<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.2 20190208//EN"  "JATS-archivearticle1-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">83373</article-id><article-id pub-id-type="doi">10.7554/eLife.83373</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Biochemistry and Chemical Biology</subject></subj-group></article-categories><title-group><article-title>Z-REX uncovers a bifurcation in function of Keap1 paralogs</article-title></title-group><contrib-group><contrib contrib-type="author" equal-contrib="yes" id="author-144242"><name><surname>Van Hall-Beauvais</surname><given-names>Alexandra</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-2515-5191</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-292677"><name><surname>Poganik</surname><given-names>Jesse R</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="other" rid="fund4"/><xref ref-type="other" rid="fund5"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-292678"><name><surname>Huang</surname><given-names>Kuan-Ting</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-7057-1448</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-144243"><name><surname>Parvez</surname><given-names>Saba</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="other" rid="fund6"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-192129"><name><surname>Zhao</surname><given-names>Yi</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-6049-1943</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-144786"><name><surname>Lin</surname><given-names>Hong-Yu</given-names></name><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-192131"><name><surname>Liu</surname><given-names>Xuyu</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf2"/></contrib><contrib contrib-type="author" corresp="yes" id="author-292679"><name><surname>Long</surname><given-names>Marcus John Curtis</given-names></name><email>marcusjohncurtis.long@unil.ch</email><xref ref-type="aff" rid="aff8">8</xref><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf2"/></contrib><contrib contrib-type="author" corresp="yes" id="author-144040"><name><surname>Aye</surname><given-names>Yimon</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-1256-4159</contrib-id><email>yimon.aye@epfl.ch</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02s376052</institution-id><institution>Swiss Federal Institute of Technology Lausanne</institution></institution-wrap><addr-line><named-content content-type="city">Lausanne</named-content></addr-line><country>Switzerland</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/04b6nzv94</institution-id><institution>Division of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School</institution></institution-wrap><addr-line><named-content content-type="city">Boston</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03r0ha626</institution-id><institution>Department of Pharmacology and Toxicology, College of Pharmacy, University of Utah</institution></institution-wrap><addr-line><named-content content-type="city">Salt Lake City</named-content></addr-line><country>United States</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00sdcjz77</institution-id><institution>BayRay Innovation Center, Shenzhen Bay Laboratory</institution></institution-wrap><addr-line><named-content content-type="city">Shenzhen</named-content></addr-line><country>China</country></aff><aff id="aff5"><label>5</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00mcjh785</institution-id><institution>Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University</institution></institution-wrap><addr-line><named-content content-type="city">Xiamen</named-content></addr-line><country>China</country></aff><aff id="aff6"><label>6</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0384j8v12</institution-id><institution>School of Chemistry, The University of Sydney</institution></institution-wrap><addr-line><named-content content-type="city">Sydney</named-content></addr-line><country>Australia</country></aff><aff id="aff7"><label>7</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/046fa4y88</institution-id><institution>The Heart Research Institute, Newtown</institution></institution-wrap><addr-line><named-content content-type="city">Newtown</named-content></addr-line><country>Australia</country></aff><aff id="aff8"><label>8</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/019whta54</institution-id><institution>Department of Biochemistry, Faculty of Biology and Medicine, University of Lausanne</institution></institution-wrap><addr-line><named-content content-type="city">Lausanne</named-content></addr-line><country>Switzerland</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Cooper</surname><given-names>Jonathan A</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/007ps6h72</institution-id><institution>Fred Hutchinson Cancer Research Center</institution></institution-wrap><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Cooper</surname><given-names>Jonathan A</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/007ps6h72</institution-id><institution>Fred Hutchinson Cancer Research Center</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><author-notes><fn fn-type="con" id="equal-contrib1"><label>†</label><p>These authors contributed equally to this work</p></fn></author-notes><pub-date publication-format="electronic" date-type="publication"><day>27</day><month>10</month><year>2022</year></pub-date><pub-date pub-type="collection"><year>2022</year></pub-date><volume>11</volume><elocation-id>e83373</elocation-id><history><date date-type="received" iso-8601-date="2022-09-09"><day>09</day><month>09</month><year>2022</year></date><date date-type="accepted" iso-8601-date="2022-10-12"><day>12</day><month>10</month><year>2022</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint at bioRxiv.</event-desc><date date-type="preprint" iso-8601-date="2022-10-12"><day>12</day><month>10</month><year>2022</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2022.10.10.511579"/></event></pub-history><permissions><copyright-statement>© 2022, Van Hall-Beauvais, Poganik, Huang et al</copyright-statement><copyright-year>2022</copyright-year><copyright-holder>Van Hall-Beauvais, Poganik, Huang et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-83373-v4.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-83373-figures-v4.pdf"/><abstract><p>Studying electrophile signaling is marred by difficulties in parsing changes in pathway flux attributable to on-target, vis-à-vis off-target, modifications. By combining bolus dosing, knockdown, and Z-REX—a tool investigating on-target/on-pathway electrophile signaling, we document that electrophile labeling of one zebrafish-Keap1-paralog (zKeap1b) stimulates Nrf2- driven antioxidant response (AR) signaling (like the human-ortholog). Conversely, zKeap1a is a dominant-negative regulator of electrophile-promoted Nrf2-signaling, and itself is nonpermissive for electrophile-induced Nrf2-upregulation. This behavior is recapitulated in human cells: (1) zKeap1b-expressing cells are permissive for augmented AR-signaling through reduced zKeap1b–Nrf2 binding following whole-cell electrophile treatment; (2) zKeap1a-expressing cells are non-permissive for AR-upregulation, as zKeap1a–Nrf2 binding capacity remains unaltered upon whole-cell electrophile exposure; (3) 1:1 ZKeap1a:zKeap1b-co-expressing cells show no Nrf2-release from the Keap1-complex following whole-cell electrophile administration, rendering these cells unable to upregulate AR. We identified a zKeap1a-specific point-mutation (C273I) responsible for zKeap1a’s behavior during electrophilic stress. Human-Keap1(C273I), of known diminished Nrf2-regulatory capacity, dominantly muted electrophile-induced Nrf2-signaling. These studies highlight divergent and interdependent <italic>electrophile signaling</italic> behaviors, despite conserved <italic>electrophile sensing</italic>.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>Keap1/Nrf2 antioxidant response</kwd><kwd>electrophile signaling</kwd><kwd>paralog-specific signaling</kwd><kwd>zebrafish</kwd><kwd>REX technologies</kwd><kwd>covalent drug mode-of-action</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Zebrafish</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100004336</institution-id><institution>Novartis FreeNovation</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Aye</surname><given-names>Yimon</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100000781</institution-id><institution>European Research Council</institution></institution-wrap></funding-source><award-id>101043303</award-id><principal-award-recipient><name><surname>Aye</surname><given-names>Yimon</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001703</institution-id><institution>Swiss Federal Institute of Technology Lausanne</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Aye</surname><given-names>Yimon</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>NIH T32GM008500</award-id><principal-award-recipient><name><surname>Poganik</surname><given-names>Jesse R</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution>AHA predoctoral Fellowship</institution></institution-wrap></funding-source><award-id>17PRE33670395</award-id><principal-award-recipient><name><surname>Poganik</surname><given-names>Jesse R</given-names></name></principal-award-recipient></award-group><award-group id="fund6"><funding-source><institution-wrap><institution>HHMI International Fellow</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Parvez</surname><given-names>Saba</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Two zebrafish Keap1-paralogs are equally adept at electrophile-sensing but manifest divergent and co-regulatory electrophile-signaling behaviors.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Many proteins are now implicated in sensing native reactive metabolites such as lipid-derived electrophiles (LDEs; <xref ref-type="bibr" rid="bib42">Schopfer et al., 2011</xref>). The resulting modified states impinge on cell physiology and behavior (<xref ref-type="bibr" rid="bib34">Parvez et al., 2018</xref>; <xref ref-type="bibr" rid="bib9">Jacobs and Marnett, 2010</xref>). Electrophile-responsive proteins span a large range in reactivity—from sensors engaging sluggishly with LDEs to those reacting faster than expected based on the inherent reactivity of cysteine (<xref ref-type="bibr" rid="bib34">Parvez et al., 2018</xref>). Many state-of-the-art target-ID methods agree that the number of highly LDE-reactive proteins in the proteome is relatively small (<xref ref-type="bibr" rid="bib48">Wang et al., 2014</xref>). Thus reactive-electrophile sensors, or privileged first responders (PFRs) <xref ref-type="bibr" rid="bib20">Liu et al., 2019</xref>, have interesting properties warranting further investigation.</p><p>Our laboratory established T-REX—the only platform that interrogates with high spatiotemporal resolution individual PFR-specific LDE-modification in live cells and organisms (<xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib25">Long et al., 2017c</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>). T-REX can probe consequences of on-target PFR-modification, at an accurately-determined ligand/target-binding stoichiometry, ligand chemotype, and spatiotemporal context of target engagement. These features contrast with traditional bolus electrophile-dosing methods, that simultaneously modify many proteins, and typically give readouts that cannot be clearly linked to labeling of specific protein(s), and are limited in assignment of individual ligand occupancy. T-REX has shown that electrophile signaling on PFRs typically functions through phenotypically-dominant pathways, such as gain-of-function or dominant-negative signaling <xref ref-type="bibr" rid="bib34">Parvez et al., 2018</xref>. Several PFRs discovered were not enzymes, opening a new dimension into how PFRs can function to orchestrate signal propagation. Furthermore, sensor residues within PFR-enzymes are surprisingly not essential for enzyme-activity, or even close to the active site. We further demonstrated recently that understanding precision electrophile signaling is a new means to uncover novel pathway players <xref ref-type="bibr" rid="bib38">Poganik et al., 2021</xref> and intersections <xref ref-type="bibr" rid="bib24">Long et al., 2017b</xref>, protein-targets <xref ref-type="bibr" rid="bib25">Long et al., 2017c</xref>; <xref ref-type="bibr" rid="bib51">Zhao et al., 2018</xref>; <xref ref-type="bibr" rid="bib44">Surya et al., 2018</xref>; <xref ref-type="bibr" rid="bib52">Zhao et al., 2022</xref>; <xref ref-type="bibr" rid="bib36">Poganik et al., 2019</xref> and chemically actionable sites (<xref ref-type="bibr" rid="bib21">Liu et al., 2020</xref>) not traditionally considered drug discovery fare (<xref ref-type="bibr" rid="bib27">Long et al., 2019</xref>).</p><p>How such sensing and dominant-signaling behaviors come about remain poorly understood. These gaps in our understanding can be traced to the fact that good model systems for reactive electrophile signaling are just coming into focus and the tools to study ‘on-target’ electrophile signaling have only existed for a few years. It thus remains critical to interrogate known and established signaling pathways more thoroughly using a range of different methods and comparing the outputs and conclusions that can be drawn.</p><p>One of the most venerable LDE-signal-responsive pathways is the Keap1/Nrf2-antioxidant response (AR) axis (<xref ref-type="bibr" rid="bib6">Hayes and Dinkova-Kostova, 2014</xref>), wherein dimeric-Keap1 is <italic>both</italic> a cytosolic anchor <italic>and</italic> an essential component of the E3-ligase complex responsible for the degradation of the key AR-promoting transcription factor, Nrf2. <italic>Both</italic> functions of Keap1 serve to inhibit Nrf2. When Keap1 is LDE-modified, Keap1 function is compromised and active Nrf2 accumulates, promoting AR. Two main models have been proposed for Nrf2/AR-axis: inhibition of Nrf2 degradation through the formation of an abortive Nrf2-Keap1 complex <xref ref-type="bibr" rid="bib50">Zhang and Chapman, 2020</xref>; and release of Nrf2 from Keap1 <xref ref-type="bibr" rid="bib11">Kensler et al., 2007</xref>, causing inhibition of Keap1 and a boost in free Nrf2 concentrations. The Keap1/Nrf2 pathway is a primary target of some drugs in clinic, for example, the blockbuster multiple sclerosis drug, dimethyl fumarate (Tecfidera) (<xref ref-type="bibr" rid="bib38">Poganik et al., 2021</xref>; <xref ref-type="bibr" rid="bib37">Poganik and Aye, 2020</xref>; <xref ref-type="bibr" rid="bib2">Cuadrado et al., 2019</xref>; <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>) compounds causing release of Nrf2 from Keap1 are also under investigation <xref ref-type="bibr" rid="bib39">Raghunath et al., 2019</xref>. However, consistent with the pleiotropic nature of electrophiles, it was not until recently that it was unambiguously shown that substoichiometric modification of Keap1-alone is sufficient to promote gain-of-function Nrf2/AR- signaling (<xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib38">Poganik et al., 2021</xref>; <xref ref-type="bibr" rid="bib24">Long et al., 2017b</xref>; <xref ref-type="bibr" rid="bib32">Parvez et al., 2015</xref>; <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref>). Thus, despite the importance of the Keap1/Nrf2-pathway, we are far from unraveling all its mechanistic mysteries.</p><p>One major roadblock is that empirical systems to study Keap1/Nrf2 signaling are limited. Experiments are typically conducted in cancer cells, which have undergone rewiring of their AR and other pathways that feedback with AR. For instance, aberrant Wnt-signaling proteins, often present in cancer cells, rewire the interaction between AR and Wnt signaling (<xref ref-type="bibr" rid="bib24">Long et al., 2017b</xref>). Furthermore, mutants that exert genetically-predictable effects on AR, in terms of dominant-suppression of AR-signaling upon electrophile exposure, would also be a useful addition to the armory with which to study AR, particularly in cancer cells. However, we have often found that mutation of several postulated electrophile-sensor residues within human Keap1 (hKeap1), did not ablate electrophile sensing, and did not ablate pathway-activation upon hKeap1(mutant)-specific labeling (<xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib32">Parvez et al., 2015</xref>; <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref>). Nrf2 mutations are also hampered by complex roles that Nrf2 plays in development and other processes loosely linked to AR (<xref ref-type="bibr" rid="bib30">Mills et al., 2020</xref>).</p><p>To avoid several of the above issues, we here demonstrate a generalizable means to study on-target electrophile signaling along the druggable Keap1/Nrf2/AR-axis in zebrafish (Z-REX) (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). The Keap1/Nrf2/AR-axis and consequent AR-mediated gene upregulation have been previously studied in zebrafish models, but only under bolus electrophile dosing. Using Z-REX, we explore how different segments of the embryo respond to bolus LDE exposure vs. Z-REX-assisted on-target LDE-delivery in vivo. Intriguingly, under Z-REX and under bolus dosing, AR-response is mounted in the fish tail: the head is recalcitrant to AR-upregulation. Targeted knockdown of different zebrafish paralogs of Keap1 (zKeap1) identified that zKeap1a and zKeap1b are <italic>both</italic> inhibitors of AR in the basal (i.e. non-electrophile-stimulated) state, but have functionally diverged in their response to electrophiles: zKeap1b is permissive for electrophile-stimulated AR-upregulation similarly to hKeap1; zKeap1a is unresponsive to electrophile-stimulated AR-induction, even in the presence of equal amounts of Keap1b. Such contrasted electrophile sensing/signaling between these paralogs was recapitulated in cell culture. These data collectively illuminate intricate on-target-modification-specific nuances of electrophile signaling. They further highlight that for some PFRs electrophile, signaling modalities are partially uncoupled from electrophile sensing.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Z-REX directly evaluates the functional consequences of reactive electrophile–target engagement in live zebrafish embryos at a specific time.</title><p>(<bold>A</bold>) This work investigates the biological impacts on druggable antioxidant response (AR) pathway at the organismal level following Z-REX-enabled hKeap1-specific electrophilic modification in live zebrafish embryos and compares these results to those obtained from bulk reactive electrophile exposure. In the process, novel paralog-specific regulation of AR was discovered. <italic>Inset, lower right:</italic> Structures of alkyne-functionalized lipid-derived electrophiles (LDEs). Unless otherwise specified, all LDEs deployed were alkyne-functionalized. See also <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>. (<bold>B</bold>) <italic>Left:</italic> Punnett square denoting how cross of wild-type zebrafish with a transgenic strain (homozygous, or heterozygous, not shown) ensures that all transgenic progeny are heterozygous for the AR-reporter GFP-gene. <italic>Right:</italic> Using whole-mount immunofluorescence (IF) imaging, <italic>Tg(gstp1:GFP</italic>) heterozygotes were quantified separately for AR levels in head and tail regions indicated in green. Note: GFP expression was detected using immunofluorescence (IF) in fixed fish, analyzed by red fluorescence. The IF protocol is used because auto-fluorescence in the green channel is high in fish and prevents accurate quantitation and this avoids concerns regarding effects of electrophile on GFP fluorescence. (For whole-head/whole-tail separation in qRT-PCR analysis, see Figure 1C, inset). (<bold>C</bold>) <italic>Inset, left:</italic> Illustration for head vs. tail qRT-PCR analysis, where the fish were mechanically separated as marked by the dashed line. <italic>Right:</italic> The relative levels of mRNA of each paralog were assessed using qRT-PCR following physical separation of head and tail (see inset on left). Number of embryos analyzed: Head, all paralogs (6); Tail zKeap1a and zKeap1b (10), zNrf2a (5), zNrf2b (6). Note: these segments contain tissue other than the areas that express the AR-reporter GFP-gene. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig1-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig1-v4.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Halo-•-hKeap1-(2xHA) fusion protein deployed in Z-REX is ubiquitously expressed in fish to a similar level as endogenous zKeap1-paralogs.</title><p>(<bold>A</bold>) Z-REX workflow (also see Appendix-Scheme 1): zebrafish embryos transiently expressing Halo-POI are treated with the bioinert and live-fish permeable Halo-targetable photocaged LDE-precursor (Ht-PreLDEs) <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib25">Long et al., 2017c</xref>. A hexyl chloride linker within the small-molecule photocaged precursor selectively binds Halo in vivo. Low-energy UV light (365 nm, 5 mW/cm<sup>2</sup>, 1–4 min) liberates LDE in proximity of Halo-POI <xref ref-type="bibr" rid="bib22">Long et al., 2016</xref>, resulting in POI modification provided POI is a kinetically-privileged first responder to the LDE <xref ref-type="bibr" rid="bib34">Parvez et al., 2018</xref>; <xref ref-type="bibr" rid="bib20">Liu et al., 2019</xref>. This concept enables a direct and precise evaluation of target engagement in vivo under electrophile-limited conditions. (<bold>B</bold>) Representative electrophilic covalent small-molecule therapeutics and candidates housing Michael acceptors (see text for details) <xref ref-type="bibr" rid="bib37">Poganik and Aye, 2020</xref>; <xref ref-type="bibr" rid="bib2">Cuadrado et al., 2019</xref>. (<bold>C</bold>) IF in zebrafish larvae injected with Halo-•-hKeap1-(2xHA) mRNA and probed with indicated antibodies conjugated to AlexaFluor568 shows ubiquitous expression of the indicated transgene and that Halo-•-hKeap1-(2xHA)-transgene expression levels are similar to those of endogenous Keap1. <italic>Top:</italic> Non-injected larvae; <italic>bottom:</italic> larvae derived from embryos injected with mRNA encoding transgene. The level of ectopic Halo-•-hKeap1-(2xHA) protein is comparable to endogenous Keap1. <italic>Inset</italic>: Quantitation of fluorescence intensity (i.e., Keap1 protein levels) in non-injected fish larvae and those ectopically expressing Halo-•-hKEAP1-(2xHA). Number of larvae evaluated: No injection: 10; Halo-•-Keap1-(2xHA): 5. (<bold>D</bold>) Quantification of affinity of Keap1-antibody to hKeap1 compared to the zebrafish paralogs. All Keap1 variants were expressed with a HaloTag in HEK293T cells. The Keap1 signal was normalized to the Halo signal to allow assessment of the relative sensitivity of our Keap1 antibody to each Keap1 variant. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig1s1sdata1"><label>Figure 1—figure supplement 1—source data 1.</label><caption><title>Full view blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig1-figsupp1-data1-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig1s1sdata2"><label>Figure 1—figure supplement 1—source data 2.</label><caption><title>Raw blot images.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig1-figsupp1-data2-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig1s1sdata3"><label>Figure 1—figure supplement 1—source data 3.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig1-figsupp1-data3-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig1-figsupp1-v4.tif"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 2.</label><caption><title>Halo-•-hKeap1-(2xHA) fusion protein expressed in fish is a functional antagonist of antioxidant response (AR) pathway.</title><p>(<bold>A</bold>) Ectopic Halo-•-hKeap1-(2xHA) is a functional negative-regulator of AR in zebrafish embryos. <italic><underline>Left panel:</underline></italic> Representative IF images in <italic>Tg(gstp1:GFP</italic>) embryos show a decrease in GFP signal intensity (immuno-stained with goat anti-GFP primary antibody and anti-goat secondary antibody conjugated with AlexaFluor568) in the tail of embryos injected with Halo-•-hKeap1-(2xHA)mRNA (<italic>bottom panel</italic>) relative to those injected with Halo mRNA alone (<italic>top panel</italic>). Arrows point to the region in the tail with upregulated AR. <italic><underline>Middle panel</underline>:</italic> Image quantitation was performed on the head/tail-regions illustrated in the <italic><underline>inset, on right</underline></italic>. Halo: n=22; Halo-•-hKeap1-(2xHA)-(2xHA): n=38. Note: the immunofluorescence (IF) protocol is used because auto-fluorescence in the green channel is high in fish and prevents accurate quantitation. (<bold>B</bold>)<italic><underline>Inset above</underline></italic>: Illustrating separation of whole-head and whole-tail prior to RNA isolation separately from head and tails, for qPCR analysis. qRT-PCR analysis of casper zebrafish larvae expressing Halo-•-hKeap1-(2xHA) mRNA shows a lower-level abundance of endogenous transcripts of AR-regulated genes compared to those injected with Halo mRNA alone. 2 hr post Z-REX, embryos were euthanized, head and tail separated before RNA extraction. Comparable to results from IF-imaging-data described elsewhere, transcript levels of AR-regulated endogenous genes in head are less responsive compared to the tail to Halo-•-hKeap1-(2xHA) injection. n=3 independent biological replicates and 2 technical replicates per sample. (<bold>C</bold>) Halo-•-hKeap1-(2xHA) overexpression, or Nrf2a-alone downregulation, is sufficient for complete AR-suppression in the tail. Quantitation of AR in tails (<italic>middle panel</italic>) or the heads (<italic>right panel</italic>) of <italic>Tg(gstp1:GFP</italic>) embryos co-injected with the indicated reagents. In the tail, co-injection of Nrf2a ATG MO and Nrf2b ATG MO does not suppress AR further than injection of Nrf2a ATG MO alone, demonstrating that Nrf2a downregulation is sufficient for complete AR suppression. A similar observation is reached for Nrf2a ATG MO and Halo-•-hKeap1-(2xHA) mRNA injection. Empty: Control MO1 (23); Nrf2a ATG MO (40); (Nrf2a+Nrf2 b) ATG MOs (24); Halo-•-hKeap1-(2xHA): Control MO1 (54); and Nrf2a ATG MO (43). All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig1s2sdata1"><label>Figure 1—figure supplement 2—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig1-figsupp2-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig1-figsupp2-v4.tif"/></fig><fig id="fig1s3" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 3.