels, inactivation may also be induced through steric clash between L138 and T92. To our knowledge, these are the first reported GOF mutants that inactivate in the absence of STIM1.</p></sec><sec id="s2-5"><title>Inactivation of T92W Orai1 exhibits aberrant dependence on intracellular Ca<sup>2+</sup> buffering</title><p>Previous work has shown that fast CDI is exquisitely sensitive to the species of the intracellular Ca<sup>2+</sup> buffer (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>; <xref ref-type="bibr" rid="bib11">Fierro and Parekh, 1999</xref>; <xref ref-type="bibr" rid="bib41">Yamashita et al., 2007</xref>). Specifically, fast CDI is not affected by the slow Ca<sup>2+</sup> chelator, EGTA but is strongly reduced by the fast chelator, BAPTA (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>; <xref ref-type="bibr" rid="bib11">Fierro and Parekh, 1999</xref>), whose <italic>k<sub>on</sub></italic> of Ca<sup>2+</sup> binding is about 400 times faster than that of EGTA. This is because although both buffers have comparable affinities for Ca<sup>2+</sup>, the slower kinetics of Ca<sup>2+</sup> binding to EGTA produces a region of relatively unbuffered [Ca<sup>2+</sup>]<sub>i</sub> around individual CRAC channels. By contrast, the faster <italic>k<sub>on</sub></italic> of BAPTA ensures that [Ca<sup>2+</sup>] is strongly attenuated in the vicinity (&lt;20 nm) of individual open CRAC channels in this chelator. Therefore, whereas BAPTA is very effective in suppressing both local and global Ca<sup>2+</sup> signals, EGTA mainly buffers the global Ca<sup>2+</sup> signal (<xref ref-type="bibr" rid="bib30">Neher, 1986</xref>). We therefore used the differential effects of EGTA and BAPTA to study the local [Ca<sup>2+</sup>]<sub>i</sub> dependence of T92W Orai1 inactivation.</p><p>In WT Orai1 channels activated by STIM1, we found that increasing intracellular BAPTA from 0.8 to 8 mM reduced the extent of CDI (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). Because increasing the buffer concentration is predicted to markedly reduce the size of the Ca<sup>2+</sup> microdomain around individual CRAC channels (<xref ref-type="fig" rid="fig5">Figure 5E</xref>), this result is in line with the idea that CDI is driven by local Ca<sup>2+</sup> microdomains and diminishes as the local [Ca<sup>2+</sup>] is reduced (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>; <xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>). Likewise, substituting BAPTA with the slower chelator EGTA (which cannot effectively buffer local [Ca<sup>2+</sup>] due to its slower on-rate), increases [Ca<sup>2+</sup>]<sub>i</sub> around CRAC channels (<xref ref-type="fig" rid="fig5">Figure 5E</xref>) and markedly increased the extent of CDI (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). No significant change in CDI occurred by increasing intracellular EGTA from 10 to 20 mM, consistent with the known insensitivity of CDI to changes in the concentration of intracellular EGTA (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>) and in line with the minimal effects on local [Ca<sup>2+</sup>]<sub>i</sub> by this buffer (<xref ref-type="fig" rid="fig5">Figure 5E</xref>).</p><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>CDI of T92W Orai1 shows enhanced Ca<sup>2+</sup> sensitivity compared to WT Orai1.</title><p>(<bold>A–B</bold>) Representative inactivation traces of WT Orai1 +STIM1 and constitutively active T92W Orai1 mutant channels during voltage steps with either a slow (EGTA) or fast (BAPTA) Ca<sup>2+</sup> chelator in the internal solution. (<bold>A</bold>) In cells expressing WT Orai1, raising the intracellular BAPTA concentration from 0.8 to 8 or 20 mM diminishes CDI. Further, replacing intracellular BAPTA with EGTA at any concentration strongly enhances CDI. (<bold>B</bold>) However, in T92W Orai1, increasing the BAPTA concentration from 0.8 to 8 or 20 mM enhances CDI, and replacing BAPTA with EGTA strongly diminishes CDI. (<bold>C–D</bold>) The extent of inactivation (1−<italic>I<sub>ss</sub></italic>/<italic>I<sub>peak</sub></italic>) plotted against membrane voltage in the indicated buffer solutions. The extracellular Ringer’s solution contained 20 mM Ca<sup>2+</sup> in all cases. N=4–17 cells. Values are mean ± S.E.M. Note that the inactivation quantification plot for T92W in 8 mM BAPTA is also shown in <xref ref-type="fig" rid="fig4">Figure 4E</xref>. (<bold>E</bold>) [Ca<sup>2+</sup>]<sub>i</sub> profiles in the presence of different concentrations of EGTA or BAPTA. [Ca<sup>2+</sup>] was estimated from <xref ref-type="disp-formula" rid="equ1">equation 1</xref> (see Results). The unitary Ca<sup>2+</sup> current amplitude was assumed to be 5 fA. At distances beyond 2 nm, [Ca<sup>2+</sup>]<sub>i</sub> is significantly buffered by BAPTA but not EGTA.</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Dependence of T92W inactivation on internal local Ca<sup>2+</sup> concentration compared to WT Orai1 channels.</title></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-82281-fig5-data1-v2.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig5-v2.tif"/></fig><p>Unexpectedly, fast CDI of T92W showed very different phenotypes in response to changes in the species and concentrations of intracellular buffers. In T92W Orai1, the highest extent of CDI occurred at 20 mM BAPTA and the extent and rate of inactivation at this concentration was broadly comparable to CDI seen in WT Orai1 channels at –120 mV with 10 mM EGTA (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). Reducing the concentration of intracellular BAPTA to 0.8 mM paradoxically <italic>decreased</italic> CDI in the constitutively active T92W mutant (<xref ref-type="fig" rid="fig5">Figure 5B</xref>), in contrast to the <italic>increase</italic> seen in WT Orai1 channels. Most strikingly, replacing BAPTA with 10 mM EGTA caused marked loss of CDI with only a small hint of current decay apparent during the hyperpolarizing steps (<xref ref-type="fig" rid="fig5">Figure 5B</xref>), in contrast to the behavior of WT Orai1 channels which displayed significant <italic>increases</italic> in CDI in EGTA (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). Overall, these trends indicated that the pattern of CDI seen in response to varying the intracellular buffer (EGTA and BAPTA) is essentially reversed in the T92W mutant compared to WT Orai1 channels.</p><p>What is the explanation for this aberrant dependence of T92W Orai1 CDI on intracellular Ca<sup>2+</sup> buffering? We considered and excluded several possibilities. First, we weighed whether the observed inactivation is not Ca<sup>2+</sup>-mediated but instead occurs due to changes in membrane voltage. However, this notion is not consistent with observations indicating that CDI is lost in the presence of Na<sup>+</sup> as the current carrier (<xref ref-type="fig" rid="fig4">Figure 4B and D</xref> right traces), and that raising extracellular Ca<sup>2+</sup> from 20 to 110 mM significantly accelerates and increases the extent of CDI (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A</xref>). A second possibility is that inactivation of T92W Orai1 channels in EGTA containing internal solutions may occur too fast to be detected over the 300ms hyperpolarizing steps, representing some unknown type of ultra-fast activation. However, careful examination of the initial current immediately following membrane hyperpolarization revealed no such component, and increasing the current sampling rate from 5 kHz to 20 kHz failed to reveal the presence of an ultra-fast inactivating current that was missed in our recording conditions. A third possibility, that T92W disrupts (or impairs) inactivation gating is ruled out by the fact that CDI is very clearly seen in the presence of 8 and 20 mM BAPTA (<xref ref-type="fig" rid="fig5">Figure 5B</xref>) and occurs with kinetics similar to that observed for WT Orai1 channels in EGTA containing internal solutions. A fourth possibility is that CDI of the T92W still requires STIM1, with the endogenous pool of STIM1 in HEK293 cells interacting with the T92W mutant Orai1 channel with increased affinity to drive CDI. However, T92W current recordings in STIM1/STIM2 double knock-out HEK293 cells (<xref ref-type="bibr" rid="bib7">Emrich et al., 2019</xref>) also showed continued persistence of CDI, indicating that the CDI of T92W occurs independently of STIM1 and STIM2 (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1D</xref>). Finally, introducing the E106D Orai1 mutation, which abrogates CDI of heterologously-expressed Orai1 channels (<xref ref-type="bibr" rid="bib41">Yamashita et al., 2007</xref>), also abrogated inactivation of T92W Orai1 currents (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1E</xref>), confirming that the basic mechanism of inactivation gating are shared between T92W and WT Orai1 channels. Together, these results indicate that although the gating mechanism that causes inactivation is likely similar, the Ca<sup>2+</sup> sensing process upstream of the conformation changes that drives inactivation gating is altered in T92W mutant channels.</p></sec><sec id="s2-6"><title>CDI of constitutively active T92W Orai1 exhibits increased Ca<sup>2+</sup> sensitivity</title><p>One clue for why T92W Orai1 shows greater CDI in the presence of BAPTA comes from comparison of the [Ca<sup>2+</sup>]<sub>i</sub> profiles that give similar amounts of CDI in different buffering conditions (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). The steady-state inactivation plots show that the extent of CDI of WT Orai1 channels at –120 mV in 10 mM EGTA is quantitatively similar to CDI of T92W Orai1 at –60 mV in 8 mM BAPTA (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). Diffusion models predict that the magnitude of the Ca<sup>2+</sup> concentration in Ca<sup>2+</sup> microdomains around individual Orai1 channels should be strongly influenced by the properties of the buffer and the single channel Ca<sup>2+</sup> current amplitude (<italic>i<sub>Ca</sub></italic>) (<xref ref-type="bibr" rid="bib30">Neher, 1986</xref>; <xref ref-type="bibr" rid="bib38">Stern, 1992</xref>; <xref ref-type="bibr" rid="bib33">Prakriya and Lingle, 2000</xref>). Specifically, the steady-state [Ca<sup>2+</sup>] as a function of distance <italic>d</italic> from a point source of Ca<sup>2+</sup> influx can be given by the relation:<disp-formula id="equ1"><label>(1)</label><mml:math id="m1"><mml:mrow><mml:mstyle displaystyle="true" scriptlevel="0"><mml:mo stretchy="false">[</mml:mo><mml:mi>C</mml:mi><mml:msup><mml:mi>a</mml:mi><mml:mrow><mml:mn>2</mml:mn><mml:mo>+</mml:mo></mml:mrow></mml:msup><mml:mo stretchy="false">]</mml:mo><mml:mo>=</mml:mo><mml:mo stretchy="false">[</mml:mo><mml:mi>C</mml:mi><mml:msup><mml:mi>a</mml:mi><mml:mrow><mml:mn>2</mml:mn><mml:mo>+</mml:mo></mml:mrow></mml:msup><mml:msub><mml:mo stretchy="false">]</mml:mo><mml:mrow><mml:mi>s</mml:mi><mml:mi>s</mml:mi></mml:mrow></mml:msub><mml:mo>+</mml:mo><mml:mfrac><mml:msub><mml:mi>i</mml:mi><mml:mrow><mml:mi>c</mml:mi><mml:mi>a</mml:mi></mml:mrow></mml:msub><mml:mrow><mml:mn>4</mml:mn><mml:mi>π</mml:mi><mml:mi>F</mml:mi><mml:mi>d</mml:mi><mml:msub><mml:mi>D</mml:mi><mml:mrow><mml:mi>C</mml:mi><mml:mi>a</mml:mi></mml:mrow></mml:msub></mml:mrow></mml:mfrac><mml:msup><mml:mi>e</mml:mi><mml:mrow><mml:mrow><mml:mo>(</mml:mo><mml:mfrac><mml:mrow><mml:mo>−</mml:mo><mml:mi>d</mml:mi></mml:mrow><mml:mi>λ</mml:mi></mml:mfrac><mml:mo>)</mml:mo></mml:mrow></mml:mrow></mml:msup></mml:mstyle></mml:mrow></mml:math></disp-formula></p><p>where [Ca<sup>2+</sup>]<sub>ss</sub> is the bulk [Ca<sup>2+</sup>]<sub>i</sub> (estimated to be negligible in the presence of exogenous buffers), <italic>F</italic> is the Faraday’s constant, <italic>D<sub>Ca</sub></italic> is the diffusion constant for Ca<sup>2+</sup> (3x10<sup>–10</sup> m<sup>2</sup>s<sup>–1</sup>). <italic>λ,</italic> the space constant for Ca<sup>2+</sup> diffusion in the presence of a buffer (EGTA or BAPTA) is given by the relation:<disp-formula id="equ2"><label>(2)</label><mml:math id="m2"><mml:mrow><mml:mstyle displaystyle="true" scriptlevel="0"><mml:mi>λ</mml:mi><mml:mo>=</mml:mo><mml:msqrt><mml:mfrac><mml:msub><mml:mi>D</mml:mi><mml:mrow><mml:mi>C</mml:mi><mml:mi>a</mml:mi></mml:mrow></mml:msub><mml:mrow><mml:msub><mml:mi>k</mml:mi><mml:mrow><mml:mi>o</mml:mi><mml:mi>n</mml:mi></mml:mrow></mml:msub><mml:mo stretchy="false">[</mml:mo><mml:mi>B</mml:mi><mml:mo stretchy="false">]</mml:mo></mml:mrow></mml:mfrac></mml:msqrt></mml:mstyle></mml:mrow></mml:math></disp-formula></p><p>where <italic>k<sub>on</sub></italic> is the on-rate for Ca<sup>2+</sup> binding (<italic>k<sub>on</sub></italic> = 6 × 10<sup>8</sup> M<sup>–1</sup>s<sup>–1</sup> for BAPTA and 1.5x10<sup>6</sup> M<sup>–1</sup>s<sup>–1</sup> for EGTA) and the [<italic>B</italic>] is the concentration of the buffer. The estimated unitary current of CRAC channels from noise analysis is ~3.5 fA at –80 mV in 22 mM [Ca<sup>2+</sup> ]<sub>o</sub> (<xref ref-type="bibr" rid="bib51">Zweifach and Lewis, 1993</xref>). <italic>i<sub>Ca</sub></italic> is likely about 40% larger due to the high open probability of single CRAC channels during brief (200–300ms) sweeps (<xref ref-type="bibr" rid="bib34">Prakriya and Lewis, 2006</xref>), which would be expected to depress current noise.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Depolarizing the cell promotes recovery from CDI in T92W Orai1 channels.</title><p>(<bold>A</bold>) Comparison of extent of CDI in constitutively active T92W Orai1 (in 8 mM internal BAPTA) and WT Orai1 +STIM1 currents (in 10 mM internal EGTA). The extent of CDI at –60 mV in T92W is identical to CDI in WT Orai1 channels at –120 mV (dashed red arrow). The standard external solution contained 20 mM Ca<sup>2+</sup> (see Methods). (<bold>B</bold>) [Ca<sup>2+</sup>]<sub>i</sub> profiles in the two conditions that elicit similar levels of CDI in the experimental conditions in <italic>A</italic>. The unitary Ca<sup>2+</sup> current at each potential was estimated by scaling the estimated <italic>i</italic><sub>Ca</sub> at –100 mV with the ratio of the peak whole-cell current at the different voltages (see Methods). The profiles indicate that although CDI is similar, the [Ca<sup>2+</sup>]<sub>i</sub> mediating CDI in T92W Orai1 at –60 mV is substantively lower than the [Ca<sup>2+</sup>]<sub>i</sub> in WT Orai1 at –120 mV. (<bold>C–F</bold>) Analysis of recovery from inactivation in response to termination of Ca<sup>2+</sup> influx with depolarizing voltage steps. (<bold>C</bold>) After a –100 mV hyperpolarizing voltage step to induce CDI, the cell was depolarized to +100 mV to abruptly terminate Ca<sup>2+</sup> influx and lower submembrane [Ca<sup>2+</sup>]<sub>i</sub>. Following the recovery interval at +100 mV (200 ms), a second pulse to –100 mV was applied to evoke CRAC current. In WT Orai1 channels, the second pulse evokes Orai1 current with similar amplitude and inactivation as the first pulse. Holding potential is +30 mV. (<bold>E</bold>) Recovery from inactivation in T92W Orai1. Following a recovery step to +100 mV to terminate Ca<sup>2+</sup> influx, a second hyperpolarizing pulse to –100 mV reveals significantly larger peak current and re-appearance of CDI indicating that abruptly terminating Ca<sup>2+</sup> influx partly restores inactivation of T92W Orai1 channels in 10 mM EGTA. (<bold>D and F</bold>) The extent of inactivation (1 − <italic>I<sub>ss</sub></italic>/<italic>I<sub>peak</sub></italic>) in the first and second pulses at different extracellular Ca<sup>2+</sup> concentrations. For T92W channels, CDI was enhanced by pre-pulse with +100 mV in 2 mM, 20 mM, and 110 mM external Ca<sup>2+</sup> solutions. N=6–8 cells. Values are mean ± S.E.M. *:p&lt;0.05, **p&lt;0.01, ***: p&lt;0.001 by paired t-test.</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>Paired pulse experiments reveals recovery of T92W inactivation through depolarizing steps.</title></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-82281-fig6-data1-v2.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig6-v2.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Recovery of inactivation of T92W and L138F Orai1 channels is promoted by depolarizing steps to +100 mV.</title><p>(<bold>A–B</bold>) T92W Orai1 CDI in paired pulses separated by a recovery step to +100 mV to reduce [Ca<sup>2+</sup>]<sub>i</sub> and promote recovery from CDI. The second pulse shows greater CDI relative to the first pulse indicating that abruptly terminating Ca<sup>2+</sup> influx enhances channel recovery from inactivated states and manifests greater CDI during the second hyperpolarizing step. Intracellular chelator: 8 mM BAPTA. N=4–6 cells. (<bold>C–D</bold>) Recovery from inactivation of L138F Orai1. Recovery was examined using the same paired-pulse protocol in the presence of 10 mM intracellular EGTA. L138F recovery pattern resembles the pattern seen in WT Orai1 channels likely due to minimal accumulation of CDI at the holding potential due to the weak activity of the mutant channels. N=5–6 cells. Values are mean ± S.E.M. *:p&lt;0.05, **p&lt;0.01, ***: p&lt;0.001 by paired t-test.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig6-figsupp1-v2.tif"/></fig></fig-group><p>The predicted [Ca<sup>2+</sup>]<sub>i</sub> profiles in BAPTA and EGTA as a function of <italic>d</italic> using an estimated <italic>i<sub>Ca</sub></italic> value of 5 fA are shown in <xref ref-type="fig" rid="fig5">Figure 5E</xref>. The plots indicate that [Ca<sup>2+</sup>]<sub>i</sub> is substantively reduced in 8 mM BAPTA compared to 10 mM EGTA. At less hyperpolarized membrane potentials (−60 to –80 mV), the local [Ca<sup>2+</sup>] would be expected to be smaller due to reduction in <italic>i<sub>Ca</sub></italic>. With the assumption that the number of channels and channel <italic>P<sub>o</sub></italic> is unchanged by hyperpolarizing steps, we calculated <italic>i<sub>Ca</sub></italic> at each potential by scaling the unitary current estimate (5 fA at –100 mV) by the ratio of the peak current at each potential to the current at –100 mV. At a distance of 3 nm (estimated to be the distance of the inactivation binding site from the CRAC channel pore <xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>) and using the scaled estimates of <italic>i<sub>Ca</sub></italic>, we predict that [Ca<sup>2+</sup>]<sub>i</sub> is ~1.3 µM at a membrane voltage of –60 mV and 8 mM BAPTA. By contrast, in 10 mM EGTA and at –120 mV, local [Ca<sup>2+</sup>]<sub>i</sub> is ~5.6 µM (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). Thus, the similarity of inactivation of T92W in 8 mM BAPTA at –60 mV to that of WT Orai1 in 10 mM EGTA at –120 mV (<xref ref-type="fig" rid="fig6">Figure 6A</xref>) indicates that the Ca<sup>2+</sup>-sensitivity of inactivation of T92W Orai1 is substantively increased, such that constitutively active T92W currents inactivate at <italic>lower</italic> concentrations of intracellular Ca<sup>2+</sup> compared to WT Orai1 channels (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). Note that this conclusion is not dependent on the exact values of <italic>i<sub>Ca</sub></italic> or the precise distance of the Ca<sup>2+</sup> binding site from the pore, for while altering these parameters would be expected to change the absolute values of [Ca<sup>2+</sup>] at the putative Ca<sup>2+</sup> binding site, the greater inactivation of T92W channels in BAPTA containing solutions still indicates that these channels show CDI at lower levels of [Ca<sup>2+</sup>]<sub>i</sub> than WT Orai1 channels. An increase in Ca<sup>2+</sup> sensitivity of CDI in T92W Orai1 predicts that the mutant channel will enter the inactivated state more readily (and faster) than WT Orai1 (also see Discussion for a conceptual explanation of this phenomenon). As a result, in EGTA-containing solutions, steady-state inactivation of mutant channels at the holding potential is expected to be greater due to the higher local [Ca<sup>2+</sup> ]<sub>i</sub>. Accordingly, hyperpolarizing steps are unable to elicit robust inactivation in the mutant channels in EGTA, likely explaining reduced CDI in this buffer.</p></sec><sec id="s2-7"><title>CDI of T92W Orai1 in EGTA is unmasked by rapid termination of Ca<sup>2+</sup> influx</title><p>If CDI of T92W Orai1 in EGTA is reduced relative to BAPTA solutions because channels are already at equilibrium with inactivation due to higher submembrane [Ca<sup>2+</sup>]<sub>i</sub> at the holding potential (+30 mV), then abruptly lowering submembrane [Ca<sup>2+</sup>]<sub>i</sub> should promote recovery of channels from inactivated states. We examined this idea using a two-pulse protocol in which we delivered a +100 mV depolarizing recovery pulse in between two hyperpolarizing pulses to –100 mV where we assessed CDI. In native CRAC channels of T-cells, it was previously shown that recovery from CDI occurs with a time course over tens of milliseconds, with ~90% recovery occurring in 200 ms at a recovery potential of –12 mV (<xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>). We reasoned that the depolarizing step to +100 mV should abruptly terminate Ca<sup>2+</sup> influx, and because submembrane Ca<sup>2+</sup> should be chelated by EGTA during the recovery pulse, recovery of T92W Orai1 channels from CDI will be promoted. As a consequence, a second pulse to –100 mV should manifest more inactivation. We tested this hypothesis at three extracellular Ca<sup>2+</sup> concentrations (2 mM, 20 mM, and 110 mM) applied to the same cells in the presence of 10 mM intracellular EGTA or 8 mM BAPTA in a paired-pulse protocol with a 200 ms step to +100 mV to terminate Ca<sup>2+</sup> influx and promote recovery of Orai1 from CDI. (<xref ref-type="fig" rid="fig6">Figure 6C–F</xref>).