</label><caption><title>Validations of knockdown and MOs used by pathway response assessment and in vitro translation reporter analysis.</title><p>(<bold>A</bold>) Treatment with zNrf2 ATG/SPL-MOs results in AR-pathway suppression as expected. Representative IF images in <italic>Tg(gstp1:GFP</italic>) fish. Data show a decrease in GFP expression in embryos injected with Nrf2a and Nrf2b morpholinos (MO; 2 nL, 0.5 mM), either blocking protein translation (ATG MO) or splicing (SPL MO), relative to non-injected embryos or those injected with Control MOs (see Appendix). (<bold>B</bold>) zKeap1 ATG-MOs inhibit translation as expected. mRNA encoding the binding site of either zKeap1a or zKeap1b MOs upstream of an in-frame copy of the gene encoding Firefly luciferase (see Appendix) was generated. This mRNA was incubated with either control or corresponding MO for 5 min at room temperature, followed by addition to rabbit reticulocyte lysate. The sample was loaded into a white plate 96 well plate, and translated Firefly luciferase was quantified using standard methods. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig1s3sdata1"><label>Figure 1—figure supplement 3—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig1-figsupp3-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig1-figsupp3-v4.tif"/></fig><fig id="fig1s4" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 4.</label><caption><title>Validations of knockdown and MOs used by reverse transcription-PCR analysis.</title><p>(<bold>A–B</bold>) zKeap1a/b splice-blocking MOs inhibit zKeap1a/b-splicing expected. MOs (2 nl of 0.5 mM MO) targeting the indicated region of the zKeap1a/b-transcript were injected and RNA was isolated and reverse transcribed at 30hpf. Primers as indicated in the figures were used to amplify the targeted sites and the resulting PCR products were run on a gel. <italic><underline>Inset at right</underline></italic>: Bands corresponding to the correctly spliced product were quantitated using the Measure tool of image-J(NIH) (n=3 independent replicates). All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig1s4sdata1"><label>Figure 1—figure supplement 4—source data 1.</label><caption><title>Full view gel image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig1-figsupp4-data1-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig1s4sdata2"><label>Figure 1—figure supplement 4—source data 2.</label><caption><title>Raw gel image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig1-figsupp4-data2-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig1s4sdata3"><label>Figure 1—figure supplement 4—source data 3.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig1-figsupp4-data3-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig1-figsupp4-v4.tif"/></fig><fig id="fig1s5" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 5.</label><caption><title>Validations of knockdown and MOs used by protein expression level assessment.</title><p>Treatment with zKeap1 ATG/SPL-MOs results in reduced zKeap1 expression. (<bold>A</bold>) Representative images of zebrafish injected with the indicated MO (2 nl of 0.5 mM MO), fixed at 30 hpf, and stained with anti-Keap1. Scale bars, 500 μm. (<bold>B</bold>) IF data were quantified using the measure tool of Image-J(NIH) (mean ± sem; sample sizes analyzed: Control MO, n=908; zKeap1a ATG-MO, n=153; zKeap1a-SPL-MO, n=192; zKeap1b-SPL-MO, n=75; zKeap1a+zKeap1 b SPL-MOs, n=131; zKeap1a-SPL-MO+zKeap1b-ATG-MO, n=115). All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig1s5sdata1"><label>Figure 1—figure supplement 5—source data 1.</label><caption><title>quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig1-figsupp5-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig1-figsupp5-v4.tif"/></fig></fig-group></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Halo-hKeap1 is functionally active in zebrafish and expressed at similar levels to zKeap1</title><p>To enable delivery of the desired electrophile directly to Keap1, Z-REX requires ectopic expression of Halo-Keap1 in larval fish (<xref ref-type="fig" rid="fig1">Figure 1A</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>). Since Halo-hKeap1 has been proven to be amenable to on-target LDE-signaling studies primarily in cultured cells (<xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib24">Long et al., 2017b</xref>; <xref ref-type="bibr" rid="bib32">Parvez et al., 2015</xref>; <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref>; <xref ref-type="bibr" rid="bib4">Fang et al., 2013</xref>) and <italic>C. elegans</italic> (<xref ref-type="bibr" rid="bib47">Van Hall-Beauvais et al., 2018</xref>; <xref ref-type="bibr" rid="bib26">Long et al., 2018</xref>), we first demonstrated functionality of this fusion protein in fish. Following mRNA injection directly to the yolk sac at the 1–4 cell stage, the resulting expression of Halo-hKeap1 at 24 hr post fertilization (hpf) was: (<italic>1</italic>) ubiquitous, and (<italic>2</italic>) similar to the overall level of the endogenous zKeap1, since global Keap1-signal doubled in transgene-injected fish, relative to controls (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1C</xref>). <bold>Note:</bold> our Keap1-antibody detects hKeap1 with similar or higher efficiency to zKeap1a/b-paralogs-combined (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>). We next confirmed using two independent readouts (live-imaging and mRNA-analysis) that Halo-hKeap1 was functionally active. The imaging readout used the well-established transgenic AR-reporter strain, <italic>Tg(–3.5gstp1:GFP)/it416b</italic> <xref ref-type="bibr" rid="bib31">National BioResource Project Zebrafish, 2020</xref> [hereafter <italic>Tg(gstp1:GFP</italic>)] (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A</xref>). In this and all subsequent experiments with these reporter fish, adult <italic>Tg(gstp1:GFP</italic>) zebrafish were crossed with wild-type (wt) zebrafish to generate embryos for experimentation. This strategy ensures transgenic progeny maintain consistent zygosity (heterozygotes) and standardization of number of reporter alleles per transgenic fish (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Imaging data were further backed-up by qRT-PCR analysis of Nrf2/AR-driven endogenous downstream genes in Casper zebrafish (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2B</xref>). In both instances, a drop in overall basal AR and AR-driven genes was observed selectively in zebrafish injected with Halo-hKeap1 mRNA, compared to controls injected with Halo-mRNA alone (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A-B</xref>).</p></sec><sec id="s2-2"><title>Halo-hKeap1 manifests intriguing effects on AR in different segments of the fish</title><p>We observed during these validations differential AR-responsivity between the head and tail of the fish. This intriguing disparity was first measured in <italic>Tg(gstp1:GFP</italic>) fish, wherein ubiquitous Halo-hKeap1-expression led to AR-downregulation selectively in the tail (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A</xref>). This spatially-selective response was also observed in Halo-hKeap1-mRNA-injected Casper embryos using qRT-PCR, where the tail showed a more prominent attenuation in the AR-driven endogenous zebrafish genes, than the head (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2B</xref>). Thus, although the qRT-PCR and the reporter assays likely observe different pools of cells, at least in some instances, data from the reporter and qRT-PCR are in agreement.</p><p>To further demonstrate that hKeap1 functions in zebrafish in a zNrf2-dependent manner, we made use of the zNrf2a/b-MOs previously described by several independent laboratories <xref ref-type="bibr" rid="bib45">Timme-Laragy et al., 2012</xref>; <xref ref-type="bibr" rid="bib14">Kobayashi et al., 2002</xref>; <xref ref-type="bibr" rid="bib41">Sant et al., 2017</xref> and the resulting morphants in our hands also gave rise to the expected AR-suppression outcome in <italic>Tg(gstp1:GFP</italic>) fish tail (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2C</xref>; left panel, 1st vs. 2<sup>nd</sup> bars; and <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3A</xref>). This result is consistent with the data from Keap1-overexpression above, analyzed by both imaging and qRT-PCR analysis (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A-B</xref>), further validating the MOs. Upon Halo-hKeap1 overexpression in these zNrf2-depleted morphants, no further AR-suppression in the tail was noted (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2C</xref>; left panel: 1<sup>st</sup>-2<sup>nd</sup> vs. 4<sup>th</sup>-5<sup>th</sup> bars). This epistasis is strong evidence that hKeap1 and zNrf2 reside on the same axis, as required by the current model of Keap1/Nrf2/AR-signaling (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Furthermore, since hKeap1-expression had no effect on AR in the head in fish treated with control morpholinos (MOs) (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2C</xref>; right panel: 1<sup>st</sup> vs. 4<sup>th</sup> bar), as well as in non-MO-treated reporter fish (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2A</xref>: 3<sup>rd</sup> vs. 4<sup>th</sup> bar), there may be a dominant suppressor of AR in the head.</p></sec><sec id="s2-3"><title>Difference in head- vs. tail-AR-responsivity is principally due to zKeap1a expression</title><p>We examined zNrf2 and zKeap1 in the head and tail of the fish separately by qRT-PCR. (Consequences of expression levels of both paralogs—present in teleost fish due to a whole genome duplication event that occurred during their evolution—are also further examined below by paralog-specific-knockdown in fish and -overexpression in cell culture). <bold>Note:</bold> these data are, as illustrated in <xref ref-type="fig" rid="fig1">Figure 1C</xref> (inset), for the <italic>whole</italic> tail and <italic>whole</italic> head, and thus, do <italic>not</italic> likely reflect expression levels in specific tissues in the tail, e.g., where GFP, or other genes subsequently investigated for that matter, are expressed. The qRT-PCR analysis (<xref ref-type="fig" rid="fig1">Figure 1C</xref>) revealed that levels of both zNrf2a and zNrf2b were <italic>overall</italic> higher in the tail than the head. zNrf2b was a minor contributor to both segments of the fish and was almost undetectable in the head. Levels of zKeap1a were <italic>overall</italic> similar in the head and the tail, but zKeap1b was <italic>overall</italic> slightly depleted in the tail.</p><p>To investigate the function of zKeap1 paralogs and their effects on AR, we initially examined effects of their targeted-knockdown in <italic>Tg(gstp1:GFP</italic>) heterozygous embryos. The zKeap1a/b-MOs were first validated: (i) by in vitro translation reporter assay (for translation-blocking ATG-MOs) (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3B</xref>), (ii) by RT-PCR (for splice-blocking SPL-MOs) (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>), and (iii) by measuring depletion of signal by whole-mount immunofluorescence (for both types of MOs) (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref>). With these validations in hand, we naively expected zKeap1a-knockdown to increase AR. However, in the tail, only depletion of <italic>both</italic> zKeap1-paralogs increased AR (single knockdown was not effective at modulating AR) (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). More strikingly still, loss of zKeap1b decreased AR in the head, but knockdown of both zKeap1-paralogs increased AR as expected. These data indicate an intriguing, antagonistic interplay between the two zKeap1 alleles.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Assessments of AR-reporter in the fish tail vs head reveal differential roles of zKeap1a and zKeap1b.</title><p>Homozygous <italic>Tg(gstp1:GFP</italic>) fish were crossed with wt fish. Resulting heterozygous embryos were injected with the stated morpholino (MO) at the 1- to four-cell stage. (See experimental Workflow in <xref ref-type="fig" rid="app1scheme1">Appendix 1-Scheme 1</xref>). Image quantitation was performed on the head/tail-regions as illustrated. Note: GFP expression was detected using immunofluorescence (IF) in fixed fish, analyzed by red fluorescence. The IF protocol is used because auto-fluorescence in the green channel is high in fish and prevents accurate quantitation and IF avoids concerns regarding effects of electrophile on GFP fluorescence. ATG MOs used for single-MO injection, SPL MOs used for simultaneously knocking down zKeap1a and zKeap1b; see <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplements 3</xref>–<xref ref-type="fig" rid="fig1s5">5</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplements 1</xref>–<xref ref-type="fig" rid="fig2s2">2</xref> for MO validations and Appendix for MO sequences. Also see <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplements 1</xref>–<xref ref-type="fig" rid="fig1s5">5</xref>, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplements 1</xref>–<xref ref-type="fig" rid="fig2s2">2</xref>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>. (<bold>A</bold>) Quantitation of GFP expression (which indicates relative basal AR-levels) in the tail (left panel) and head (right) of <italic>Tg(gstp1:GFP</italic>) zebrafish larvae following MO-knockdown of the indicated zKeap1 and zNrf2 paralogs. No. embryos analyzed: Control MO (38), zNrf2a MO (32), zNrf2b MO (21), zKeap1a MO (21), zKeap1b MO (22), zKeap1a and zKeap1b MOs (29). (<bold>B</bold>) Quantitation of the relative <italic>fold change</italic> of AR level (GFP signal) in the tail (left panel) and head (right) following bulk electrophile (NE; see <xref ref-type="fig" rid="fig1">Figure 1A</xref> inset) exposure. No. embryos analyzed: Control MO (48), zNrf2a MO (27), zNrf2b MO (27), zKeap1a MO (24), zKeap1b MO (29), zKeap1a and zKeap1b MOs (20). All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig2-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig2-v4.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Validations of zKeap1a-ATG-MO.</title><p>zKeap1a-mRNA rescues the effects of MO knockdown. (Also see <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplements 3B</xref> and <xref ref-type="fig" rid="fig1s4">4</xref>,5). (<bold>A</bold>) Representative images of wildtype (WT) and <italic>Tg(gstp1:GFP</italic>) zebrafish at 8 hpf. (<bold>B</bold>) Representative images of zebrafish (co-)injected with the indicated MO and mRNA (2 nl of 0.2 mM zKeap1a-ATG-MO; 250 ng/μL Halo-TEV-zKeap1a mRNA), treated at 4 hpf with 10 μM NE (4 hr treatment period followed by image acquisition at 8 hpf). (<bold>C</bold>) GFP expression from the experiments in (<bold>B</bold>) was quantified using the measure tool of Image-J(NIH). Yolk sac was excluded from quantification (see sketches on top). Sample sizes analyzed: (left panel, DMSO-treated): Control MO, n=26; zKeap1a MO, n=18; zKeap1a MO + zKeap1 a mRNA, n=16; (right panel, NE-treated): Control MO, n=20; zKeap1 MO, n=35; zKeap1a MO + zKeap1 a mRNA, n=26. Fish age: 8 hpf. Scale bars, 500 μm. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig2s1sdata1"><label>Figure 2—figure supplement 1—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig2-figsupp1-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig2-figsupp1-v4.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Validations of zKeap1b-ATG-MO.</title><p>zKeap1b-mRNA rescues the effects of MO knockdown. (Also see <xref ref-type="fig" rid="fig1s3 fig1s4">Figure 1—figure supplements 3B, 4</xref> and <xref ref-type="fig" rid="fig1s5">5</xref>,). (<bold>A</bold>) Quantitation of GFP expression in the tail (<italic><underline>left panel</underline></italic>) and head (<italic><underline>right panel</underline></italic>) of zebrafish (co-)injected with the indicated MO and mRNA (2 nl of 0.25 mM zKeap1b-ATG-MO; 250 ng/μL Halo-TEV-zKeap1b mRNA). Sample sizes analyzed: Control MO, n=42; zKeap1b MO, n=36; zKeap1a MO + zKeap1 a mRNA, n=40. (<bold>B</bold>) Quantitation of the relative <italic>fold change</italic> of AR level (GFP signal) in the tail (<italic><underline>left panel</underline></italic>) and head (<italic><underline>right panel</underline></italic>) following bulk NE exposure at 30 hpf (20 μM, 4 h treatment period followed, by image acquisition at 36 hpf). Embryos were (co-)injected with MO and mRNA at 1–4 cell stage (2 nL of 0.25 mM zKeap1b-ATG-MO and 250 ng/μL Halo-TEV-zKeap1b mRNA). Sample sizes analyzed: Control MO, n=42; zKeap1b MO, n=39; zKeap1a MO + zKeap1 a mRNA, n=32. Fish age: 34 hpf. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig2s2sdata1"><label>Figure 2—figure supplement 2—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig2-figsupp2-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig2-figsupp2-v4.tif"/></fig></fig-group><p>Depletion of zNrf2a or zNrf2b (using the same MOs validated above <xref ref-type="bibr" rid="bib45">Timme-Laragy et al., 2012</xref>; <xref ref-type="bibr" rid="bib14">Kobayashi et al., 2002</xref>; <xref ref-type="bibr" rid="bib41">Sant et al., 2017</xref>), decreased AR in the tail, confirming their expected AR-regulatory roles (<xref ref-type="fig" rid="fig2">Figure 2A</xref> left panel, <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2C</xref>, <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3A</xref>). There was little overall change in AR in the head when either Nrf2-paralog was knocked down (<xref ref-type="fig" rid="fig2">Figure 2A</xref> right panel, <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3A</xref>).</p><p>We thus investigated how AR-upregulation was affected in the different morphants by treatment with a representative bioactive LDE, 2-nonenal (NE) (<xref ref-type="fig" rid="fig1">Figure 1A</xref> inset). No effect was observed on the response in the head, upon depleting either zNrf2-paralog (<xref ref-type="fig" rid="fig2">Figure 2B</xref> right panel), but the head was unresponsive to AR regulation (<xref ref-type="fig" rid="fig2">Figure 2A</xref> right panel), and thus, this result is unsurprising. (Note: NE and other electrophiles can label proteins in the head and tail, as we describe below). Consistent with a previous report on Nrf2a-defective fish <xref ref-type="bibr" rid="bib30">Mills et al., 2020</xref>, knockdown of zNrf2a suppressed the tail’s ability to mount AR in response to an electrophile challenge, whereas zNrf2b-knockdown led to a hyper-elevated AR-response in the tail (<xref ref-type="fig" rid="fig2">Figure 2B</xref> left panel). From the data in the tail, it is likely that overall zNrf2b countermands electrophile-induced AR-upregulation, whereas zNrf2a functions in mounting AR in response to electrophile stimulation. Similar data for some AR-related genes were previously reported for the zNrf2-paralogs <xref ref-type="bibr" rid="bib45">Timme-Laragy et al., 2012</xref>.</p><p>Since knockdown of zNrf2-paralogs did little to affect regulation of AR in the head, both in electrophile-stimulated and non-stimulated conditions (<xref ref-type="fig" rid="fig2">Figure 2A–B</xref>, right panels), we focused our subsequent investigations on how zKeap1a/b-knockdown affects LDE-induced AR. Previous overexpression studies have implied that zKeap1a (unresponsive) and zKeap1b (responsive) respond differently to different electrophiles, although these studies were performed via overexpression at early embryonic stages <xref ref-type="bibr" rid="bib15">Kobayashi et al., 2009</xref>. We found that NE-treatment of zKeap1a-depleted fish led to elevated AR in both head and tail (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). This effect was also observed in 8-hr old embryos. In this manifold, injection of zKeap1a-mRNA rescued effects of the MO (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). Unfortunately, zKeap1a-mRNA injection had minimal effect on older embryos, likely due to the stability of zKeap1a-mRNA, or possibly due to secondary effects incurred through ectopic expression of zKeap1a. Nonetheless, the fact that zKeap1a-knockdown was sufficient to rescue response to electrophile treatment in cells expressing GFP in the head (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, right panel) strongly implies that the presence of zKeap1a is responsible for ‘the head’s’ recalcitrance to mounting AR, following electrophile treatment. Similar, but less pronounced, effects were observed in the tail (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, comparing the difference in the 1st and 4th bars in the left panel, vs. corresponding bars in the right panel), likely because intrinsic expression of zKeap1a within the GFP-positive cells in the tail is relatively lower than that in the head. The same posit also explains why in the absence of zKeap1a knockdown, NE induced higher fold AR-upregulation in the tail than in the head (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, the 1st bars in the left vs. right panels). <bold>Note</bold>: the assessment of the mRNA-abundance of zKeap1a/b by qRT-PCR above (<xref ref-type="fig" rid="fig1">Figure 1D</xref>) represents global levels of allele expression in the two segments, but does not inform on levels in the GFP-positive cells used in the GFP-reporter assays. Thus, these data indicate that hypomorphism in NE-induced AR-upregulation in the tail is zKeap1a-dependent.</p><p>By contrast, in zKeap1b-knockdown fish, electrophile treatment elicited lower-fold AR-upregulation selectively in the tail (<xref ref-type="fig" rid="fig2">Figure 2B</xref> left panel). This effect could be rescued by injection of Keap1b mRNA, even though these procedures had little effect on the basal AR in this region (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>). zKeap1b-knockdown elicited little or no effect on the head (<xref ref-type="fig" rid="fig2">Figure 2B</xref> right panel), compared to control fish. <bold>Note:</bold> in fish subjected to no knockdown, electrophile treatment resulted in little or no AR-upregulation (~1.1-fold) in the head, although the tail was responsive (~3.4-fold) (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, 1st bars in both panels). Overall ~3-fold increase in the magnitude of AR following electrophile stimulation has been reported by us <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib32">Parvez et al., 2015</xref>; <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref>; <xref ref-type="bibr" rid="bib26">Long et al., 2018</xref> and other laboratories <xref ref-type="bibr" rid="bib8">Huang et al., 2012</xref>; <xref ref-type="bibr" rid="bib17">Levonen et al., 2004</xref>; <xref ref-type="bibr" rid="bib1">Chen et al., 2009</xref>; <xref ref-type="bibr" rid="bib53">Zou et al., 2016</xref>; <xref ref-type="bibr" rid="bib10">Kachadourian et al., 2011</xref>; <xref ref-type="bibr" rid="bib3">Dev et al., 2015</xref>; <xref ref-type="bibr" rid="bib46">Trott et al., 2008</xref> in cultured cells and animals, using multiple orthogonal readouts including GFP- and luciferase-reporter assays and by western blot and qRT-PCR analyses assessing endogenous AR-driven genes. Electrophile treatment of zKeap1a/1b-double-knockdown fish also upregulated AR in both head and tail (<xref ref-type="fig" rid="fig2">Figure 2B</xref>, both panels), an observation that may be due to re-routing of electrophile response in these fish, or possibly hinting at a dominant-negative effect being at play. Notably, zebrafish Keap1 paralogs have been shown to form heterodimers post lysis and these paralogs can occur in the same tissues, indicating that particularly in some tissues, a heterodimer of zKeap1 paralogs could be formed <xref ref-type="bibr" rid="bib18">Li et al., 2008</xref>. Overall, our data and previous reports <xref ref-type="bibr" rid="bib15">Kobayashi et al., 2009</xref> indicate that there is dominant-negative effect shown by one zKeap1-allele, but typical regulatory behavior shown by the other, at least under electrophile stimulation.</p></sec><sec id="s2-4"><title>Bulk LDE-exposure and hKeap1-specific LDE-modification upregulates AR similarly—analyzed by (i) AR-reporter Tg fish and (ii) qRT-PCR of endogenous AR-genes</title><p>One possible alternative explanation for the observed differences in AR in the head vs. the tail, is that bolus electrophile dosing to stimulate AR is dominated by divergent off-target effects between the head and tail (for instance, due to varied levels of detoxifying enzymes <xref ref-type="bibr" rid="bib6">Hayes and Dinkova-Kostova, 2014</xref>, or different expression levels of electrophile-sensors <xref ref-type="bibr" rid="bib34">Parvez et al., 2018</xref>). We thus used fish transiently expressing Halo-hKeap1 to examine how Keap1 ‘on-target’ electrophile-modification affects AR signaling in the head and the tail.</p><p>Z-REX is built on proximity-directed delivery of an LDE in situ controlled by light (<xref ref-type="fig" rid="fig1">Figure 1A</xref> and <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>). HaloTag–Ht-PreLDE complex serves as a latent source for rapid release of nascent LDE in an amount stoichiometric to Halo-POI <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib25">Long et al., 2017c</xref>. Because labeling occurs rapidly (<italic>t</italic><sub>1/2</sub> &lt; 1 min) <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref> and under what constitutes electrophile-limited (<italic>k</italic><sub>cat</sub>/K<sub>m</sub>-type) conditions <xref ref-type="bibr" rid="bib20">Liu et al., 2019</xref>, this scenario is in stark contrast to bolus LDE-administered from outside of animals, and does not significantly label proteins other than hKeap1 (see below for proof of this experimentally). This technique is not as subject to upstream factors extrinsic to hKeap1 (e.g. detoxification) as bolus dosing (<xref ref-type="fig" rid="fig1">Figure 1A</xref>), but is particularly effective at illuminating unexpected pathway intersections with Keap1-modification-specific changes in signaling <xref ref-type="bibr" rid="bib24">Long et al., 2017b</xref>.</p><p>Immediately following mRNA-injection, Ht-PreLDE was introduced, and after 28.5 hr, excess Ht-PreLDE was removed by 30-min cycles of washing (x3) (see <bold>Appendix-Scheme 1</bold>). Our recent data establish that our Ht-PreHNE [LDE = 4-hydroxynonenal (HNE)] saturates Halo-binding site within Halo-POIs in fish embryos <xref ref-type="bibr" rid="bib25">Long et al., 2017c</xref>. We found that Z-REX-targeted hKeap1-modification resulted in 1.5-fold AR-upregulation (~40% of what we observed with NE-bolus dosing) in the tail 34 hr-post-fertilization (hpf), following light-exposure 30 hpf (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). The head was unresponsive.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Fish expressing Halo-•-hKeap1-(2xHA) can mount AR following bolus-electrophile dosing or Z-REX-mediated hKeap1-specific electrophile labeling.</title><p>(<bold>A</bold>) <italic>Tg(gstp1:GFP</italic>) heterozygotes injected with Halo-•-hKeap1-(2xHA) mRNA at one- to four-cell stage. (See <xref ref-type="fig" rid="app1scheme1">Appendix 1-Scheme 1</xref> for workflow). <italic>Left:</italic> Representative IF-images of <italic>Tg(gstp1:GFP</italic>) fish 4 hr post Z-REX show an increase in GFP-signal intensity in the tail (arrows) subsequent to Z-REX-mediated Keap1-specific HNEylation. No AR activation was observed with all Z-REX controls (DMSO-treated, light alone, and Ht-PreHNE alone). [<bold>Note:</bold> GFP-expression was detected using red fluorescence because of high background signal in GFP (ex: 488 nm; em: 520–550 nm) channel]. <italic>Right:</italic> Image quantitation was performed on the head/tail-regions illustrated in <xref ref-type="fig" rid="fig1">Figure 1B</xref>. No. embryos analyzed: DMSO: No light (65), light (61); photocaged probe Ht-PreHNE: No light (47), with light (59); HNE (13). Also see <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplements 1C</xref> and <xref ref-type="fig" rid="fig1s2">2A</xref>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>. (<bold>B</bold>) Z-REX-targeted Keap1-specific HNEylation is sufficient to upregulate <italic>endogenous</italic> AR-genes represented by <italic>gstpi1, gsta.2, hmox1, and abcb6a</italic> (see <bold>Appendix</bold>). 2 hr post Z-REX or bolus HNE treatment, embryos were euthanized, RNA was isolated separately from head and tail and qRT-PCR analyses were performed as described in Methods. <italic>Inset</italic> above shows whole-head/-tail separation performed prior to RNA isolation. See, for workflow, Appendix 1-Scheme 1. n&gt;4 independent biological replicates and 2 technical repeats for each sample. Also see <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2B</xref>. (<bold>C</bold>) Illustration of a ‘perfect’ negative control for Z-REX using the non-fused construct that allows Halo and POI (protein of interest) to be expressed separately in vivo. See text for discussions. Replicating T-REX/Z-REX using the non-fused construct (here, P2A construct) results in ablation of POI modification by LDE as well as ablation of downstream signaling that are otherwise observed using the fused Halo-POI construct. Also see Figure 3D–E and <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>. (<bold>D</bold>) Z-REX-mediated AR-upregulation in the tail is observed only in Halo-•-hKeap1-(2xHA)-fusion-protein-expressing fish embryos, but <italic>not</italic> in the non-fused construct [i.e. Halo-(2xHA)-P2A-•-hKeap1-(2xHA)-mRNA]-injected embryos (see <bold>Appendix</bold> for mRNA sequence). See also Figure 3C and <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>. Bolus treatment of embryos expressing either construct with Tecfidera (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>) results in AR-upregulation in the tail. Image quantitation was performed on the tail-regions as illustrated. No. embryos analyzed: Halo-•-hKeap1-(2xHA): DMSO (43), Light alone (29), Ht-PreHNE alone (47), Z-REX (58), and Tecfidera (24); Halo-(2xHA)-P2A-•-hKeap1-(2xHA): DMSO (55), Light alone (49), Ht-PreHNE alone (52), Z-REX (47), and Tecfidera (9). See also <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2B</xref>. (<bold>E</bold>) Z-REX-mediated-AR-upregulation is not observed in the head. The dashed line indicates the average level of AR-upregulation in the tail following bulk exposure to Tecfidera (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>). Image quantitation was performed on the head as illustrated. No. embryos analyzed: Halo-•-hKeap1-(2xHA): DMSO (43), Light alone (29), Ht-PreHNE alone (49), Z-REX (65), and Tecfidera (24); Halo-(2xHA)-P2A-•-hKeap1-(2xHA): DMSO (55), Light alone (48), Ht-PreHNE alone (54), Z-REX (49), and Tecfidera (10). All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig3-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig3-v4.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Z-REX execution maintains viability and proper development of embryos, whereas bolus LDE treated embryos show reduced viability following prolonged incubation.</title><p>See also <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A</xref>. (<bold>A</bold>) Photocaged precursor compounds deployed in Z-REX are non-invasive, whereas fish viability is significantly affected by bolus electrophile treatment at one- to four-cell stage. Representative data shown for HNE (bolus) and Ht-PreHNE (Z-REX). Ht-PreHNE does not show any significant toxicity/teratogenicity compared to non-injected or DMSO-treated fish, despite prolonged treatment <xref ref-type="bibr" rid="bib41">Sant et al., 2017</xref>. Number of embryos analyzed: Non-injected (30), Halo-•-hKeap1-(2xHA) injected: DMSO (101), Ht-PreHNE alone (72), Bolus HNE (31), Bolus HNE treated at one- to four-cell-stage (37). (<bold>B</bold>) Z-REX is non-teratogenic. Fish embryos were treated with 6 μM Ht-PreHNE at one- to four-cell stage. After 28.5 hr, fish were exposed to light for 4 min, and subsequently allowed to develop for another 72 hr before imaging. These fish were compared to photocaged compound-alone-treated (i.e. no light exposure) and DMSO-alone-treated fish.</p><p><supplementary-material id="fig3s1sdata1"><label>Figure 3—figure supplement 1—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig3-figsupp1-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig3-figsupp1-v4.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>Comparison of results from Z-REX using fused vs non-fused Halo-POI constructs (see <xref ref-type="fig" rid="fig3">Figure 3C</xref>) allows precise measurement of ‘on-target/on-pathway’ responses in vivo.</title><p>(<bold>A</bold>) Fused vs. non-fused-construct validations: similar levels of Keap1 ubiquitous expression are obtained in Halo-•-hKeap1-(2xHA) and Halo-(2xHA)-P2A-•-hKeap1-(2xHA) mRNA injected fish. <bold>Appendix</bold> lists the gene sequences of Halo-•-hKeap1-(2xHA) proteins in fused and non-fused systems. (<bold>B</bold>) Replication of Z-REX using non-fused construct (see <xref ref-type="fig" rid="fig3">Figure 3C</xref>) rules out off-target responses. <italic><underline>Inset</underline></italic>: Whole-head/-tail separation was performed as indicated (see top left), prior to RNA isolation selectively from the tails. qRT-PCR analysis evaluating upregulation of a representative AR-driven endogenous gene in fish demonstrates Z-REX-mediated Keap1-modification-specific AR-upregulation. 2 hr post Z-REX, embryos expressing either Halo-•-hKeap1-(2xHA) or Halo-(2xHA)-P2A-•- hKeap1-(2xHA) were euthanized, and RNA was isolated separately from head and tail. qRT-PCR was performed on tail samples for <italic>gstpi2</italic>. n&gt;4 independent biological replicates and two technical repeats. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig3s2sdata1"><label>Figure 3—figure supplement 2—source data 1.</label><caption><title>quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig3-figsupp2-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig3-figsupp2-v4.tif"/></fig><fig id="fig3s3" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 3.</label><caption><title>Z-REX on-target electrophile modification strategy validates proximity-directed electrophile responsivity.</title><p>(<bold>A</bold>) Comparison of results from Z-REX using fused vs non-fused Halo-POI constructs (see <xref ref-type="fig" rid="fig3">Figure 3C</xref>) allows precise measurement of ‘on-target’ electrophile modification in vivo, because fusion of Halo and Keap1 domains is required for Z-REX-mediated targeted electrophile delivery to Keap1 <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib25">Long et al., 2017c</xref>; <xref ref-type="bibr" rid="bib47">Van Hall-Beauvais et al., 2018</xref>. <italic><underline>Left panel:</underline></italic> Workflow for electrophile-labeling analysis of protein of interest (POI), following Z-REX in vivo or bolus treatment of live embryos. Procedures involve biotin/streptavidin enrichment of LDE-modified proteins from fish lysate following Z-REX in vivo. Post Z-REX, zebrafish larvae are lysed, and Halo and hKeap1 domains separated using TeV protease. Click coupling with biotin azide in lysate biotinylates the alkyne handle on the LDE-modified POI, and the alkyne handle within the photocaged-precursor bound to Halo (if/when photouncaging is incomplete post light illumination). Enrichment using streptavidin agarose beads and subsequent western blot analysis evaluates extent of Keap1 modification. <italic><underline>Right panel:</underline></italic> Similar analysis is performed on fish directly treated with reactive LDEs. (<bold>B</bold>) Using procedure in (<bold>A</bold>) post Z-REX shows LDE-modification only when Halo-•-hKeap1-(2xHA) is expressed as a fusion protein. No labeling of hKeap1 is observed in fish injected with Halo-(2xHA)-P2A-•-hKeap1-(2xHA) mRNA. This result is representative of an experiment repeated three independent times, by three different operators, yielding identical results. (<italic><bold>Note</bold>: each sample in pulldown analysis typically requires 75–150 fish, yielding 120–300 μg of fish lysates</italic>). Actin is used as loading control in input samples. The upper band around 110 kDa observable in certain samples in the ‘Input’ blot (<italic>left panel</italic>) corresponds to the full-length fusion protein. This band is variable due to adventitious protease cleavage post lysis. A faint signal corresponding to the same band is observed in the ‘Elution’ blot (<italic>right panel</italic>) (only in the Z-REX samples originating from fusion protein) due to incomplete photouncaging in vivo (i.e. alkyne from the remaining photocaged probe bound to Halo domain within the full-length Halo-•-hKeap1-(2xHA)), leading to simultaneous enrichment of this full-length protein (~110 kDa) upon biotin pulldown along with HNEylated TEV-cleaved Keap1 (~70 kDa). <bold>Note:</bold> <italic>association between Keap1 and its binding partners is not possible since washes and Click assays are carried out under denaturing conditions</italic>. <bold>Appendix</bold> lists the gene sequences of Halo-•-hKeap1-(2xHA) proteins in fused and non-fused systems.</p><p><supplementary-material id="fig3s3sdata1"><label>Figure 3—figure supplement 3—source data 1.</label><caption><title>Full view blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig3-figsupp3-data1-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig3s3sdata2"><label>Figure 3—figure supplement 3—source data 2.</label><caption><title>Raw blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig3-figsupp3-data2-v4.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig3-figsupp3-v4.tif"/></fig><fig id="fig3s4" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 4.</label><caption><title>Markedly contrasting to Z-REX (i.e., combined treatment with both light and Ht-PreHNE), wherein liberated LDE efficiently labels hKeap1 in situ, the extent of hKeap1 labeling upon bolus HNE-treatment of fish is minimal.</title><p>Bolus HNE treatment of embryos expressing Halo-•-hKeap1-(2xHA) does <italic>not</italic> label hKeap1 efficiently, despite showing increase in AR and general upregulation of AR-controlled downstream genes (e.g. <xref ref-type="fig" rid="fig3">Figure 3A–B</xref>). MW: Halo-•-hKeap1-(2xHA) (~110 kDa), hKeap1-(2xHA) (~70 kDa). See <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3A</xref> for workflow of biotin pulldown (details are described in Methods).</p><p><supplementary-material id="fig3s4sdata1"><label>Figure 3—figure supplement 4—source data 1.</label><caption><title>Full view blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig3-figsupp4-data1-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig3s4sdata2"><label>Figure 3—figure supplement 4—source data 2.</label><caption><title>Raw blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig3-figsupp4-data2-v4.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig3-figsupp4-v4.tif"/></fig><fig id="fig3s5" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 5.</label><caption><title>Z-REX-mediated AR upregulation following hKeap1-specific low-occupancy LDE-modification, is transient.</title><p>(<bold>A</bold>) IF in <italic>Tg(gstp1:GFP</italic>) fish shows basal AR is higher in the tail of larvae at 48 hpf compared to 34 hpf. (<bold>B</bold>) Quantitation of mean AR in the tails of embryos at 34 hpf and 48 hpf. 34 hpf: n=18, 48 hpf: n=6. (<bold>C</bold>) Selective modification of hKeap1 with HDE elicits AR upregulation at 4 hr post Z-REX (34 hpf) in the tails of zebrafish embryos. By contrast, at 18 h post Z-REX (48 hpf), no significant difference in AR upregulation is observed between controls and Z-REX. Number of fish evaluated: 18 hr post Z-REX, DMSO: No light (20), with light (16); Ht-PreHDE: no light (15), with light (12); 18 hr post Z-REX, DMSO: No light (6), with light (6); Ht-PreHDE: no light (8), with light (14). (<bold>D</bold>) Latency of AR upregulation post Z-REX. <italic>Tg(gstp1:GFP</italic>) fish were injected with mRNA encoding Halo-•-hKeap1-(2xHA). Fish were treated with Ht-PreHNE. The wash-out of Ht-PreHNE and light shining was staggered such as the endpoint of each condition was the same (34 hpf). 1.5 hr: DMSO (25), Light alone (34), Z-REX (26); 4 hr: Light alone (29), Z-REX (20); 8 hr: Light alone (24), Z-REX (22). (<bold>E</bold>) Same as in (<bold>D</bold>) except embryos were directly treated with two different concentrations of HNE for the indicated duration. Treatment was staggered such that the endpoint of each condition was the same. DMSO (38); HNE: 26 µM, 4 hr (15); 13 µM, 6 hr (9); 26 µM, 6 hr (4); 13 µM, 8 hr (12); 26 µM, 8 hr (13); 13 µM, 12 hr (10). All numerical data present mean ±sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig3s5sdata1"><label>Figure 3—figure supplement 5—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig3-figsupp5-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig3-figsupp5-v4.tif"/></fig></fig-group><p>We next compared these data with results from fish bolus-treated with HNE. The conditions for whole-animal LDE exposure (25 µM) were chosen to: (<italic>1</italic>) closely mirror Z-REX conditions, and (<italic>2</italic>) avoid prolonged bolus LDE exposure that was deleterious to embryonic development (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>), whereas exposure to photocaged precursors of similar or higher dose/longer duration was easily tolerated in these larval fish: Ht-PreHNE showed little effect on development, even when Z-REX was performed at 30 hpf and embryos were left to develop for another 3 days (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). Whole-fish treatment with HNE (25 µM) at 30 hpf, for 4 hr, elicited similar tail-specific AR-upregulation as was found under Z-REX (<xref ref-type="fig" rid="fig3">Figure 3A</xref> inset; the last two bars in left panel). Taken together, differences between head and tail response, and the fact that fold changes in AR are generally relatively small, collectively indicate that the measured response in the tail is indeed a biologically relevant change.</p><p>We next examined by qRT-PCR the extent of upregulation of <italic>endogenous</italic> AR-driven genes of conserved importance in higher eukaryotes, under both regimens, namely: global LDE-exposure and Z-REX-mediated Keap1-specific-modification. Representative genes associated with drug metabolism under control of Nrf2 (Gst-isoforms, Hmox1, and Abcb6) were activated to similar levels between Z-REX and bulk HNE-treatment, and AR modulation was most prominent in the tail (<xref ref-type="fig" rid="fig3">Figure 3B</xref>), particularly in the case of <italic>gsta.2</italic>, but also for <italic>abcd6a</italic> that only showed a significant upregulation relative to controls in the tail. <italic>gstpi1</italic> showed hypomorphic responses in the head relative to the tail, but these were not significantly different, at this level of statistical power. We ascribe this modest AR-upregulation in the head [seen only by qRT-PCR analysis of several genes, and not by immunofluorescence(IF)-imaging of <italic>Tg(gstp1:GFP</italic>)] to increased sensitivity of qRT-PCR analysis compared to in vivo fluorescence-imaging, and the fact that the <italic>gstp1</italic> locus (used in the GFP-reporter fish) is not the most responsive in the head. By contrast, bolus LDE-treatment yielded mixed responses in most cases (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). We further note that mRNA extracted from head or tail covers cells that are not necessarily examined in <italic>Tg(gstp1:GFP</italic>), rendering data from head and tail in the qRT-PCR (e.g. <xref ref-type="fig" rid="fig3">Figure 3B</xref>) and IF-imaging (e.g. <xref ref-type="fig" rid="fig2">Figures 2</xref> and <xref ref-type="fig" rid="fig3">3A</xref>) assays not necessarily comparable.</p></sec><sec id="s2-5"><title>Replication of Z-REX using non-fused construct rules out off-target signaling and validates on-target/pathway interrogations—analyzed by: (i) AR-reporter Tg fish and (ii) qRT-PCR of endogenous AR-genes</title><p>To validate that AR-upregulation observed upon Z-REX is due to Keap1-specific HNEylation as opposed to off-target effects, we compared the extent of AR modulation in fish expressing either Halo-•-hKeap1, or the ‘non-fused’ Halo-P2A-•-hKeap1 (where ‘•’ designates TEV-protease-site that is cleaved post lysis). The P2A-sequence allows for slipping of the translation machinery <xref ref-type="bibr" rid="bib12">Kim et al., 2011</xref>, thereby expressing Halo and hKeap1 proteins separately (i.e. non-fused), from the same mRNA, during the same translation step. Based on our previous cell-based studies <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib25">Long et al., 2017c</xref>; <xref ref-type="bibr" rid="bib32">Parvez et al., 2015</xref>; <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref>; <xref ref-type="bibr" rid="bib47">Van Hall-Beauvais et al., 2018</xref>, the non-fused system wherein Halo and POI are expressed as two separate proteins serves as a robust negative control in our proximity-directed LDE-targeting platform (<xref ref-type="fig" rid="fig3">Figure 3C</xref>): when electrophile release is executed in the non-fused system, both labeling of POI and downstream ramifications are ablated. A similar level of ubiquitous expression of hKeap1 was achieved following injection of mRNA encoding the non-fused construct (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2A</xref>). Similar to our previous cell-based data, the P2A-integrated construct yielded little or no AR-upregulation upon Z-REX, compared to that achieved with Halo-•-hKeap1, demonstrated by both IF-imaging of GFP-reporter upregulation (<xref ref-type="fig" rid="fig3">Figure 3D–E</xref>) and qRT-PCR analyses targeting 3 different endogenous AR-driven genes (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2B</xref>). These data also show that minor upregulation of AR-specific genes due to treatment with light alone, or photocaged-compound alone, do not synergize significantly and hence do not contribute dramatically to responses observed during Z-REX. Importantly, upon bolus exposure to Tecfidera (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>), an approved pleiotropic electrophilic drug that stimulates AR as part of its pharmaceutical program <xref ref-type="bibr" rid="bib38">Poganik et al., 2021</xref>; <xref ref-type="bibr" rid="bib37">Poganik and Aye, 2020</xref>, both fused and non-fused systems gave twofold AR-upregulation, particularly in the tail region (<xref ref-type="fig" rid="fig3">Figure 3D–E</xref>).</p></sec><sec id="s2-6"><title>LDE-labeling extent of hKeap1 is different between bolus conditions and Z-REX-target-specific interrogations</title><p>Importantly, at the level of target labeling by Z-REX, we showed that the non-fused expression system strongly-diminished the extent of LDE-signal on hKeap1 compared to the fused construct (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3A-B</xref>). We demonstrated this outcome using ‘biotin-Click-streptavidin pulldown’ of LDE-modified proteins in fish, subsequent to Z-REX in vivo. Briefly, lysates from either control fish or Z-REX-treated fish—expressing either Halo-•-hKeap1 or Halo-•-P2A- hKeap1—were all subjected to: (in the former instance) TeV-protease to separate Halo and Keap1; Click-coupling with biotin-azide; and streptavidin enrichment to evaluate LDE-modified proteins (see <bold>Appendix-Scheme 1</bold>).</p><p>Using the same enrichment protocol, we examined the extent of hKeap1 labeling subsequent to bolus HNE-treatment of embryos (<xref ref-type="fig" rid="fig3s4">Figure 3—figure supplement 4</xref>). We unexpectedly found little discernable hKeap1-modifcation. This result is surprising because bolus dosing promoted AR-upregulation to a level similar to that elicited by Z-REX targeted hKeap1-HNEylation (<xref ref-type="fig" rid="fig3">Figure 3A–B</xref>). This result underscores the importance of using Z-REX to parse on-target electrophile signaling, especially in organisms because phenotypic effects of <italic>on-target</italic> LDE-modification can be directly and unambiguously interrogated by Z-REX. However, because bolus dosing affects numerous proteins, and changes redox balance, such outcomes are overall not surprising. To further investigate this phenomenon, we compared how AR was induced as a function of time under bulk-exposure and Z-REX.</p></sec><sec id="s2-7"><title>Latencies and duration of AR are similar between bolus exposure and Z-REX</title><p>AR increased as the fish aged, such that the DMSO-treated group had significantly higher AR 48 hpf than 34 hpf (<xref ref-type="fig" rid="fig3s5">Figure 3—figure supplement 5A-B</xref>). Thus, even though Z-REX-mediated Keap1-specific LDEylation led to a 1.5–1.7-fold increase in AR 4 hr post light-exposure (ple) (34 hpf), there was no significant difference between Z-REX and controls 18 hr ple (48 hpf) (<xref ref-type="fig" rid="fig3s5">Figure 3—figure supplement 5C</xref>). To further examine the time-dependent AR-upregulation following Z-REX, we measured AR-upregulation at 34 hpf (<xref ref-type="fig" rid="fig3s5">Figure 3—figure supplement 5D</xref>). However, photouncaging was executed at different time points prior to harvesting (1.5, 4, and 8 h ple).</p><p>Interestingly, Z-REX gave a transient AR-upregulation, which peaked around 4 hr ple but returned to basal levels 8 hr ple (<xref ref-type="fig" rid="fig3s5">Figure 3—figure supplement 5D</xref>). This profile is consistent with the Z-REX model, wherein the transient release of LDE in an amount sub-stoichiometric to POI in vivo mimics signaling conditions <xref ref-type="bibr" rid="bib20">Liu et al., 2019</xref>; <xref ref-type="bibr" rid="bib29">Long et al., 2021</xref>, such that AR-upregulation is not sustained. Conversely, when we examined the effects of bolus HNE-treatment, a similar kinetic profile was observed (<xref ref-type="fig" rid="fig3s5">Figure 3—figure supplement 5E</xref>), although fish were constantly exposed to electrophile. It is likely that the off-target effects incurred during bolus-electrophile treatment cause insults that lead to severe negative effects on fish, which we showed above are not present in Z-REX (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). This finding makes precise comparisons between bolus dosing and Z-REX in terms of absolute outcomes difficult, and may explain the difficulty in correlating labeling of Keap1 with the extent of AR-upregulation under bolus dosing with that resulting from Z-REX. Regardless, the overall conclusions of the two methods in terms of head vs. tail AR are surprisingly similar.