</p><p>Depolarizing the membrane potential to +100 mV in 2 mM extracellular Ca<sup>2+</sup> resulted in strong enhancement of the inward current in the second pulse (<xref ref-type="fig" rid="fig6">Figure 6E and F</xref>). Elevating [Ca<sup>2+</sup>]<sub>o</sub> to 20 mM elicited smaller current enhancement of the second pulse relative to the first pulse, and raising [Ca<sup>2+</sup>]<sub>o</sub> to 110 mM elicited even less recovery (<xref ref-type="fig" rid="fig6">Figure 6E and F</xref>). This result suggests that depolarizing pulses to +100 mV lower [Ca<sup>2+</sup>]<sub>i</sub> and prevents the entry of channels into inactivated states, thereby allowing channels to recover from inactivation, and therefore, showing greater CDI during the second –100 mV pulse (also see scheme in Discussion). The extent of current recovery was, however, dependent on the extracellular Ca<sup>2+</sup> concentration with higher Ca<sup>2+</sup> concentrations causing less current recovery, as would be expected for a process involving Ca<sup>2+</sup>-dependent accumulation of inactivation. These results indicate that T92 Orai1 channels are significantly inactivated in 10 mM EGTA at the holding potential and that recovery from inactivation is promoted by the depolarizing step to +100 mV which is predicted to lower submembrane [Ca<sup>2+</sup>]<sub>i</sub>. In 8 mM BAPTA, recovery is also promoted by depolarizing pulses to +100 mV (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A and B</xref>), although the degree recovery is reduced relative to EGTA. This is expected as substantial CDI already occurs in BAPTA indicating that at this level of buffering, resting inactivation at the holding potential (+30 mV) is less than in EGTA. As a result, there is diminished need for the membrane potential to be further depolarized to promote recovery from CDI. Recovery of L138F also resembled WT Orai1 rather than T92W Orai1 in EGTA solutions (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1C and D</xref>). We think this is due to the very small current density of L138F Orai1, which is predicted to cause much lower levels of submembrane [Ca<sup>2+</sup>]<sub>i</sub> elevations (relative to T92W Orai1) and hence reduced accumulation of channels into the inactivated state. Taken together, these observations are consistent with the interpretation that under weak buffering conditions, the intracellular Ca<sup>2+</sup> dependence of T92W Orai1 channels is strongly sensitized relative to WT channels, causing accumulation of channels into inactivated state at the holding potential (+30 mV) thereby reducing further inactivation during hyperpolarizing steps.</p></sec><sec id="s2-8"><title>C- and N-terminal Orai1 mutations differentially affect T92W Orai1 inactivation</title><p>We next turned our attention to the molecular determinants of CDI of T92W channels. Previous studies have implicated several domains of the CRAC channel for CDI, including the ID region of STIM1, the Orai1 N-terminus and the Orai2/3 C-terminus (<xref ref-type="bibr" rid="bib19">Lee et al., 2009</xref>; <xref ref-type="bibr" rid="bib26">Mullins et al., 2009</xref>; <xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>). To determine the role of the Orai1 N- and C-termini for T92W CDI, we tested the effects of mutations in these domains on T92W Orai1 CDI. A previous study employing domain swap and site-directed mutations in Orai2 and Orai3 implicated the C-terminus as a key locus regulating Orai2/3 CDI (<xref ref-type="bibr" rid="bib19">Lee et al., 2009</xref>). To address a potential role of the Orai1 C-terminus for T92W Orai1 inactivation, we therefore truncated the Orai1 C-terminus (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). We found that deletion of the Orai1 C-terminus (∆267–301) had no effect the constitutive activity of Orai1 T92W currents (<xref ref-type="fig" rid="fig7">Figure 7B</xref>), indicating that the Orai1 C-terminus is not necessary for the constitutive gating of this open mutant and reaffirming its STIM-independence for manifesting channel activity. However, T92W ∆267–301 Orai1 channels showed markedly reduced inactivation (<xref ref-type="fig" rid="fig7">Figure 7B and C</xref>) with the extent of inactivation decreasing from ~50% to~25% at –100 mV. This finding indicates that the Orai1 C-terminus contributes to CDI of T92W Orai1. The presence of residual inactivation (20–30%) in the T92W ∆267–301 mutant however, implies that additional regions outside of the Orai1 C-terminus also make contributions to CDI.</p><fig-group><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>The Orai1 C-terminus contributes to T92W Orai1 CDI.</title><p>(<bold>A</bold>) Side view of dOrai dimer (PDB ID: 4HKR; hOrai1 numbering in parentheses) showing location of T92 and L138 residues relative to the deleted C-terminal residues 267–301. The Orai1 C-terminus is shown in dark grey. (<bold>B–C</bold>) Deletion of the Orai1 C-terminus residues attenuates inactivation of T92W Orai1. Example traces showing CDI of T92W Orai1 and T92W Δ267–301 Orai1 mutant (<bold>B</bold>) The extent of inactivation is summarized in panel C. (<bold>D</bold>) Location of N-terminal residues (<bold>W76, Y80 and R83</bold>) previously implicated in regulating CDI in Orai1 channels. (<bold>E</bold>) Mutations of W76, Y80 and R83 in T92W Orai1 all strongly accelerated CDI compared to T92W Orai1 alone. (<bold>F</bold>) The extent of CDI plotted against membrane voltage in the indicated mutants. The inactivation quantification plot for T92W in <italic>C</italic> and <italic>F</italic> is the same as the data for this mutant in <xref ref-type="fig" rid="fig4">Figure 4E</xref>. N=4–17 cells. Values are mean ± S.E.M. The intracellular solution used was the standard internal solution with 8 mM BAPTA as the Ca<sup>2+</sup> buffer and the standard external solution contained 20 mM Ca<sup>2+</sup> (see Materials and methods).</p><p><supplementary-material id="fig7sdata1"><label>Figure 7—source data 1.</label><caption><title>Effects of N- and C-terminal mutations on T92W CDI.</title></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-82281-fig7-data1-v2.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig7-v2.tif"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 1.</label><caption><title>Deletion of the Orai1 N-terminus or introduction of a K85E mutation abrogates the constitutive T92W Orai1 current.</title><p>(<bold>A–B</bold>) Example traces of Δ2–85 T92W and K85E/T92W Orai1 mutants. The current density of these mutants is summarized in panel C. N=5–8 cells. Values are mean ± S.E.M. ***: p&lt;0.001 by paired t-test.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig7-figsupp1-v2.tif"/></fig></fig-group><p>At the Orai1 N-terminus, several reports have described changes in CDI in N-terminal Orai1 mutants (<xref ref-type="bibr" rid="bib1">Bergsmann et al., 2011</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>; <xref ref-type="bibr" rid="bib48">Zhang et al., 2019</xref>). We found that truncation of the N-terminus (∆2–85) abrogated T92W Orai1 currents (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1A and C</xref>). Likewise, insertion of a K85E mutation in the N-terminus, which has been shown to abolish activity of both WT Orai1 channels gated by STIM1 as well as activity of many constitutively active Orai1 mutant channels, also abolished T92W channel activity (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1B and C</xref>). The loss of channel activity in the ∆2–85 T92W and K85E/T92W mutants is similar to the loss of gating evoked by truncation of the N-terminus in STIM1-gated WT Orai1 and other constitutively active mutants (<xref ref-type="bibr" rid="bib21">Lis et al., 2010</xref>; <xref ref-type="bibr" rid="bib24">McNally et al., 2013</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>; <xref ref-type="bibr" rid="bib39">Tiffner et al., 2021</xref>), indicating a generalized requirement of the N-terminus and the K85 residue for gating of WT and all constitutively active Orai1 mutant channels.</p><p>Mullins et al. have shown that mutation of the aromatic residues, Y80 and W76, in the N-terminus can enhance or abrogate CDI in Orai1 channels (<xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>). That study also implicated three positively charged residues (R91, K87, and R83) located in the inner pore (<xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>) for CDI and it was postulated that the three residues, along with Y80 and W76 may form the inactivation gate, or are at least involved in the conformational changes mediating CDI (<xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>). To examine the role of these residues for T92W inactivation, we mutated Y80, R83, and W76 and studied whether these mutations similarly affected T92W CDI. The Y80A mutation was previously shown to strongly enhance the rate and extent of CDI of WT Orai1 channels activated by STIM1 (<xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>). In a similar fashion, we found that constitutively active Y80A/T92W Orai1 currents inactivated markedly faster and to a greater degree compared to T92W Orai1 channels (<xref ref-type="fig" rid="fig7">Figure 7E and F</xref>). Surprisingly, however, the Y80E mutation, which was previously shown to abrogate Orai1 CDI, also enhanced the rate and extent of T92W inactivation (<xref ref-type="fig" rid="fig7">Figure 7E and F</xref>). Similarly, both the W76E and the R83E mutations, which were previously shown to eliminate CDI of WT Orai1 (<xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>), accelerated the rate and increased the extent of CDI of T92W Orai1 currents (<xref ref-type="fig" rid="fig7">Figure 7E and F</xref>). These results are consistent with previous models indicating that the Orai1 N-terminus has an important role in inactivation gating. However, the enhancement of T92W Orai1 inactivation gating by mutations (Y80E, R83E, W76E) that were previously shown to abrogate CDI of WT Orai1 channels reveals a degree of complexity in the role of these residue in controlling inactivation and argue that the aromatics Y80 and W76 regulate inactivation of Orai1 channels through a mechanism distinct from serving as the inactivation gate.</p></sec><sec id="s2-9"><title>STIM1 normalizes the inactivation of T92W Orai1 channels</title><p>STIM1 is required for CDI of CRAC channels and is postulated to promote inactivation via functional coupling between the ID region of STIM1 with the Orai1 N-terminus (<xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>). What effect, if any, does STIM1 have on the intrinsic CDI of constitutively active T92W Orai1 channels? We examined this question by co-expressing STIM1 together with T92W Orai1 at a STIM/Orai1 cDNA ratio of 5:1, which is expected to be sufficient for STIM1-mediated inactivation of WT Orai1 channels. To our surprise, in the presence of STIM1, the EGTA/BAPTA buffer-dependence of T92W Orai1 CDI was reversed. T92W Orai1 currents in STIM1 showed robust CDI in the presence of 10 mM EGTA, which was comparable in extent and rate to WT Orai1 channels gated by STIM1 (<xref ref-type="fig" rid="fig8">Figure 8C and D</xref>). Conversely, replacing the intracellular buffer with 8 mM BAPTA (high buffering) strongly reduced CDI of T92W Orai1 channels (<xref ref-type="fig" rid="fig8">Figure 8C and E</xref>). As summarized in the steady-state inactivation plots, the behavior of T92W Orai1 channels co-expressing STIM1 was essentially similar to that of WT Orai1 channels activated by STIM1 (<xref ref-type="fig" rid="fig8">Figure 8D and E</xref>), and fully reversed from the behavior of STIM1-free T92W Orai1 channels. These results indicate that STIM1 ‘normalizes’ the aberrant buffer dependence of inactivation of the constitutively active T92W Orai1 channels. Likewise, co-expressing STIM1 with constitutively active Y80E/T92W Orai1 mutant, which exhibits faster inactivation than T92W Orai1 single mutant in BAPTA containing solutions, also markedly decreased the rate and extent of CDI of this mutant relative to cells without STIM1 co-expression (<xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>). These findings indicate that STIM1 modulates CDI of T92W Orai1 channels such that its Ca<sup>2+</sup> sensitivity is similar to that of WT Orai1 channels gated by STIM1. The normalization of CDI by STIM1 is reminiscent of the ‘normalization’ of Ca<sup>2+</sup> selectivity of V102C and other less Ca<sup>2+</sup>-selective constitutively active Orai1 mutants by STIM1 (<xref ref-type="bibr" rid="bib23">McNally et al., 2012</xref>) and reaffirms the viewpoint that STIM1 plays an essential role for multiple aspects of Orai1 gating including activation, permeation, and inactivation.</p><fig-group><fig id="fig8" position="float"><label>Figure 8.</label><caption><title>STIM1 modulates the Ca<sup>2+</sup> sensitivity of T92W Orai1 CDI.</title><p>(<bold>A–B</bold>) Representative traces of CDI in WT Orai1 +STIM1 (<bold>A</bold>) and T92W Orai1 (<bold>B</bold>) currents in the presence of EGTA (10 mM) or BAPTA (8 mM). (<bold>C</bold>) The addition of STIM1 normalizes the aberrant intracellular buffer dependence of T92W Orai1 CDI. In the presence of STIM1, CDI of T92 Orai1 is strongly enhanced in 10 mM EGTA compared to T92W currents in the absence of STIM1. Conversely, CDI in STIM1-expressing T92W Orai1 cells in 8 mM BAPTA is reduced relative to cells expressing T92W Orai1 alone (compare right traces in T92W in panels B and C), analogous to the behavior seen in WT Orai1 (<bold>A</bold>). (<bold>D–E</bold>) Summary plots showing the extent of CDI in the indicated conditions. The inactivation quantification plots for WT and T92W Orai1 are also shown in <xref ref-type="fig" rid="fig5">Figure 5C–D</xref>. All recordings were conducted in the standard external solution containing 20 mM Ca<sup>2+</sup>. N=4–17 cells. Values are mean ± S.E.M.</p><p><supplementary-material id="fig8sdata1"><label>Figure 8—source data 1.</label><caption><title>STIM1 restores the Ca<sup>2+</sup> sensitivity of T92W CDI to that of WT Orai1.</title></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-82281-fig8-data1-v2.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig8-v2.tif"/></fig><fig id="fig8s1" position="float" specific-use="child-fig"><label>Figure 8—figure supplement 1.</label><caption><title>STIM1 modulates CDI of Y80E/T92W Orai1.</title><p>(<bold>A</bold>) Example traces of Y80E/T92W voltage family steps without and with STIM1 co-expression. (<bold>B</bold>) Summary data of Y80E/T92W Orai1 inactivation modulation by STIM1. The example trace and quantification shown without STIM1 is the same data as in <xref ref-type="fig" rid="fig7">Figure 7E–F</xref>. N=4 cells. Values are mean ± S.E.M.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig8-figsupp1-v2.tif"/></fig></fig-group></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>A previous report showed that human mutation Orai1 L138F causes tubular aggregate myopathy with hypocalcemia in human patients (<xref ref-type="bibr" rid="bib9">Endo et al., 2015</xref>). This syndrome is driven by dysregulated Ca<sup>2+</sup> signaling in muscle cells secondary to constitutive Ca<sup>2+</sup> entry through open Orai1 channels (<xref ref-type="bibr" rid="bib9">Endo et al., 2015</xref>). In this study, we sought to understand the underlying mechanism of this pathogenic mutation and determined that steric clash between L138F and T92 on TM1 drives constitutive Orai1 activation. Large amino acid substitutions at either L138 or T92 that would increase the amount of contact between these two residues cause GOF Orai1 channels by disrupting the closed state of the pore. By contrast, mutations that reduce the packing density at this interface such as small or flexible substitutions at L138 lead to LOF Orai1 channels. These phenotypes point to a model wherein the L138-T92 nexus acts as a lever/pivot point at the TM2-TM1 interface to mediate channel activation. Unusually, constitutively active currents arising from L138F and T92W mutations show fast CDI with kinetics comparable to WT Orai1 channels gated by STIM1. CDI of T92W Orai1 shows increased Ca<sup>2+</sup> sensitivity and is not buffered by BAPTA, a chelator that reduces CDI of WT Orai1 channels. However, STIM1 co-expression normalizes the Ca<sup>2+</sup> sensitivity of T92W Orai1 to that of WT channels gated by STIM1. These results have important implications for the CDI mechanism and the role of STIM1 in the feedback inhibition process.</p><sec id="s3-1"><title>The T92-L138 motif regulates Orai1 activation</title><p>The finding that the L138-T92 motif regulates Orai1 gating is notable as this locus is located very close to the H134 residue that functions as a steric “brake” at the interface between helices TM1, TM2, and TM3 to control Orai gating (<xref ref-type="bibr" rid="bib13">Frischauf et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>). However, the side-chain size dependence of Orai1 activity at the L138-T92 locus follows an inverse pattern of what is observed for the H134 locus which is located one helical turn above on TM2 (<xref ref-type="fig" rid="fig9">Figure 9A</xref>). Introduction of bulky amino acids at T92 or L138 yield GOF channels, whereas small or flexible residues lead to LOF channels. At H134, by contrast, exactly the opposite is true: at this position small or flexible substitutions cause constitutive activity and large amino acids impede STIM1-mediated gating (<xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>).</p><fig id="fig9" position="float"><label>Figure 9.</label><caption><title>Schematic of the ‘brace’ formed by the H134 and L138 residues around TM1.</title><p>(<bold>A</bold>) Polynomial fits of T92 and H134 mutant channel activity plotted against side chain surface area shows opposite dependence of these two positions on size. For both fits, charged residues (D/E/K/R) and G/P were excluded from this analysis because of their propensity to break α-helical secondary structure. (<bold>B</bold>) Left: Top view of the dOrai hexameric channel with the relative positions at the TM1-TM2/3 ring interface with H134 (teal) and L138 (red) shown. Middle and right: Top and side views of residues H134 (teal spheres) and L138 (red spheres) at the TM1 (blue) and TM2 (grey) interface. The two amino acids are on either side of the pore helix, approximately one turn apart. One TM2 and TM1 helix from each subunit are displayed for simplicity. (<bold>C</bold>) Intra-subunit interaction of S97 (navy) with H134 (teal) and inter-subunit interaction of T92 (green) with L138 (red) are shown to highlight the different interfaces of these pairs of interactions. (<bold>D</bold>) Proposed gating conformational change of L138 and H134 associated with channel opening. H134 and L138 are positioned one helical turn away from each other on opposite sides of the TM1 pore helix. Amino acid substitutions at L138 that cause TM1 to be pushed inwards, or H134 to be drawn outwards, cause channel activation via TM1 pore helix twisting and pore dilation to open the channel gate.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-fig9-v2.tif"/></fig><p>What insights do the phenotypes of these mutants offer about the Orai1 channel activation process? The opposite dependencies of channel activity on the size of the side chain at H134 and L138 implies that these two residues are complementary in their effects. Both residues are on TM2, which is tilted diagonally relative to the membrane and TM1 pore helix. H134 and L138 are positioned squarely at the crossover between the two helices, and when viewed from the top, their side chains are in contact with opposite sides of TM1 (<xref ref-type="fig" rid="fig9">Figure 9B</xref>). We postulate that their complementary functional roles is related to several key differences in their positioning – (<italic>i</italic>) when viewed from the top, the side-chains of H134 and L138 are on opposite sides of TM1, (<italic>ii</italic>) L138 is located one turn below H134, and (<italic>iii</italic>) the S97-H134 interaction is intra-subunit (<xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>) while T92-L138 interaction is inter-subunit (<xref ref-type="fig" rid="fig9">Figure 9B and C</xref>). We suggest that H134 and L138 function as pivot points for a ‘brace’ that stabilizes the pore helix. In this scenario, introducing steric pressure on TM1 via large amino acids substitutions at L138 or creating steric void at H134 outward through small substitutions both lead to channel activation, while ‘pulling’ at L138 or ‘pushing’ inward at H134 abolishes channel function. Although speculative, this pattern also raises the possibility that during STIM1-mediated gating, the TM1 helix is pushed outward by the lower portion of TM2 where L138 is positioned, causing it to tilt outward towards H134, leading to pore dilation in the hydrophobic stretch of the pore encompassing F99 that functions as the channel gate (<xref ref-type="bibr" rid="bib43">Yamashita et al., 2017</xref>; <xref ref-type="fig" rid="fig9">Figure 9D</xref>). Moreover, because L138 and H134 are on different sides of TM1, they are also suitably positioned to help mediate rotation of the pore helix that accompanies pore dilation and channel opening (<xref ref-type="bibr" rid="bib43">Yamashita et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>; <xref ref-type="fig" rid="fig9">Figure 9D</xref>).</p><p>A recent MD simulation study (<xref ref-type="bibr" rid="bib49">Zhang et al., 2021</xref>) that examined the dOrai L210F mutation (equivalent to the human L138F Orai1 mutation) lends partial support to such a model. This study found that the introduced Phe side-chain at L210 is stabilized in a clockwise rotated state compared to WT channels (<xref ref-type="bibr" rid="bib49">Zhang et al., 2021</xref>). The study also determined the conformational deflection of the L138F side chain was associated with opening of the hydrophobic gate in the pore through counter-clockwise rotation of TM1 to increase pore waters as previously proposed for channel activation (<xref ref-type="bibr" rid="bib43">Yamashita et al., 2017</xref>; <xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>; <xref ref-type="bibr" rid="bib3">Bulla et al., 2019</xref>) and concurrent dilation of the inner pore (<xref ref-type="bibr" rid="bib13">Frischauf et al., 2017</xref>; <xref ref-type="bibr" rid="bib22">Liu et al., 2019</xref>; <xref ref-type="bibr" rid="bib17">Hou et al., 2020</xref>). Together, the results of this study are compatible with our findings here that L138-TM1 interactions strongly influence the conformation(s) of the channel gate and suggest that a clockwise rotation of L138F as suggested by Zhang et al. would increases pore waters via a wetting transition to open the hydrophobic channel gate.