</p></sec><sec id="s2-8"><title>All LDEs have similar capacity to mount AR following hKeap1-specific LDEylation in live fish—analyzed by (i) AR-reporter Tg fish and (ii) qRT-PCR of endogenous AR-genes</title><p>The above results (primarily obtained with HNE, selected because it is the most well-known LDE) were intriguing, and we were keen to understand how Keap1 labeling contributed to overall AR for structurally-homologous native LDEs (<xref ref-type="fig" rid="fig1">Figure 1</xref> inset). HDE (4-hydroxydodecenal, identified in human urine <xref ref-type="bibr" rid="bib5">Florens et al., 2016</xref> and heated oils <xref ref-type="bibr" rid="bib43">Seppanen and Csallany, 2004</xref>), NE (nonenal, another endogenously-generated LDE exhibiting an age-dependent rise in production <xref ref-type="bibr" rid="bib7">Haze et al., 2001</xref>), and DE (3-decen-2-one, an FDA-approved food additive with natural occurrence in certain fruits and mushrooms <xref ref-type="bibr" rid="bib13">Knowles and Knowles, 2012</xref>) were chosen as representatives. As with HNE, the HaloTag-targetable photocaged precursors to HDE, NE, and DE have been successfully applied to target hKeap1 selectively in cells <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref>. The measured AR-upregulation in each case is of comparable efficiency to that obtained under whole-cell LDE flooding <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref>. Using <italic>Tg(gstp1:GFP</italic>) fish, we found that these LDEs elicited similar AR-upregulation in fish tails upon Z-REX (<xref ref-type="fig" rid="fig4">Figure 4A</xref>), but the head was not responsive (<xref ref-type="fig" rid="fig4">Figure 4B</xref>).</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Z-REX delivery of 4-different electrophiles studied consistently labels hKeap1 and activates AR to similar extent (as previously observed in cell culture).</title><p>Also see <xref ref-type="fig" rid="fig5">Figures 5</xref>–<xref ref-type="fig" rid="fig6">6</xref> and <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>, <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplements 3</xref>–<xref ref-type="fig" rid="fig3s5">5</xref>, <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>. (<bold>A</bold>) Quantitation of mean AR-levels in the tail of embryos 4 h post Z-REX with indicated LDEs. Image quantitation was performed on the tail-regions as illustrated. No. embryos analyzed: DMSO: No light (65), with light (84); Ht-PreHNE: No light (47), with light (59); Ht-PreHDE: No light (59), with light (59); Ht-PreNE: No light (38), with light (18); Ht-PreDE: No light (23), with light (22). (<bold>B</bold>) Similar quantitation in the head shows no increase in AR post Z-REX. Image quantitation was performed on the head-regions as illustrated. No. embryos analyzed: DMSO: No light (65), with light (82); Ht-PreHNE: No light (49), with light (65); Ht-PreHDE: No light (63), with light (60); Ht-PreNE: No light (38), with light (21); Ht-PreDE: No light (23), with light (22). (<bold>C</bold>) hKeap1-modification alone is sufficient to drive <italic>endogenous</italic> AR-gene upregulation in the tail in casper zebrafish. Whole-head/-tail separation was performed as indicated in inset (left), prior to RNA isolation selectively from the tails. 2 h post Z-REX with indicated LDEs, embryos were euthanized, and RNA was isolated, and qRT-PCR analyses were performed on tail samples (see inset, left) targeting indicated downstream genes (see <bold>Appendix</bold> for primer sequences). n&gt;4 independent biological replicates and 2 technical repeats for each sample. Inset: schematic for fish separation. Note: tail was taken as a representative segment in these experiments. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig4-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig4-v4.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>DE efficiently labels hKeap1 upon bolus treatment of whole embryos Cf. results from bolus treatment with 4-OH-bearing LDEs, such as HNE (<xref ref-type="fig" rid="fig3s4">Figure 3—figure supplement 4</xref>).</title><p>By contrast, Z-REX shows uniform labeling of hKeap1 irrespective of the LDE structure (see also <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplements 3B</xref> and <xref ref-type="fig" rid="fig3s4">4</xref>). For LDE-permeability assessment and whole-reactive-proteome labeling by various LDEs following bolus treatment, see <xref ref-type="fig" rid="fig6">Figure 6</xref>.</p><p><supplementary-material id="fig4s1sdata1"><label>Figure 4—figure supplement 1—source data 1.</label><caption><title>Full view blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig4-figsupp1-data1-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig4s1sdata2"><label>Figure 4—figure supplement 1—source data 2.</label><caption><title>Raw blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig4-figsupp1-data2-v4.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig4-figsupp1-v4.tif"/></fig></fig-group><p>Independent qRT-PCR analysis of endogenous AR-driven genes following Z-REX in casper fish gave broadly-consistent results across all the LDEs examined (<xref ref-type="fig" rid="fig4">Figure 4C</xref>). Using Click-biotin-pulldown following Z-REX in vivo, we validated using DE as an example that hKeap1-labeling extent was similar to that achieved with HNE (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). Given that AR under Z-REX conditions stems only from hKeap1-modification, these findings explain the similar magnitude of AR-outputs observed with Z-REX. These outcomes were further substantiated by qRT-PCR analysis of downstream genes discussed above (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2B</xref>), where we showed that Halo-P2A-•-hKeap1 was hypomorphic for Z-REX-assisted hKeap1-HNEylation-promoted AR-upregulation.</p></sec><sec id="s2-9"><title>Whole-fish LDE-exposure elicits complex AR outputs that are dependent on LDE structure: allylic alcohols disfavor AR-upregulation—analyzed by (i) AR-reporter Tg fish and (ii) qRT-PCR of endogenous AR-genes</title><p>Having established that each LDE when targeted specifically to Keap1 could trigger tail-specific AR-upregulation, we compared effects on AR from whole-fish-LDE-exposure under otherwise identical conditions/timescales to Z-REX. Bolus dosing with these LDEs elicited widely different AR that was chemical-structure dependent. By both imaging of the AR-reporter fish (<xref ref-type="fig" rid="fig5">Figure 5A–B</xref>) and qRT-PCR analysis of endogenous AR-driven genes (<xref ref-type="fig" rid="fig5">Figure 5C</xref>), LDEs that did not contain a 4-hydroxyl group were best at eliciting AR. Interestingly, 4-dehydroxy species are intrinsically less electrophilic than their 4-hydroxylated counterparts. This result was markedly different from those seen under Z-REX targeted conditions for the same LDEs.</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Bolus dosing with different LDEs or reactive covalent electrophilic drugs elicits complex AR responses.</title><p>Also see <xref ref-type="fig" rid="fig6">Figure 6</xref>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplements 1</xref> and <xref ref-type="fig" rid="fig3s4">4</xref> and 5E, <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, and <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>. (<bold>A</bold>) Representative IF images of <italic>Tg(gstp1:GFP</italic>) fish expressing Halo-•-hKeap1-(2xHA), following bolus exposure to indicated electrophiles. (<bold>B</bold>) Quantitation of data in (<bold>A</bold>). Image quantitation was performed on the head/tail-regions as illustrated. No. embryos analyzed: Tail, DMSO (55), Sulforaphane (16), HNE (12), Tecfidera (24), NE (9); Head, DMSO (43), Sulforaphane (16), HNE (15), Tecfidera (24), NE (9). Sulforaphane and HNE elicit non-significant and 1.5-fold AR upregulation, respectively. Tecfidera gives medium (~2-fold) AR response and NE elicits the strongest AR upregulation (~3-fold) in tail. Consistent with data elsewhere (e.g., <xref ref-type="fig" rid="fig3">Figure 3A and C-E</xref>), head is not responsive. (<bold>C</bold>) qRT-PCR analysis of <italic>endogenous</italic> AR-responsive genes following bolus exposure of native reactive LDEs to whole fish similarly shows mixed responses. Whole-head/-tail separation was performed as indicated in inset (left), prior to RNA isolation selectively from the tails. 2 hr post Z-REX, embryos were euthanized, and RNA was isolated separately from tail (see inset, left). Data are presented as mean ± sem. n&gt;3 independent biological replicates and two technical repeats for each sample. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig5-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig5-v4.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Uncontrolled bulk exposure of developing larvae with reactive electrophiles results in differential proteome labeling extent and adversely affects development/viability.</title><p>(<bold>A</bold>) Treatment with 25 µM CDDO-Me for 4 hr negatively impacts the morphology of the developing embryos (curved tail; malformed/missing caudal fin), whereas Z-REX photocaged probe treatment shows no negative impacts. See also <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>. <italic>Top:</italic> CDDO-Me treated, <italic>Bottom:</italic> Ht-PreNE treated. (<bold>B</bold>) Comparison of relative whole-reactive-proteome labeling extent by the respective alkyne-bearing small-molecules, following either bolus LDE treatment (2<sup>nd</sup> to 4<sup>th</sup> bars) or treatment with Z-REX-photocaged-LDE precursor alone (6<sup>th</sup> bar) or full Z-REX execution (7<sup>th</sup> bar) in live embryos. Zebrafish embryos at 32 hpf were directly treated with 25 μM of the indicated LDEs for 2 hr. After fixing and permeabilization, Cy5 azide was conjugated to alkyne labeled proteins using copper-assisted Click procedure as described in Methods. Larvae were imaged after washing away unbound dye. The Cy5 fluorescence intensity was analyzed using Image-J(NIH). Electrophiles devoid of 4-OH group such as DE and NE (4<sup>th</sup> and 5<sup>th</sup> bars) (see also <xref ref-type="fig" rid="fig1">Figure 1A</xref> inset) efficiently label the whole-reactive-proteome upon bolus treatment of whole embryos, whereas 4-OH-group containing electrophile such as HNE and HDE (2<sup>nd</sup> and 3<sup>rd</sup> bars) show a lower degree of whole-reactive-proteome labeling. See <xref ref-type="fig" rid="fig6">Figure 6</xref> for representative images related to the data in 1<sup>st</sup> to 5<sup>th</sup> bars. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig5s1sdata1"><label>Figure 5—figure supplement 1—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig5-figsupp1-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig5-figsupp1-v4.tif"/></fig></fig-group><p>We also assayed the effects of electrophiles of clinical relevance under bulk-exposure. Tecfidera gave outputs between those elicited by bolus HNE and NE (and of higher magnitude than the Z-REX responses) (<xref ref-type="fig" rid="fig5">Figure 5A–B</xref>; Cf. <xref ref-type="fig" rid="fig3">Figure 3D</xref>). Bardoxolone methyl (CDDO-Me; Phase II trials recently completed for pulmonary hypertension, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>) was severely toxic to the fish at this concentration, although AR was upregulated (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A</xref>). Sulforaphane (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>) did not elicit AR under these conditions (<xref ref-type="fig" rid="fig5">Figure 5A–B</xref>). However, regardless of the magnitude of the output in the tail, where responses were observed, there remained minimal, and indeed non-statistically-significant, increase in AR in the head (<xref ref-type="fig" rid="fig5">Figure 5B</xref>).</p></sec><sec id="s2-10"><title>Extent of the fish proteome labeling following bulk LDE-exposure closely mirrors that of AR induction</title><p>We next examined the ability of the LDEs to label the fish proteome following whole-fish treatment (<xref ref-type="fig" rid="fig6">Figure 6A–B</xref>, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1B</xref>). Interestingly, this trend closely mirrored that of AR-upregulation elicited upon bolus dosing, with hydroxyl-bearing LDEs (HNE and HDE) manifesting a reduced level of proteome labeling and corresponding reduced AR-induction (<xref ref-type="fig" rid="fig5">Figure 5</xref> vs. <xref ref-type="fig" rid="fig6">Figure 6A-B</xref>, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1B</xref>). Thus, AR-upregulation upon bulk LDE-exposure is dominated by permeation/pharmacokinetic-effects over inherent ligand electrophilicity. However, the divergent AR-induction in the front and hind portions of the fish was retained.</p><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Bolus LDE treatment results in different extent of whole-reactive-proteome labeling that correlates with the magnitude of AR-upregulation (<xref ref-type="fig" rid="fig5">Figure 5A–C</xref>).</title><p>See also <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>. (<bold>A</bold>) Casper zebrafish were treated with indicated LDEs for 2 hr before euthanasia and fixing. See Methods for whole-reactive-proteome labeling procedure in fish using Click coupling. (<bold>B</bold>) Comparison of whole-reactive-proteome labeling extent of HDE and DE over time (2 hr) shows allylic alcohol motif within LDEs is likely responsible for reduced Keap1-labeling degree under bolus conditions.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig6-v4.tif"/></fig></sec><sec id="s2-11"><title>Examination of zKeap1a and zKeap1b unveils divergent regulatory roles for these proteins in AR</title><p>We thus predicted that zKeap1a is a negative regulator of electrophile-stimulated AR, and zKeap1b is the principal means through which electrophile-stimulated AR is mounted in zebrafish. Based on this hypothesis, we examined the phylogeny between the two zebrafish genes and the human protein, for clues as to which residue could lead to the proposed unusual behavior of zKeap1a. We reasoned that signaling could be affected through mutation of a cysteine in the human protein (sensing competent) to a bulky residue in Keap1a (mimicking the electrophile-modified state <xref ref-type="bibr" rid="bib35">Poganik et al., 2018</xref>). In Keap1b, this residue would remain a cysteine. Based on this logic (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1A</xref>), we identified C273 (human numbering); the analogous residue in zKeap1a is an isoleucine, but it remains a cysteine in zKeap1b (<xref ref-type="fig" rid="fig7">Figure 7A</xref> and <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1B</xref>). We thus cloned hKeap1(C273I) in a bid to find a humanized form of zKeap1a. This mutation has already been identified as a loss-of-function mutation to hKeap1 (<xref ref-type="bibr" rid="bib17">Levonen et al., 2004</xref>; <xref ref-type="bibr" rid="bib40">Saito et al., 2016</xref>), although it has not been extensively characterized, particularly in terms of how it interacts with wild-type(wt)-hKeap1. We thus progressed to evaluate hKeap1(C273I) more deeply. We also amplified zKeap1a and zKeap1b from cDNA and cloned these genes into mammalian expression vectors with a HaloTag.</p><fig-group><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Cell-based studies of zKeap1a and zKeap1b recapitulate the dominant-negative behavior observed in developing embryos; cell-based T-REX analysis (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>) reveal similar electrophile sensitivity across all Keap1-variants.</title><p>See also <xref ref-type="fig" rid="fig8">Figure 8A–B</xref>, <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplements 1</xref>–<xref ref-type="fig" rid="fig7s2">2</xref> and <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>. (<bold>A</bold>) The nine cysteines within hKeap1 that are present in only one of the two Keap1 paralogs in zebrafish. (N-term, BTB, IVR, Kelch-Repeats, C-term are individual conserved domains of Keap1). All indicated cysteines are conserved between human and zebrafish Keap1. (<bold>B</bold>) HEK293T cells were transiently transfected to express indicated Halo-•-Keap1 constructs. (See <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>, <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2A and D</xref> for validation of construct functionality). 36 hr post transfection, cells were treated with Ht-PreNE (10 µM, 2 hr), and after rinsing cycles, cells were then exposed to UV light (5 mW/cm<sup>2</sup> 365 nm lamp). Post lysis, samples were treated with TeV protease and subjected to Click coupling with Cy5-azide. The targeting efficiency of NE on each variant was calculated using a previously-reported procedure <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib47">Van Hall-Beauvais et al., 2018</xref>. See <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2B-C</xref> for representative in-gel fluorescence and western blot data. (<bold>C</bold>) HEK293T cells were transfected with plasmids encoding ARE:Firefly luciferase and CMV:Renilla Firefly reporters, human myc-Nrf2, and Keap1 (Halo-•-hKeap1, Halo-•-(3xFLAG)-zKeap1a, Halo-•-(3xFLAG)-zKeap1b, Halo-•-hKeap1 C273I, or empty vector). (See <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>, <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2A and D</xref> for validation of construct functionality). Basal (non-electrophile-stimulated) AR levels were quantified using a standard procedure <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib24">Long et al., 2017b</xref>; <xref ref-type="bibr" rid="bib47">Van Hall-Beauvais et al., 2018</xref>. The horizontal dotted line represents basal AR levels with no exogenous Keap1 introduction. All conditions show a significant drop compared to basal level (i.e. with no exogenous Keap1 overexpression). No. independent biological replicates: Halo-•-hKeap1 (n=65), Halo-•-hKeap1 C273I (n=63), Halo-•-(3xFLAG)-zKeap1a (n=19), Halo-•-(3xFLAG)-zKeap1b (n=19). These were all dosed at a plasmid loading equivalent to 100%. Also see <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2A and D</xref>. (<bold>D</bold>) HEK293T cells were transfected with a mixture of plasmids encoding Halo-•-(3xF)-zKeap1a and Halo-•-(3xF)-zKeap1b in various ratios this mix also contained empty vector as required, myc-Nrf2, and AR reporter plasmids, see (<bold>C</bold>) See <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>, <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2A and D</xref> for validation of construct functionality. 36 hr post transfection, AR was measured using a standard procedure <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib24">Long et al., 2017b</xref>; <xref ref-type="bibr" rid="bib47">Van Hall-Beauvais et al., 2018</xref>. The horizontal dotted line indicates the basal AR levels in the absence of exogenously-introduced Keap1. Percentages are relative to those analyzed in <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2D</xref>. No. independent biological replicates: n=22 for zKeap1a/b mixing, n=63 for WT/C273I hKeap1 mixing. (<bold>E</bold>) A similar experiment to (<bold>C</bold>) except AR in response to NE bolus dosing was measured in HEK293T cells transfected with: Halo-•-hKeap1(WT); Halo-•-(3xFLAG)-zKeap1b; Halo-•-hKeap1(C273I); and Halo-•-(3xFLAG)-zKeap1a. (See <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>, <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2A and D</xref> for validation of construct functionality). The horizontal dotted line represents the normalized AR-level for respective Keap1-variants following DMSO-treatment in place of NE. No. independent biological replicates: hKeap1 WT (n=28), hKeap1 C273I (n=28), zKeap1a (n=20), zKeap1b (n=20). (<bold>F</bold>) A similar experiment to (<bold>D</bold>), except AR in response to NE bolus dosing was measured in HEK293T cells. (See <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>, <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2A and D</xref> for validation of construct functionality). Note: the indicated mix of Halo-•-(3xFLAG)-zKeap1a and Halo-•-(3xFLAG)-zKeap1b upregulated AR to a similar extent as Halo-•-(3xFLAG)-zKeap1a alone. The horizontal dotted line represents the normalized AR-level for respective Keap1-variants following DMSO-treatment in place of NE. Percentages are relative to those described in <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2D</xref>. No. independent biological replicates: n=54 for zKeap1a/b mixing, n=20 for WT/C273I hKeap1 mixing. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig7sdata1"><label>Figure 7—source data 1.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig7-data1-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig7-v4.tif"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 1.</label><caption><title>Keap1 is widely conserved and Keap1 variants from fish and human mutants sense NE to a similar extent.</title><p>(<bold>A</bold>) Evolutionary analysis of Keap1 through various species shows C273I conservation. The phylogenetic tree was generated using MEGA-X (<xref ref-type="bibr" rid="bib16">Kumar et al., 2018</xref>) and the Maximum Likelihood method based on JTT matrix-based model. The tree was generated using Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using a JTT model. Topology with superior log likelihood value was selected. See (<bold>B</bold>) for the designation of boxes A-C in color. (<bold>B</bold>) Sequence logos of the flanking residues of C273 (263–283, human numbering). Various groups indicated by colored boxes in (<bold>A</bold>) are compared, and the conservation of C273 can be seen in higher level organisms. The relative size of residues is indicative of their frequency. WebLogo (invented by Steven E. Brenner et al, Computational Genomics Research Group, University of California, Berkeley) was used to generate the sequence logos.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig7-figsupp1-v4.tif"/></fig><fig id="fig7s2" position="float" specific-use="child-fig"><label>Figure 7—figure supplement 2.</label><caption><title>Keap1-paralogs/variants express at similar levels in cells; zKeap1a is an overall more-effective suppressor of basal AR than the other variants; but all manifest similar sensitivity to HNE and NE analyzed by cell-based T-REX assays.</title><p>(<bold>A</bold>) The relative expression levels in HEK293T cells ectopically expressing the indicated Keap1-variants, analyzed by western blot using anti-Halo antibody. Full constructs employed are Halo-•-hKeap1, Halo-•-hKeap1 (C273I), Halo-•-Flag3-zKeap1a, and Halo-•-Flag3-zKeap1b. (<bold>B–C</bold>) (The box in red emphasizes the region of interest pertaining to electrophile-modified Keap1 post TeV-protease cleavage; also see <xref ref-type="fig" rid="fig7">Figure 7B</xref>). Following workflow in <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref> in live HEK293T cells with the use of either: (<bold>B</bold>) Ht-PreHNE- or (<bold>C</bold>) Ht-PreNE-photocaged precursors, the extent of POI-modification by the indicated LDE (HNE in A and NE in B) was assessed by in-gel fluorescence analysis. POI-expression and lysate loading were analyzed by western blots using anti-Halo and anti-actin antibodies, respectively. Full constructs used are Halo-•-hKeap1, Halo-•-hKeap1 (C273I), Halo-•-Flag3-zKeap1a, and Halo-•-Flag3-zKeap1b. [Cmp, compound (photocaged LDE-precursor); TeV, TeV-protease]. (<bold>D</bold>) When expressed in HEK293T cells, both zebrafish paralogs suppressed basal AR levels, although zKeap1a regulates basal AR more effectively in a plasmid-dose-dependent manner. Neither paralog suppressed AR to undetectable levels. Horizontal dotted line designates basal AR-levels following transfection of empty vector in place of Keap1-encoding-plasmid. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig7s2sdata1"><label>Figure 7—figure supplement 2—source data 1.</label><caption><title>Full view gel and blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig7-figsupp2-data1-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig7s2sdata2"><label>Figure 7—figure supplement 2—source data 2.</label><caption><title>Raw gel and blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig7-figsupp2-data2-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig7s2sdata3"><label>Figure 7—figure supplement 2—source data 3.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig7-figsupp2-data3-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig7-figsupp2-v4.tif"/></fig></fig-group><p>Behavior ascribed to zKeap1a could be due to an inability to sense LDE that leads to an overall muted AR, similar to what has been previously postulated <xref ref-type="bibr" rid="bib15">Kobayashi et al., 2009</xref>. We thus first examined the sensing abilities of the four Keap1-variants to NE and HNE using T-REX in HEK293T cells ectopically expressing respective Halo-tagged proteins. All four constructs expressed similarly in HEK293T cells and at levels far above that of the endogenous Keap1-protein, allowing us to discard the influence of the endogenous hKeap1. hKeap1 was expressed at marginally higher levels than some of the other proteins (<xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2A</xref>). Intriguingly, all four proteins sensed HNE equally well (<xref ref-type="fig" rid="fig7">Figure 7B</xref> and <xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2B-C</xref>). hKeap1 and hKeap1(C273I) sensed NE marginally better than zKeap1a/b, both of which sensed NE to the same extent (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). Thus, differences in sensing abilities of the different proteins cannot explain the data we, and indeed others, have observed with zKeap1a and zKeap1b.</p><p>There remains the possibility that the different zKeap1-paralogs have different modes of marshalling AR in response to electrophiles. We thus examined these behaviors, again using cell culture. When the drop in AR was measured following transfection of equal amounts of the different zKeap1 plasmids (which, based on the experiments above, gave roughly similar amounts of protein), we found that all zKeap1a/b and hKeap1 could all significantly suppress AR, again consistent with previous reports <xref ref-type="bibr" rid="bib18">Li et al., 2008</xref>. zKeap1b appeared to be less efficient at suppressing basal AR than zKeap1a (<xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2D</xref>), which does not completely agree with previous reports, although the previous reports are limited both in terms of statistical power, and direct comparability as they were carried out in early embryos where signal-to-noise can be low. zKeap1a was similar at suppressing AR relative to hKeap1. hKeap1(C273I) suppressed basal AR, but marginally (<xref ref-type="fig" rid="fig7">Figure 7C</xref>). Critically, none of these conditions were able to suppress basal AR to undetectable levels (<xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2D</xref>). Intriguingly, when zKeap1b was co-transfected with sub-saturating amounts of zKeap1a, no decrease in basal AR was observed relative to zKeap1a alone (<xref ref-type="fig" rid="fig7">Figure 7D</xref>), implying that zKeap1a somehow affects the ability of zKeap1b to suppress AR. When we performed similar experiments mixing hKeap1 and hKeap1(C273I), a similar effect was observed (<xref ref-type="fig" rid="fig7">Figure 7D</xref>).</p><p>We progressed to examine response of the different Keap1-variants upon electrophile modification. For these purposes, we used NE as a bolus electrophile. We selected NE because in fish NE was the most permeable molecule giving the most robust AR and labeling (<xref ref-type="fig" rid="fig5">Figure 5A–C</xref>, <xref ref-type="fig" rid="fig6">Figure 6A</xref>, <xref ref-type="fig" rid="fig5">Figure 5</xref><xref ref-type="fig" rid="fig1">Figure 1B</xref>). Intriguingly, although hKEAP1 and zKeap1b were significantly responsive to bolus NE treatment, significantly upregulating AR, zKeap1a, and hKeap1(C273I) were much less responsive (<xref ref-type="fig" rid="fig7">Figure 7E</xref>). In terms of AR-upregulation ability, these data fully recapitulate data from zebrafish embryos expressing zKeap1a and zKeap1b <xref ref-type="bibr" rid="bib15">Kobayashi et al., 2009</xref>. These data further imply that the C273I mutation is a likely cause of the zKeap1a’s inability to mount AR. Furthermore, as the ability to suppress basal levels of AR were significantly different between zKeap1a and hKeap1(C273I) (<xref ref-type="fig" rid="fig7">Figure 7C</xref>), this suppressive effect is independent of fold basal-AR suppression. However, this finding does not fully explain what we found from the initial morphant data (<xref ref-type="fig" rid="fig2">Figure 2B</xref>); that is, why knockdown of zKeap1a could lead to hyper-elevated AR in zebrafish following bolus electrophile treatment. Such a mechanism could be explained if zKeap1a were a dominant-negative regulator of AR in the electrophile-stimulated states.</p><p>We next transfected equal amounts of zKeap1a/b plasmids, or 2:1 zKeap1a:zKeap1b and compared AR-levels upon bolus electrophile treatment to those found in cells transfected with zKeap1a- or zKeap1b-alone. Consistent with a dominant-negative effect on AR induction, NE caused zKeap1b-alone-expressing cells to induce AR significantly, whereas zKeap1a-alone or zKeap1a/Keap1b-expressing cells mounted AR significantly less efficiently upon NE treatment (<xref ref-type="fig" rid="fig7">Figure 7F</xref>). A similar effect was observed when hKeap1 and hKeap1(C273I) were mixed. These data explain why morpholinos targeting zKeap1a led to upregulation of electrophile-induced AR in both tail and especially the head and provide evidence for dominant-negative effects during Keap1/AR signaling.</p></sec><sec id="s2-12"><title>Differential extent of altered Nrf2-binding in response to electrophile signaling confers divergent AR-management by zKeap1a vs. zKeap1b</title><p>To examine how these paralog-divergent electrophile responses arose, we next examined how NE treatment affected the amount of Nrf2 bound to zKeap1a and zKeap1b, or the heterozygotic state. For these experiments we used HEK293T cells transiently expressing Nrf2, co-transfected with empty vector, zKeap1a, zKeap1b, or equal amounts zKeap1a and zKeap1b. We found that zKeap1b accumulated Nrf2 in the basal (i.e. non-electrophile-stimulated) state, whereas relative to zKeap1b, zKeap1a accumulated less Nrf2, and zKeap1a/zKeap1b accumulated an amount of Nrf2 that was significantly more than Keap1a alone and less than zKeap1b alone (<xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>). When treated with NE, zKeap1b-bound Nrf2 was diminished by approximately 40% (<xref ref-type="fig" rid="fig8">Figure 8A–B</xref>). Conversely for zKeap1a and zKeap1a/zKeap1b no release of Nrf2 was observed. These data agree with the paralog-specific regulation of electrophile signaling observed above, which showed that zKeap1a and the heterozygotic state were unable to upregulate AR effectively following electrophile treatment. Furthermore, given that significant amount of Nrf2 is bound to zKeap1b in both the heterozygous- and zKeap1b-only-expressing states, these data are consistent with a model in which electrophile engagement of zKeap1b can trigger AR through causing net release of Nrf2, whereas zKeap1a (either with or without zKeap1b) cannot lead to net release of Nrf2 upon electrophile labeling, and hence cannot upregulate AR. Thus, zKeap1a (either electrophile modified or unmodified) acts to suppress loss of Nrf2 binding to zKeap1b.</p><fig-group><fig id="fig8" position="float"><label>Figure 8.</label><caption><title>zKeap1a/b paralog-specific AR regulation is reflected by the differences in altered Nrf2 binding following electrophile stimulation.</title><p>(<bold>A</bold>) HEK293T cells were transfected with a plasmid encoding HA-Nrf2 [used because anti-HA-antibody is orthogonal to our anti-FLAG-antibody; and because this anti-HA-antibody (for detecting HA-Nrf2) is of higher sensitivity, compared to anti-myc-antibody to myc-Nrf2], and (an)other plasmid(s) encoding: either a mix of Halo-•–3xFlag-zKeap1a and Halo-•–3xFlag-zKeap1b, Halo-•–3xFlag-zKeap1a and empty vector (EV), Halo-•–3xFlag-zKeap1b and EV, or EV alone. The plasmid amount of HA-Nrf2 was 50% in all co-transfection conditions, and the rest of the co-transfected plasmids made up the other 50% (with equal 1:1 or 1:1:1 contribution from each plasmid, as applicable). Following whole-cell NE treatment (25 µM, 18 hr), normalized cell lysates were treated with anti-Flag M2 resin to evaluate the relative extent of association between zKeap1a/b and Nrf2 following NE stimulation. Representative blots for Elution. The band around ~37 kDa in anti-Flag blot, although of unknown identity, is present almost equally in both ‘zKeap1b’ and ‘zKeap1b+zkeap1 a’ samples, and thus its presence cannot be sufficient to explain the differences observed between these two data sets. See <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref> for the corresponding Input. (<bold>B</bold>) Quantification of (<bold>A</bold>) normalized over input (see <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>) and corresponding DMSO-treated samples in each set. Right panel: Quantification for Nrf2 association to zKeap1 upon NE bolus treatment for different ratios of zKeap1a:zKeap1b. (n=6 biological replicates). (<bold>C</bold>) Proposed model illustrating paralog-specific nuanced regulation of cellular antioxidant response (AR) under steady-state vs. electrophile-stimulated conditions. <italic>Left panel:</italic> under non-electrophile-stimulated conditions, zKeap1a is a more effective antagonist of Nrf2 (and hence, AR-signaling) than zKeap1b. <italic>Right:</italic> following electrophile stimulation, zKeap1b-modification results in a large upregulation in AR through significantly-reduced binding of Nrf2. By contrast, zKeap1a-modification gives rise to a weaker AR-upregulation, and zKeap1a—likely in the electrophile-modified or -non-modified state—functions as a negative regulator to suppress Nrf2/AR-pathway activation promoted by modified-zKeap1b. See also Figure 8A–B and <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>. All numerical data present mean ± sem. Numbers above the bars represent analysis by two-tailed <italic>t</italic>-tests.</p><p><supplementary-material id="fig8sdata1"><label>Figure 8—source data 1.</label><caption><title>Full view blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig8-data1-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig8sdata2"><label>Figure 8—source data 2.</label><caption><title>Raw blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig8-data2-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig8sdata3"><label>Figure 8—source data 3.</label><caption><title>Quantification results.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-83373-fig8-data3-v4.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig8-v4.tif"/></fig><fig id="fig8s1" position="float" specific-use="child-fig"><label>Figure 8—figure supplement 1.</label><caption><title>IP assays investigating differential association of zKeap1a and zKeap1b to Nrf2, following electrophile stimulation (see also <xref ref-type="fig" rid="fig8">Figure 8A–B</xref>).</title><p>HEK293T cells were transfected with a plasmid encoding HA-Nrf2 (used because anti-HA-antibody is orthogonal to our anti-FLAG-antibody; and because this anti-HA-antibody to HA-Nrf2 is of higher sensitivity, compared to anti-myc-antibody to myc-Nrf2 which we have tested before), and (an)other plasmid(s) encoding: either a mix of Halo-•–3xFlag-zKeap1a and Halo-•–3xFlag-zKeap1b, Halo-•–3xFlag-zKeap1a and empty vector (EV), Halo-•–3xFlag-zKeap1b and EV, or EV alone. The plasmid amount of HA-Nrf2 was 50% in all co-transfection conditions, and the rest of the co-transfected plasmids made up the other 50% (with equal 1:1 or 1:1:1 contribution from each plasmid, as applicable). Following whole-cell NE treatment (25 µM, 18 hr), normalized cell lysates were treated with anti-Flag M2 resin to evaluate the relative extent of association between zKeap1a/b and Nrf2 following NE stimulation. Representative blots for Input. Note: The band around ~37 kDa in anti-Flag blot, although of unknown identity, is present almost equally in both ‘zKeap1b’ and ‘zKeap1b+zkeap1 a’ samples, and thus its presence cannot be sufficient to explain the differences observed between these two data sets.</p><p><supplementary-material id="fig8s1sdata1"><label>Figure 8—figure supplement 1—source data 1.</label><caption><title>Full view blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig8-figsupp1-data1-v4.zip"/></supplementary-material></p><p><supplementary-material id="fig8s1sdata2"><label>Figure 8—figure supplement 1—source data 2.</label><caption><title>Raw blot image.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-83373-fig8-figsupp1-data2-v4.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-fig8-figsupp1-v4.tif"/></fig></fig-group></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>This study has furnished several deliverables. On a technical level, we have established a simple, yet realistic and versatile organismal model system to interrogate on- and off-target effects of pathophysiologically-relevant native lipid-derived electrophilic metabolites represented by HNE, HDE, NE, and DE (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Because of its putative druggability and clear links to physiological well-being and disease, we used AR as a conserved model pathway <xref ref-type="bibr" rid="bib36">Poganik et al., 2019</xref>; <xref ref-type="bibr" rid="bib6">Hayes and Dinkova-Kostova, 2014</xref>; <xref ref-type="bibr" rid="bib37">Poganik and Aye, 2020</xref>, using a reporter fish strain that is freely available <xref ref-type="bibr" rid="bib31">National BioResource Project Zebrafish, 2020</xref>. Many of our assays using the reporter fish were also further supplemented with qRT-PCR, an analysis that is applicable to most signaling pathways and that interrogates endogenous genes. Furthermore, we have shown that our in vivo electrophile-targeting approach is functionally compatible with other reporter assays (e.g. Akt/FOXO pathway in live fish <xref ref-type="bibr" rid="bib25">Long et al., 2017c</xref>). It is thus likely that this regimen will be readily adaptable to the study of how LDEs and drugs with Michael-acceptor electrophilic appendages affect numerous redox-dependent pathways <xref ref-type="bibr" rid="bib23">Long and Aye, 2017a</xref>.</p><p>The setup is straightforward: the HaloTagged POI is expressed using mRNA injection; this functional fusion protein is expressed at close-to-endogenous levels; a bioinert photocaged compound is added to the fish water, and can be washed away prior to light-triggered electrophile-targeting at a user-prescribed time; and readouts are typically simple and required 10–30 fish. Although mRNA injection does have its detractors, we have found robust, reliable, and ubiquitous expression of Halo-POI can be readily obtained using this method up to at least 36 hpf, and is practically suited to studying impacts of transient protein-expression on ephemeral redox-/stress-dependent signaling responses. Furthermore, many POIs can be studied simply, without the need for tedious genetic manipulation steps. Such adaptability/simplicity is paramount for studying potential off-target proteins identified in large-scale screening assays, or for screening large numbers of compounds that could have numerous on- and off-the-path targets.</p><p>We also uncovered new insights into AR-regulation orchestrated by the different zKeap1-paralogs present in fish. These findings were derived from transient knockdowns, and Z-REX experiments that highlighted differences in responsivity to electrophiles in the head and the tail of the fish. Morphant data tied this difference to expression of zKeap1a, which we identified as a negative regulator of electrophile-induced AR. Intriguingly, our data in fish using Z-REX implied off the bat that this aspect was a dominant effect, as the in-trans expression of hKeap1 and its specific targeting was not sufficient to bypass this regulation. These results imply that Z-REX will be useful to identify such behaviors in other systems, a finding that complements the general ability of REX technologies to identify dominant electrophile-signaling events. We progressed to evaluate zKeap1a and zKeap1b function in cultured cells, where we found that expression of zKeap1a or a mixture of zKeap1a/zKeap1b could not upregulate AR following electrophile treatment. We point out that such systems are indeed apposite for study by this combination of fish and ectopic expression in human cells. This is because of the control offered by ectopic expression, and because of the overall dominant-negative effects conferred by the zKeap1a paralog. The latter render interpretation of data derived from MO rescue, particularly in a tissue-specific manner difficult to interpret.</p><p>In cells expressing zKeap1b, although this protein elicited effectively lower overall suppression of basal AR than zKeap1a, AR-upregulation upon electrophile treatment was robust. The divergent electrophile responses of zKeap1a and zKeap1b are entirely consistent with a previous report in zebrafish <xref ref-type="bibr" rid="bib15">Kobayashi et al., 2009</xref>, implying that these proteins function appropriately in cell culture. Furthermore, a single point mutation in hKeap1, to match a cysteine mutation present in zKeap1a but that remains a cysteine in zKeap1b, can recapitulate most of the zKeap1a-associated cell responses. Finally, T-REX—which allows for the most stringent and direct measurement of electrophile sensitivity known <xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>—showed that despite the disparate capabilities in basal vs. electrophile-stimulated AR-regulation, all Keap1-variants exhibit similar electrophile sensitivity. Given that we have previously published that single- or double-point mutations of LDE-sensing cysteines in Keap1 have little impact on electrophile sensing by Keap1 (<xref ref-type="bibr" rid="bib32">Parvez et al., 2015</xref>; <xref ref-type="bibr" rid="bib19">Lin et al., 2015</xref>), this result is unsurprising. On the contrary, the inability of zKeap1a to respond to electrophiles, and even zKeap1a’s activity in the wake of the poor AR-suppressing activity shown by hKeap1(C273I) mutant, warrant more investigations in further work. Nevertheless, the electrophile-signal propagation programs associated with zKeap1b-modification (which promotes AR-signaling) are resisted by zKeap1a functioning as an overall negative-regulator of electrophile-stimulated AR-upregulation (<xref ref-type="fig" rid="fig8">Figure 8C</xref>), as opposed to differences in electrophile occupancy/sensing efficiencies influencing these behaviors.</p><p>To investigate this matter further, we showed that there are subtle differences in the way zKeap1a and zKeap1b function upon electrophile treatment. Whereas zKeap1a does not undergo net release of Nrf2 upon electrophile treatment, and further does not accumulate a large amount of Nrf2 in the steady-state prior to electrophile treatment, zKeap1b net relinquishes around 40% bound-Nrf2 upon electrophile treatment, and accrues a large amount of bound-Nrf2 in the basal state prior to electrophile treatment. The mixture of zKeap1a/zKeap1b also does not undergo net release of Nrf2 upon electrophile treatment, although it can still accrue substantial bound-Nrf2 in the state prior to electrophile treatment. These data allow rationalization of our results both from zebrafish and human cell culture, and favor a model in which decrease in affinity of electrophile-modified zKeap1b for Nrf2 is a means to upregulate AR in response to electrophilic stress. It is likely that such a mode of action leads to release of bound-Nrf2 from zKeap1b upon electrophile modification, given that turnover of Nrf2 on zKeap1b is slow [or otherwise, build-up of Nrf2 would not occur upon zKeap1b overexpression (just as it does not occur on zKeap1a)], and generally AR-upregulation is observed even at low-electrophile occupancy on Keap1<sup>2,5-6</sup>. Inhibition of rebinding of Nrf2 post dissociation, and inhibition of newly-synthesized Nrf2 binding to zKeap1b may also contribute to AR increase in such circumstances, as binding also contributes to zKeap1b–Nrf2 affinity. The contribution of zKeap1b re(binding) to Nrf2 to AR-upregulation vis-à-vis the contribution of release of bound-Nrf2 is difficult to parse, and indeed beyond the scope of this paper. Of course, other potential/synergistic mechanisms—such as inhibition of zKeap1b-promoted Nrf2 degradation—could occur <italic>in tandem</italic>. But the comparison of zKeap1a/zKeap1b and zKeap1b systems argues in favor of net release being the key component of AR upregulation.</p><p>There are further <italic>potential</italic> complications in data interpretation due to there being three possible zKeap1 dimeric forms (ignoring higher order structures) in the zKeap1a/zKeap1b-mixed system. However, an appreciable amount of Nrf2 is built up on zKeap1 in the zKeap1a/Keap1b system (unlike upon expression of zKeap1a alone), and <italic>no</italic> release of Nrf2 was observed upon NE treatment (unlike upon expression of zKeap1b alone). Thus, zKeap1a exerts a significant direct effect on how zKeap1b responds to electrophiles, and hence the heterodimer, or higher order state(s) containing both proteins, must be a significant component of the zKeap1 present in the assay.</p><p>We further note that a non-inconsiderable amount of Nrf2 builds up on Keap1 in human cells, as evidenced by primarily-cytosol-localized Keap1 promoting cytosolic Nrf2 accmulation (<xref ref-type="bibr" rid="bib33">Parvez et al., 2016</xref>; <xref ref-type="bibr" rid="bib32">Parvez et al., 2015</xref>; <xref ref-type="bibr" rid="bib49">Zhang and Hannink, 2003</xref>). Such a mechanism further helps reconcile why relatively low electrophile occupancy on Keap1 is able to trigger large AR upregulation.</p><p>These studies further underscore subtle regulatory roles of lipid-derived electrophilic metabolites <xref ref-type="bibr" rid="bib34">Parvez et al., 2018</xref> and applications of advanced chemical biology techniques <xref ref-type="bibr" rid="bib28">Long et al., 2020</xref> in a model organism that enable nuanced target-specific electrophile-regulatory behaviors to be unmasked. They have unearthed interesting aspects of paralog-specific diversion and interplay, which continue to be of interest to the zebrafish community and to evolutionary biologists as a whole.</p><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Reagent type (species) or resource</th><th align="left" valign="bottom">Designation</th><th align="left" valign="bottom">Source or reference</th><th align="left" valign="bottom">Identifiers</th><th align="left" valign="bottom">Additional information</th></tr></thead><tbody><tr><td align="left" valign="bottom">Strain, strain background (<italic>Escherichia coli</italic>)</td><td align="left" valign="bottom">XL10-Gold Ultracompetent Cells</td><td align="left" valign="bottom">Agilent Technologies</td><td align="left" valign="bottom">Cat# 200315</td><td align="left" valign="bottom">N/A</td></tr><tr><td align="left" valign="bottom">Cell line (<italic>Homo-sapiens</italic>)</td><td align="char" char="." valign="bottom">293T (ATCC CRL-3216)</td><td align="left" valign="bottom">ATCC</td><td align="left" valign="bottom">Cat# CRL-3216, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:CVCL_0063">CVCL_0063</ext-link></td><td align="left" valign="bottom"><ext-link ext-link-type="uri" xlink:href="https://www.atcc.org/products/crl-3216">https://www.atcc.org/products/crl-3216</ext-link></td></tr><tr><td align="left" valign="bottom">Genetic reagent (<italic>Danio rerio</italic>)</td><td align="left" valign="bottom"><italic>Tg(–3.5gstp1:GFP)/it416b</italic></td><td align="left" valign="bottom">Japanese National BioResource Project</td><td align="left" valign="bottom">N/A</td><td align="left" valign="bottom"><ext-link ext-link-type="uri" xlink:href="https://shigen.nig.ac.jp/zebra/index_en.html">https://shigen.nig.ac.jp/zebra/index_en.html</ext-link></td></tr><tr><td align="left" valign="bottom">Genetic reagent (<italic>Danio rerio</italic>)</td><td align="left" valign="bottom">Brian’s wildtype</td><td align="left" valign="bottom">Professor Joseph Fetcho’s lab (Cornell University)</td><td align="left" valign="bottom">N/A</td><td align="left" valign="bottom">A strain of wt-zebrafish that shows low pigmentation</td></tr><tr><td align="left" valign="bottom">Genetic reagent (<italic>Danio rerio</italic>)</td><td align="left" valign="bottom">Wild-type line <italic>Casper</italic></td><td align="left" valign="bottom">Professor Joseph Fetcho’s lab (Cornell University)</td><td align="left" valign="bottom"><ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/pmc/?term=PMC2292119">PMCID:PMC2292119</ext-link></td><td align="left" valign="bottom">N/A</td></tr><tr><td align="left" valign="bottom">Recombinant DNA reagent</td><td align="left" valign="bottom">pGL4.37[luc2P/ARE/Hygro]</td><td align="left" valign="bottom">Promega</td><td align="left" valign="bottom">Cat# E3641</td><td align="left" valign="bottom">N/A</td></tr><tr><td align="left" valign="bottom">Recombinant DNA reagent</td><td align="left" valign="bottom">pGL4.75[hRluc/CMV]</td><td align="left" valign="bottom">Promega</td><td align="left" valign="bottom">Cat# E6931</td><td align="left" valign="bottom">N/A</td></tr><tr><td align="left" valign="bottom">Recombinant DNA reagent</td><td align="left" valign="bottom">pCDNA3 myc-Nrf2</td><td align="left" valign="bottom">Addgene</td><td align="left" valign="bottom">Cat# 21555, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:Addgene_21555">Addgene_21555</ext-link></td><td align="left" valign="bottom">N/A</td></tr><tr><td align="left" valign="bottom">Recombinant DNA reagent</td><td align="left" valign="bottom">pCS2 +8 vector</td><td align="left" valign="bottom">Addgene</td><td align="left" valign="bottom">Cat# 34931, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:Addgene_34931">Addgene_34931</ext-link></td><td align="left" valign="bottom">N/A</td></tr><tr><td align="left" valign="bottom">Recombinant DNA reagent</td><td align="left" valign="bottom">pFN21a Halo-TEV-Keap1</td><td align="left" valign="bottom">Halo ORFeome, Promega Kazusa collection</td><td align="left" valign="bottom">Cat# FHC00420</td><td align="left" valign="bottom">N/A</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-GFP (FITC) (goat polyclonal)</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">Cat# ab6662, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_305635">AB_305635</ext-link></td><td align="left" valign="bottom">IF (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-Flag (mouse monoclonal)</td><td align="left" valign="bottom">Sigma</td><td align="left" valign="bottom">Cat# F3165, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_259529">AB_259529</ext-link></td><td align="left" valign="bottom">WB (1:4000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-Keap1 (mouse monoclonal)</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">Cat# ab119403, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_10903761">AB_10903761</ext-link></td><td align="left" valign="bottom">IF (1:500)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-HaloTag (rabbit polyclonal)</td><td align="left" valign="bottom">Promega</td><td align="left" valign="bottom">Cat# G9281, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_713650">AB_713650</ext-link></td><td align="left" valign="bottom">WB (1:3000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-HA HRP (mouse monoclonal)</td><td align="left" valign="bottom">Sigma</td><td align="left" valign="bottom">Cat# H3663, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_262051">AB_262051</ext-link></td><td align="left" valign="bottom">IF and WB (1:500)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-β-actin HRP (mouse monoclonal)</td><td align="left" valign="bottom">Sigma</td><td align="left" valign="bottom">Cat# A3854, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_262011">AB_262011</ext-link></td><td align="left" valign="bottom">WB (1:30,000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-mouse-HRP (horse polyclonal)</td><td align="left" valign="bottom">Cell Signaling</td><td align="left" valign="bottom">Cat# 7076, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_330924">AB_330924</ext-link></td><td align="left" valign="bottom">WB (1:2000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-rabbit-HRP (goat polyclonal)</td><td align="left" valign="bottom">Cell Signaling</td><td align="left" valign="bottom">Cat# 7074, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2099233">AB_2099233</ext-link></td><td align="left" valign="bottom">WB (1:2000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-goat IgG H&amp;L (AlexaFluor568) (rabbit polyclonal)</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">Cat# ab175707, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2923275">AB_2923275</ext-link></td><td align="left" valign="bottom">IF (1:2000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-rat IgG H&amp;L (AlexaFluor568) (donkey polyclonal)</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">Cat# ab175475, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2636887">AB_2636887</ext-link></td><td align="left" valign="bottom">IF (1:500)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-mouse IgG H&amp;L (AlexaFluor568) (donkey polyclonal)</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">Cat# ab175472, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2636996">AB_2636996</ext-link></td><td align="left" valign="bottom">IF (1:1000)</td></tr><tr><td align="left" valign="bottom">Antibody</td><td align="left" valign="bottom">Anti-mouse IgG H&amp;L (AlexaFluor647) (donkey polyclonal)</td><td align="left" valign="bottom">Abcam</td><td align="left" valign="bottom">Cat# ab150107, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2890037">AB_2890037</ext-link></td><td align="left" valign="bottom">IF (1:1000)</td></tr></tbody></table></table-wrap><p>For additional information of other resources, See Appendix for detailed information on:</p><p>Sequences of cDNAs, cloning primers, qRT-PCR primers, morpholinos (MOs) and primers for splice-blocking MO validation.