</p></sec><sec id="s3-2"><title>The T92-L138 motif regulates fast CDI: implications for the CDI mechanism</title><p>Fast CDI is a distinguishing feature of CRAC channels and was first described in early recordings of CRAC currents in mast cells and T cells (<xref ref-type="bibr" rid="bib15">Hoth and Penner, 1993</xref>; <xref ref-type="bibr" rid="bib52">Zweifach and Lewis, 1995</xref>). Although several reports have described effects of mutations in different regions of the CRAC channel on CDI, a broader molecular understanding of fast CDI remains elusive. Key aspects of CDI that remain obscure include the identity of the Ca<sup>2+</sup> sensor for CDI, the identity and nature of the inactivation gate that closes the pore, and the coupling between the Ca<sup>2+</sup> sensor and the inactivation gate. A potential role for calmodulin (<xref ref-type="bibr" rid="bib26">Mullins et al., 2009</xref>) and STIM1 (<xref ref-type="bibr" rid="bib4">Derler et al., 2009</xref>; <xref ref-type="bibr" rid="bib36">Scrimgeour et al., 2009</xref>; <xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>) as the Ca<sup>2+</sup> sensors for CDI were suggested in earlier studies, but subsequent evidence raised questions about their role (<xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>), leaving the identity of the Ca<sup>2+</sup> sensor a mystery. Nevertheless, a general consensus that STIM1 is necessary for CDI has emerged, and in particular, the ID region of STIM1 (encompassing residues 474–491) containing several acidic residues is implicated as an essential domain for CDI. STIM1 mutants lacking ID<sub>STIM1</sub> fail to show CDI, and mutating specific acidic residues in this region accelerate, or in some cases, diminish CDI (<xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>). Within Orai1, mutational analysis and domain swap experiments between Orai isoforms have implicated the cytosolic domains, in particular the Orai1 N- and the C-termini (<xref ref-type="bibr" rid="bib19">Lee et al., 2009</xref>; <xref ref-type="bibr" rid="bib37">Srikanth et al., 2010</xref>; <xref ref-type="bibr" rid="bib12">Frischauf et al., 2011</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>) in CDI. From these studies, the most generally accepted view is that the ID<sub>STIM1</sub> allosterically interacts with the Orai1 inner pore to mediate CDI (<xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>). The aromatics Y80 and W76 and to a lesser extent, three positively charged residues (R91, K87, and R83), have been strongly implicated (<xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>) raising the possibility that this region of the inner pore may function as the channel gate for CDI.</p><p>Against this backdrop, the finding that Orai1 L138F and T92W channels show rapid CDI in the absence of STIM1 provide several new insights on the mechanisms of CDI. First, this result indicates that STIM1 is not essential for mediating CDI, nor does it function as the Ca<sup>2+</sup> sensor. Rather, the results suggest that the Ca<sup>2+</sup> sensor is likely located within the Orai1 protein itself, or a closely associated accessory subunit. We favor the idea that the Ca<sup>2+</sup> binding site is located on Orai1 itself and our early experiments suggest that the Orai1 C-terminus likely has a key role in this process. Second, we find that CDI of T92W Orai1 is much more prominent in BAPTA-containing internal solutions compared to EGTA-based solutions. This is the exact reverse of what is seen for WT Orai1 channels. Our analysis suggests that this is due to enhanced Ca<sup>2+</sup> sensitivity of T92W Orai1 channels for CDI compared to WT Orai1 channels, which is normalized by STIM1. Thus, STIM1 functions to tune the Ca<sup>2+</sup>-sensitivity of CDI.</p><p>The implications of the increased Ca<sup>2+</sup>-sensitivity of inactivation in T92W Orai1 channels for macroscopic Orai1 currents can be analyzed in terms of the simple reaction scheme:<disp-formula id="equ3"><label>(3)</label><mml:math id="m3"><mml:mrow><mml:mi>C</mml:mi><mml:mi>a</mml:mi><mml:mtext> </mml:mtext><mml:mo>+</mml:mo><mml:mtext> </mml:mtext><mml:mi>O</mml:mi><mml:munderover><mml:mo>⇌</mml:mo><mml:mpadded width="+0.667em" lspace="0.278em" voffset="-.24em"><mml:mi>k</mml:mi><mml:mn>2</mml:mn></mml:mpadded><mml:mpadded width="+0.667em" lspace="0.278em" voffset=".15em"><mml:mi>k</mml:mi><mml:mn>1</mml:mn></mml:mpadded></mml:munderover><mml:mi>C</mml:mi><mml:mi>a</mml:mi><mml:mtext> </mml:mtext><mml:mo>−</mml:mo><mml:mi>O</mml:mi><mml:munderover><mml:mo>⇌</mml:mo><mml:mpadded width="+0.667em" lspace="0.278em" voffset="-.24em"><mml:mi>β</mml:mi></mml:mpadded><mml:mpadded width="+0.667em" lspace="0.278em" voffset=".15em"><mml:mi>α</mml:mi></mml:mpadded></mml:munderover><mml:mi>I</mml:mi></mml:mrow></mml:math></disp-formula></p><p>where Ca<sup>2+</sup> ions bind to open (<italic>O</italic>) CRAC channels with forward and reverse rate constants of <italic>k<sub>1</sub></italic> and <italic>k<sub>2</sub></italic> and drive them into the inactivated state (<italic>I</italic>) with forward and reverse rate constants of and <italic>β</italic> respectively. Purely for simplicity, we have assumed first-order kinetics for the binding and gating steps, although the actual state diagram is likely more complex (as already hinted by the presence of at least two exponentials for the inactivation time course). Nevertheless, the simple scheme above is instructive in illuminating the potential mechanisms of the change in CDI in T92W Orai1 channels. The analysis of <xref ref-type="fig" rid="fig6">Figure 6A</xref> suggests that the Ca<sup>2+</sup> sensitivity of T92W Orai1 for CDI is strongly enhanced compared to WT Orai1 channels (i.e. <italic>K<sub>d</sub></italic> = <italic>k<sub>2</sub></italic>/<italic>k<sub>1</sub></italic> is reduced in T92W Orai1). This change in <italic>K<sub>d</sub></italic> predicts that at a given [Ca<sup>2+</sup>]<sub>i</sub>, the forward reaction will be more strongly favored in the mutant compared to WT Orai1, and the overall reaction is predicted to reach equilibrium at lower Ca<sup>2+</sup> concentrations in T92W compared to WT Orai1 channels. In fact, with weak Ca<sup>2+</sup> buffering (EGTA or low concentrations of BAPTA) and recurring (every 1 s) steps to –100 mV, T92W inactivation could reach equilibrium at the holding potential (+30 mV) itself such that hyperpolarizing steps are unable to cause additional inactivation. As a result, membrane hyperpolarization fails to elicit additional inactivation in the presence of EGTA.</p><p>Although T92W Orai1 channels show enhanced Ca<sup>2+</sup> sensitivity for CDI, co-expression of STIM1 ‘normalizes’ the Ca<sup>2+</sup>-dependence of the mutant channels (<xref ref-type="fig" rid="fig8">Figure 8</xref>). The ‘normalization’ of CDI Ca<sup>2+</sup> sensitivity is reminiscent of the normalization of ion selectivity of poorly Ca<sup>2+</sup> selective V102C/A Orai1 channels by STIM1 (<xref ref-type="bibr" rid="bib23">McNally et al., 2012</xref>; <xref ref-type="bibr" rid="bib5">Derler et al., 2013</xref>). A change in Ca<sup>2+</sup> sensitivity of CDI could presumably occur via STIM1-driven change in the conformation of the C-terminus, which harbors several acidic residues that could bind Ca<sup>2+</sup> and which are located in close vicinity to residues L273 and L276 that are critical for STIM1 binding (<xref ref-type="bibr" rid="bib25">Muik et al., 2008</xref>; <xref ref-type="bibr" rid="bib29">Navarro-Borelly et al., 2008</xref>). Interaction of STIM1 with the Orai1 C-terminus could potentially alter Ca<sup>2+</sup> binding to this region to modulate CDI. Interestingly, truncation of the C-terminus does not completely eliminate CDI (<xref ref-type="fig" rid="fig7">Figure 7B and C</xref>) indicating the C-terminus is not the sole determinant of CDI. Other potential candidates that could function as the Ca<sup>2+</sup> sensors for CDI could include the Glu selectivity filter, which has been previously implicated in CDI (<xref ref-type="bibr" rid="bib41">Yamashita et al., 2007</xref>) and the TM2-3 loop (<xref ref-type="bibr" rid="bib37">Srikanth et al., 2010</xref>) which contains several acidic residues.</p><p>In the N-terminus, mutations (W76E, Y80E, R83E) that abrogate CDI of WT Orai1 channels gated by STIM1 (<xref ref-type="bibr" rid="bib27">Mullins and Lewis, 2016a</xref>; <xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref>) substantially accelerated and increased CDI of T92W Orai1 channels. These phenotypes reinforce that notion that the inner pore is a key molecular determinant of CDI in Orai1 channels, but the acceleration of CDI indicates that this region may not function as the inactivation gate.</p><p>A key question is why mutations at the Orai1 L138-T92 locus even show CDI. This stands in sharp contrast to all other previously described GOF mutations (at V102, H134, P245 and others) which do not display CDI. We propose that the Orai1 L138-T92 locus mutations described here stabilize the inner pore of the channel in a conformation that is permissive for local Ca<sup>2+</sup> to drive inactivation, and this occurs in a manner similar to that induced by STIM1 itself. While the other GOF mutations activate the channel gate and allow ion conduction, the inner pore is not in the correct conformational state permissive for Ca<sup>2+</sup> to stimulate CDI. This interpretation would also imply that the molecular determinants of activation and inactivation differ in important ways and more studies are needed to resolve this major question.</p><p>The increased Ca<sup>2+</sup> sensitivity of T92W and L138F CDI likely also explains the high I<sub>Na</sub>/I<sub>Ca</sub> current ratio observed for these mutants (<xref ref-type="fig" rid="fig1">Figure 1</xref>), as inactivation is relieved in Na<sup>+</sup>-containing solutions. The presence of CDI in the L138F human mutation may also explain previous observations indicating that this pathological mutation raises resting cytoplasmic [Ca<sup>2+</sup>] to a lesser degree than other gain-of-function human mutations (e.g. S97C, G98S) and evokes milder symptoms (tubular aggregate myopathy but not hypocalcemia) (<xref ref-type="bibr" rid="bib9">Endo et al., 2015</xref>; <xref ref-type="bibr" rid="bib14">Garibaldi et al., 2016</xref>; <xref ref-type="bibr" rid="bib2">Böhm et al., 2017</xref>). The milder defect in the L138F mutant may be related to partial blunting of the steady-state open probability of the GOF channel thereby somewhat blunting constitutive Ca<sup>2+</sup> entry.</p><p>Taken together, this evidence indicates that CDI of Orai1 occurs independently of STIM1 with the Ca<sup>2+</sup> binding site likely located within Orai1 itself, possibly at the Orai1 C-terminus. The precise identity and structural basis of the Ca<sup>2+</sup> binding and how Ca<sup>2+</sup> binding to the sensor is communicated to the pore to evoke channel closure remains to be understood but the results here provide a way forward to address these questions in a simplified one-component system using a constitutively active Orai1 mutant that shows CDI in the absence of STIM1.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Cells</title><p>HEK293-H cells were maintained in suspension at 37 °C with 5% CO<sub>2</sub> in CD293 medium supplemented with 4 mM GlutaMAX (Invitrogen). The HEK293 cell line is a permanent line established from primary embryonic human kidney and transformed with sheared human adenovirus type 5 DNA. The E1A adenovirus gene is expressed in these cells to optimize protein production. HEK293-H cells were cloned from the original 293 cell line and adapted to CD293 serum-free medium for growth in suspension. Cell line identity has been authenticated by Thermo- Fisher Scientific, and cells were tested negative for mycoplasma by qPCR detection assay. For imaging and electrophysiology, cells were plated onto poly-L-lysine coated coverslips one day before transfection and grown in a medium containing 44% DMEM (Corning), 44% Ham’s F12 (Corning), 10% fetal bovine serum (HyClone), 2 mM glutamine, 50 U/ml penicillin and 50 µg/ml streptomycin.</p></sec><sec id="s4-2"><title>Plasmids and transfections</title><p>The Orai1 mutants employed for electrophysiology were engineered into a pEYFP-N1 vector (Clonetech) to produce C-terminally tagged Orai1-YFP proteins (<xref ref-type="bibr" rid="bib29">Navarro-Borelly et al., 2008</xref>). mCherry-STIM1 and CFP-CAD were kind gifts of Dr. R. Lewis (Stanford University, USA). All mutants were generated by the QuikChange Mutagenesis Kit (Agilent Technologies) and the mutations were confirmed by DNA sequencing. For electrophysiology, the indicated Orai1 constructs were transfected into HEK293-H cells either alone (200 ng DNA per coverslip) or together with STIM1 (100 ng Orai1 and 500 ng STIM1 DNA per coverslip). For FRET microscopy experiments, cells were transfected with Orai1-YFP and CFP-CAD constructs (100 ng each per coverslip). All transfections were performed using Lipofectamine 2000 (Thermo Fisher Scientific) 24–48 hours prior to electrophysiology or imaging experiments.</p></sec><sec id="s4-3"><title>Solutions and chemicals</title><p>The standard 20 mM Ca<sup>2+</sup> extracellular Ringer’s solution used for electrophysiological experiments contained 135 mM NaCl, 4.5 mM KCl, 20 mM CaCl<sub>2</sub>, 1 mM MgCl<sub>2</sub>, 10 mM D-glucose, and 5 mM HEPES (pH 7.4 with NaOH). 110 mM Ca<sup>2+</sup> solution contained 110 mM CaCl<sub>2</sub>, 10 mM D-glucose, and 5 mM HEPES (pH 7.4 with NaOH). The divalent-free (DVF) solution contained 150 mM NaCl, 10 mM HEDTA, 1 mM EDTA, and 10 mM HEPES (pH 7.4 with NaOH). 10 mM TEA-Cl was added to prevent contamination from voltage-gated K<sup>+</sup> channels. All internal solutions contained 8 mM MgCl<sub>2</sub> and 10 mM HEPES (pH 7.2 with CsOH). The standard 8 mM BAPTA internal solution (which was used in the experiments shown in all Figures unless otherwise indicated) contained 135 mM Cs aspartate and 8 mM BAPTA. The 20 mM BAPTA solution contained 95 Cs asparatate and the 0.8 mM BAPTA solution contained 145 mM Cs aspartate (all pH 7.2). The 10 mM EGTA solution contained 130 mM Cs aspartate, and the 20 mM EGTA solution contained 110 mM Cs aspartate (pH 7.2).</p></sec><sec id="s4-4"><title>Electrophysiology</title><p>Currents were recorded in the standard whole-cell configuration at room temperature on an Axopatch 200B amplifier (Molecular Devices) interfaced to an ITC-18 input/output board (Instrutech). Routines developed by R. S. Lewis (Stanford) on the Igor Pro software (Wavemetrics) were employed for stimulation, data acquisition and analysis. Data are corrected for the liquid junction potential of the pipette solution relative to Ringer’s in the bath (–10 mV). The holding potential was +30 mV. The standard voltage stimulus consisted of a 100 ms step to –100 mV followed by a 100 ms ramp from –100 to +100 mV applied at 1 s intervals. For voltage families, steps to –120 mV, –100 mV, –80 mV, and –60 mV were 300 ms each. In the paired-pulse experiment, the holding potential was +30 mV and the two steps were to –100 mV for 300 ms each separated by a step to +100 mV for 200 ms in between the two hyperpolarizing steps. In experiments where Orai1 was co-expressed with STIM1, I<sub>CRAC</sub> was typically activated by passive depletion of ER Ca<sup>2+</sup> stores by intracellular dialysis of 8 mM BAPTA. All currents were acquired at 5 kHz and low pass filtered with a 1 kHz Bessel filter built into the amplifier. All data were corrected for leak currents collected in 100–200 µM LaCl<sub>3</sub>.</p></sec><sec id="s4-5"><title>Data analysis</title><p>Analysis of current amplitudes was typically performed by measuring the peak currents during the –100 mV pulse. Specific mutants were categorized as gain-of-function if their currents exceeded 2 pA/pF, which is more than ten times the current density of WT Orai1 without STIM1. Reversal potentials were measured from the average of several leak-subtracted sweeps in each cell. For CDI, the extent of inactivation was determined from the relative decrease in current (relative to the peak current) during the voltage pulse and quantified as (1−<italic>I<sub>ss</sub></italic>/<italic>I<sub>peak</sub></italic>) where <italic>I<sub>ss</sub></italic> is the current at the end of the 300 ms hyperpolarizing step and <italic>I<sub>peak</sub></italic> is the peak current immediately following the hyperpolarizing step. The time course of CDI was fit with a double-exponential function and the fast and slow time constants (τ<sub>fast</sub> and τ<sub>slow</sub>) were determined from the fits. All fitting was done using the built-in routines in Igor Pro v6.12. [Ca<sup>2+</sup>]<sub>i</sub> profiles were calculated using <xref ref-type="disp-formula" rid="equ1 equ2">equations 1 and 2</xref> using the parameters for <italic>i<sub>Ca</sub></italic>, <italic>D<sub>Ca</sub></italic>, and buffer concentration as indicated in the Results. The <italic>i<sub>Ca</sub></italic> at –60 mV (2.2 fA) and –120 mV (~6.2 fA) was calculated by linearly scaling the unitary current at –100 mV (5 fA) with the altered driving force for Ca<sup>2+</sup> entry. All data are expressed as means ± SEM. For datasets with two groups, statistical analysis was performed with two-tailed t test to compare between control and test conditions. For datasets with greater than two groups, one-way ANOVA followed by Tukey post-hoc test was used to compare groups. Statistical analysis was performed with a confidence level of 95%, and results with p&lt;0.05 were considered statistically significant. Significance is denoted as *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001.</p></sec><sec id="s4-6"><title>Atomic packing analysis</title><p>Atomic packing analysis was performed as in our previous study (<xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref>). Briefly, it carried out using the programs REDUCE and PROBE that simulates rolling a 0.25 Å radius sphere along the van der Waals surfaces. Locations where the probe sphere contacts two surfaces are marked (with a ‘dot’) that classifies whether the surfaces are in wide contact, close contact, overlapped, or clashing. The resulting contact dot scores were summed for all atoms of each residue and displayed using PyMOL on a heat map that shows the degree of contacts.</p></sec><sec id="s4-7"><title>FRET microscopy</title><p>HEK293-H cells transfected with Orai1-YFP and CFP-CAD DNA constructs were imaged using wide-field epifluorescence microscopy on an IX71 inverted microscope (Olympus, Center Valley, PA). Cells were imaged with a 60 X oil immersion objective (UPlanApo NA 1.40), a 175 W Xenon arc lamp (Sutter, Novatao, CA), and excitation and emission filter wheels (Sutter, Novato, CA). At each time point, three sets of images (CFP, YFP, and FRET) were captured on a cooled EM-CCD camera (Hamamatsu, Bridgewater, NJ) using optical filters specific for the three images as previously described. Image acquisition and analysis was performed with SlideBook software (Imaging Innovations Inc, Denver, CO). Images were captured at exposures of 100–500 ms with 1X1 binning. Lamp output was attenuated to 25% by a 0.6 ND filter in the light path to minimize photobleaching. All experiments were performed at room temperature.</p><p>FRET analysis was performed as previously described (<xref ref-type="bibr" rid="bib29">Navarro-Borelly et al., 2008</xref>). The microscope-specific bleed-through constants (a=0.12; b=0.008; c=0.002 and d=0.33) were determined from cells expressing cytosolic CFP or YFP alone. The apparent FRET efficiency was calculated from background-subtracted images using the formalism (<xref ref-type="bibr" rid="bib46">Zal and Gascoigne, 2004</xref>):<disp-formula id="equ4"><mml:math id="m4"><mml:mrow><mml:mstyle displaystyle="true" scriptlevel="0"><mml:msub><mml:mi>E</mml:mi><mml:mrow><mml:mi>F</mml:mi><mml:mi>R</mml:mi><mml:mi>E</mml:mi><mml:mi>T</mml:mi></mml:mrow></mml:msub><mml:mo>=</mml:mo><mml:mfrac><mml:msub><mml:mi>F</mml:mi><mml:mrow><mml:mi>c</mml:mi></mml:mrow></mml:msub><mml:mrow><mml:msub><mml:mi>F</mml:mi><mml:mrow><mml:mi>c</mml:mi></mml:mrow></mml:msub><mml:mo>+</mml:mo><mml:mi>G</mml:mi><mml:msub><mml:mi>I</mml:mi><mml:mrow><mml:mi>D</mml:mi><mml:mi>D</mml:mi></mml:mrow></mml:msub></mml:mrow></mml:mfrac></mml:mstyle></mml:mrow></mml:math></disp-formula></p><p>where<disp-formula id="equ5"><mml:math id="m5"><mml:mrow><mml:msub><mml:mi>F</mml:mi><mml:mrow><mml:mi>c</mml:mi></mml:mrow></mml:msub><mml:mo>=</mml:mo><mml:msub><mml:mi>I</mml:mi><mml:mrow><mml:mi>D</mml:mi><mml:mi>A</mml:mi></mml:mrow></mml:msub><mml:mspace width="thinmathspace"/><mml:mo>⋅</mml:mo><mml:mspace width="thinmathspace"/><mml:mi>a</mml:mi><mml:msub><mml:mi>I</mml:mi><mml:mrow><mml:mi>A</mml:mi><mml:mi>A</mml:mi></mml:mrow></mml:msub><mml:mo>−</mml:mo><mml:mi>d</mml:mi><mml:msub><mml:mi>I</mml:mi><mml:mrow><mml:mi>D</mml:mi><mml:mi>D</mml:mi></mml:mrow></mml:msub></mml:mrow></mml:math></disp-formula></p><p><italic>I<sub>DD</sub></italic>, <italic>I<sub>AA</sub></italic> and <italic>I<sub>DA</sub></italic> refer to the background subtracted CFP, YFP, and FRET images, respectively. The instrument dependent <italic>G</italic> factor had the value 1.85±0.1. E-FRET analysis was restricted to cells with YFP/CFP ratios in the range of 2–6 to ensure that E-FRET was compared across identical acceptor to donor ratios, and measurements were restricted to regions of interest drawn at the plasma membrane.</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn><fn fn-type="COI-statement" id="conf2"><p>Reviewing editor, <italic>eLife</italic></p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Resources, Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con3"><p>Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="mdar"><label>MDAR checklist</label><media xlink:href="elife-82281-mdarchecklist1-v2.pdf" mimetype="application" mime-subtype="pdf"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>Source data files containing the numerical data used in Figures 1–8 and the associated figure supplements have been provided.