</p><sec id="s3-1"><title>Statistical analysis and reporting</title><p>Wherever applicable, figure legends contain information pertaining to SEM with associated P values, sample size (e.g. number of fish embryos analyzed, number of independent biological replicates). Representative raw images are included with accompanying quantitation where relevant. Figure legends contain description of independent biological replicates, vs. technical replicates. Outliers were maintained in all data sets with error bars designating SEM and p-values from application of two-tailed Students’ t-test included. Figure legends contain information pertaining to the following: the exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement; whether measurements were taken from distinct samples or whether the same sample was measured repeatedly; null hypothesis testing (two-tailed Students’ t-test) with exact p values noted whenever suitable. No statistical methods were used to pre-determine sample size. Size of datasets was chosen according to literature and based on our own experience, integrating similar methods of analysis. Number of technical replicates and biological replicates are reported in figure legends. Summary information related to sample allocation/handling is detailed in the supplementary text.Briefly, no masking was used. Prior to beginning each experiment, cells/embryos were allocated into groups randomly, for each sample group. When an experiment was commenced, groups of cells/embryos were allocated into treatment groups without pattern or bias. This ensured that each treatment group in an experiment was identical to account for any variation across cells/fish breeding. Cell counting was performed at each step of the experiment whenever relevant, to rigorously standardize conditions both within each experiment and across different experiments. Casper strain zebrafish, wild-type zebrafish, and previously-validated reporter strains were used for the experiments involving embryos and for the latter transgenic reporter strains, at consistent zygosity. As zebrafish are believed to exhibit polygenic sex determination, at the age at which experiments were undertaken, the sex of the fish was unable to be determined, but likely account for 50:50 male: female.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><p>LDEs and photocaged LDEs all contain alkyne-functionalization and were synthesized in house as previously described. All primers were from IDT. Phusion HotStart II polymerase was from Thermo Scientific. All restriction enzymes were from NEB. pFN21a Halo-TEV-Keap1 (Kazusa Collection) was from Promega. Trizol RNA purification kit, RnaseZap RNA decontamination solution, DNaseI AMP grade, and Superscript III Reverse transcriptase were from ThermoFisher Scientific. iQ SYBR Green Supermix was from BioRad. Complete EDTA free protease inhibitor was from Roche. 1 X Bradford dye was from BioRad. Photocaged precursors and the corresponding uncaged LDEs were synthesized as described previously <xref ref-type="bibr" rid="bib24">Long et al., 2017b</xref>; <xref ref-type="bibr" rid="bib51">Zhao et al., 2018</xref>; <xref ref-type="bibr" rid="bib44">Surya et al., 2018</xref>. Cy5 azide and Cu(TBTA) were from Lumiprobe. Dithiothreitol (DTT) and TCEP-HCl were from Goldbio Biotechnology. Streptavidin sepharose beads were from GE Healthcare. Bovine Serum Albumin (BSA) powder was from Thermo Scientific. CYP inhibitor, PF-4981517, was from ApexBio. Bardoxolone methyl (CDDO-Me), and dimethyl fumarate (Tecfidera) were from Selleckchem. Zirconia beads were from Biospec. Glass beads (150–200 μm) were from Sigma. Biotin-dPEG11-azide was from Quanta Biodesign. Lithium dodecyl sulfate (LDS) was from Chem-Impex. Sulforaphane was from Santa Cruz Biotech. Tryspin inhibitor from Glycine max and all other chemicals were from Sigma. The empty pCS2 +8 vector (Addgene #34931) was from Addgene. Morpholinos were synthesized by Gene Tools, LLC. 365 nm UV lamp was from Spectroline (XX-15N) for T-REX experiments in fish (Z-REX), 365 nm UV was from Camag (022.9160) for T-REX experiments in cells. For T-REX experiments, the lamps were positioned above zebrafish embryos in six-well plates such that the power of UV irradiation was ~5 mW/ cm<sup>2</sup> [as measured by a hand-held power sensor Spectroline, XDS-1000] and ~3 mW/cm<sup>2</sup> for cells. For all imaging experiments, a Leica M205-FA microscope equipped with a stereomicroscope was used, aside from <xref ref-type="fig" rid="fig6">Figure 6A</xref> that was imaged on a LSM710 (Zeiss). Quantitation of fluorescence intensity was performed using Image-J software (NIH, version 1.50 g). In-gel fluorescence analysis and imaging of western blots and Coomassie stained gel were performed using BioRad Chemi-Doc MP Imaging system. Densitometric quantitation was performed using Image-J (NIH). Cy5 excitation source was epi illumination and 695/55 emission filter was used. Quantitative PCR (qRT-PCR) was performed using Light Cycler 480 instrument (Roche Life Sciences). Anti-Flag M2 affinity agarose gel was from Sigma-Aldrich (A2220). Primer information and antibodies used are listed in <bold>Appendix</bold>.</p><sec id="s4-1"><title>Plasmids</title><p>Plasmids to express (His<sub>6</sub>)-Halo-TEV-Keap1-(2xHA) (hereafter, Halo-•-Keap1) and (His<sub>6</sub>)-Halo-(2xHA)-P2A-TEV-Keap1-(2xHA) (hereafter, Halo-P2A-•-Keap1) in pCS2 +8 vectors were cloned using ligase-independent cloning method using primers specified in <bold>Appendix</bold>. Briefly, Halo-TEV-Keap1 was amplified from pFN21a Halo-TEV-Keap1 (Halo ORFeome, Promega Kazusa collection) using fwd1 and rev1 primers. The amplified product was then extended using fwd ext1 and rev ext1. An additional extension step was performed using the product from the first extension step as the template and using primers fwd ext2 and rev ext2 to generate the ‘megaprimer’. The ‘megaprimer’ was inserted in empty pCS2 +8 vector linearized using EcoR1.</p><p>To generate Halo-P2A-•-Keap1, Halo and Tev-Keap1 were amplified separately from pFN21a Halo-TEV-Keap1 using primers fwd1 and rev1, and fwd1’ and rev1’, respectively. The amplified products were then extended using fwd ext1 and rev ext1, and fwd ext1’ and rev ext1’. The two fragments were joined using PCR and amplified using another set of primers, fwd ext2 and rev ext2, to generate the ‘megaprimer’. The ‘megaprimer’ was inserted in empty pCS2 +8 vector linearized using EcoR1.</p><p>To generate zKeap1a and zKeap1b in mammalian expression vectors, RNA from wild-type zebrafish was isolated and used to generate cDNA using an oligo(dT) primer. From the cDNA, primers designed to overlap with the zKeap1a/b sequences were used to amplify zKeap1a and zKeap1b. The primers also contained an overlapping region with the pCS2 +8 backbone. The empty pCS2 +8 plasmid was cut with EcoRI-HF enzyme and the zKeap1a/b PCR product with overlapping pCS2 +8 backbone was inserted into the vector. To obtain HaloTagged zKeap1a/b, the zKeap1a/b plasmids were cut with SpeI and a ‘megaprimer’ PCR sequence encoding Halo-TEV-Flag (3 x) was inserted to form the full construct: Halo-TEV-Flag3-zKeap1a/b, referred to as Halo-•-(3xF)-zKeap1a/b. The amino acid sequence for zKeap1a and zKeap1b from our fish matched the sequences reported in uniprot. Note: additional synonymous mutations were introduced in pCS2 +8 Halo-•–3xFlag-zKeap1a to prevent knockdown interference in the course of rescue experiments where embryos were injected with both Keap1a-ATG-MO MO and Halo-•–3xFlag-zKeap1a mRNA. The stop codon was added separately by site-directed mutagenesis. All primers used are listed in <bold>Appendix</bold>.</p><p>Successful inserts for each plasmid were identified with colony PCR. ‘Hit’ colonies were grown overnight in LB-AMP medium and purified using a miniprep kit (Bio Basic, BS614). The insert was fully sequenced at the Cornell Biotechnology Resource Center Genomics facility and Microsynth AG (Switzerland).</p></sec><sec id="s4-2"><title>Fish husbandry and crossing</title><p>All procedures performed at Cornell (2017–2018) and EPFL (2018-present) conform to the animal care, maintenance, and experimentation procedures followed by Cornell University’s and EPFL’s Institutional Animal Care and Use Committee (IACUC) guidelines and approved by the respective institutional committees. All experiments with zebrafish performed at EPFL (2018-present) have been performed in accordance with the Swiss regulations on Animal Experimentation (Animal Welfare Act SR 455 and Animal Welfare Ordinance SR 455.1), in the EPFL zebrafish unit, cantonal veterinary authorization VD-H23. Either Casper strain or <italic>Tg(–3.5gstp1:GFP)/it416b</italic> reporter [hereafter <italic>Tg(gstp1:GFP</italic>)] <italic>Danio rerio</italic> (zebrafish) were used for all experiments. Casper strain was a kind gift from the Fetcho Lab (Cornell University). <italic>Tg(gstp1:GFP</italic>) fish was from the Japanese National BioResource Project. Since zebrafish are believed to exhibit polygenic sex determination, at the age at which experiments were undertaken, sex of the fish was unable to be determined, although our samples are likely roughly equal mixtures of males and females. Animals were maintained and embryos were obtained according to standard fish husbandry procedures. For <italic>Tg(gstp1:GFP</italic>) fish, crosses were set between a homozygous transgenic parent and a WT parent such that the resulting progeny were all heterozygous for the reporter gene.</p></sec><sec id="s4-3"><title>Fish injection and Z-REX</title><p>For injection in fish embryos, mRNA for Halo-•-Keap1 and Halo-P2A-•-Keap1 was generated. First, the desired genes were amplified using RNA-fwd and RNA-rev primers (<bold>Appendix</bold>). mRNA was generated using an mMessage mMachine SP6 in vitro transcription kit (Ambion, AM1340) as per manufacturer’s protocol except the reaction was scaled up for two preps.</p><p>Fertilized eggs at the one- to four-cell stage were injected with 2 nl mRNA (1.3–1.6 mg/ml) and/or morpholino (2.7 mg/mL, approximately 5 ng of MO per fish) into the yolk sac. Immediately after injection, embryos were pooled, and separated into two petri dishes (10 cm) filled with 30 mL 10% Hank’s salt solution with methylene blue and penicillin (100 U/ml) / streptomycin (100 µg/ml). To one set was added the photocaged precursor to designated LDE at a final concentration of 6 µM and to the other equal volume of DMSO in the dark. Embryos were maintained at 28 °C in the dark for 28 hr after which time fish larva were washed in 10% Hank’s solution with no methylene blue/antibiotic (3 times for 30 min each). Larvae were moved to six-well plates. Half of the larvae (Ht-PreLDE-treated or -untreated) were exposed to light for 4 min, and the other half of each set was not. For bolus dosing, treatment of larvae with LDEs was staggered such that the harvest time was the same for all samples including larvae that underwent Z-REX (34 hpf). Further experiments were performed as illustrated in <bold>Appendix</bold>-Scheme 1 and described elsewhere in the supplementary methods, and main and supporting figure legends.</p></sec><sec id="s4-4"><title>qRT-PCR</title><p>All qPCR experiments were performed in casper strain. 2 hr post light illumination or bolus LDE treatment, 12–15 larvae per sample were euthanized by chilling, dechorionated, the head and tail separated using sharp forceps (11252–40 Dumont #5 Forceps - Biologie/Titanium), and transferred to separate Eppendorf tubes. The samples were washed twice with ice-cold PBS and homogenized in 1 mL Trizol (ThermoFisher Scientific, 15596018) together with vortexing with glass beads for 2 min. Total RNA was extracted per manufacturer’s protocol. Glycoblue (ThermoFisher Scientific, AM9516) was used for visualization of the RNA pellet. Around 600 ng of total RNA was treated with AMP grade DNaseI (ThermoFisher Scientific, 18068015), reverse transcribed using Superscript III reverse transcriptase (ThermoFisher Scientific, 18080085) per manufacturer’s instruction. qRT-PCR was performed for the indicated genes using primers specified in <bold>Appendix</bold>. All primers were validated as previously reported. qRT-PCR analysis was performed with iQ SYBR Green Supermix (Bio-Rad, 170–8880) on a Light Cycler 480 instrument (Roche). In a total volume of 10 µL the PCR reaction mix contained, in final concentrations, 1 X iQ SYBR Green Supermix, 0.30 µM each of the forward and reverse primers and 10–13 ng of template cDNA. The qPCR program was set for 3 min at 95 °C followed by 40-repeat cycles comprising heating at 95 °C for 10 s and at 55 °C for 10 s. The expected products were of ~100–130 bp in size. The data was analyzed using ΔΔC<sub>t</sub> method and presented relative to zebrafish actin, β2.</p></sec><sec id="s4-5"><title>Immunofluorescence</title><p>To assess AR upregulation in <italic>Tg</italic>(<italic>gstp1:GFP</italic>) fish, larvae 4 hr post light illumination or bolus LDE treatment were dechorionated, washed twice in ice-cold PBS and fixed in 4% paraformaldehyde in 1 X PBS (Gibco 14190169) for at least overnight with gentle rocking at 4 °C. Fixed larvae were permeabilized with chilled methanol at –20 °C for 4 hr–overnight. Fish were then washed 2 times with PBS-0.1%Tween-1% DMSO for 30 min each with gentle rocking, then blocked in PBS-0.1%Tween containing 2% BSA and 10% FBS, then stained with anti-GFP FITC conjugated (Abcam, ab6662) primary antibody overnight at 4 °C in blocking buffer. Subsequently, the larvae were washed twice (30 min each wash), re-blocked for 1 hr at room temperature, and incubated with the AlexaFluor 568-conjugated fluorescent secondary antibodies (Abcam, ab175707) in blocking buffer for 1.5 hr at room temperature with gentle rocking, and then washed three times. Fish were imaged on 2% agarose plates on a Leica M205-FA equipped with a stereomicroscope. Quantitation of IF data was performed using ImageJ/FIJI (NIH).</p><p>To assess protein expression in zebrafish, larvae were fixed at 34 hours post fertilization (hpf) after dechorionation. Permeabilization and immunostaining protocols are as above except antibodies to the desired protein/tag and appropriate secondary antibodies were used.</p></sec><sec id="s4-6"><title>Click coupling in whole fish</title><p>Casper zebrafish expressing Halo-•-Keap1, and either treated with the photocaged precursor (6 μM, overnight) or bolus treatment (2 hr) with the indicated LDE, were dechorionated at 34 hpf and fixed in 4% PFA for at least overnight with gentle rocking at 4 °C. Where relevant, PF-4981517 (1 or 5 µM) was added 4 hr prior to LDE treatment. Fish were then permeated in methanol (100%) at −20 °C for at least 24 hr. Fish were then washed twice in PBS and two times in Hepes (50 mM, pH 7.6) for 30 min each (Note: Fish tend to float after MeOH wash. Allow them to settle prior to manipulation/washing). Fish were then exposed to a cocktail containing (in final concentration): 50 mM Hepes (pH 7.6), <italic>t</italic>-BuOH (5%), CuSO<sub>4</sub> (1.1 mM), sodium ascorbate (10 mM; made as a 100 mM stock in 500 mM Hepes (pH 7.6) with no further pH adjustment), and Cy5-azide (10 µM). This was shaken at room temperature for 1 h, then washed three times in 1 x PBS with 0.015% Tween-20. After third wash, fish were incubated overnight at 4 °C, then fresh 1 x PBS with 0.015% Tween-20 was added and fish were imaged. Fixed fish can stick to plastic. Tween helps to reduce this problem.</p></sec><sec id="s4-7"><title>Click coupling and enrichment of modified proteins</title><p>Casper zebrafish expressing Halo-•-Keap1 were treated with either the photocaged precursor or bolus treatment with the indicated LDEs (~120 per condition). Photocaged precursors were added to the fish water after injection of Halo-•-Keap1 mRNA at a final concentration of 6 μM and Z-REX was performed as specified above. Bolus dosing was done for 2 hr. Immediately after Z-REX, larvae were dechorionated and deyolked manually at 4 °C, washed twice with cold PBS to remove yolk proteins, and washed once with cold 50 mM Hepes (pH 7.6). The zebrafish pellet was flash frozen in liquid nitrogen and stored at −80 °C until lysis. Fish pellet was resuspended in 50 mM Hepes (pH 7.6), 1% Triton X-100, 0.1 mg/ml soybean trypsin inhibitor, and 2 X Roche protease inhibitor. Lysis was performed by vortexing with Zirconia beads for 20 s and subsequent 3 times freeze-thaw. Lysate protein was collected after centrifugation at 21,000×g for 10 min, and concentration determined using Bradford dye relative to BSA standard. 30–50 μg of the lysate protein was removed, quenched with Laemmli buffer and saved as input. The remaining lysate was diluted to 1 mg/ml with 50 mM Hepes (pH 7.6) and 0.2 mM TCEP, TEV protease was added at a final concentration of 0.2 mg/ml, and the sample incubated at 37 °C for 30 min. Next, 5% <italic>t</italic>-BuOH was added to the sample. A stock solution containing 10% SDS, 10 mM CuSO<sub>4</sub>, 1 mM Cu-TBTA, 1 mM biotin-azide and 20 mM TCEP (made as a 100 mM stock in 500 mM HEPES pH 7.5) was prepared and added to the sample such that the final concentration are as follows: 1% SDS, 1 mM CuSO<sub>4</sub>, 0.1 mM Cu-TBTA, 0.1 mM biotin-azide, and 2 mM TCEP. The mixture was mixed thoroughly and incubated at 37 °C for 15 min, after which another 1 mM TCEP was added, mixed, and the sample incubated for additional 15 min. Protein precipitation was performed by adding EtOH (prechilled at −20 °C) at a final concentration of 75% (v/v), vortexing the sample, and incubating at −80 °C for at least overnight. Precipitated protein was collected by centrifugation at 21,000×g at 4 °C for 2 hr, washed twice with prechilled EtOH (twice), once with 75% EtOH in water, and an additional wash with prechilled acetone. Precipitate was air-dried and subsequently redissolved in 8% LDS in 50 mM HEPES (pH 7.6), 1 mM EDTA by sonication at 50 °C and vortexing. The solubilized lysate protein was collected following centrifugation and diluted in 50 mM Hepes (pH 7.6) to give a final concentration of 0.5% LDS. The sample was added to pre-washed streptavidin high-capacity resin and incubated at 4–6 hr at rt. The supernatant was removed following a low-speed centrifugation (1000×g), and the beads washed thrice with 50 mM Hepes (pH 7.6) containing 0.5% LDS. Bound proteins were eluted by boiling beads in 2 x Laemmli buffer with 6% βME at 98 °C. Samples were analyzed using SDS-PAGE followed by western blot as specified below.</p></sec><sec id="s4-8"><title>SDS-PAGE and western blot</title><p>Up to 30 μl of input or elution samples were separated on a 10% polyacrylamide gel using SDS-PAGE. The gel was subsequently transferred to a PVDF membrane at 4 °C in ice-cold transfer buffer containing 25 mM Tris, 192 mM Glycine, and 15% Methanol (v/v). Membrane was blocked in 5% milk for 2 hr at rt, incubated with primary antibody in 1% milk for 5 hr at rt, washed three times with Tris Buffer Saline (100 mM Tris, pH 7.6, 150 mM NaCl) containing 0.2% Tween-20 (TBST). Where applicable, the membrane was incubated with secondary antibody in 1% milk for 5 hr at rt, washed twice with TBST, followed by an additional wash with TBS. Pierce ECL western blotting substrate was used for detection of the desired protein bands.</p></sec><sec id="s4-9"><title>Data quantitation and analysis</title><p>Imaging data was quantitated using ImageJ (NIH). For assessing AR upregulation in <italic>Tg</italic>(<italic>gstp1:GFP</italic>) fish, the area around the head (excluding the eyes), the tail (median fin fold), or the whole fish (excluding the yolk sac) were selected using freeform selection tool. Corresponding illustrations are included in each sub-figure for clarity. For IF, the mean red fluorescence intensity of the selected region was measured and subtracted from the mean background fluorescence intensity (region with no fish). For live fish imaging, the mean GFP fluorescence intensity of the selected region was measured and subtracted from the mean background fluorescence intensity (non-transgenic fish).</p><p>The mean value for the control group was calculated from the raw, background-subtracted, values within that control group. Then all raw values were divided by the mean for the control. n for imaging experiments represent the number of single cells or fish embryos quantified from at least 7–8 fields of view with controls (empty vector controls for ectopically-overexpressed proteins, shRNA knockdown cell controls for endogenous proteins) shown in the figures.</p><p>Unless specified, all <italic>t</italic> tests were two-tailed analysis. n for western blot/gels, qRT-PCR, and luciferase assays represents the number of lanes on western blots/gels under identical experimental conditions and each lane is from a separate individual replicate, no. of independent biological replicates as indicated in the figure legends.</p></sec><sec id="s4-10"><title>Cell culture</title><p>HEK293T cells (obtained from ATCC) were cultured in complete 10% FBS medium (MEM Glutamax, 1 X sodium pyruvate, 1 X penicillin streptomycin, 1 X MEM NEAA, 10% FBS). Cells were grown at 37 °C with 5% CO<sub>2</sub> in a humidified incubator. Cell lines were verified to be free of mycoplasma contamination by Venor GeM Mycoplasma Detection Kit from Sigma.</p></sec><sec id="s4-11"><title>AR reporter screen bolus dosing</title><p>HEK293T cells were seeded in 48 (or 96) well plates (cell density was 0.25×10<sup>6</sup> cells/mL, 0.3 mL (or 0.1 mL) cells per well). Cells were transfected with 100 (or 33) ng pCDNA3 myc-Nrf2, 100 (or 33) ng luciferase plasmid mix (20:1 Firefly luciferase ARE promoter:Renilla CMV promoter), and 100 (or 33) ng total of either empty pCS2 +8, WT Keap1 (hKeap1, zKeap1a, or zKeap1b), or hKeap1 C273I. Transfection was carried out using Mirus TransIT-2020 transfection reagent. After 24 hr of transfection, the medium was removed and replaced with rinse medium (MEM glutamax, 1 X sodium pyruvate, 1 X penicillin streptomycin, 1 X MEM NEAA) containing 25 μM NE or HNE or corresponding volume of DMSO. Cells were incubated for a further 18 hr, at which point they were lysed in 65 (or 30) μL passive lysis buffer by shaking at room temperature for 25 min. 25 μL of sample was transferred to a 96-well opaque white plate for reading, and an additional 30 μL of sample was mixed with 10 μL of 4 X Laemmli dye with BME to run on a gel to confirm expression levels of the variants of Keap1. A BioTek Cytation3 or a Perkin Elmer 2300 microplate reader was used to perform Firefly and <italic>Renilla</italic> luciferase activity readings as previously reported <xref ref-type="bibr" rid="bib51">Zhao et al., 2018</xref>; <xref ref-type="bibr" rid="bib44">Surya et al., 2018</xref>.</p></sec><sec id="s4-12"><title>AR reporter assay following T-REX</title><p>Procedure was followed as above, except T-REX was performed as previously published after 24 hr of transfection and the cells were lysed 18 hr post light <xref ref-type="bibr" rid="bib51">Zhao et al., 2018</xref>; <xref ref-type="bibr" rid="bib44">Surya et al., 2018</xref>. Briefly, after 24 hr transfection, 10 μM Ht-PreHNE was added to the cells in rinse medium (or corresponding amount of DMSO). After 2 hr incubation in the dark, the medium was removed, and the cells rinsed three times with rinse medium, half an hour for each rinse. After the last rinse, the cells were exposed to UV light (~3 mW/cm<sup>2</sup>) for 5 min and returned to the incubator for 18 hr before being lysed and read as described above.</p></sec><sec id="s4-13"><title>T-REX electrophile-labeling assay in cells</title><p>HEK293T cells were transfected to express Halo-TEV-hKeap1, Halo-TEV-hKeap1 (C273I), or Halo-TEV-zKeap1a/b. After 36 hr of transfection, 25 µM of PreHNE or PreNE was introduced. After 2 hr of incubation in the dark, the cells were rinsed three times, 30 min each. The cells were exposed to light (~5 mW/cm<sup>2</sup>) for 10 min, incubated for a further 5 min, and then harvested. Click reactions with Cy5-azide were performed as previously published <xref ref-type="bibr" rid="bib51">Zhao et al., 2018</xref>; <xref ref-type="bibr" rid="bib27">Long et al., 2019</xref>.</p></sec><sec id="s4-14"><title>MO validation – translation inhibition reporter assay</title><p>Plasmids were generated that contained the binding site of the zKeap1a or zKeap1b ATG morpholino (the start codon and approximately 20 following bases) upstream of the gene encoding Firefly Luciferase (with a Gly-Ser linker). mRNA was generated using mMessage mMachine SP6 in vitro transcription kit. To test the translation blocking ability of the MOs, 50 ng of mRNA (0.136 µM) was incubated with random control MO, standard control MO, water, or corresponding zKeap1 MO in indicated ratios for 5 min at room temperature. Then, each sample was added to Rabbit Reticulocyte Lysate (Promega) and incubated at 37 °C for 15 min. The sample was loaded onto a white plate (Corning 3912) and the Firefly Luciferase quantified using standard methods. A decrease in Firefly signal indicated blocked translation.</p></sec><sec id="s4-15"><title>MO validation – splice blocking analysis by RT-PCR</title><p>The yolk sac of <italic>Tg(gstp1:GFP</italic>) embryos at the one- to four-cell stage was microinjected with approximately 2 nL of splice-blocking (SPL) morpholino oligonucleotides [0.5 mM (GeneTools LLC; sequences in <bold>Appendix</bold>)]. Embryos were grown at 28.5 °C and euthanized at 30 hpf. Euthanized embryos were lysed by vortexing for approximately 30 s in Trizol (Life Technologies) with zirconia beads, and RNA was isolated following the manufacturer’s protocol. The quality of the RNA was assessed by Nanodrop spectrophotometry (A260/A280 ratio ~2) and integrity was assessed by agarose gel electrophoresis. 1 μg of total RNA was treated with amplification-grade DNase I (NEB) and reverse transcribed using Oligo(dT)<sub>20</sub> as a primer and Superscript III Reverse Transcriptase (Life Technologies) following the manufacturer’s protocols. The resulting cDNA was used as a template in PCR reactions with primers flanking the sites targeted by the splice-blocking MOs (<bold>Appendix</bold>). PCR products were resolved on an agarose gel and band intensity was quantitated using the Measure tool of Image-J(NIH).</p></sec><sec id="s4-16"><title>MO validation – assessment of relative protein expression levels by whole-mount immunofluorescence (IF)</title><p>The yolk sac of <italic>Tg(gstp1:GFP</italic>) embryos at the one- to four-cell stage was microinjected with approximately 2 nL of morpholino oligonucleotides, namely SPL-MOs targeting zKeap1a and zKeap1b [0.5 mM (GeneTools LLC; sequences in <bold>Appendix</bold>)]. Embryos were grown at 28.5 °C and euthanized at 30 hpf. Whole-mount IF was carried out as described above, using anti-Keap1.</p></sec><sec id="s4-17"><title>MO validation – zkeap1a/b-mRNA overexpression rescues effects of the zkeap1a/b MOs</title><p>Either Approach (<bold>1</bold>) or (<bold>2</bold>) below, was deployed as indicated in figure legends and text discussion: (<bold>1</bold>) The yolk sac of <italic>Tg(gstp1:GFP</italic>) embryos at the one- to four-cell stage was co-microinjected with 2 nL of 0.2 mM zKeap1a-ATG-MO and 250 ng/μL Halo-TEV-zKeap1a mRNA. Embryos were grown at 28.5 °C and treated with 10 μM NE alkyne at 4 hpf for 4 hr before being imaged. (<bold>2</bold>) The yolk sac of <italic>Tg(gstp1:GFP</italic>) embryos at the one- to four-cell stage was co-microinjected with 2 nL of 0.25 mM zKeap1b-ATG-MO and 250 ng/μL Halo-TEV-zKeap1b mRNA. Embryos were grown at 28.5 °C and treated with 20 μM NE alkyne at 30 hpf for 4 hr before image acquisition. Whole-mount IF was carried out as described above, using anti-GFP FITC-conjugated (Abcam, ab6662) primary antibody and AlexaFluor 568-conjugated fluorescent secondary antibody (Abcam, ab175707). <bold>NOTE:</bold> the bolus LDE dosage and MO concentrations deployed were reduced in Approach (1), since the blastula period (4 hpf) was found to be more sensitivite to high-LDE/MO-dosage-induced viability loss.</p></sec><sec id="s4-18"><title>Anti-flag immunoprecipitation</title><p>HEK293T cells (~5–6×10<sup>6</sup>) were seeded in a 10 cm adherent tissue culture plate. After the cells reached 70–80% confluence (~18–24 h), the media were replaced with fresh complete media (8 mL). Cells were transfected with 7.5 µg (total amount) of indicated plasmid(s) using TransIT-2020 transfection reagent (per the manufacturer’s recommendation, Mirus). Following 24–36 hr incubation period, the media were changed, and the cells were treated with fresh media containing either 25 µM NE or DMSO, and incubated for a further 18 h. Cells were harvested, pooled, washed twice with ice-chilled 1 X DPBS, and flash-frozen in liquid nitrogen. Cell lysis was performed by first resuspending the cell pellets in 100–200 µL (per 1.5×10<sup>6</sup> cells) of lysis buffer [containing in final concentrations, 50 mM Hepes (pH 7.6), 150 mM NaCl, 1% Nonidet P-40 and 1 X Roche cOmplete, mini, EDTA-free protease inhibitor cocktail], then by subjecting the resulting cell suspension to rapid freeze-thaw cycles (x3). The lysate was clarified by centrifugation at 18,000 x g for 10 min at 4 °C. Total protein concentration was determined using Bradford assay using BSA as standard (triplicate measurements were made and average value was taken). The lysate was subsequently diluted to 2 mg/mL with binding buffer containing in final concentrations, 50 mM Hepes (pH 7.6), 150 mM NaCl, 1 X Roche cOmplete, mini, EDTA-free protease inhibitor cocktail, and 0.1% Tween-20. This diluted lysate was subjected to either 50–100 µL bed volume of Anti-Flag M2 affinity agarose gel (A2220, Sigma) that had been pre-equilibrated with the binding buffer above. The sample was incubated with beads overnight at 4 °C by end-over-end rotation, after which time the supernatant was removed post-centrifugation at 500 x g. The beads were washed three times at 4 °C with 500 µL wash buffer containing in final concentrations, 50 mM Hepes (pH 7.6), 150 mM NaCl, 1 X Roche cOmplete, mini, EDTA-free protease inhibitor cocktail, and 0.1% Tween-20, using end-over-end rotation over 10 min during each wash. The bound protein was eluted by incubating with 0.15 mg/mL 3 X Flag peptide for 2 h at 4 °C. The sample was subjected to SDS-PAGE and transferred to a PVDF membrane for western blot analysis using antibodies indicated in corresponding figure legends.</p></sec><sec id="s4-19"><title>Materials availability statement</title><p>All plasmids generated by the authors are provided in <bold>Appendix</bold>. These plasmids are being deposited to Addgene upon manuscript publication. In the interim, they are available from the corresponding primary contact upon request, in the same way as for small-molecule reagents used in REX technologies. All other chemical and biological materials used are commercially available and their sources are indicated in Materials &amp; Methods (<bold>Key Resources Table</bold>) and <bold>Appendix</bold>.</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn><fn fn-type="COI-statement" id="conf2"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Data curation, Formal analysis, Investigation, Writing – review and editing</p></fn><fn fn-type="con" id="con2"><p>Data curation, Formal analysis, Investigation, Writing – review and editing</p></fn><fn fn-type="con" id="con3"><p>Data curation, Formal analysis, Investigation, Writing – review and editing</p></fn><fn fn-type="con" id="con4"><p>Data curation, Formal analysis, Investigation, Writing – review and editing</p></fn><fn fn-type="con" id="con5"><p>Data curation, Formal analysis, Investigation</p></fn><fn fn-type="con" id="con6"><p>Resources</p></fn><fn fn-type="con" id="con7"><p>Resources</p></fn><fn fn-type="con" id="con8"><p>Conceptualization, Resources, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review and editing</p></fn><fn fn-type="con" id="con9"><p>Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Methodology, Writing – original draft, Project administration, Writing – review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>All procedures performed at Cornell (2017-2018) and EPFL (2018-present) conform to the animal care, maintenance, and experimentation procedures followed by Cornell University's and EPFL's Institutional Animal Care and Use Committee (IACUC) guidelines and approved by the respective institutional committees. All experiments with zebrafish performed at EPFL (2018-present) have been performed in accordance with the Swiss regulations on Animal Experimentation (Animal Welfare Act SR 455 and Animal Welfare Ordinance SR 455.1), in the EPFL zebrafish unit, cantonal veterinary authorization VD-H23.</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="mdar"><label>MDAR checklist</label><media xlink:href="elife-83373-mdarchecklist1-v4.pdf" mimetype="application" mime-subtype="pdf"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>The data generated in this study using these materials are provided in main Figures 1–8, accompanied by 17 associated figure supplements, and the source data files associated with main Figures 1–8 and 17 associated figure supplements.</p></sec><ack id="ack"><title>Acknowledgements</title><p>Novartis FreeNovation Grant; European Research Council (ERC) grant (Project no. 101043303) funded by the State Secretairat for Education, Research and Innovation, Switzerland (SERI), and Swiss Federal Institute of Technology Lausanne (EPFL) (to YA). For zebrafish husbandry: Dr. Guillaume Valentin and Ms. Chloé C L Jollivet at EPFL; and Mr. Brian J Miller and Mrs. Nikki Gilbert, and Professor Joe Fetcho (NIH R01 NS026593, PI: JRF) at Cornell University. National BioResource Project Zebrafish (NBRP) grant funded by Japanese government for Tg(gstp1:GFP) fish line. NIH CBI training grant [NIH T32GM008500 (JRP as a trainee fellow)] and AHA predoctoral fellowship (17PRE33670395 to JRP); HHMI International Fellow (SP).</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname><given-names>J</given-names></name><name><surname>Wang</surname><given-names>L</given-names></name><name><surname>Chen</surname><given-names>Y</given-names></name><name><surname>Sternberg</surname><given-names>P</given-names></name><name><surname>Cai</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Phosphatidylinositol 3 kinase pathway and 4-hydroxy-2-nonenal-induced oxidative injury in the RPE</article-title><source>Investigative Ophthalmology &amp; Visual Science</source><volume>50</volume><fpage>936</fpage><lpage>942</lpage><pub-id pub-id-type="doi">10.1167/iovs.08-2439</pub-id><pub-id pub-id-type="pmid">18806289</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cuadrado</surname><given-names>A</given-names></name><name><surname>Rojo</surname><given-names>AI</given-names></name><name><surname>Wells</surname><given-names>G</given-names></name><name><surname>Hayes</surname><given-names>JD</given-names></name><name><surname>Cousin</surname><given-names>SP</given-names></name><name><surname>Rumsey</surname><given-names>WL</given-names></name><name><surname>Attucks</surname><given-names>OC</given-names></name><name><surname>Franklin</surname><given-names>S</given-names></name><name><surname>Levonen</surname><given-names>AL</given-names></name><name><surname>Kensler</surname><given-names>TW</given-names></name><name><surname>Dinkova-Kostova</surname><given-names>AT</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Therapeutic targeting of the Nrf2 and Keap1 partnership in chronic diseases</article-title><source>Nature Reviews. Drug Discovery</source><volume>18</volume><fpage>295</fpage><lpage>317</lpage><pub-id pub-id-type="doi">10.1038/s41573-018-0008-x</pub-id><pub-id pub-id-type="pmid">30610225</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dev</surname><given-names>S</given-names></name><name><surname>Kumari</surname><given-names>S</given-names></name><name><surname>Singh</surname><given-names>N</given-names></name><name><surname>Kumar Bal</surname><given-names>S</given-names></name><name><surname>Seth</surname><given-names>P</given-names></name><name><surname>Mukhopadhyay</surname><given-names>CK</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Role of extracellular hydrogen peroxide in regulation of iron homeostasis genes in neuronal cells: implication in iron accumulation</article-title><source>Free Radical Biology &amp; Medicine</source><volume>86</volume><fpage>78</fpage><lpage>89</lpage><pub-id pub-id-type="doi">10.1016/j.freeradbiomed.2015.05.025</pub-id><pub-id pub-id-type="pmid">26006106</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fang</surname><given-names>X</given-names></name><name><surname>Fu</surname><given-names>Y</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Haegele</surname><given-names>JA</given-names></name><name><surname>Ge</surname><given-names>EJ</given-names></name><name><surname>Parvez</surname><given-names>S</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Temporally controlled targeting of 4-hydroxynonenal to specific proteins in living cells</article-title><source>Journal of the American Chemical Society</source><volume>135</volume><fpage>14496</fpage><lpage>14499</lpage><pub-id pub-id-type="doi">10.1021/ja405400k</pub-id><pub-id pub-id-type="pmid">24015839</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Florens</surname><given-names>N</given-names></name><name><surname>Calzada</surname><given-names>C</given-names></name><name><surname>Lyasko</surname><given-names>E</given-names></name><name><surname>Juillard</surname><given-names>L</given-names></name><name><surname>Soulage</surname><given-names>CO</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Modified lipids and lipoproteins in chronic kidney disease: a new class of uremic toxins</article-title><source>Toxins</source><volume>8</volume><elocation-id>376</elocation-id><pub-id pub-id-type="doi">10.3390/toxins8120376</pub-id><pub-id pub-id-type="pmid">27999257</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hayes</surname><given-names>JD</given-names></name><name><surname>Dinkova-Kostova</surname><given-names>AT</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>The Nrf2 regulatory network provides an interface between redox and intermediary metabolism</article-title><source>Trends in Biochemical Sciences</source><volume>39</volume><fpage>199</fpage><lpage>218</lpage><pub-id pub-id-type="doi">10.1016/j.tibs.2014.02.002</pub-id><pub-id pub-id-type="pmid">24647116</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Haze</surname><given-names>S</given-names></name><name><surname>Gozu</surname><given-names>Y</given-names></name><name><surname>Nakamura</surname><given-names>S</given-names></name><name><surname>Kohno</surname><given-names>Y</given-names></name><name><surname>Sawano</surname><given-names>K</given-names></name><name><surname>Ohta</surname><given-names>H</given-names></name><name><surname>Yamazaki</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>2-nonenal newly found in human body odor tends to increase with aging</article-title><source>The Journal of Investigative Dermatology</source><volume>116</volume><fpage>520</fpage><lpage>524</lpage><pub-id pub-id-type="doi">10.1046/j.0022-202x.2001.01287.x</pub-id><pub-id pub-id-type="pmid">11286617</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huang</surname><given-names>Y</given-names></name><name><surname>Li</surname><given-names>W</given-names></name><name><surname>Kong</surname><given-names>ANT</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Anti-oxidative stress regulator NF-E2-related factor 2 mediates the adaptive induction of antioxidant and detoxifying enzymes by lipid peroxidation metabolite 4-hydroxynonenal</article-title><source>Cell &amp; Bioscience</source><volume>2</volume><elocation-id>40</elocation-id><pub-id pub-id-type="doi">10.1186/2045-3701-2-40</pub-id><pub-id pub-id-type="pmid">23190551</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jacobs</surname><given-names>AT</given-names></name><name><surname>Marnett</surname><given-names>LJ</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Systems analysis of protein modification and cellular responses induced by electrophile stress</article-title><source>Accounts of Chemical Research</source><volume>43</volume><fpage>673</fpage><lpage>683</lpage><pub-id pub-id-type="doi">10.1021/ar900286y</pub-id><pub-id pub-id-type="pmid">20218676</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kachadourian</surname><given-names>R</given-names></name><name><surname>Pugazhenthi</surname><given-names>S</given-names></name><name><surname>Velmurugan</surname><given-names>K</given-names></name><name><surname>Backos</surname><given-names>DS</given-names></name><name><surname>Franklin</surname><given-names>CC</given-names></name><name><surname>McCord</surname><given-names>JM</given-names></name><name><surname>Day</surname><given-names>BJ</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>2’,5’-dihydroxychalcone-induced glutathione is mediated by oxidative stress and kinase signaling pathways</article-title><source>Free Radical Biology &amp; Medicine</source><volume>51</volume><fpage>1146</fpage><lpage>1154</lpage><pub-id pub-id-type="doi">10.1016/j.freeradbiomed.2011.05.041</pub-id><pub-id pub-id-type="pmid">21712085</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kensler</surname><given-names>TW</given-names></name><name><surname>Wakabayashi</surname><given-names>N</given-names></name><name><surname>Biswal</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Cell survival responses to environmental stresses via the keap1-nrf2-ARE pathway</article-title><source>Annual Review of Pharmacology and Toxicology</source><volume>47</volume><fpage>89</fpage><lpage>116</lpage><pub-id pub-id-type="doi">10.1146/annurev.pharmtox.46.120604.141046</pub-id><pub-id pub-id-type="pmid">16968214</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kim</surname><given-names>JH</given-names></name><name><surname>Lee</surname><given-names>S-R</given-names></name><name><surname>Li</surname><given-names>L-H</given-names></name><name><surname>Park</surname><given-names>H-J</given-names></name><name><surname>Park</surname><given-names>J-H</given-names></name><name><surname>Lee</surname><given-names>KY</given-names></name><name><surname>Kim</surname><given-names>M-K</given-names></name><name><surname>Shin</surname><given-names>BA</given-names></name><name><surname>Choi</surname><given-names>S-Y</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice</article-title><source>PLOS ONE</source><volume>6</volume><elocation-id>e18556</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0018556</pub-id><pub-id pub-id-type="pmid">21602908</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Knowles</surname><given-names>LO</given-names></name><name><surname>Knowles</surname><given-names>NR</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Toxicity and metabolism of exogenous α, β-unsaturated carbonyls in potato (Solanum tuberosum L.) tubers</article-title><source>Journal of Agricultural and Food Chemistry</source><volume>60</volume><fpage>11173</fpage><lpage>11181</lpage><pub-id pub-id-type="doi">10.1021/jf303299n</pub-id><pub-id pub-id-type="pmid">23030770</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kobayashi</surname><given-names>M</given-names></name><name><surname>Itoh</surname><given-names>K</given-names></name><name><surname>Suzuki</surname><given-names>T</given-names></name><name><surname>Osanai</surname><given-names>H</given-names></name><name><surname>Nishikawa</surname><given-names>K</given-names></name><name><surname>Katoh</surname><given-names>Y</given-names></name><name><surname>Takagi</surname><given-names>Y</given-names></name><name><surname>Yamamoto</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Identification of the interactive interface and phylogenic conservation of the Nrf2-Keap1 system</article-title><source>Genes to Cells</source><volume>7</volume><fpage>807</fpage><lpage>820</lpage><pub-id pub-id-type="doi">10.1046/j.1365-2443.2002.00561.x</pub-id><pub-id pub-id-type="pmid">12167159</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kobayashi</surname><given-names>M</given-names></name><name><surname>Li</surname><given-names>L</given-names></name><name><surname>Iwamoto</surname><given-names>N</given-names></name><name><surname>Nakajima-Takagi</surname><given-names>Y</given-names></name><name><surname>Kaneko</surname><given-names>H</given-names></name><name><surname>Nakayama</surname><given-names>Y</given-names></name><name><surname>Eguchi</surname><given-names>M</given-names></name><name><surname>Wada</surname><given-names>Y</given-names></name><name><surname>Kumagai</surname><given-names>Y</given-names></name><name><surname>Yamamoto</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>The antioxidant defense system Keap1-Nrf2 comprises a multiple sensing mechanism for responding to a wide range of chemical compounds</article-title><source>Molecular and Cellular Biology</source><volume>29</volume><fpage>493</fpage><lpage>502</lpage><pub-id pub-id-type="doi">10.1128/MCB.01080-08</pub-id><pub-id pub-id-type="pmid">19001094</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kumar</surname><given-names>S</given-names></name><name><surname>Stecher</surname><given-names>G</given-names></name><name><surname>Li</surname><given-names>M</given-names></name><name><surname>Knyaz</surname><given-names>C</given-names></name><name><surname>Tamura</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>MEGA X: molecular evolutionary genetics analysis across computing platforms</article-title><source>Molecular Biology and Evolution</source><volume>35</volume><fpage>1547</fpage><lpage>1549</lpage><pub-id pub-id-type="doi">10.1093/molbev/msy096</pub-id><pub-id pub-id-type="pmid">29722887</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Levonen</surname><given-names>AL</given-names></name><name><surname>Landar</surname><given-names>A</given-names></name><name><surname>Ramachandran</surname><given-names>A</given-names></name><name><surname>Ceaser</surname><given-names>EK</given-names></name><name><surname>Dickinson</surname><given-names>DA</given-names></name><name><surname>Zanoni</surname><given-names>G</given-names></name><name><surname>Morrow</surname><given-names>JD</given-names></name><name><surname>Darley-Usmar</surname><given-names>VM</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Cellular mechanisms of redox cell signalling: role of cysteine modification in controlling antioxidant defences in response to electrophilic lipid oxidation products</article-title><source>The Biochemical Journal</source><volume>378</volume><fpage>373</fpage><lpage>382</lpage><pub-id pub-id-type="doi">10.1042/BJ20031049</pub-id><pub-id pub-id-type="pmid">14616092</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname><given-names>L</given-names></name><name><surname>Kobayashi</surname><given-names>M</given-names></name><name><surname>Kaneko</surname><given-names>H</given-names></name><name><surname>Nakajima-Takagi</surname><given-names>Y</given-names></name><name><surname>Nakayama</surname><given-names>Y</given-names></name><name><surname>Yamamoto</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Molecular evolution of Keap1. two Keap1 molecules with distinctive intervening region structures are conserved among fish</article-title><source>The Journal of Biological Chemistry</source><volume>283</volume><fpage>3248</fpage><lpage>3255</lpage><pub-id pub-id-type="doi">10.1074/jbc.M708702200</pub-id><pub-id pub-id-type="pmid">18057000</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lin</surname><given-names>HY</given-names></name><name><surname>Haegele</surname><given-names>JA</given-names></name><name><surname>Disare</surname><given-names>MT</given-names></name><name><surname>Lin</surname><given-names>Q</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>A generalizable platform for interrogating target- and signal-specific consequences of electrophilic modifications in redox-dependent cell signaling</article-title><source>Journal of the American Chemical Society</source><volume>137</volume><fpage>6232</fpage><lpage>6244</lpage><pub-id pub-id-type="doi">10.1021/ja5132648</pub-id><pub-id pub-id-type="pmid">25909755</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Proteomics and beyond: cell decision-making shaped by reactive electrophiles</article-title><source>Trends in Biochemical Sciences</source><volume>44</volume><fpage>75</fpage><lpage>89</lpage><pub-id pub-id-type="doi">10.1016/j.tibs.2018.09.014</pub-id><pub-id pub-id-type="pmid">30327250</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Hopkins</surname><given-names>BD</given-names></name><name><surname>Luo</surname><given-names>C</given-names></name><name><surname>Wang</surname><given-names>L</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Precision targeting of pten-null triple-negative breast tumors guided by electrophilic metabolite sensing</article-title><source>ACS Central Science</source><volume>6</volume><fpage>892</fpage><lpage>902</lpage><pub-id pub-id-type="doi">10.1021/acscentsci.9b00893</pub-id><pub-id pub-id-type="pmid">32607436</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Poganik</surname><given-names>JR</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>On-Demand targeting: investigating biology with proximity-directed chemistry</article-title><source>Journal of the American Chemical Society</source><volume>138</volume><fpage>3610</fpage><lpage>3622</lpage><pub-id pub-id-type="doi">10.1021/jacs.5b12608</pub-id><pub-id pub-id-type="pmid">26907082</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2017">2017a</year><article-title>Privileged electrophile sensors: a resource for covalent drug development</article-title><source>Cell Chemical Biology</source><volume>24</volume><fpage>787</fpage><lpage>800</lpage><pub-id pub-id-type="doi">10.1016/j.chembiol.2017.05.023</pub-id><pub-id pub-id-type="pmid">28648380</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Lin</surname><given-names>HY</given-names></name><name><surname>Parvez</surname><given-names>S</given-names></name><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Poganik</surname><given-names>JR</given-names></name><name><surname>Huang</surname><given-names>P</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2017">2017b</year><article-title>Β-trcp1 is a vacillatory regulator of wnt signaling</article-title><source>Cell Chemical Biology</source><volume>24</volume><fpage>944</fpage><lpage>957</lpage><pub-id pub-id-type="doi">10.1016/j.chembiol.2017.06.009</pub-id><pub-id pub-id-type="pmid">28736239</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Parvez</surname><given-names>S</given-names></name><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Surya</surname><given-names>SL</given-names></name><name><surname>Wang</surname><given-names>Y</given-names></name><name><surname>Zhang</surname><given-names>S</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2017">2017c</year><article-title>Akt3 is a privileged first responder in isozyme-specific electrophile response</article-title><source>Nature Chemical Biology</source><volume>13</volume><fpage>333</fpage><lpage>338</lpage><pub-id pub-id-type="doi">10.1038/nchembio.2284</pub-id><pub-id pub-id-type="pmid">28114274</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Urul</surname><given-names>DA</given-names></name><name><surname>Chawla</surname><given-names>S</given-names></name><name><surname>Lin</surname><given-names>HY</given-names></name><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Haegele</surname><given-names>JA</given-names></name><name><surname>Wang</surname><given-names>Y</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Precision electrophile tagging in <italic>Caenorhabditis elegans</italic></article-title><source>Biochemistry</source><volume>57</volume><fpage>216</fpage><lpage>220</lpage><pub-id pub-id-type="doi">10.1021/acs.biochem.7b00642</pub-id><pub-id pub-id-type="pmid">28857552</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Genie in a bottle: controlled release helps TAME natural polypharmacology?