</p></sec><ack id="ack"><title>Acknowledgements</title><p>We thank members of the laboratory and RS Lewis and CJ Lingle for helpful discussions. This work was supported by NIH grants R01 NS057499 and R01 NS115508 to MP. PS-WY was supported by NIH predoctoral fellowship F31NS101830.</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bergsmann</surname><given-names>J</given-names></name><name><surname>Derler</surname><given-names>I</given-names></name><name><surname>Muik</surname><given-names>M</given-names></name><name><surname>Frischauf</surname><given-names>I</given-names></name><name><surname>Fahrner</surname><given-names>M</given-names></name><name><surname>Pollheimer</surname><given-names>P</given-names></name><name><surname>Schwarzinger</surname><given-names>C</given-names></name><name><surname>Gruber</surname><given-names>HJ</given-names></name><name><surname>Groschner</surname><given-names>K</given-names></name><name><surname>Romanin</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Molecular determinants within N terminus of orai3 protein that control channel activation and gating</article-title><source>The Journal of Biological Chemistry</source><volume>286</volume><fpage>31565</fpage><lpage>31575</lpage><pub-id pub-id-type="doi">10.1074/jbc.M111.227546</pub-id><pub-id pub-id-type="pmid">21724845</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Böhm</surname><given-names>J</given-names></name><name><surname>Bulla</surname><given-names>M</given-names></name><name><surname>Urquhart</surname><given-names>JE</given-names></name><name><surname>Malfatti</surname><given-names>E</given-names></name><name><surname>Williams</surname><given-names>SG</given-names></name><name><surname>O’Sullivan</surname><given-names>J</given-names></name><name><surname>Szlauer</surname><given-names>A</given-names></name><name><surname>Koch</surname><given-names>C</given-names></name><name><surname>Baranello</surname><given-names>G</given-names></name><name><surname>Mora</surname><given-names>M</given-names></name><name><surname>Ripolone</surname><given-names>M</given-names></name><name><surname>Violano</surname><given-names>R</given-names></name><name><surname>Moggio</surname><given-names>M</given-names></name><name><surname>Kingston</surname><given-names>H</given-names></name><name><surname>Dawson</surname><given-names>T</given-names></name><name><surname>DeGoede</surname><given-names>CG</given-names></name><name><surname>Nixon</surname><given-names>J</given-names></name><name><surname>Boland</surname><given-names>A</given-names></name><name><surname>Deleuze</surname><given-names>J-F</given-names></name><name><surname>Romero</surname><given-names>N</given-names></name><name><surname>Newman</surname><given-names>WG</given-names></name><name><surname>Demaurex</surname><given-names>N</given-names></name><name><surname>Laporte</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>ORAI1 mutations with distinct channel gating defects in tubular aggregate myopathy</article-title><source>Human Mutation</source><volume>38</volume><fpage>426</fpage><lpage>438</lpage><pub-id pub-id-type="doi">10.1002/humu.23172</pub-id><pub-id pub-id-type="pmid">28058752</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bulla</surname><given-names>M</given-names></name><name><surname>Gyimesi</surname><given-names>G</given-names></name><name><surname>Kim</surname><given-names>JH</given-names></name><name><surname>Bhardwaj</surname><given-names>R</given-names></name><name><surname>Hediger</surname><given-names>MA</given-names></name><name><surname>Frieden</surname><given-names>M</given-names></name><name><surname>Demaurex</surname><given-names>N</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>ORAI1 channel gating and selectivity is differentially altered by natural mutations in the first or third transmembrane domain</article-title><source>The Journal of Physiology</source><volume>597</volume><fpage>561</fpage><lpage>582</lpage><pub-id pub-id-type="doi">10.1113/JP277079</pub-id><pub-id pub-id-type="pmid">30382595</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Derler</surname><given-names>I</given-names></name><name><surname>Fahrner</surname><given-names>M</given-names></name><name><surname>Muik</surname><given-names>M</given-names></name><name><surname>Lackner</surname><given-names>B</given-names></name><name><surname>Schindl</surname><given-names>R</given-names></name><name><surname>Groschner</surname><given-names>K</given-names></name><name><surname>Romanin</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>A ca2 (+) release-activated ca2 (+) (CRAC) modulatory domain (CMD) within STIM1 mediates fast ca2 (+) -dependent inactivation of orai1 channels</article-title><source>The Journal of Biological Chemistry</source><volume>284</volume><fpage>24933</fpage><lpage>24938</lpage><pub-id pub-id-type="doi">10.1074/jbc.C109.024083</pub-id><pub-id pub-id-type="pmid">19622747</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Derler</surname><given-names>I</given-names></name><name><surname>Plenk</surname><given-names>P</given-names></name><name><surname>Fahrner</surname><given-names>M</given-names></name><name><surname>Muik</surname><given-names>M</given-names></name><name><surname>Jardin</surname><given-names>I</given-names></name><name><surname>Schindl</surname><given-names>R</given-names></name><name><surname>Gruber</surname><given-names>HJ</given-names></name><name><surname>Groschner</surname><given-names>K</given-names></name><name><surname>Romanin</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>The extended transmembrane orai1 N-terminal (ETON) region combines binding interface and gate for orai1 activation by STIM1</article-title><source>The Journal of Biological Chemistry</source><volume>288</volume><fpage>29025</fpage><lpage>29034</lpage><pub-id pub-id-type="doi">10.1074/jbc.M113.501510</pub-id><pub-id pub-id-type="pmid">23943619</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Derler</surname><given-names>I</given-names></name><name><surname>Butorac</surname><given-names>C</given-names></name><name><surname>Krizova</surname><given-names>A</given-names></name><name><surname>Stadlbauer</surname><given-names>M</given-names></name><name><surname>Muik</surname><given-names>M</given-names></name><name><surname>Fahrner</surname><given-names>M</given-names></name><name><surname>Frischauf</surname><given-names>I</given-names></name><name><surname>Romanin</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Authentic CRAC channel activity requires STIM1 and the conserved portion of the Orai N terminus</article-title><source>The Journal of Biological Chemistry</source><volume>293</volume><fpage>1259</fpage><lpage>1270</lpage><pub-id pub-id-type="doi">10.1074/jbc.M117.812206</pub-id><pub-id pub-id-type="pmid">29237734</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Emrich</surname><given-names>SM</given-names></name><name><surname>Yoast</surname><given-names>RE</given-names></name><name><surname>Xin</surname><given-names>P</given-names></name><name><surname>Zhang</surname><given-names>X</given-names></name><name><surname>Pathak</surname><given-names>T</given-names></name><name><surname>Nwokonko</surname><given-names>R</given-names></name><name><surname>Gueguinou</surname><given-names>MF</given-names></name><name><surname>Subedi</surname><given-names>KP</given-names></name><name><surname>Zhou</surname><given-names>Y</given-names></name><name><surname>Ambudkar</surname><given-names>IS</given-names></name><name><surname>Hempel</surname><given-names>N</given-names></name><name><surname>Machaca</surname><given-names>K</given-names></name><name><surname>Gill</surname><given-names>DL</given-names></name><name><surname>Trebak</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Cross-talk between N-terminal and C-terminal domains in stromal interaction molecule 2 (STIM2) determines enhanced STIM2 sensitivity</article-title><source>The Journal of Biological Chemistry</source><volume>294</volume><fpage>6318</fpage><lpage>6332</lpage><pub-id pub-id-type="doi">10.1074/jbc.RA118.006801</pub-id><pub-id pub-id-type="pmid">30824535</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Emrich</surname><given-names>SM</given-names></name><name><surname>Yoast</surname><given-names>RE</given-names></name><name><surname>Trebak</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Physiological functions of CRAC channels</article-title><source>Annual Review of Physiology</source><volume>84</volume><fpage>355</fpage><lpage>379</lpage><pub-id pub-id-type="doi">10.1146/annurev-physiol-052521-013426</pub-id><pub-id pub-id-type="pmid">34637326</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Endo</surname><given-names>Y</given-names></name><name><surname>Noguchi</surname><given-names>S</given-names></name><name><surname>Hara</surname><given-names>Y</given-names></name><name><surname>Hayashi</surname><given-names>YK</given-names></name><name><surname>Motomura</surname><given-names>K</given-names></name><name><surname>Miyatake</surname><given-names>S</given-names></name><name><surname>Murakami</surname><given-names>N</given-names></name><name><surname>Tanaka</surname><given-names>S</given-names></name><name><surname>Yamashita</surname><given-names>S</given-names></name><name><surname>Kizu</surname><given-names>R</given-names></name><name><surname>Bamba</surname><given-names>M</given-names></name><name><surname>Goto</surname><given-names>YI</given-names></name><name><surname>Matsumoto</surname><given-names>N</given-names></name><name><surname>Nonaka</surname><given-names>I</given-names></name><name><surname>Nishino</surname><given-names>I</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Dominant mutations in ORAI1 cause tubular aggregate myopathy with hypocalcemia via constitutive activation of store-operated Ca²⁺ channels</article-title><source>Human Molecular Genetics</source><volume>24</volume><fpage>637</fpage><lpage>648</lpage><pub-id pub-id-type="doi">10.1093/hmg/ddu477</pub-id><pub-id pub-id-type="pmid">25227914</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Feske</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Crac channelopathies</article-title><source>Pflugers Archiv</source><volume>460</volume><fpage>417</fpage><lpage>435</lpage><pub-id pub-id-type="doi">10.1007/s00424-009-0777-5</pub-id><pub-id pub-id-type="pmid">20111871</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fierro</surname><given-names>L</given-names></name><name><surname>Parekh</surname><given-names>AB</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Fast calcium-dependent inactivation of calcium release-activated calcium current (CRAC) in RBL-1 cells</article-title><source>The Journal of Membrane Biology</source><volume>168</volume><fpage>9</fpage><lpage>17</lpage><pub-id pub-id-type="doi">10.1007/s002329900493</pub-id><pub-id pub-id-type="pmid">10051685</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Frischauf</surname><given-names>I</given-names></name><name><surname>Schindl</surname><given-names>R</given-names></name><name><surname>Bergsmann</surname><given-names>J</given-names></name><name><surname>Derler</surname><given-names>I</given-names></name><name><surname>Fahrner</surname><given-names>M</given-names></name><name><surname>Muik</surname><given-names>M</given-names></name><name><surname>Fritsch</surname><given-names>R</given-names></name><name><surname>Lackner</surname><given-names>B</given-names></name><name><surname>Groschner</surname><given-names>K</given-names></name><name><surname>Romanin</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Cooperativeness of Orai cytosolic domains tunes subtype-specific gating</article-title><source>The Journal of Biological Chemistry</source><volume>286</volume><fpage>8577</fpage><lpage>8584</lpage><pub-id pub-id-type="doi">10.1074/jbc.M110.187179</pub-id><pub-id pub-id-type="pmid">21220423</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Frischauf</surname><given-names>I</given-names></name><name><surname>Litviňuková</surname><given-names>M</given-names></name><name><surname>Schober</surname><given-names>R</given-names></name><name><surname>Zayats</surname><given-names>V</given-names></name><name><surname>Svobodová</surname><given-names>B</given-names></name><name><surname>Bonhenry</surname><given-names>D</given-names></name><name><surname>Lunz</surname><given-names>V</given-names></name><name><surname>Cappello</surname><given-names>S</given-names></name><name><surname>Tociu</surname><given-names>L</given-names></name><name><surname>Reha</surname><given-names>D</given-names></name><name><surname>Stallinger</surname><given-names>A</given-names></name><name><surname>Hochreiter</surname><given-names>A</given-names></name><name><surname>Pammer</surname><given-names>T</given-names></name><name><surname>Butorac</surname><given-names>C</given-names></name><name><surname>Muik</surname><given-names>M</given-names></name><name><surname>Groschner</surname><given-names>K</given-names></name><name><surname>Bogeski</surname><given-names>I</given-names></name><name><surname>Ettrich</surname><given-names>RH</given-names></name><name><surname>Romanin</surname><given-names>C</given-names></name><name><surname>Schindl</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Transmembrane helix connectivity in orai1 controls two gates for calcium-dependent transcription</article-title><source>Science Signaling</source><volume>10</volume><elocation-id>eaao0358</elocation-id><pub-id pub-id-type="doi">10.1126/scisignal.aao0358</pub-id><pub-id pub-id-type="pmid">29184031</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Garibaldi</surname><given-names>M</given-names></name><name><surname>Fattori</surname><given-names>F</given-names></name><name><surname>Riva</surname><given-names>B</given-names></name><name><surname>Labasse</surname><given-names>C</given-names></name><name><surname>Brochier</surname><given-names>G</given-names></name><name><surname>Ottaviani</surname><given-names>P</given-names></name><name><surname>Sacconi</surname><given-names>S</given-names></name><name><surname>Vizzaccaro</surname><given-names>E</given-names></name><name><surname>Laschena</surname><given-names>F</given-names></name><name><surname>Romero</surname><given-names>NB</given-names></name><name><surname>Genazzani</surname><given-names>A</given-names></name><name><surname>Bertini</surname><given-names>E</given-names></name><name><surname>Antonini</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>A novel gain-of-function mutation in orai1 causes late-onset tubular aggregate myopathy and congenital miosis</article-title><source>Clinical Genetics</source><volume>91</volume><fpage>780</fpage><lpage>786</lpage><pub-id pub-id-type="doi">10.1111/cge.12888</pub-id><pub-id pub-id-type="pmid">27882542</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hoth</surname><given-names>M</given-names></name><name><surname>Penner</surname><given-names>R</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Calcium release-activated calcium current in rat mast cells</article-title><source>The Journal of Physiology</source><volume>465</volume><fpage>359</fpage><lpage>386</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.1993.sp019681</pub-id><pub-id pub-id-type="pmid">8229840</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hou</surname><given-names>X</given-names></name><name><surname>Pedi</surname><given-names>L</given-names></name><name><surname>Diver</surname><given-names>MM</given-names></name><name><surname>Long</surname><given-names>SB</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Crystal structure of the calcium release-activated calcium channel Orai</article-title><source>Science</source><volume>338</volume><fpage>1308</fpage><lpage>1313</lpage><pub-id pub-id-type="doi">10.1126/science.1228757</pub-id><pub-id pub-id-type="pmid">23180775</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hou</surname><given-names>X</given-names></name><name><surname>Outhwaite</surname><given-names>IR</given-names></name><name><surname>Pedi</surname><given-names>L</given-names></name><name><surname>Long</surname><given-names>SB</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Cryo-EM structure of the calcium release-activated calcium channel orai in an open conformation</article-title><source>eLife</source><volume>9</volume><elocation-id>e62772</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.62772</pub-id><pub-id pub-id-type="pmid">33252040</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lacruz</surname><given-names>RS</given-names></name><name><surname>Feske</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Diseases caused by mutations in ORAI1 and STIM1</article-title><source>Annals of the New York Academy of Sciences</source><volume>1356</volume><fpage>45</fpage><lpage>79</lpage><pub-id pub-id-type="doi">10.1111/nyas.12938</pub-id><pub-id pub-id-type="pmid">26469693</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname><given-names>KP</given-names></name><name><surname>Yuan</surname><given-names>JP</given-names></name><name><surname>Zeng</surname><given-names>W</given-names></name><name><surname>So</surname><given-names>I</given-names></name><name><surname>Worley</surname><given-names>PF</given-names></name><name><surname>Muallem</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Molecular determinants of fast ca2+-dependent inactivation and gating of the orai channels</article-title><source>PNAS</source><volume>106</volume><fpage>14687</fpage><lpage>14692</lpage><pub-id pub-id-type="doi">10.1073/pnas.0904664106</pub-id><pub-id pub-id-type="pmid">19706554</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lis</surname><given-names>A</given-names></name><name><surname>Peinelt</surname><given-names>C</given-names></name><name><surname>Beck</surname><given-names>A</given-names></name><name><surname>Parvez</surname><given-names>S</given-names></name><name><surname>Monteilh-Zoller</surname><given-names>M</given-names></name><name><surname>Fleig</surname><given-names>A</given-names></name><name><surname>Penner</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>CRACM1, CRACM2, and CRACM3 are store-operated Ca2+ channels with distinct functional properties</article-title><source>Current Biology</source><volume>17</volume><fpage>794</fpage><lpage>800</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2007.03.065</pub-id><pub-id pub-id-type="pmid">17442569</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lis</surname><given-names>A</given-names></name><name><surname>Zierler</surname><given-names>S</given-names></name><name><surname>Peinelt</surname><given-names>C</given-names></name><name><surname>Fleig</surname><given-names>A</given-names></name><name><surname>Penner</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>A single lysine in the N-terminal region of store-operated channels is critical for STIM1-mediated gating</article-title><source>The Journal of General Physiology</source><volume>136</volume><fpage>673</fpage><lpage>686</lpage><pub-id pub-id-type="doi">10.1085/jgp.201010484</pub-id><pub-id pub-id-type="pmid">21115697</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Wu</surname><given-names>G</given-names></name><name><surname>Yu</surname><given-names>Y</given-names></name><name><surname>Chen</surname><given-names>X</given-names></name><name><surname>Ji</surname><given-names>R</given-names></name><name><surname>Lu</surname><given-names>J</given-names></name><name><surname>Li</surname><given-names>X</given-names></name><name><surname>Zhang</surname><given-names>X</given-names></name><name><surname>Yang</surname><given-names>X</given-names></name><name><surname>Shen</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Molecular understanding of calcium permeation through the open Orai channel</article-title><source>PLOS Biology</source><volume>17</volume><elocation-id>e3000096</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pbio.3000096</pub-id><pub-id pub-id-type="pmid">31009446</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McNally</surname><given-names>BA</given-names></name><name><surname>Somasundaram</surname><given-names>A</given-names></name><name><surname>Yamashita</surname><given-names>M</given-names></name><name><surname>Prakriya</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Gated regulation of CRAC channel ion selectivity by STIM1</article-title><source>Nature</source><volume>482</volume><fpage>241</fpage><lpage>245</lpage><pub-id pub-id-type="doi">10.1038/nature10752</pub-id><pub-id pub-id-type="pmid">22278058</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McNally</surname><given-names>BA</given-names></name><name><surname>Somasundaram</surname><given-names>A</given-names></name><name><surname>Jairaman</surname><given-names>A</given-names></name><name><surname>Yamashita</surname><given-names>M</given-names></name><name><surname>Prakriya</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>The C- and N-terminal STIM1 binding sites on Orai1 are required for both trapping and gating CRAC channels</article-title><source>The Journal of Physiology</source><volume>591</volume><fpage>2833</fpage><lpage>2850</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2012.250456</pub-id><pub-id pub-id-type="pmid">23613525</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Muik</surname><given-names>M</given-names></name><name><surname>Frischauf</surname><given-names>I</given-names></name><name><surname>Derler</surname><given-names>I</given-names></name><name><surname>Fahrner</surname><given-names>M</given-names></name><name><surname>Bergsmann</surname><given-names>J</given-names></name><name><surname>Eder</surname><given-names>P</given-names></name><name><surname>Schindl</surname><given-names>R</given-names></name><name><surname>Hesch</surname><given-names>C</given-names></name><name><surname>Polzinger</surname><given-names>B</given-names></name><name><surname>Fritsch</surname><given-names>R</given-names></name><name><surname>Kahr</surname><given-names>H</given-names></name><name><surname>Madl</surname><given-names>J</given-names></name><name><surname>Gruber</surname><given-names>H</given-names></name><name><surname>Groschner</surname><given-names>K</given-names></name><name><surname>Romanin</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Dynamic coupling of the putative coiled-coil domain of Orai1 with STIM1 mediates Orai1 channel activation</article-title><source>The Journal of Biological Chemistry</source><volume>283</volume><fpage>8014</fpage><lpage>8022</lpage><pub-id pub-id-type="doi">10.1074/jbc.M708898200</pub-id><pub-id pub-id-type="pmid">18187424</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mullins</surname><given-names>FM</given-names></name><name><surname>Park</surname><given-names>CY</given-names></name><name><surname>Dolmetsch</surname><given-names>RE</given-names></name><name><surname>Lewis</surname><given-names>RS</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Stim1 and calmodulin interact with orai1 to induce ca2+-dependent inactivation of CRAC channels</article-title><source>PNAS</source><volume>106</volume><fpage>15495</fpage><lpage>15500</lpage><pub-id pub-id-type="doi">10.1073/pnas.0906781106</pub-id><pub-id pub-id-type="pmid">19706428</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mullins</surname><given-names>FM</given-names></name><name><surname>Lewis</surname><given-names>RS</given-names></name></person-group><year iso-8601-date="2016">2016a</year><article-title>The inactivation domain of STIM1 is functionally coupled with the orai1 pore to enable ca2+-dependent inactivation</article-title><source>The Journal of General Physiology</source><volume>147</volume><fpage>153</fpage><lpage>164</lpage><pub-id pub-id-type="doi">10.1085/jgp.201511438</pub-id><pub-id pub-id-type="pmid">26809794</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mullins</surname><given-names>FM</given-names></name><name><surname>Yen</surname><given-names>M</given-names></name><name><surname>Lewis</surname><given-names>RS</given-names></name></person-group><year iso-8601-date="2016">2016b</year><article-title>Orai1 pore residues control CRAC channel inactivation independently of calmodulin</article-title><source>The Journal of General Physiology</source><volume>147</volume><fpage>137</fpage><lpage>152</lpage><pub-id pub-id-type="doi">10.1085/jgp.201511437</pub-id><pub-id pub-id-type="pmid">26809793</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Navarro-Borelly</surname><given-names>L</given-names></name><name><surname>Somasundaram</surname><given-names>A</given-names></name><name><surname>Yamashita</surname><given-names>M</given-names></name><name><surname>Ren</surname><given-names>D</given-names></name><name><surname>Miller</surname><given-names>RJ</given-names></name><name><surname>Prakriya</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Stim1-Orai1 interactions and Orai1 conformational changes revealed by live-cell FRET microscopy</article-title><source>The Journal of Physiology</source><volume>586</volume><fpage>5383</fpage><lpage>5401</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2008.162503</pub-id><pub-id pub-id-type="pmid">18832420</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Neher</surname><given-names>E</given-names></name></person-group><year iso-8601-date="1986">1986</year><article-title>Concentration profiles of intracellular calcium in the presence of a diffusible chelator</article-title><source>Experimental Brain Research Series</source><volume>14</volume><fpage>80</fpage><lpage>96</lpage></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nesin</surname><given-names>V</given-names></name><name><surname>Wiley</surname><given-names>G</given-names></name><name><surname>Kousi</surname><given-names>M</given-names></name><name><surname>Ong</surname><given-names>EC</given-names></name><name><surname>Lehmann</surname><given-names>T</given-names></name><name><surname>Nicholl</surname><given-names>DJ</given-names></name><name><surname>Suri</surname><given-names>M</given-names></name><name><surname>Shahrizaila</surname><given-names>N</given-names></name><name><surname>Katsanis</surname><given-names>N</given-names></name><name><surname>Gaffney</surname><given-names>PM</given-names></name><name><surname>Wierenga</surname><given-names>KJ</given-names></name><name><surname>Tsiokas</surname><given-names>L</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Activating mutations in STIM1 and orai1 cause overlapping syndromes of tubular myopathy and congenital miosis</article-title><source>PNAS</source><volume>111</volume><fpage>4197</fpage><lpage>4202</lpage><pub-id pub-id-type="doi">10.1073/pnas.1312520111</pub-id><pub-id pub-id-type="pmid">24591628</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Palty</surname><given-names>R</given-names></name><name><surname>Stanley</surname><given-names>C</given-names></name><name><surname>Isacoff</surname><given-names>EY</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Critical role for Orai1 C-terminal domain and TM4 in CRAC channel gating</article-title><source>Cell Research</source><volume>25</volume><fpage>963</fpage><lpage>980</lpage><pub-id pub-id-type="doi">10.1038/cr.2015.80</pub-id><pub-id pub-id-type="pmid">26138675</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Prakriya</surname><given-names>M</given-names></name><name><surname>Lingle</surname><given-names>CJ</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Activation of BK channels in rat chromaffin cells requires summation of Ca (2+) influx from multiple Ca (2+) channels</article-title><source>Journal of Neurophysiology</source><volume>84</volume><fpage>1123</fpage><lpage>1135</lpage><pub-id pub-id-type="doi">10.1152/jn.2000.84.3.1123</pub-id><pub-id pub-id-type="pmid">10979988</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Prakriya</surname><given-names>M</given-names></name><name><surname>Lewis</surname><given-names>RS</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Regulation of CRAC channel activity by recruitment of silent channels to a high open-probability gating mode</article-title><source>The Journal of General Physiology</source><volume>128</volume><fpage>373</fpage><lpage>386</lpage><pub-id pub-id-type="doi">10.1085/jgp.200609588</pub-id><pub-id pub-id-type="pmid">16940559</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Prakriya</surname><given-names>M</given-names></name><name><surname>Lewis</surname><given-names>RS</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Store-Operated calcium channels</article-title><source>Physiological Reviews</source><volume>95</volume><fpage>1383</fpage><lpage>1436</lpage><pub-id pub-id-type="doi">10.1152/physrev.00020.2014</pub-id><pub-id pub-id-type="pmid">26400989</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Scrimgeour</surname><given-names>N</given-names></name><name><surname>Litjens</surname><given-names>T</given-names></name><name><surname>Ma</surname><given-names>L</given-names></name><name><surname>Barritt</surname><given-names>GJ</given-names></name><name><surname>Rychkov</surname><given-names>GY</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Properties of Orai1 mediated store-operated current depend on the expression levels of STIM1 and Orai1 proteins</article-title><source>The Journal of Physiology</source><volume>587</volume><fpage>2903</fpage><lpage>2918</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2009.170662</pub-id><pub-id pub-id-type="pmid">19403622</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Srikanth</surname><given-names>S</given-names></name><name><surname>Jung</surname><given-names>HJ</given-names></name><name><surname>Ribalet</surname><given-names>B</given-names></name><name><surname>Gwack</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>The intracellular loop of Orai1 plays a central role in fast inactivation of Ca2+ release-activated Ca2+ channels</article-title><source>The Journal of Biological Chemistry</source><volume>285</volume><fpage>5066</fpage><lpage>5075</lpage><pub-id pub-id-type="doi">10.1074/jbc.M109.072736</pub-id><pub-id pub-id-type="pmid">20007711</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stern</surname><given-names>MD</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>Buffering of calcium in the vicinity of a channel pore</article-title><source>Cell Calcium</source><volume>13</volume><fpage>183</fpage><lpage>192</lpage><pub-id pub-id-type="doi">10.1016/0143-4160(92)90046-u</pub-id><pub-id pub-id-type="pmid">1315621</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tiffner</surname><given-names>A</given-names></name><name><surname>Schober</surname><given-names>R</given-names></name><name><surname>Höglinger</surname><given-names>C</given-names></name><name><surname>Bonhenry</surname><given-names>D</given-names></name><name><surname>Pandey</surname><given-names>S</given-names></name><name><surname>Lunz</surname><given-names>V</given-names></name><name><surname>Sallinger</surname><given-names>M</given-names></name><name><surname>Frischauf</surname><given-names>I</given-names></name><name><surname>Fahrner</surname><given-names>M</given-names></name><name><surname>Lindinger</surname><given-names>S</given-names></name><name><surname>Maltan</surname><given-names>L</given-names></name><name><surname>Berlansky</surname><given-names>S</given-names></name><name><surname>Stadlbauer</surname><given-names>M</given-names></name><name><surname>Schindl</surname><given-names>R</given-names></name><name><surname>Ettrich</surname><given-names>R</given-names></name><name><surname>Romanin</surname><given-names>C</given-names></name><name><surname>Derler</surname><given-names>I</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Crac channel opening is determined by a series of Orai1 gating checkpoints in the transmembrane and cytosolic regions</article-title><source>The Journal of Biological Chemistry</source><volume>296</volume><elocation-id>100224</elocation-id><pub-id pub-id-type="doi">10.1074/jbc.RA120.015548</pub-id><pub-id pub-id-type="pmid">33361160</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Word</surname><given-names>JM</given-names></name><name><surname>Lovell</surname><given-names>SC</given-names></name><name><surname>LaBean</surname><given-names>TH</given-names></name><name><surname>Taylor</surname><given-names>HC</given-names></name><name><surname>Zalis</surname><given-names>ME</given-names></name><name><surname>Presley</surname><given-names>BK</given-names></name><name><surname>Richardson</surname><given-names>JS</given-names></name><name><surname>Richardson</surname><given-names>DC</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Visualizing and quantifying molecular goodness-of-fit: small-probe contact dots with explicit hydrogen atoms</article-title><source>Journal of Molecular Biology</source><volume>285</volume><fpage>1711</fpage><lpage>1733</lpage><pub-id pub-id-type="doi">10.1006/jmbi.1998.2400</pub-id><pub-id pub-id-type="pmid">9917407</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yamashita</surname><given-names>M</given-names></name><name><surname>Navarro-Borelly</surname><given-names>L</given-names></name><name><surname>McNally</surname><given-names>BA</given-names></name><name><surname>Prakriya</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Orai1 mutations alter ion permeation and Ca2+-dependent fast inactivation of CRAC channels: evidence for coupling of permeation and gating</article-title><source>The Journal of General Physiology</source><volume>130</volume><fpage>525</fpage><lpage>540</lpage><pub-id pub-id-type="doi">10.1085/jgp.200709872</pub-id><pub-id pub-id-type="pmid">17968026</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yamashita</surname><given-names>M</given-names></name><name><surname>Somasundaram</surname><given-names>A</given-names></name><name><surname>Prakriya</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Competitive modulation of Ca2+ release-activated Ca2+ channel gating by STIM1 and 2-aminoethyldiphenyl borate</article-title><source>The Journal of Biological Chemistry</source><volume>286</volume><fpage>9429</fpage><lpage>9442</lpage><pub-id pub-id-type="doi">10.1074/jbc.M110.189035</pub-id><pub-id pub-id-type="pmid">21193399</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yamashita</surname><given-names>M</given-names></name><name><surname>Yeung</surname><given-names>PSW</given-names></name><name><surname>Ing</surname><given-names>CE</given-names></name><name><surname>McNally</surname><given-names>BA</given-names></name><name><surname>Pomès</surname><given-names>R</given-names></name><name><surname>Prakriya</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Stim1 activates CRAC channels through rotation of the pore helix to open a hydrophobic gate</article-title><source>Nature Communications</source><volume>8</volume><elocation-id>14512</elocation-id><pub-id pub-id-type="doi">10.1038/ncomms14512</pub-id><pub-id pub-id-type="pmid">28220789</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yeung</surname><given-names>PSW</given-names></name><name><surname>Yamashita</surname><given-names>M</given-names></name><name><surname>Ing</surname><given-names>CE</given-names></name><name><surname>Pomès</surname><given-names>R</given-names></name><name><surname>Freymann</surname><given-names>DM</given-names></name><name><surname>Prakriya</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Mapping the functional anatomy of orai1 transmembrane domains for CRAC channel gating</article-title><source>PNAS</source><volume>115</volume><fpage>E5193</fpage><lpage>E5202</lpage><pub-id pub-id-type="doi">10.1073/pnas.1718373115</pub-id><pub-id pub-id-type="pmid">29760086</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yeung</surname><given-names>PS-W</given-names></name><name><surname>Yamashita</surname><given-names>M</given-names></name><name><surname>Prakriya</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Molecular basis of allosteric orai1 channel activation by STIM1</article-title><source>The Journal of Physiology</source><volume>598</volume><fpage>1707</fpage><lpage>1723</lpage><pub-id pub-id-type="doi">10.1113/JP276550</pub-id><pub-id pub-id-type="pmid">30950063</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zal</surname><given-names>T</given-names></name><name><surname>Gascoigne</surname><given-names>NRJ</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Photobleaching-corrected FRET efficiency imaging of live cells</article-title><source>Biophysical Journal</source><volume>86</volume><fpage>3923</fpage><lpage>3939</lpage><pub-id pub-id-type="doi">10.1529/biophysj.103.022087</pub-id><pub-id pub-id-type="pmid">15189889</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>SL</given-names></name><name><surname>Yeromin</surname><given-names>AV</given-names></name><name><surname>Hu</surname><given-names>J</given-names></name><name><surname>Amcheslavsky</surname><given-names>A</given-names></name><name><surname>Zheng</surname><given-names>H</given-names></name><name><surname>Cahalan</surname><given-names>MD</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Mutations in orai1 transmembrane segment 1 cause STIM1-independent activation of orai1 channels at glycine 98 and channel closure at arginine 91</article-title><source>PNAS</source><volume>108</volume><fpage>17838</fpage><lpage>17843</lpage><pub-id pub-id-type="doi">10.1073/pnas.1114821108</pub-id><pub-id pub-id-type="pmid">21987804</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>X</given-names></name><name><surname>Pathak</surname><given-names>T</given-names></name><name><surname>Yoast</surname><given-names>R</given-names></name><name><surname>Emrich</surname><given-names>S</given-names></name><name><surname>Xin</surname><given-names>P</given-names></name><name><surname>Nwokonko</surname><given-names>RM</given-names></name><name><surname>Johnson</surname><given-names>M</given-names></name><name><surname>Wu</surname><given-names>S</given-names></name><name><surname>Delierneux</surname><given-names>C</given-names></name><name><surname>Gueguinou</surname><given-names>M</given-names></name><name><surname>Hempel</surname><given-names>N</given-names></name><name><surname>Putney</surname><given-names>JW</given-names></name><name><surname>Gill</surname><given-names>DL</given-names></name><name><surname>Trebak</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>A calcium/camp signaling loop at the Orai1 mouth drives channel inactivation to shape NFAT induction</article-title><source>Nature Communications</source><volume>10</volume><elocation-id>1971</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-019-09593-0</pub-id><pub-id pub-id-type="pmid">31036819</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>X</given-names></name><name><surname>Yu</surname><given-names>H</given-names></name><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Song</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>The impact of mutation L138F/L210F on the Orai channel: a molecular dynamics simulation study</article-title><source>Frontiers in Molecular Biosciences</source><volume>8</volume><elocation-id>755247</elocation-id><pub-id pub-id-type="doi">10.3389/fmolb.2021.755247</pub-id><pub-id pub-id-type="pmid">34796201</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname><given-names>Y</given-names></name><name><surname>Cai</surname><given-names>X</given-names></name><name><surname>Loktionova</surname><given-names>NA</given-names></name><name><surname>Wang</surname><given-names>X</given-names></name><name><surname>Nwokonko</surname><given-names>RM</given-names></name><name><surname>Wang</surname><given-names>X</given-names></name><name><surname>Wang</surname><given-names>Y</given-names></name><name><surname>Rothberg</surname><given-names>BS</given-names></name><name><surname>Trebak</surname><given-names>M</given-names></name><name><surname>Gill</surname><given-names>DL</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>The STIM1-binding site nexus remotely controls Orai1 channel gating</article-title><source>Nature Communications</source><volume>7</volume><elocation-id>13725</elocation-id><pub-id pub-id-type="doi">10.1038/ncomms13725</pub-id><pub-id pub-id-type="pmid">27929067</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zweifach</surname><given-names>A</given-names></name><name><surname>Lewis</surname><given-names>RS</given-names></name></person-group><year iso-8601-date="1993">1993</year><article-title>Mitogen-regulated Ca2+ current of T lymphocytes is activated by depletion of intracellular Ca2+ stores</article-title><source>PNAS</source><volume>90</volume><fpage>6295</fpage><lpage>6299</lpage><pub-id pub-id-type="doi">10.1073/pnas.90.13.6295</pub-id><pub-id pub-id-type="pmid">8392195</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zweifach</surname><given-names>A</given-names></name><name><surname>Lewis</surname><given-names>RS</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Rapid inactivation of depletion-activated calcium current (Icrac) due to local calcium feedback</article-title><source>The Journal of General Physiology</source><volume>105</volume><fpage>209</fpage><lpage>226</lpage><pub-id pub-id-type="doi">10.1085/jgp.105.2.209</pub-id><pub-id pub-id-type="pmid">7760017</pub-id></element-citation></ref></ref-list><app-group><app id="appendix-1"><title>Appendix 1</title><table-wrap id="app1keyresource" position="anchor"><label>Appendix 1—key resources table</label><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Reagent type (species) or resource</th><th align="left" valign="bottom">Designation</th><th align="left" valign="bottom">Source or reference</th><th align="left" valign="bottom">Identifiers</th><th align="left" valign="bottom">Additional information</th></tr></thead><tbody><tr><td align="left" valign="bottom">Cell line (<italic>Homo-sapiens</italic>)</td><td align="left" valign="bottom">HEK293-H</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="char" char="." valign="bottom">11631017</td><td align="left" valign="bottom">RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:CVCL_6643">CVCL_6643</ext-link></td></tr><tr><td align="left" valign="bottom">Commercial assay or kit</td><td align="left" valign="bottom">QuikChange II XL Site-Directed Mutagenesis Kit</td><td align="left" valign="bottom">Agilent</td><td align="char" char="." valign="bottom">200522</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Transfected construct (human)</td><td align="left" valign="bottom">Orai1-YFP</td><td align="left" valign="bottom">Clontech</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib29">Navarro-Borelly et al., 2008</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Transfected construct (human)</td><td align="left" valign="bottom">mCherry-STIM1</td><td align="left" valign="bottom">Richard Lewis (Stanford)</td><td align="left" valign="bottom"/><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Transfected construct (human)</td><td align="left" valign="bottom">CFP-CAD</td><td align="left" valign="bottom">Richard Lewis (Stanford)</td><td align="left" valign="bottom"/><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Chemical compound, drug</td><td align="left" valign="bottom">Lipofectamine 2000</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="char" char="." valign="bottom">11668019</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Chemical compound, drug</td><td align="left" valign="bottom">EGTA</td><td align="left" valign="bottom">Sigma Aldrich</td><td align="left" valign="bottom">E3889</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Chemical compound, drug</td><td align="left" valign="bottom">BAPTA</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="left" valign="bottom">B1212</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138A</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gcaggtgctgatcatggccgcaaacaggtgcaca tgtgcacctgtttgcggccatgatcagcacctgc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138C</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref></td><td align="left" valign="bottom">tgcaggtgctgatcatgcacgcaaacaggtgcacag ctgtgcacctgtttgcgtgcatgatcagcacctgca</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138D</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gcaggtgctgatcatgtccgcaaacaggtgcaca tgtgcacctgtttgcggacatgatcagcacctgc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138E</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gatgcaggtgctgatcatctccgcaaacaggtgcacagc gctgtgcacctgtttgcggagatgatcagcacctgcatc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138F</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">caggtgctgatcatgaacgcaaacaggtgcaca tgtgcacctgtttgcgttcatgatcagcacctg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138G</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gcaggtgctgatcatgcccgcaaacaggtgcaca tgtgcacctgtttgcgggcatgatcagcacctgc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138H</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">caggtgctgatcatgtgcgcaaacaggtgca tgcacctgtttgcgcacatgatcagcacctg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138I</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">caggtgctgatcatgatcgcaaacaggtgcaca tgtgcacctgtttgcgatcatgatcagcacctg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138K</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gatgcaggtgctgatcatcttcgcaaacaggtgcacagc gctgtgcacctgtttgcgaagatgatcagcacctgcatc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138M</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">atgcaggtgctgatcatcatcgcaaacaggtgcacag ctgtgcacctgtttgcgatgatgatcagcacctgcat</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138N</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">tgcaggtgctgatcatgttcgcaaacaggtgcacag ctgtgcacctgtttgcgaacatgatcagcacctgca</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138P</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">caggtgctgatcatgggcgcaaacaggtgca tgcacctgtttgcgcccatgatcagcacctg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138Q</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">tgcaggtgctgatcatctgcgcaaacaggtgcac gtgcacctgtttgcgcagatgatcagcacctgca</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138R</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">caggtgctgatcatgcgcgcaaacaggtgca tgcacctgtttgcgcgcatgatcagcacctg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138S</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">tgcaggtgctgatcatgctcgcaaacaggtgcacag ctgtgcacctgtttgcgagcatgatcagcacctgca</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138T</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">tgcaggtgctgatcatggtcgcaaacaggtgcacag ctgtgcacctgtttgcgaccatgatcagcacctgca</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138V</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">aggtgctgatcatgaccgcaaacaggtgcac gtgcacctgtttgcggtcatgatcagcacct</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138W</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gatgcaggtgctgatcatccacgcaaacaggtgcacagc gctgtgcacctgtttgcgtggatgatcagcacctgcatc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 L138Y</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">ggatgcaggtgctgatcatatacgcaaacaggtgcacagcc ggctgtgcacctgtttgcgtatatgatcagcacctgcatcc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92A</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">cagagccgaggcccggctggagg cctccagccgggcctcggctctg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92C</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib44">Yeung et al., 2018</xref></td><td align="left" valign="bottom">gagcagagccgagcaccggctggaggct agcctccagccggtgctcggctctgctc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92D</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gagcagagccgagtcccggctggaggct agcctccagccgggactcggctctgctc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92E</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">ggagagcagagccgactcccggctggaggcttt aaagcctccagccgggagtcggctctgctctcc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92F</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gagcagagccgagaaccggctggaggct agcctccagccggttctcggctctgctc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92G</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gagcagagccgagccccggctggaggct agcctccagccggggctcggctctgctc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92H</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gagcagagccgagtgccggctggaggct agcctccagccggcactcggctctgctc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92I</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">agcagagccgagatccggctggagg cctccagccggatctcggctctgct</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92K</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">agcagagccgacttccggctggaggctttaagc gcttaaagcctccagccggaagtcggctctgct</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92L</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">cggagagcagagccgatagccggctggaggcttta taaagcctccagccggctatcggctctgctctccg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92M</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">agcagagccgacatccggctggaggctttaagc gcttaaagcctccagccggatgtcggctctgct</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92N</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">agcagagccgagttccggctggagg cctccagccggaactcggctctgct</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92P</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">cagagccgagggccggctggagg cctccagccggccctcggctctg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92Q</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">ggagagcagagccgactgccggctggaggcttt aaagcctccagccggcagtcggctctgctctcc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92R</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gcagagccgacctccggctggaggctttaa ttaaagcctccagccggaggtcggctctgc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92S</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gcagagccgagctccggctggag ctccagccggagctcggctctgc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92V</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">gagcagagccgagacccggctggaggct agcctccagccgggtctcggctctgctc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92W</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">ggagagcagagccgaccaccggctggaggcttt aaagcctccagccggtggtcggctctgctctcc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 T92Y</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">cggagagcagagccgaataccggctggaggcttta taaagcctccagccggtattcggctctgctctccg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 K85E</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib24">McNally et al., 2013</xref></td><td align="left" valign="bottom">ggaggctttaagctcggcgcggctcaagt acttgagccgcgccgagcttaaagcctcc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 W76E</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref></td><td align="left" valign="bottom">caagtagagcttgcgctcggacagcgcctgcatg catgcaggcgctgtccgagcgcaagctctacttg</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 Y80A</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref></td><td align="left" valign="bottom">ggcgcggctcaaggcgagcttgcgccag ctggcgcaagctcgccttgagccgcgcc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 Y80E</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref></td><td align="left" valign="bottom">tggcgcggctcaactcgagcttgcgccag ctggcgcaagctcgagttgagccgcgcca</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 R83E</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib28">Mullins et al., 2016b</xref></td><td align="left" valign="bottom">ggaggctttaagcttggcctcgctcaagtagagcttgcg cgcaagctctacttgagcgaggccaagcttaaagcctcc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 del267-301</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom"><xref ref-type="bibr" rid="bib41">Yamashita et al., 2007</xref></td><td align="left" valign="bottom">gcgtccagctgcacatccaccattgccac gtggcaatggtggatgtgcagctggacgc</td></tr><tr><td align="left" valign="bottom">Sequence-based reagent</td><td align="left" valign="bottom">mutagenesis primers for Orai1 del267-301</td><td align="left" valign="bottom">IDT</td><td align="left" valign="bottom">This paper</td><td align="left" valign="bottom">ggcgaccggtggatcggtcttatggctaac gttagccataagaccgatccaccggtcgcc</td></tr></tbody></table></table-wrap></app></app-group></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.82281.sa0</article-id><title-group><article-title>Editor's evaluation</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Trebak</surname><given-names>Mohamed</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01an3r305</institution-id><institution>University of Pittsburgh</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><related-object id="sa0ro1" object-id-type="id" object-id="10.1101/2022.08.12.503733" link-type="continued-by" xlink:href="https://sciety.org/articles/activity/10.1101/2022.08.12.503733"/></front-stub><body><p>This manuscript provides strong evidence on the molecular basis of a mutation (L138F) in Orai1 channels that is associated with tubular aggregate myopathy. This disease-related mutation results in a gain of function of Orai1 channels due to a steric clash clash between TM1 and TM2. The study further suggests that Ca<sup>2+</sup>-dependent Inactivation (CDI) is an intrinsic feature of Orai1 channels and that STIM1 fine-tunes CDI.</p></body></sub-article><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.82281.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Trebak</surname><given-names>Mohamed</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01an3r305</institution-id><institution>University of Pittsburgh</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Stathopulos</surname><given-names>Peter B</given-names></name><role>Reviewer</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02grkyz14</institution-id><institution>University of Western Ontario</institution></institution-wrap><country>Canada</country></aff></contrib></contrib-group></front-stub><body><boxed-text id="sa2-box1"><p>Our editorial process produces two outputs: (i) <ext-link ext-link-type="uri" xlink:href="https://sciety.org/articles/activity/10.1101/2022.08.12.503733">public reviews</ext-link> designed to be posted alongside <ext-link ext-link-type="uri" xlink:href="https://www.biorxiv.org/content/10.1101/2022.08.12.503733v1">the preprint</ext-link> for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.</p></boxed-text><p><bold>Decision letter after peer review:</bold></p><p>Thank you for submitting your article &quot;A human tubular aggregate myopathy mutation unmasks STIM1-independent rapid inactivation of Orai1 channels&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Richard Aldrich as the Senior Editor. The following individual involved in the review of your submission has agreed to reveal their identity: Peter B. Stathopulos (Reviewer #3).</p><p>The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.</p><p>Essential revisions:</p><p>1) Additional experiments are required to strengthen data related to CDI of the T92W Orai1 mutant. The authors propose that constitutive T92W Orai1 currents inactivate at a lower intracellular Ca<sup>2+</sup> concentration compared to WT Orai1. Based on a 2-step CDI protocol from a holding membrane potential of +100mV and 10mM EGTA in the patch pipette, the authors show in this case enhanced CDI with T92W Orai1 mutant but not with WT Orai1. Several additional experiments are needed to further strengthen the idea that T92W Orai1 currents inactivate at a lower intracellular Ca<sup>2+</sup> concentration. If the authors are to use a holding potential of +30mV that is maintained over a significantly longer period of time, to provide sufficient time to decrease intracellular Ca<sup>2+</sup> concentration, one expects a similar outcome in terms of T92W CDI.</p><p>2) The authors should also examine additional buffering conditions utilizing different concentrations of BAPTA during their CDI two-step protocols. For instance, what will the 2-step inactivation protocol look like with 8mM BAPTA or an intermediary concentration between 0.8, 8mM, and 20 mM BAPTA? Since BAPTA is removing also local Ca<sup>2+</sup>, the CDI should probably be not different/less pronounced in the 2nd step. Ideally, CDI should be shown under comparable conditions, i.e. all with identical intracellular Ca<sup>2+</sup> buffer concentrations. What is the rationale for using 8mM and 0.8mM BAPTA, but 10mM and 20mM EGTA? Why not 10 mM and 20 mM BAPTA?</p><p>3) A recent study (PMID: 34796201) reported on the impact of L138F in the Orai channel using MD simulations. They discovered two local but essential conformational changes they supposed to be key to the activation. On the one hand, a rotation of L138 and on the other hand a counter-clockwise rotation of F99, resulting in higher hydration. Could you discuss these findings in addition or even find a correlation with your study? Similarly, is there any evidence in past MD simulations by this group (or others) that L138 and H134 apply to oppose push-pull forces to TM1, as suggested in the present manuscript?</p><p>4) The authors discuss the analysis of Figure 6 in terms of a simple reaction scheme, but there are no fitted data or fitted rate constants. Where are the fitted data shown and conformance to the reaction scheme to support the conclusions made by this analysis?</p><p>5) Figure 7 – If not from W76, R83, or Y80, please provide insights on where is the additional/residual inactivation coming from after deletion of 267-301.</p><p>6) The authors focused on L138F and T92W showing CDI in the absence of STIM1 to conclude that CDI is intrinsic to Orai1. What does CDI look like with additional mutations within the same sites (e.g. L138Y and T92F/Y)? For data in Figure 6, what does the same data look like for the L138F Orai1 mutant?</p><p>7) Does enhanced CDI manifest in smaller SOCE in Ca<sup>2+</sup> measurements? Can the authors show what the Ca<sup>2+</sup> signal (measured with a dye) looks like for L138F and T92W mutants?</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>This is a very clearly written manuscript that reports on novel and interesting findings of relevance to CRAC channel regulation, function, and dysfunction. STIM1 was previously shown to be necessary for CDI of WT Orai1 and the present study sheds light and refines previous models of CDI and hints that the gate for CDI is likely located on the Orai1 channel itself and that STIM1 modulates CDI by altering the Ca<sup>2+</sup> sensitivity of Orai1 channels. Although the altered Ca<sup>2+</sup> sensitivity of L138 and T92 mutants and its normalization is novel and enhances our knowledge of the mechanism of CRAC channel CDI, the full picture of CDI and particularly the Ca<sup>2+</sup> sensing site(s) for CDI within Orai1 remain obscure. This and other comments are listed below:</p><p>– The authors focused on L138F and T92W showing CDI in the absence of STIM1 to conclude that CDI is intrinsic to Orai1. This statement needs to be further supported by additional mutations within the same sites (e.g. L138Y and T92F/Y) with similar experiments as in Figure 4 and 5.</p><p>– Based on the authors' calculations of intracellular Ca<sup>2+</sup> under BAPTA vs EGTA, they propose that the reversal of CDI behavior in the different buffer conditions (Figure 5) is due to enhanced Ca<sup>2+</sup> sensitivity of the mutants and that mutant channels reach equilibrium for CDI at a holding potential of +30 mV, such as that with the classic step protocol CDI is already in place before the hyperpolarizing step. Although this is a sensible and straightforward interpretation and 2-step CDI pulse data in Figure 6 lend it support, this explanation would be more convincing if additional recordings were conducted with mutants with a holding potential of +100mV or +120mV with two different concentrations of BAPTA falling between 0.8 and 8mM and between 8 and 20 mM.</p><p>– For data in Figure 6, what does the same data look like for the L138F Orai1 mutant?</p><p>– The patch clamp data is of high quality and convincing, but the authors provide no clues as to how the Ca<sup>2+</sup> signal (measured with a dye, e.g. Fura) looks like for all the L138 and T92 mutants in the presence of different external driving force conditions.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>The manuscript is timely and of broad interest, nevertheless, the authors should address several further points in particular regarding the puzzling behavior of T92W in dependence on Ca<sup>2+</sup>.</p><p>The authors state: &quot;L138F currents exhibited rapid rundown during the first 20-30 seconds (Figure 1A).&quot; Is this rundown occurring in a Ca<sup>2+</sup>-dependent manner? Are there other reasons for this rundown? In contrast, T92F does not show inactivation/rundown in the time course (Figure 2E), while T92W does (Figure 3C). What could be the reason for that?</p><p>The authors state: &quot;whether relieving this clash by reducing the size of the opposing residue could relieve constitutive channel activity&quot; For this, they incorporated glycine, however, glycine is also known to affect the geometry of the helical transmembrane domain by increasing flexibility. Hence, did the authors observe the &quot;rescue effect&quot; also with an alanine, for instance?</p><p>Figure 4: Could you please show CDI always under comparable conditions – all with identical intracellular Ca<sup>2+</sup> buffer concentrations?</p><p>What is the rationale for using 8mM and 0.8mM BAPTA, but 10mM and 20mM EGTA? Why not 10 mM and 20 mM BAPTA?</p><p>The authors propose that the Ca<sup>2+</sup> sensitivity of the inactivation of T92W is substantially increased. Constitutive Orai1 T92W currents inactivate at lower Ca<sup>2+</sup> concentrations compared to Orai1 WT. The authors applied a sophisticated two-step protocol using a prepulse to +100 mV to reveal subsequently increased inactivation of T92W Orai1 in 10 mM EGTA which is not seen with Orai1 WT. I would expect a similar effect if the prepulse goes to +30mV and is applied for a longer time interval providing sufficient time to decrease intracellular Ca<sup>2+</sup> concentrations. Additionally, what will the 2-step inactivation protocol look like for 8mM BAPTA? Since BAPTA is removing also local Ca<sup>2+</sup>, the CDI should probably be not different/less pronounced in the 2nd step.</p><p>A recent study (PMID: 34796201) reported on the impact of L138F in the Orai channel using MD simulations. They discovered two local but essential conformational changes they supposed to be key to the activation. On the one hand, a rotation of L138 and on the other hand a counter-clockwise rotation of F99, resulting in higher hydration. Could you discuss these findings in addition or even find a correlation with your study?</p><p>The idea that the Ca<sup>2+</sup> sensor is likely located within the Orai1 protein itself is compatible with the T92W/L138F mutants, but how will it explain the missing CDI of Orai1 P245L?</p><p><italic>Reviewer #3 (Recommendations for the authors):</italic></p><p>Tryptophan is one of three aromatic amino acids that contain a benzene ring in their side chains; the other two being Phe and Tyr. Thus, the claim that &quot;the introduction of a large benzene ring at L138 likely leads to a steric clash of the exogenous Phe or Tyr side-chains with residues in TM1 causing channel activation&quot; seems inconsistent with their Trp substitution. In the case of Trp, the benzene is fused to a pyrrole ring.</p><p>In all hydrophobicity plots, His could have two points (protonated and deprotonated); the authors should specify which one is plotted and why they believe this is the protonation state in their electrophys measurements.</p><p>Supplementary Figure 3 – Not only did R and D result in a loss of function but also G and P. The authors should comment on why they think this may be the case.</p><p>Figure 4 – Why isn't the same intracellular Ca<sup>2+</sup> chelator used for WT and mutants in this set of data?</p><p>In Figure 4B and D, are the DVF panels mixed up, or are the DVF plots in 4C and 4E mixed up? – In the current layout, it appears that L138F shows a time-dependent inactivation in the DVF buffer whereas the T92W does not, but what is the basis for this inactivation if buffers are DVF? Statistical comparisons need to be made in 4C and 4E and differences interpreted.</p><p>The authors should describe/discuss the data in Figure 5E.</p><p>It is not totally clear to me why comparisons between WT and T92W mutant are not being made at 8 mM BAPTA chelator for both. The equations are comparing 10 mM EGTA (WT) with 8 mM BAPTA (T92W). Does the increased Ca<sup>2+</sup> sensitivity of T92W hold when doing these comparisons using the same chelator?</p><p>Page 18 – The authors discuss the analysis of Figure 6 in terms of a simple reaction scheme, but I don't see any fitted data or any fitted rate constants. Where is the fitted data shown and conformance to the reaction scheme to support the conclusions made by this analysis?</p><p>Figure 7 – If not from W76, R83, and Y80 where is the additional/residual inactivation coming from after deletion of 267-301? What happens if you delete the N- and C-termini; do you completely abrogate CDI?</p><p>Figure 8 – Is it possible that Ca<sup>2+</sup> interactions with STIM1, specifically the ID domain, may be buffering and normalizing the CDI response? Can this be tested with ID domain mutants?</p><p>Figure 8 – Supplement 1 – Can the authors comment on why the voltage dependence of CDI is lost for the Y80E/T92W mutant, even in the presence of STIM1?</p><p>Figure 9 – Is there any evidence in past MD simulations by this group that L138 and H134 apply to oppose push-pull forces to TM1?</p><p>Some sample double-exponential fits of the inactivation profiles should be shown for the mutants and WT Orai1 channels. Differences in the goodness of fits may point to differences in CDI mechanisms.</p><p>It is suggested that &quot;a change in Ca<sup>2+</sup> sensitivity of CDI could presumably occur via STIM1-driven change in the conformation of the domain containing the Ca<sup>2+</sup> binding site at the Orai1 C-terminus.&quot; The authors should consider and discuss how Ca<sup>2+</sup> binding to the ID when STIM1 is coupled to Orai1 channels may affect the Ca<sup>2+</sup> sensitivity of CDI.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.82281.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><disp-quote content-type="editor-comment"><p>Essential revisions:</p><p>1) Additional experiments are required to strengthen data related to CDI of the T92W Orai1 mutant. The authors propose that constitutive T92W Orai1 currents inactivate at a lower intracellular ca<sup>2+</sup> concentration compared to WT Orai1. Based on a 2-step CDI protocol from a holding membrane potential of +100mV and 10mM EGTA in the patch pipette, the authors show in this case enhanced CDI with T92W Orai1 mutant but not with WT Orai1. Several additional experiments are needed to further strengthen the idea that T92W Orai1 currents inactivate at a lower intracellular ca<sup>2+</sup> concentration. If the authors are to use a holding potential of +30mV that is maintained over a significantly longer period of time, to provide sufficient time to decrease intracellular ca<sup>2+</sup> concentration, one expects a similar outcome in terms of T92W CDI.</p></disp-quote><p>We thank the reviewer for this comment. Increasing the duration of recovery at +30 mV does not make any difference (<xref ref-type="fig" rid="sa2fig1">Author response image 1A</xref>) as recovery from CDI occurs much faster than the 200 ms interpulse time interval that we used in Figure 6 of the paper. For native CRAC channels, Zweifach and Lewis (1995) previously showed that recovery from CDI occurs over a biexponential time course with time constants of 7 and 75 ms, and is nearly complete by ~200 ms (in their recording, the recovery potential was -12 mV compared to +30 mV in our experiments). For T92W Orai1, we have similarly found that recovery from CDI also occurs rapidly and reaches steady-state by 120 ms at +100 mV (<xref ref-type="fig" rid="sa2fig1">Author response image 1B</xref>).</p><fig id="sa2fig1" position="float"><label>Author response image 1.</label><caption><title>Recovery from CDI of T92W Orai1 is not improved by prolonging the interpulse interval.</title><p>(A) The traces show inactivation in response to -100 mV pulses separated by a 3 s depolarizing step to +30 mV to promote recovery from CDI. Extracellular ca<sup>2+</sup> was 20 mM and the intracellular solution contained 10 mM EGTA. (B) Recovery time course of CDI of T92W Orai1 channels. The interpulse interval was varied from 40 ms to 200 ms. The recovery time course is shown on the right plot. Recovery reaches steady-state by 200 ms.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-sa2-fig1-v2.tif"/></fig><p>We explicitly tested the reviewer’s suggested experiment by extending the recovery duration at +30 mV to 3 s (&gt; 10-fold longer than the original 200 ms interpulse interval) (<xref ref-type="fig" rid="sa2fig1">Author response image 1A</xref>) but this offered no added recovery. This result is consistent with the notion that channels are already at equilibrium between open and inactivated states within 200 ms (with the equilibrium set by the Ca influx occurring at +30 mV). To promote recovery, what is needed is to reduce submembrane [Ca] <italic>further</italic> at the recovery potential, which can only be achieved by further depolarizing the recovery potential to reduce the driving force for Ca<sup>2+</sup> influx and therefore the submembrane [Ca<sup>2+</sup>] below what occurs at +30 mV. This is what we tried to accomplish by using the +100 mV recovery pulse.</p><p>Also, just to clarify, the above statement in the comment “the authors show enhanced CDI with T92W Orai1 mutant but not with WT Orai1” is actually not correct. What we show is enhanced <italic>recovery</italic> from CDI in T92W (not enhanced CDI) compared to WT Orai1 (because T92W Orai1 channels enter the inactivation state <italic>faster</italic> at the recovery potential of +100 mV than WT).</p><disp-quote content-type="editor-comment"><p>2) The authors should also examine additional buffering conditions utilizing different concentrations of BAPTA during their CDI two-step protocols. For instance, what will the 2-step inactivation protocol look like with 8mM BAPTA or an intermediary concentration between 0.8, 8mM, and 20 mM BAPTA? Since BAPTA is removing also local Ca<sup>2+</sup>, the CDI should probably be not different/less pronounced in the 2nd step. Ideally, CDI should be shown under comparable conditions, i.e. all with identical intracellular Ca<sup>2+</sup> buffer concentrations. What is the rationale for using 8mM and 0.8mM BAPTA, but 10mM and 20mM EGTA? Why not 10 mM and 20 mM BAPTA?</p></disp-quote><p>Done. We added the results for 8 mM BAPTA data to Figure 6 —figure supplement 1. The new data show that there is still recovery that happens in BAPTA but it is less than that seen in EGTA as the membrane holding potential is further depolarized. This is because with BAPTA, there is still substantial CDI that occurs during the hyperpolarizing steps indicating that at this level of buffering, resting inactivation at the holding potential (+30 mV) is less than what occurs in EGTA. As a result of <italic>reduced</italic> resting inactivation, there is therefore less need for the membrane potential to be further depolarized to promote recovery from CDI.</p><p>Rationale for the BAPTA and EGTA concentrations. We apologize for the confusion regarding the use of the different buffer concentrations. We recognize that the order of the buffer concentrations shown in the original Figure 5 of the paper was confusing. To address this issue, we have now added data for 20 mM BAPTA to Figure 5A and also show CDI at exactly the same buffer concentration for both WT Orai1 and T92W Orai1. The concentration of the buffers are also ordered from low to high for each buffer (Figure 5A of the manuscript).</p><p>We should note that the concentrations of EGTA and BAPTA were not chosen at random but to contrast the effective buffering properties of 10 mM EGTA and 8 mM BAPTA. The concentrations of the buffers were chosen to match the local buffering created by the buffers. As Neher (Neher, 1986; Neher and Augustine, 1992) showed, the effective local buffering is mainly dictated by the space constant of Ca<sup>2+</sup> diffusion under the different buffering conditions. The space constant is given by the relation: <inline-formula><mml:math id="sa2m1"><mml:mstyle displaystyle="true" scriptlevel="0"><mml:mrow><mml:mi>λ</mml:mi><mml:mo>=</mml:mo><mml:msup><mml:mrow><mml:mo>(</mml:mo><mml:mfrac><mml:msub><mml:mi>D</mml:mi><mml:mrow><mml:mtext>Ca</mml:mtext></mml:mrow></mml:msub><mml:mrow><mml:msub><mml:mi>k</mml:mi><mml:mrow><mml:mtext>on</mml:mtext></mml:mrow></mml:msub><mml:mi>B</mml:mi></mml:mrow></mml:mfrac><mml:mo>)</mml:mo></mml:mrow><mml:mrow><mml:mn>1</mml:mn><mml:mrow><mml:mo>/</mml:mo></mml:mrow><mml:mn>2</mml:mn></mml:mrow></mml:msup></mml:mrow></mml:mstyle></mml:math></inline-formula> where <italic>D<sub>Ca</sub></italic> is the Ca<sup>2+</sup> diffusion coefficient (~3 x 10-10 m<sup>2</sup> s<sup>-1</sup>), k<sub>on</sub> is the forward rate constant of the buffer (<italic>k<sub>on</sub></italic> = 6 x 10<sup>8</sup>M<sup>-1</sup>s<sup>-1</sup> for BAPTA and 1.5 x 10<sup>6</sup> M<sup>-1</sup>s<sup>-1</sup> for EGTA) at pH 7.2. <italic>B</italic> is the concentration of the buffer. <italic>λ</italic> is 7.9 nm in the presence of 8 mM BAPTA and much larger at 25 nm at 0.8 mM BAPTA. At 20 mM BAPTA, <italic>λ</italic> drops to 5 nm. Thus, changing the BAPTA concentration from 8 mM to 0.8 mM markedly increases the capture distance for a Ca<sup>2+</sup> ion, effectively putting it beyond the molecular dimensions of a typical ion channel (for context, the Orai1 channel diameter is ~6-7 nm (Hou et al., 2012)). Once <italic>λ</italic> is beyond the molecular dimensions of the channel, we speculate that the local Ca<sup>2+</sup> will be essentially unbuffered for CDI. In EGTA solutions, <italic>λ</italic> is 141 nm at 10 mM EGTA, and 100 nm at 20 mM EGTA. These distances are far too large for EGTA to have <italic>any</italic> meaningful local buffering capacity. Thus, CDI is essentially unaffected by EGTA in the 10-20 mM range (and hence not very meaningful to use these EGTA concentrations for buffering local Ca<sup>2+</sup> that drives CDI).</p><fig id="sa2fig2" position="float"><label>Author response image 2.</label><caption><title>Intracellular [Ca<sup>2+</sup>] profiles from a point source of Ca<sup>2+</sup> entry.</title><p>The left plots show [Ca<sup>2+</sup>] profiles in varying concentrations of EGTA and the right profiles in BAPTA. Whereas local Ca<sup>2+</sup> is largely unaffected by variations in [EGTA], they are profoundly reduced by increasing [BAPTA] from 0.8 mM to 8 mM or more. The dotted line shows the estimated distance of the putative Ca<sup>2+</sup> binding site for CDI (Zweifach and Lewis, 1995. JGP).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-sa2-fig2-v2.tif"/></fig><p>We note that for T92W Orai1, its enhanced Ca<sup>2+</sup> sensitivity to CDI means that CDI is essentially maximal and reaches equilibrium with EGTA at the holding potential itself, such as membrane hyperpolarization elicits no further CDI. With BAPTA, buffering becomes increasingly effective as the concentration is raised such that CDI is visible and apparent during hyperpolarizing steps. Hence, we empirically selected buffer concentrations to span the widest possible range of space constants.</p><disp-quote content-type="editor-comment"><p>3) A recent study (PMID: 34796201) reported on the impact of L138F in the Orai channel using MD simulations. They discovered two local but essential conformational changes they supposed to be key to the activation. On the one hand, a rotation of L138 and on the other hand a counter-clockwise rotation of F99, resulting in higher hydration. Could you discuss these findings in addition or even find a correlation with your study? Similarly, is there any evidence in past MD simulations by this group (or others) that L138 and H134 apply to oppose push-pull forces to TM1, as suggested in the present manuscript?</p></disp-quote><p>Thank you for raising this point. Previous MD simulations performed by Zhang et al. suggest that in dOrai L210F (L138F Orai1), the introduction of the Phe side-chain at position 210 stabilizes the side chain in a clockwise rotated state compared to in WT channels. This conformational change is associated with opening of the hydrophobic gate in the pore through counter-clockwise rotation of TM1 as previously shown (Yamashita et al., 2017; Yeung et al., 2018; Bulla et al., 2019) as well as inner pore dilation as shown in other constitutively active channels (Hou et al., 2020; Liu et al., 2019; Dong et al., 2019). Although our current study does not directly examine whether or not the L138F side-chain is rotated compared to the WT L138 residue, both studies implicate that L138-TM1 interactions are critical for determining the outer and inner pore conformations. Based on mutational analysis, we hypothesize that this effect is governed by intersubunit L138-T92 steric interactions (Figure 9C). In this context, a clockwise rotation of L138F as suggested by Zhang et al. would increase the steric interaction and is fully compatible with our data. We have now revised the text to include this information (p 28-29 of Discussion).</p><disp-quote content-type="editor-comment"><p>4) The authors discuss the analysis of Figure 6 in terms of a simple reaction scheme, but there are no fitted data or fitted rate constants. Where are the fitted data shown and conformance to the reaction scheme to support the conclusions made by this analysis?</p></disp-quote><p>We appreciate this concern, but actually this is not currently possible since we do not have any realistic measures of the rate constants for entry of channels into inactivated states or the recovery of channels from inactivated states (into open or other closed states). The simple scheme with one closed state, one open state, and one inactivated state that we used in the manuscript was done purely for conceptual understanding of what is <italic>likely</italic> to happen when the occupancy of channels in different states is altered. The real-life situation is likely to be far more complex with multiple ca<sup>2+</sup> binding steps (for each of the six subunits), multiple STIM1 binding steps to the channel, and potentially several inactivated states (as already suggested by the presence of more than one exponential for the CDI process both in WT and in T92W channels). We used the scheme only to conceptually illustrate the fundamental steps of CDI and what might happen if channel occupancy in the inactivated state increases. It is not meant to be a quantitative reproduction of the data.</p><p>However, we do realize that this creates confusion in the paper, and in response to this concern, we have moved the state diagram scheme and its interpretation to the Discussion section (from the Results).</p><disp-quote content-type="editor-comment"><p>5) Figure 7 – If not from W76, R83, or Y80, please provide insights on where is the additional/residual inactivation coming from after deletion of 267-301.</p></disp-quote><p>There are some acidic residues in the loop which could be potential sites. Moreover, our previous work has also suggested a role for Ca binding within the pore itself (Yamashita et al., 2007). Those are possibilities. The role of these sites for T92W CDI will be addressed in followup studies. We would like to note that while we do understand and appreciate the desire to elucidate the basis of the residual inactivation that is left when the c-terminus is truncated, these studies are outside the scope of this manuscript. Our study already contains a huge amount of experimental analysis with over 200 mutations analyzed by traditional patch-clamp analysis. We began with molecular dissection of a pathological human mutation, dissected the basis of its constitutive activation phenotype, then analyzed the unusual CDI in these mutants. As our paper already contains a large amount of experimental work and novel conceptual findings, we hope reviewers will understand that elucidating the basis of the inactivation or the precise molecular role of STIM1 in CDI is beyond the scope of this manuscript and will be followed up in subsequent work.</p><disp-quote content-type="editor-comment"><p>6) The authors focused on L138F and T92W showing CDI in the absence of STIM1 to conclude that CDI is intrinsic to Orai1. What does CDI look like with additional mutations within the same sites (e.g. L138Y and T92F/Y)? For data in Figure 6, what does the same data look like for the L138F Orai1 mutant?</p></disp-quote><p>We have added data for L138Y and T92F/Y in Figure 4 Figure Supplement 1. Data for L138F is also now added in Figure 6 —figure supplement 1.</p><disp-quote content-type="editor-comment"><p>7) Does enhanced CDI manifest in smaller SOCE in ca<sup>2+</sup> measurements? Can the authors show what the Ca<sup>2+</sup> signal (measured with a dye) looks like for L138F and T92W mutants?</p></disp-quote><p>No, T92W does not produce lower [Ca<sup>2+</sup>] because the mutation elicits such a large constitutively active channel that basal [Ca<sup>2+</sup>]i is very high in T92W expressing HEK cells. [Ca<sup>2+</sup>] levels are also regulated by the synergistic action of Ca influx pathways, pumps, mitochondria, and other processes that collectively are going to be engaged to different extents in WT and T92W expressing cells. The traces in <xref ref-type="fig" rid="sa2fig3">Author response image 3</xref> show the fura-2 Ca imaging done in untransfected, WT, L138F and T92W expressing cells. As can be seen the very high constitutive activity of T92W elevates cytosolic Ca to high levels which is not necessarily reduced by CDI. We do not know the physiological implications of the increased inactivation. Our study rather deals with the molecular mechanism of the process which remains unknown.</p><fig id="sa2fig3" position="float"><label>Author response image 3.</label><caption><title>Intracellular [Ca<sup>2+</sup>] in HEK293 cells expressing T92W Orai1, L138F Orai1, WT Orai1 + STIM1, or WT Orai1 alone.</title><p>Intracellular [Ca<sup>2+</sup>] was measured using fura-2. Stores were depleted as indicated using thapsigargin and extracellular Ca<sup>2+</sup> added back to assess SOCE.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-sa2-fig3-v2.tif"/></fig><disp-quote content-type="editor-comment"><p>Reviewer #1 (Recommendations for the authors):</p><p>This is a very clearly written manuscript that reports on novel and interesting findings of relevance to CRAC channel regulation, function, and dysfunction. STIM1 was previously shown to be necessary for CDI of WT Orai1 and the present study sheds light and refines previous models of CDI and hints that the gate for CDI is likely located on the Orai1 channel itself and that STIM1 modulates CDI by altering the Ca<sup>2+</sup> sensitivity of Orai1 channels. Although the altered Ca<sup>2+</sup> sensitivity of L138 and T92 mutants and its normalization is novel and enhances our knowledge of the mechanism of CRAC channel CDI, the full picture of CDI and particularly the Ca<sup>2+</sup> sensing site(s) for CDI within Orai1 remain obscure. This and other comments are listed below:</p><p>– The authors focused on L138F and T92W showing CDI in the absence of STIM1 to conclude that CDI is intrinsic to Orai1. This statement needs to be further supported by additional mutations within the same sites (e.g. L138Y and T92F/Y) with similar experiments as in Figure 4 and 5.</p><p>– Based on the authors' calculations of intracellular Ca<sup>2+</sup> under BAPTA vs EGTA, they propose that the reversal of CDI behavior in the different buffer conditions (Figure 5) is due to enhanced Ca<sup>2+</sup> sensitivity of the mutants and that mutant channels reach equilibrium for CDI at a holding potential of +30 mV, such as that with the classic step protocol CDI is already in place before the hyperpolarizing step. Although this is a sensible and straightforward interpretation and 2-step CDI pulse data in Figure 6 lend it support, this explanation would be more convincing if additional recordings were conducted with mutants with a holding potential of +100mV or +120mV with two different concentrations of BAPTA falling between 0.8 and 8mM and between 8 and 20 mM.</p><p>– For data in Figure 6, what does the same data look like for the L138F Orai1 mutant?</p></disp-quote><p>Thank you for the suggestion. As recommended, we have carried out recordings of T92W in the presence of 8 mM BAPTA (again this concentration was chosen to be consistent with the rest of the data). These new results are shown Figure 6 —figure supplement 1. The data shows that recovery of T92W in the presence of BAPTA looks much more like WT Orai1 (in the presence of EGTA) than T92W in EGTA. This is very much consistent with the finding that T92W Orai1 shows enhanced Ca<sup>2+</sup> sensitivity to CDI and inactivation is primarily only seen in the presence of BAPTA.</p><p>We also carried out new recordings of paired pulse recovery for the L138F mutant and these data are shown in Figure 6 —figure supplement 1C,D. The recovery of L138F also looks much more like WT Orai1 rather than T92W Orai1. We think this is because the current density is so small, that the degree of resting inactivation is very little. Hence the holding potential of +30 mV is sufficient to promote recovery from CDI.</p><disp-quote content-type="editor-comment"><p>– The patch clamp data is of high quality and convincing, but the authors provide no clues as to how the Ca<sup>2+</sup> signal (measured with a dye, e.g. Fura) looks like for all the L138 and T92 mutants in the presence of different external driving force conditions.</p></disp-quote><p>T92W does not produce lower [Ca<sup>2+</sup>] because the mutation elicits such a large constitutively active channel that basal [Ca<sup>2+</sup>]i is very high in T92W expressing HEK cells. [Ca<sup>2+</sup>] levels are also regulated by the synergistic action of Ca influx pathways, pumps, mitochondria, and other processes that collectively are going to be engaged to different extents in WT and T92W expressing cells. Figure 4 of the Essential Revisions section above shows fura-2 Ca imaging done in untransfected HEK293 cells and WT Orai1, L138F Orai1 and T92W Orai1 expressing cells. As can be readily seen, the very high constitutive activity of T92W elevates cytosolic Ca to high levels which is not necessarily reduced by CDI.</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>The manuscript is timely and of broad interest, nevertheless, the authors should address several further points in particular regarding the puzzling behavior of T92W in dependence on Ca<sup>2+</sup>.</p><p>The authors state: &quot;L138F currents exhibited rapid rundown during the first 20-30 seconds (Figure 1A).&quot; Is this rundown occurring in a Ca<sup>2+</sup>-dependent manner? Are there other reasons for this rundown? In contrast, T92F does not show inactivation/rundown in the time course (Figure 2E), while T92W does (Figure 3C). What could be the reason for that?</p></disp-quote><p>As shown in Figure 4 Figure Supplement 1, CDI of T92W Orai1 is much more prominent than the CDI of T92F (which only shows minimal CDI). Hence the rundown basically reflects accumulation of inactivation and lack of recovery at the holding potential which is more prominent in T92W than T92F.</p><disp-quote content-type="editor-comment"><p>The authors state: &quot;whether relieving this clash by reducing the size of the opposing residue could relieve constitutive channel activity&quot; For this, they incorporated glycine, however, glycine is also known to affect the geometry of the helical transmembrane domain by increasing flexibility. Hence, did the authors observe the &quot;rescue effect&quot; also with an alanine, for instance?</p></disp-quote><p>We thank the reviewer for noting this. The Gly substitution at T92 does not impair channel gating. In response to the reviewer concern, we tested the ability of L138F/T92G Orai1 to be gated by STIM1. Although not constitutively open, in the presence of STIM1, L138F/T92G is still activated and gated by STIM1 to yield large CRAC currents (new data, Figure 2 —figure supplement 1A).</p><p>This result indicates that the Gly mutant is indeed functional and the mutation does not significantly affect Orai1 structure to affect function.</p><p>As suggested, we also generated a T92A/L138F double mutant and analyzed it phenotype. However, this double mutant is constitutively active. This result is not surprising since the Ala side-chain has a much larger volume and mass compared to Gly and therefore cannot reverse the GOF phenotype of the L138F mutant.</p><fig id="sa2fig4" position="float"><label>Author response image 4.</label><caption><title>Introduction of an Ala residue at T92 causes constitutive activation of T92A/L138F Orai1.</title><p>T92A/L138F Orai1 currents were measured in the absence of STIM1 using standard methods. The left plot shows the peak current at -100 mV plotted over time and the right graph shows the current-voltage relationship of the ca<sup>2+</sup> and monovalent currents as indicated.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-82281-sa2-fig4-v2.tif"/></fig><disp-quote content-type="editor-comment"><p>Figure 4: Could you please show CDI always under comparable conditions – all with identical intracellular Ca<sup>2+</sup> buffer concentrations? What is the rationale for using 8mM and 0.8mM BAPTA, but 10mM and 20mM EGTA? Why not 10 mM and 20 mM BAPTA?</p></disp-quote><p>We apologize for not making this clearer but these concentrations were chosen empirically to achieve the widest variation in the local buffering capacity for Ca<sup>2+</sup>. As explained in point 2 of the essential revisions’ response, the concentrations of the buffers were chosen to span a range of local buffering capacities. As Neher (Neher, 1986; Neher and Augustine, 1992) showed, the effective local buffering is mainly dictated by the space constant of Ca<sup>2+</sup> diffusion under the different buffering conditions. The space constant is given by the relation: <inline-formula><mml:math id="sa2m2"><mml:mstyle displaystyle="true" scriptlevel="0"><mml:mrow><mml:mi>λ</mml:mi><mml:mo>=</mml:mo><mml:msup><mml:mrow><mml:mo>(</mml:mo><mml:mfrac><mml:msub><mml:mi>D</mml:mi><mml:mrow><mml:mtext>Ca</mml:mtext></mml:mrow></mml:msub><mml:mrow><mml:msub><mml:mi>k</mml:mi><mml:mrow><mml:mtext>on</mml:mtext></mml:mrow></mml:msub><mml:mi>B</mml:mi></mml:mrow></mml:mfrac><mml:mo>)</mml:mo></mml:mrow><mml:mrow><mml:mn>1</mml:mn><mml:mrow><mml:mo>/</mml:mo></mml:mrow><mml:mn>2</mml:mn></mml:mrow></mml:msup></mml:mrow></mml:mstyle></mml:math></inline-formula> where <italic>D<sub>Ca</sub></italic> is the Ca<sup>2+</sup> diffusion coefficient (~3 x 10-10 m<sup>2</sup> s<sup>-1</sup>), k<sub>on</sub> is the forward rate constant of the buffer (<italic>k<sub>on</sub></italic> = 6 x 10<sup>8</sup>M<sup>-1</sup>s<sup>-1</sup> for BAPTA and 1.5 x 10<sup>6</sup> M<sup>-1</sup>s<sup>-1</sup> for EGTA) at pH 7.2. <italic>B</italic> is the concentration of the buffer. <italic>λ</italic> is 7.9 nm in the presence of 8 mM BAPTA and much larger at 25 nm at 0.8 mM BAPTA. At 20 mM BAPTA, <italic>λ</italic> drops to 5 nm. Thus, changing the BAPTA concentration from 8 mM to 0.8 mM markedly increases the capture distance for a Ca<sup>2+</sup> ion, effectively putting it beyond the molecular dimensions of a typical ion channel (for context, the Orai1 channel diameter is ~6-7 nm (Hou et al., 2012)). Once <italic>λ</italic> is beyond the molecular dimensions of the channel, we speculate that the local Ca<sup>2+</sup> will be essentially unbuffered for CDI. In EGTA solutions, <italic>λ</italic> is 141 nm at 10 mM EGTA, and 100 nm at 20 mM EGTA. These distances are far too large for EGTA to have <italic>any</italic> meaningful local buffering capacity. Thus, CDI is essentially unaffected by EGTA in the 1020 mM range (and hence not very meaningful to use these concentrations for EGTA).</p><p>We do recognize that the order of the buffer concentrations as shown in the original Figure 5 of the paper was confusing. To address this issue, we now show CDI at exactly the same buffer concentration for both WT Orai1 and T92W Orai1. We have also added data for 20 mM BAPTA and changed the figure so that the buffers are ordered from low-to-high for each buffer (Figure 5).</p><p>In the case of T92W, its enhanced Ca<sup>2+</sup> sensitivity means that CDI is essentially maximal in EGTA internal solutions and reaches equilibrium at the holding potential itself, such as membrane hyperpolarization can elicit no further CDI. With BAPTA, buffering becomes increasingly effective as the buffer concentration is increased, such that CDI is visible and apparent during hyperpolarizing steps. Hence, we selected buffer concentrations to span the widest possible range of space constants.</p><disp-quote content-type="editor-comment"><p>The authors propose that the Ca<sup>2+</sup> sensitivity of the inactivation of T92W is substantially increased. Constitutive Orai1 T92W currents inactivate at lower Ca<sup>2+</sup> concentrations compared to Orai1 WT. The authors applied a sophisticated two-step protocol using a prepulse to +100 mV to reveal subsequently increased inactivation of T92W Orai1 in 10 mM EGTA which is not seen with Orai1 WT. I would expect a similar effect if the prepulse goes to +30mVm and is applied for a longer time interval providing sufficient time to decrease intracellular Ca<sup>2+</sup> concentrations. Additionally, what will the 2-step inactivation protocol look like for 8mM BAPTA? Since BAPTA is removing also local Ca<sup>2+</sup>, the CDI should probably be not different/less pronounced in the 2nd step.</p></disp-quote><p>Increasing the duration at +30 mV does not make any difference as recovery from inactivation occurs over time scales that are much faster than the 200 ms inter-pulse time as shown in Figure 1 in the essential revisions response. This is consistent with the very early findings of Zweifach and Lewis (1995) who showed that recovery from CDI occurs with time constants of 7 and 75 ms and is nearly complete by ~200 ms (in their recording, the recovery potential was -12 mV compared to +30 mV or +100 mV in our experiments) (Zweifach and Lewis, 1995). In our tests, we have found that recovery of CDI in T92W also occurs rapidly and equilibrates with inactivation. Extending the duration at +30 mV to 3 s (see below) offered no added benefit as the channels are already at equilibrium between open and inactivated states (with the equilibrium set by the Ca influx occurring at +30 mV). What was needed is to reduce submembrane [Ca] further, which could only be achieved by furthering depolarizing the recovery potential to reduce the driving force for Ca<sup>2+</sup> influx and therefore the submembrane [Ca<sup>2+</sup>] even below what occurs at +30 mV. This is what we tried to accomplish by using the +100 mV recovery pulse.</p><p>We have added the results for 8 mM BAPTA data into Figure 6 —figure supplement 1A. The new data show that there is still recovery that happens in BAPTA but it is less than that seen in EGTA as the membrane holding potential is further depolarized. This is because with BAPTA, there is still substantial CDI that occurs during the hyperpolarizing steps indicating that with this buffering, resting inactivation at the holding potential (+30 mV) is less than what occurs in EGTA. As a result of reduced resting inactivation, there is therefore less need for the membrane potential to be further depolarized to promote recovery from CDI.</p><disp-quote content-type="editor-comment"><p>A recent study (PMID: 34796201) reported on the impact of L138F in the Orai channel using MD simulations. They discovered two local but essential conformational changes they supposed to be key to the activation. On the one hand, a rotation of L138 and on the other hand a counter-clockwise rotation of F99, resulting in higher hydration. Could you discuss these findings in addition or even find a correlation with your study?</p></disp-quote><p>In this MD simulation study by Zhang et al., the authors found that in the dOrai L210F (human L138F Orai1) mutant, the introduced Phe side-chain is stabilized in a clockwise rotated state compared to in WT channels. This conformational change is associated with opening of the hydrophobic gate in the pore through counter-clockwise rotation of TM1 as previously proposed (Bulla et al., 2019; Yamashita et al., 2017; Yeung et al., 2018) as well as inner pore dilation as shown in other constitutively active channels (Dong et al., 2019; Frischauf et al., 2017; Hou et al., 2020). Although our current study does not directly examine whether or not the L138F side-chain is rotated compared to the WT L138 residue, both studies implicate L138-TM1 interactions are critical for determining the outer and inner pore conformations. Based on mutational analysis, we hypothesize that this effect is governed by intersubunit L138-T92 steric interactions (Figure 9C). In this context, a clockwise rotation of L138F as suggested by Zhang et al. would increase the steric interaction and is fully compatible with our data. We have now revised the Discussion to include this information.</p><disp-quote content-type="editor-comment"><p>The idea that the Ca<sup>2+</sup> sensor is likely located within the Orai1 protein itself is compatible with the T92W/L138F mutants, but how will it explain the missing CDI of Orai1 P245L?</p></disp-quote><p>We agree that this is a conundrum that needs more work to be understood. Orai1 P245L channels, like all other previously reported gain-of-function mutants (e.g. H134), do not exhibit CDI but rather have stable or slightly potentiating current over 100 ms hyperpolarization steps. This demonstrates that Orai1 can be activated through mutation of other TM2-4 residues without exhibiting inactivation. To our knowledge, the T92-L138 locus is the only area within Orai1 reported to date where mutations can both open the channel and unmask STIM-independent inactivation. It is not clear whether the unique ability of T92-L138 mutants to inactivate is due to trapping the channel in a conformation further “downstream” to the STIM1-gated state or whether activation and inactivation are controlled by two separate pathways. However, we hypothesize that the proximity of the T92-L138 locus to inner pore residues which play a key role in regulating CDI (Mullins et al., 2016, Figure 7), contributes to this process.</p><disp-quote content-type="editor-comment"><p>Reviewer #3 (Recommendations for the authors):</p><p>Tryptophan is one of three aromatic amino acids that contain a benzene ring in their side chains; the other two being Phe and Tyr. Thus, the claim that &quot;the introduction of a large benzene ring at L138 likely leads to a steric clash of the exogenous Phe or Tyr side-chains with residues in TM1 causing channel activation&quot; seems inconsistent with their Trp substitution. In the case of Trp, the benzene is fused to a pyrrole ring.</p></disp-quote><p>Thank you for raising this point. We also initially found the result of Trp to be puzzling. However, we later found that local protein conformation surrounding T92 appears to be very sensitive to the exact locations of the side chain atoms. For example, T92L and T92I exhibit different levels of inactivation despite being the same size. We have also performed other T92-L138 double mutant experiments and seen that the phenotypes are sensitive to the positions of individual atoms (e.g. T92C/L138S is different from T92S/L138C). Because the benzene ring of Trp is fused distally to the pyrrole ring, this might create enough distance away from the α atom to avoid the steric clash seen in Phe and Tyr.</p><disp-quote content-type="editor-comment"><p>In all hydrophobicity plots, His could have two points (protonated and deprotonated); the authors should specify which one is plotted and why they believe this is the protonation state in their electrophys measurements.</p></disp-quote><p>Because we did not actively try to control the protonation state of introduced histidines, we cannot be certain the fraction of protonated vs. deprotonated forms. However, since T92-L138 is closer to the intracellular surface (pH ~7), it is more likely in deprotonated form and possibly forming hydrogen bonds with neighboring residues.</p><disp-quote content-type="editor-comment"><p>Supplementary Figure 3 – Not only did R and D result in a loss of function but also G and P. The authors should comment on why they think this may be the case.</p></disp-quote><p>In the case of Gly and Pro mutations, one possibility is that these substitutions disrupt the α helical structure of the transmembrane domains.</p><disp-quote content-type="editor-comment"><p>Figure 4 – Why isn't the same intracellular Ca<sup>2+</sup> chelator used for WT and mutants in this set of data?</p></disp-quote><p>The data for similar concentrations of EGTA and BAPTA are actually shown in Figure 5. In Figure 4, we used conditions that showed CDI in the WT and T92W mutants as this is the very first introduction to the idea that the T92W mutant shows CDI. In Figure 5, we present the results at the same concentrations of EGTA and BAPTA for both mutants. In EGTA, T92W CDI is essentially maxed out and channels are essentially at equilibrium between inactivated and open states, whereas in BAPTA which is a stronger/better buffer, inactivation is restored and clearly visible during hyperpolarizing steps. This is explained in terms of the enhanced Ca-sensitivity for CDI of T92W Orai1 channels.</p><disp-quote content-type="editor-comment"><p>In Figure 4B and D, are the DVF panels mixed up, or are the DVF plots in 4C and 4E mixed up? – In the current layout, it appears that L138F shows a time-dependent inactivation in the DVF buffer whereas the T92W does not, but what is the basis for this inactivation if buffers are DVF? Statistical comparisons need to be made in 4C and 4E and differences interpreted.</p></disp-quote><p>No the plots are as shown and not mixed up. There is no inactivation at all in DVF solutions in any of the conditions, consistent with the Ca<sup>2+</sup> dependence of the CDI process. The errors bars in Figure 4 are indeed present and if not visible, they are smaller than the size of the dots. We have added statistics to the data as suggested.</p><disp-quote content-type="editor-comment"><p>The authors should describe/discuss the data in Figure 5E.</p><p>It is not totally clear to me why comparisons between WT and T92W mutant are not being made at 8 mM BAPTA chelator for both. The equations are comparing 10 mM EGTA (WT) with 8 mM BAPTA (T92W). Does the increased Ca<sup>2+</sup> sensitivity of T92W hold when doing these comparisons using the same chelator?</p></disp-quote><p>We apologize for not making this clearer. This was done to provide the widest variation in the local buffering capacity of the buffer used. Please see our response to point 2 of essential revisions and to reviewer 2 for detailed explanation of this.</p><disp-quote content-type="editor-comment"><p>Page 18 – The authors discuss the analysis of Figure 6 in terms of a simple reaction scheme, but I don't see any fitted data or any fitted rate constants. Where is the fitted data shown and conformance to the reaction scheme to support the conclusions made by this analysis?</p></disp-quote><p>As explained in the essential revisions, this is not actually currently possible with the available information since we do not have any realistic measures of the rate constants for entry of channels into inactivation states or the recovery of channels from inactivation states (into open or other closed states). The simple scheme with one closed, one open, and one inactivated state that we used in the manuscript was done purely for conceptual understanding of what is likely to happen when the occupancy of channels in different states is altered. The real-life situation is likely to be far more complex with multiple Ca<sup>2+</sup> binding steps (for each of the six subunits), multiple STIM binding steps to the channel, and potentially several inactivated states (as already suggested by the presence of more than one exponential for the CDI process both in WT and in T92W channels). The Scheme was provided to illustrate what is likely to be the fundamental steps of CDI and what might happen if the occupancy in the inactivated states increases. It is not meant to be a quantitative reproduction of the data.</p><p>We have moved the scheme to the Discussion (from the Results) to avoid confusion on this issue.</p><disp-quote content-type="editor-comment"><p>Figure 7 – If not from W76, R83, and Y80 where is the additional/residual inactivation coming from after deletion of 267-301? What happens if you delete the N- and C-termini; do you completely abrogate CDI?</p></disp-quote><p>There are acidic residues in the cytosolic loop connecting TM2 to TM3 which could be potential sites. Moreover, our previous work has also suggested a role for Ca binding within the pore itself (Yamashita et al., 2007). Those are possibilities. The role of these sites for T92W CDI will be addressed in follow-up studies.</p><p>We have deleted the N-terminus and as seen with the K85E mutation, deleting the N-terminus abolishes T92W channel gating and there is no current left to study. This is shown in Figure 7 —figure supplement 1A,C.</p><disp-quote content-type="editor-comment"><p>Figure 8 – Is it possible that Ca<sup>2+</sup> interactions with STIM1, specifically the ID domain, may be buffering and normalizing the CDI response? Can this be tested with ID domain mutants?</p></disp-quote><p>This is certainly a possibility. Tests of the ID mutants will be the topic of a future study and we definitely plan to mutate out the ID region to examine STIMs ability to normalize CDI. We want to share that our preliminary tests indicate that the regulation by STIM1 is not as simple as the ID domain and there appear to be contributions from outside the ID region. These studies are outside the scope of the paper and will be systematically addressed in the next study.</p><disp-quote content-type="editor-comment"><p>Figure 8 – Supplement 1 – Can the authors comment on why the voltage dependence of CDI is lost for the Y80E/T92W mutant, even in the presence of STIM1?</p></disp-quote><p>There is currently no MD simulation evidence, and these need to be done, but please also see additional response to Essential revisions point 3.</p><disp-quote content-type="editor-comment"><p>Figure 9 – Is there any evidence in past MD simulations by this group that L138 and H134 apply to oppose push-pull forces to TM1?</p><p>Some sample double-exponential fits of the inactivation profiles should be shown for the mutants and WT Orai1 channels. Differences in the goodness of fits may point to differences in CDI mechanisms.</p><p>It is suggested that &quot;a change in Ca<sup>2+</sup> sensitivity of CDI could presumably occur via STIM1-driven change in the conformation of the domain containing the Ca<sup>2+</sup> binding site at the Orai1 C-terminus.&quot; The authors should consider and discuss how Ca<sup>2+</sup> binding to the ID when STIM1 is coupled to Orai1 channels may affect the Ca<sup>2+</sup> sensitivity of CDI.</p></disp-quote><p>Thank you for the suggestion, we have added a Supplementary Figure (Figure 4, figure Supplement 2) with the fits. We have also incorporated some additional discussion of Ca<sup>2+</sup> binding to the STIM1 ID domain into the Discussion but as noted, this is the topic of an ongoing study, and this question will be addressed in detail in a follow-up paper.</p><p>References</p><p>Bulla, M., Gyimesi, G., Kim, J.H., Bhardwaj, R., Hediger, M.A., Frieden, M., and Demaurex, N. (2019). ORAI1 channel gating and selectivity is differentially altered by natural mutations in the first or third transmembrane domain. J Physiol 597, 561-582.</p><p>Dong, H., Zhang, Y., Song, R., Xu, J., Yuan, Y., Liu, J., Li, J., Zheng, S., Liu, T., Lu, B., Wang, Y., and Klein, M.L. (2019). Toward a Model for Activation of Orai Channel. iScience 16, 356-367.</p><p>Frischauf, I., Litvinukova, M., Schober, R., Zayats, V., Svobodova, B., Bonhenry, D., Lunz, V., Cappello, S., Tociu, L., Reha, D., Stallinger, A., Hochreiter, A., Pammer, T., Butorac, C., Muik, M., Groschner, K., Bogeski, I., Ettrich, R.H., Romanin, C., and Schindl, R. (2017). Transmembrane helix connectivity in Orai1 controls two gates for calcium-dependent transcription. Sci Signal 10.</p><p>Hou, X., Outhwaite, I.R., Pedi, L., and Long, S.B. (2020). Cryo-EM structure of the calcium release-activated calcium channel Orai in an open conformation. <italic>ELife</italic> 9.</p><p>Hou, X., Pedi, L., Diver, M.M., and Long, S.B. (2012). Crystal Structure of the Calcium ReleaseActivated Calcium Channel Orai. Science 338, 1308-1313.</p><p>Neher, E. (1986). Concentration profiles of intracellular calcium in the presence of a diffusible chelator.. Experimental Brain Research Series 14, 80-96.</p><p>Neher, E., and Augustine, G.J. (1992). Calcium gradients and buffers in bovine chromaffin cells. J Physiol 450, 273-301.</p><p>Yamashita, M., Navarro-Borelly, L., McNally, B.A., and Prakriya, M. (2007). Orai1 mutations alter ion permeation and ca<sup>2+</sup>-dependent fast inactivation of CRAC channels: evidence for coupling of permeation and gating. J Gen Physiol 130, 525-540.</p><p>Yamashita, M., Yeung, P.S., Ing, C.E., McNally, B.A., Pomes, R., and Prakriya, M. (2017). STIM1 activates CRAC channels through rotation of the pore helix to open a hydrophobic gate. Nat Commun 8, 14512.</p><p>Yeung, P.S., Yamashita, M., Ing, C.E., Pomes, R., Freymann, D.M., and Prakriya, M. (2018). Mapping the functional anatomy of Orai1 transmembrane domains for CRAC channel gating. Proc Natl Acad Sci U S A 115, E5193-E5202.</p><p>Zweifach, A., and Lewis, R.S. (1995). Rapid inactivation of depletion-activated calcium current (ICRAC) due to local calcium feedback. J Gen Physiol 105, 209-226.</p></body></sub-article></article>