</article-title><source>Current Opinion in Chemical Biology</source><volume>51</volume><fpage>48</fpage><lpage>56</lpage><pub-id pub-id-type="doi">10.1016/j.cbpa.2019.02.014</pub-id><pub-id pub-id-type="pmid">30913473</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Neighborhood Watch: tools for defining locale-dependent subproteomes and their contextual signaling activities</article-title><source>RSC Chemical Biology</source><volume>1</volume><fpage>42</fpage><lpage>55</lpage><pub-id pub-id-type="doi">10.1039/d0cb00041h</pub-id><pub-id pub-id-type="pmid">34458747</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Rogg</surname><given-names>C</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>An oculus to profile and probe target engagement in vivo: how T-REX was born and its evolution into G-REX</article-title><source>Accounts of Chemical Research</source><volume>54</volume><fpage>618</fpage><lpage>631</lpage><pub-id pub-id-type="doi">10.1021/acs.accounts.0c00537</pub-id><pub-id pub-id-type="pmid">33228351</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mills</surname><given-names>MG</given-names></name><name><surname>Ramsden</surname><given-names>R</given-names></name><name><surname>Ma</surname><given-names>EY</given-names></name><name><surname>Corrales</surname><given-names>J</given-names></name><name><surname>Kristofco</surname><given-names>LA</given-names></name><name><surname>Steele</surname><given-names>WB</given-names></name><name><surname>Saari</surname><given-names>GN</given-names></name><name><surname>Melnikov</surname><given-names>F</given-names></name><name><surname>Kostal</surname><given-names>J</given-names></name><name><surname>Kavanagh</surname><given-names>TJ</given-names></name><name><surname>Zimmerman</surname><given-names>JB</given-names></name><name><surname>Voutchkova-Kostal</surname><given-names>AM</given-names></name><name><surname>Brooks</surname><given-names>BW</given-names></name><name><surname>Coish</surname><given-names>P</given-names></name><name><surname>Anastas</surname><given-names>PT</given-names></name><name><surname>Gallagher</surname><given-names>E</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>CRISPR-generated nrf2a loss- and gain-of-function mutants facilitate mechanistic analysis of chemical oxidative stress-mediated toxicity in zebrafish</article-title><source>Chemical Research in Toxicology</source><volume>33</volume><fpage>426</fpage><lpage>435</lpage><pub-id pub-id-type="doi">10.1021/acs.chemrestox.9b00346</pub-id><pub-id pub-id-type="pmid">31858786</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="web"><person-group person-group-type="author"><collab>National BioResource Project Zebrafish</collab></person-group><year iso-8601-date="2020">2020</year><article-title>National BioResource Project Zebrafish</article-title><ext-link ext-link-type="uri" xlink:href="https://shigen.nig.ac.jp/zebra/index_en.html">https://shigen.nig.ac.jp/zebra/index_en.html</ext-link><date-in-citation iso-8601-date="2020-06-01">June 1, 2020</date-in-citation></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parvez</surname><given-names>S</given-names></name><name><surname>Fu</surname><given-names>Y</given-names></name><name><surname>Li</surname><given-names>J</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Lin</surname><given-names>H-Y</given-names></name><name><surname>Lee</surname><given-names>DK</given-names></name><name><surname>Hu</surname><given-names>GS</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Substoichiometric hydroxynonenylation of a single protein recapitulates whole-cell-stimulated antioxidant response</article-title><source>Journal of the American Chemical Society</source><volume>137</volume><fpage>10</fpage><lpage>13</lpage><pub-id pub-id-type="doi">10.1021/ja5084249</pub-id><pub-id pub-id-type="pmid">25544059</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parvez</surname><given-names>S</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Lin</surname><given-names>H-Y</given-names></name><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Haegele</surname><given-names>JA</given-names></name><name><surname>Pham</surname><given-names>VN</given-names></name><name><surname>Lee</surname><given-names>DK</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>T-REX on-demand redox targeting in live cells</article-title><source>Nature Protocols</source><volume>11</volume><fpage>2328</fpage><lpage>2356</lpage><pub-id pub-id-type="doi">10.1038/nprot.2016.114</pub-id><pub-id pub-id-type="pmid">27809314</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parvez</surname><given-names>S</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Poganik</surname><given-names>JR</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Redox signaling by reactive electrophiles and oxidants</article-title><source>Chemical Reviews</source><volume>118</volume><fpage>8798</fpage><lpage>8888</lpage><pub-id pub-id-type="doi">10.1021/acs.chemrev.7b00698</pub-id><pub-id pub-id-type="pmid">30148624</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Poganik</surname><given-names>JR</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Getting the message? native reactive electrophiles pass two out of three thresholds to be bona fide signaling mediators</article-title><source>BioEssays</source><volume>40</volume><elocation-id>e1700240</elocation-id><pub-id pub-id-type="doi">10.1002/bies.201700240</pub-id><pub-id pub-id-type="pmid">29603288</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Poganik</surname><given-names>JR</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Disare</surname><given-names>MT</given-names></name><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Chang</surname><given-names>SH</given-names></name><name><surname>Hla</surname><given-names>T</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Post-Transcriptional regulation of nrf2-mrna by the mRNA-binding proteins HuR and AUF1</article-title><source>FASEB Journal</source><volume>33</volume><fpage>14636</fpage><lpage>14652</lpage><pub-id pub-id-type="doi">10.1096/fj.201901930R</pub-id><pub-id pub-id-type="pmid">31665914</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Poganik</surname><given-names>JR</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Electrophile signaling and emerging immuno- and neuro-modulatory electrophilic pharmaceuticals</article-title><source>Frontiers in Aging Neuroscience</source><volume>12</volume><elocation-id>1</elocation-id><pub-id pub-id-type="doi">10.3389/fnagi.2020.00001</pub-id><pub-id pub-id-type="pmid">32116644</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Poganik</surname><given-names>JR</given-names></name><name><surname>Huang</surname><given-names>KT</given-names></name><name><surname>Parvez</surname><given-names>S</given-names></name><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Raja</surname><given-names>S</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Wdr1 and cofilin are necessary mediators of immune-cell-specific apoptosis triggered by tecfidera</article-title><source>Nature Communications</source><volume>12</volume><elocation-id>5736</elocation-id><pub-id pub-id-type="doi">10.1038/s41467-021-25466-x</pub-id><pub-id pub-id-type="pmid">34593792</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Raghunath</surname><given-names>A</given-names></name><name><surname>Nagarajan</surname><given-names>R</given-names></name><name><surname>Sundarraj</surname><given-names>K</given-names></name><name><surname>Palanisamy</surname><given-names>K</given-names></name><name><surname>Perumal</surname><given-names>E</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Identification of compounds that inhibit the binding of keap1a/keap1b kelch DGR domain with Nrf2 ETGE/DLG motifs in zebrafish</article-title><source>Basic &amp; Clinical Pharmacology &amp; Toxicology</source><volume>125</volume><fpage>259</fpage><lpage>270</lpage><pub-id pub-id-type="doi">10.1111/bcpt.13222</pub-id><pub-id pub-id-type="pmid">30861618</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Saito</surname><given-names>R</given-names></name><name><surname>Suzuki</surname><given-names>T</given-names></name><name><surname>Hiramoto</surname><given-names>K</given-names></name><name><surname>Asami</surname><given-names>S</given-names></name><name><surname>Naganuma</surname><given-names>E</given-names></name><name><surname>Suda</surname><given-names>H</given-names></name><name><surname>Iso</surname><given-names>T</given-names></name><name><surname>Yamamoto</surname><given-names>H</given-names></name><name><surname>Morita</surname><given-names>M</given-names></name><name><surname>Baird</surname><given-names>L</given-names></name><name><surname>Furusawa</surname><given-names>Y</given-names></name><name><surname>Negishi</surname><given-names>T</given-names></name><name><surname>Ichinose</surname><given-names>M</given-names></name><name><surname>Yamamoto</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Characterizations of three major cysteine sensors of Keap1 in stress response</article-title><source>Molecular and Cellular Biology</source><volume>36</volume><fpage>271</fpage><lpage>284</lpage><pub-id pub-id-type="doi">10.1128/MCB.00868-15</pub-id><pub-id pub-id-type="pmid">26527616</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sant</surname><given-names>KE</given-names></name><name><surname>Hansen</surname><given-names>JM</given-names></name><name><surname>Williams</surname><given-names>LM</given-names></name><name><surname>Tran</surname><given-names>NL</given-names></name><name><surname>Goldstone</surname><given-names>JV</given-names></name><name><surname>Stegeman</surname><given-names>JJ</given-names></name><name><surname>Hahn</surname><given-names>ME</given-names></name><name><surname>Timme-Laragy</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>The role of Nrf1 and Nrf2 in the regulation of glutathione and redox dynamics in the developing zebrafish embryo</article-title><source>Redox Biology</source><volume>13</volume><fpage>207</fpage><lpage>218</lpage><pub-id pub-id-type="doi">10.1016/j.redox.2017.05.023</pub-id><pub-id pub-id-type="pmid">28582729</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schopfer</surname><given-names>FJ</given-names></name><name><surname>Cipollina</surname><given-names>C</given-names></name><name><surname>Freeman</surname><given-names>BA</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Formation and signaling actions of electrophilic lipids</article-title><source>Chemical Reviews</source><volume>111</volume><fpage>5997</fpage><lpage>6021</lpage><pub-id pub-id-type="doi">10.1021/cr200131e</pub-id><pub-id pub-id-type="pmid">21928855</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seppanen</surname><given-names>CM</given-names></name><name><surname>Csallany</surname><given-names>AS</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Incorporation of the toxic aldehyde 4-hydroxy-2- trans -nonenal into food fried in thermally oxidized soybean oil</article-title><source>Journal of the American Oil Chemists’ Society</source><volume>81</volume><fpage>1137</fpage><lpage>1141</lpage><pub-id pub-id-type="doi">10.1007/s11746-004-1031-3</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Surya</surname><given-names>SL</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Urul</surname><given-names>DA</given-names></name><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Mercer</surname><given-names>EJ</given-names></name><name><surname>EIsaid</surname><given-names>IM</given-names></name><name><surname>Evans</surname><given-names>T</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Cardiovascular small heat shock protein HSPB7 is a kinetically privileged reactive electrophilic species (Res) sensor</article-title><source>ACS Chemical Biology</source><volume>13</volume><fpage>1824</fpage><lpage>1831</lpage><pub-id pub-id-type="doi">10.1021/acschembio.7b00925</pub-id><pub-id pub-id-type="pmid">29397684</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Timme-Laragy</surname><given-names>AR</given-names></name><name><surname>Karchner</surname><given-names>SI</given-names></name><name><surname>Franks</surname><given-names>DG</given-names></name><name><surname>Jenny</surname><given-names>MJ</given-names></name><name><surname>Harbeitner</surname><given-names>RC</given-names></name><name><surname>Goldstone</surname><given-names>JV</given-names></name><name><surname>McArthur</surname><given-names>AG</given-names></name><name><surname>Hahn</surname><given-names>ME</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Nrf2b, novel zebrafish paralog of oxidant-responsive transcription factor NF-E2-related factor 2 (Nrf2)</article-title><source>The Journal of Biological Chemistry</source><volume>287</volume><fpage>4609</fpage><lpage>4627</lpage><pub-id pub-id-type="doi">10.1074/jbc.M111.260125</pub-id><pub-id pub-id-type="pmid">22174413</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Trott</surname><given-names>A</given-names></name><name><surname>West</surname><given-names>JD</given-names></name><name><surname>Klaić</surname><given-names>L</given-names></name><name><surname>Westerheide</surname><given-names>SD</given-names></name><name><surname>Silverman</surname><given-names>RB</given-names></name><name><surname>Morimoto</surname><given-names>RI</given-names></name><name><surname>Morano</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Activation of heat shock and antioxidant responses by the natural product celastrol: transcriptional signatures of a thiol-targeted molecule</article-title><source>Molecular Biology of the Cell</source><volume>19</volume><fpage>1104</fpage><lpage>1112</lpage><pub-id pub-id-type="doi">10.1091/mbc.E07-10-1004</pub-id><pub-id pub-id-type="pmid">18199679</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Van Hall-Beauvais</surname><given-names>A</given-names></name><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Urul</surname><given-names>DA</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Single-protein-specific redox targeting in live mammalian cells and <italic>C. elegans</italic></article-title><source>Current Protocols in Chemical Biology</source><volume>10</volume><elocation-id>e43</elocation-id><pub-id pub-id-type="doi">10.1002/cpch.43</pub-id><pub-id pub-id-type="pmid">30085412</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>C</given-names></name><name><surname>Weerapana</surname><given-names>E</given-names></name><name><surname>Blewett</surname><given-names>MM</given-names></name><name><surname>Cravatt</surname><given-names>BF</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>A chemoproteomic platform to quantitatively MAP targets of lipid-derived electrophiles</article-title><source>Nature Methods</source><volume>11</volume><fpage>79</fpage><lpage>85</lpage><pub-id pub-id-type="doi">10.1038/nmeth.2759</pub-id><pub-id pub-id-type="pmid">24292485</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>DD</given-names></name><name><surname>Hannink</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Distinct cysteine residues in Keap1 are required for Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress</article-title><source>Molecular and Cellular Biology</source><volume>23</volume><fpage>8137</fpage><lpage>8151</lpage><pub-id pub-id-type="doi">10.1128/MCB.23.22.8137-8151.2003</pub-id><pub-id pub-id-type="pmid">14585973</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>DD</given-names></name><name><surname>Chapman</surname><given-names>E</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>The role of natural products in revealing NRF2 function</article-title><source>Natural Product Reports</source><volume>37</volume><fpage>797</fpage><lpage>826</lpage><pub-id pub-id-type="doi">10.1039/c9np00061e</pub-id><pub-id pub-id-type="pmid">32400766</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Wang</surname><given-names>Y</given-names></name><name><surname>Zhang</surname><given-names>S</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Ube2V2 is a Rosetta stone bridging redox and ubiquitin codes, coordinating DNA damage responses</article-title><source>ACS Central Science</source><volume>4</volume><fpage>246</fpage><lpage>259</lpage><pub-id pub-id-type="doi">10.1021/acscentsci.7b00556</pub-id><pub-id pub-id-type="pmid">29532025</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhao</surname><given-names>Y</given-names></name><name><surname>Miranda Herrera</surname><given-names>PA</given-names></name><name><surname>Chang</surname><given-names>D</given-names></name><name><surname>Hamelin</surname><given-names>R</given-names></name><name><surname>Long</surname><given-names>MJC</given-names></name><name><surname>Aye</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Function-guided proximity mapping unveils electrophilic-metabolite sensing by proteins not present in their canonical locales</article-title><source>PNAS</source><volume>119</volume><elocation-id>e2120687119</elocation-id><pub-id pub-id-type="doi">10.1073/pnas.2120687119</pub-id><pub-id pub-id-type="pmid">35082156</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zou</surname><given-names>Y</given-names></name><name><surname>Wang</surname><given-names>J</given-names></name><name><surname>Peng</surname><given-names>J</given-names></name><name><surname>Wei</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Oregano essential oil induces SOD1 and GSH expression through Nrf2 activation and alleviates hydrogen peroxide-induced oxidative damage in IPEC-J2 cells</article-title><source>Oxidative Medicine and Cellular Longevity</source><volume>2016</volume><elocation-id>5987183</elocation-id><pub-id pub-id-type="doi">10.1155/2016/5987183</pub-id><pub-id pub-id-type="pmid">28105249</pub-id></element-citation></ref></ref-list><app-group><app id="appendix-1"><title>Appendix 1</title><sec sec-type="appendix" id="s8"><title>Gene Sequences</title><sec sec-type="appendix" id="s8-1"><title>(His<sub>6</sub>)-Halo-TEV-hKeap1-(2×HA)</title><list list-type="simple"><list-item><p><named-content content-type="sequence">ATGGGCAGCAGCCATCATCATCATCATCATGGGTCAGGGATGGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCTCGAGATTTCCGGCGAGCCAACCACTGAGGATCTGTACTTTCAGAGCGATAACGCGATCGCCATGCAGCCAGATCCCAGGCCTAGCGGGGCTGGGGCCTGCTGCCGATTCCTGCCCCTGCAGTCACAGTGCCCTGAGGGGGCAGGGGACGCGGTGATGTACGCCTCCACTGAGTGCAAGGCGGAGGTGACGCCCTCCCAGCATGGCAACCGCACCTTCAGCTACACCCTGGAGGATCATACCAAGCAGGCCTTTGGCATCATGAACGAGCTGCGGCTCAGCCAGCAGCTGTGTGACGTCACACTGCAGGTCAAGTACCAGGATGCACCGGCCGCCCAGTTCATGGCCCACAAGGTGGTGCTGGCCTCATCCAGCCCTGTCTTCAAGGCCATGTTCACCAACGGGCTGCGGGAGCAGGGCATGGAGGTGGTGTCCATTGAGGGTATCCACCCCAAGGTCATGGAGCGCCTCATTGAATTCGCCTACACGGCCTCCATCTCCATGGGCGAGAAGTGTGTCCTCCACGTCATGAACGGTGCTGTCATGTACCAGATCGACAGCGTTGTCCGTGCCTGCAGTGACTTCCTGGTGCAGCAGCTGGACCCCAGCAATGCCATCGGCATCGCCAACTTCGCTGAGCAGATTGGCTGTGTGGAGTTGCACCAGCGTGCCCGGGAGTACATCTACATGCATTTTGGGGAGGTGGCCAAGCAAGAGGAGTTCTTCAACCTGTCCCACTGCCAACTGGTGACCCTCATCAGCCGGGACGACCTGAACGTGCGCTGCGAGTCCGAGGTCTTCCACGCCTGCATCAACTGGGTCAAGTACGACTGCGAACAGCGACGGTTCTACGTCCAGGCGCTGCTGCGGGCCGTGCGCTGCCACTCGTTGACGCCGAACTTCCTGCAGATGCAGCTGCAGAAGTGCGAGATCCTGCAGTCCGACTCCCGCTGCAAGGACTACCTGGTCAAGATCTTCGAGGAGCTCACCCTGCACAAGCCCACGCAGGTGATGCCCTGCCGGGCGCCCAAGGTGGGCCGCCTGATCTACACCGCGGGCGGCTACTTCCGACAGTCGCTCAGCTACCTGGAGGCTTACAACCCCAGTGACGGCACCTGGCTCCGGTTGGCGGACCTGCAGGTGCCGCGGAGCGGCCTGGCCGGCTGCGTGGTGGGCGGGCTGTTGTACGCCGTGGGCGGCAGGAACAACTCGCCCGACGGCAACACCGACTCCAGCGCCCTGGACTGTTACAACCCCATGACCAATCAGTGGTCGCCCTGCGCCCCCATGAGCGTGCCCCGTAACCGCATCGGGGTGGGGGTCATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTATGATGGTCACACGTTCCTGGACAGTGTGGAGTGTTACGACCCAGATACAGACACCTGGAGCGAGGTGACCCGAATGACATCGGGCCGGAGTGGGGTGGGCGTGGCTGTCACCATGGAGCCCTGCCGGAAGCAGATTGACCAGCAGAACTGTACCTGTGGCAGCTACCCATACGATGTTCCAGATTACGCTGGCAGCTACCCA TACGATGTTCCAGATTACGCTTAA</named-content></p></list-item></list></sec><sec sec-type="appendix" id="s8-2"><title>(His<sub>6</sub>)-Halo-(2×HA)-P2A-TEV-hKeap1-(2×HA)</title><list list-type="simple"><list-item><p><named-content content-type="sequence">ATGGGCAGCAGCCATCATCATCATCATCATGGGTCAGGGATGGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCTCGAGATTTCCGGCTATCCTTACGACGTCCCAGACTACGCCGGCAGCTACCCATACGATGTTCCAGATTACGCCGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTGGCAGCGAGCCAACCACTGAGGATCTGTACTTTCAGAGCGATAACGCGATCGCCATGCAGCCAGATCCCAGGCCTAGCGGGGCTGGGGCCTGCTGCCGATTCCTGCCCCTGCAGTCACAGTGCCCTGAGGGGGCAGGGGACGCGGTGATGTACGCCTCCACTGAGTGCAAGGCGGAGGTGACGCCCTCCCAGCATGGCAACCGCACCTTCAGCTACACCCTGGAGGATCATACCAAGCAGGCCTTTGGCATCATGAACGAGCTGCGGCTCAGCCAGCAGCTGTGTGACGTCACACTGCAGGTCAAGTACCAGGATGCACCGGCCGCCCAGTTCATGGCCCACAAGGTGGTGCTGGCCTCATCCAGCCCTGTCTTCAAGGCCATGTTCACCAACGGGCTGCGGGAGCAGGGCATGGAGGTGGTGTCCATTGAGGGTATCCACCCCAAGGTCATGGAGCGCCTCATTGAATTCGCCTACACGGCCTCCATCTCCATGGGCGAGAAGTGTGTCCTCCACGTCATGAACGGTGCTGTCATGTACCAGATCGACAGCGTTGTCCGTGCCTGCAGTGACTTCCTGGTGCAGCAGCTGGACCCCAGCAATGCCATCGGCATCGCCAACTTCGCTGAGCAGATTGGCTGTGTGGAGTTGCACCAGCGTGCCCGGGAGTACATCTACATGCATTTTGGGGAGGTGGCCAAGCAAGAGGAGTTCTTCAACCTGTCCCACTGCCAACTGGTGACCCTCATCAGCCGGGACGACCTGAACGTGCGCTGCGAGTCCGAGGTCTTCCACGCCTGCATCAACTGGGTCAAGTACGACTGCGAACAGCGACGGTTCTACGTCCAGGCGCTGCTGCGGGCCGTGCGCTGCCACTCGTTGACGCCGAACTTCCTGCAGATGCAGCTGCAGAAGTGCGAGATCCTGCAGTCCGACTCCCGCTGCAAGGACTACCTGGTCAAGATCTTCGAGGAGCTCACCCTGCACAAGCCCACGCAGGTGATGCCCTGCCGGGCGCCCAAGGTGGGCCGCCTGATCTACACCGCGGGCGGCTACTTCCGACAGTCGCTCAGCTACCTGGAGGCTTACAACCCCAGTGACGGCACCTGGCTCCGGTTGGCGGACCTGCAGGTGCCGCGGAGCGGCCTGGCCGGCTGCGTGGTGGGCGGGCTGTTGTACGCCGTGGGCGGCAGGAACAACTCGCCCGACGGCAACACCGACTCCAGCGCCCTGGACTGTTACAACCCCATGACCAATCAGTGGTCGCCCTGCGCCCCCATGAGCGTGCCCCGTAACCGCATCGGGGTGGGGGTCATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTATGATGGTCACACGTTCCTGGACAGTGTGGAGTGTTACGACCCAGATACAGACACCTGGAGCGAGGTGACCCGAATGACATCGGGCCGGAGTGGGGTGGGCGTGGCTGTCACCATGGAGCCCTGCCGGAAGCAGATTGACCAGCAGAACTGTACCTGTGGCAGCTACCCATACGATGTTCCAGATTACGCTGGCAGCTACCCATACGATGTTCCAGATTACGCTTAA</named-content></p></list-item></list></sec><sec sec-type="appendix" id="s8-3"><title>Myc-Halo-TEV-3×Flag-zKeap1a</title><list list-type="simple"><list-item><p><named-content content-type="sequence">ATGGAACAAAAACTCATCTCAGAAGAGGATCTGATGGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCTCGAGATTTCCGGCTCAGGGGAAAACTTGTATTTCCAGGGCTCAGGGATGGATTATAAAGATCATGATGGCGATTATAAAGATCATGATATTGATTATAAAGATGATGATGATAAAATGATATGTCCAAGAAAGAAGAGGCCCATCAAAGATGAGGATTTCTCCGCCATCGTGGTCCCCTCCATGAGGGGTCACGGTTACTTGGATTACACGGTTGAAAGTCATCCGTCTAAAGCTCTGCAGAACATGGACGAGCTGCGTCATCATGAAATGCTGTGTGATCTGGTTCTGCATGTCACATACAAGGACAAGATAGTGGATTTTAAGGTGCATAAGCTGGTTCTGGCCGCCTCCAGTCCTTACTTCAAAGCCATGTTCACCAGCAACTTCAAGGAGTGCCACGCGTCGGAAGTCACCCTTCGAGACGTTTGTCCTCAAGTCATCAGCCGTCTCATTGACTTTGCCTACACCTCGCGCATCACAGTTGGCGAGACCTGCGTTCTTCACGTCCTCTTGACCGCCATGCGCTACCAAATGGAAGAAGTGGCCAAAGCCTGCTGCGATTTCCTCATGAAGAACCTGGAGCCATCCAATGTCATCGGCATCTCGAGATTCGCTGAGGAGATCGGCTGCACTGACCTACACCTTCGCACCAGAGAGTATATCAACACTCACTTCAATGAGGTAACCAAAGAAGAAGAGTTCTTCAGCTTGTCCCATTGCCAGCTGCTTGAGCTGATCAGTCAGGACAGTCTGAAGGTGCTCTGCGAGAGCGAGGTCTACAAGGCCTGCATAGACTGGGTACGCTGGGACGCAGAGAGCCGTGCGCAGTACTTCCATGCCCTCCTCAATGCCGTCCACATCTACGCCCTTCCACCCACTTTCCTCAAAAGACAACTGCAGTCCTGCCCCATCCTCAGCAAGGCCAACTCCTGCAAAGACTTCCTATCAAAGATCTTCCATGAAATGGCTCTCCGAAAACCCCTGCCGCCAACACCTCATCGTGGGACGCAGCTCATTTACATAGCGGGAGGTTACAAGCAACACTCTCTGGACACCTTGGAGGCCTTCGACCCGCACAAGAACGTCTGGCTCAAACTAGGTAGCATGATGTCTCCTTGTAGCGGGCTTGGGGCGTGTGTTTTGTTCGGGCTTCTTTATACAGTCGGCGGACGCAATCTCTCCCTGCAGAACAACACAGAATCTGGATCTTTGTCCTGCTACAACCCCATGACTAACCAGTGGACCCAGCTGGCTCCGCTCAACACACCCAGAAACCGAGTGGGCGTCGGGGTCATTGATGGGAGCATTTATGCTGTTGGGGGTTCACATGCCTCTACGCATCACAACAGCGTCGAGAGGTATGACCCAGAAACAAACCGCTGGACGTTTGTGGCCCCTATGTCAGTGGCGCGACTAGGGGCCGGTGTGGCGGCATGTGGAGGTTGCCTGTATGTGGTAGGAGGGTTTGACGGGGACAACCGGTGGAACACAGTGGAGCGATACCAACCAGACACCAACACCTGGCAGCATGTGGCACCTATGAACACAGTGCGCAGCGGGCTGGGGGTGGTGTGTATGGATAACTACCTCTATGCAGTTGGAGGCTATGATGGACAAACCCAACTCAAAACCATGGAGAGATATAACATCACTCGAGATGTGTGGGAACCCATGGCTTCGATGAACCACTGCCGCAGTGCACATGGAGTCTCAGTCTACCAGTGCAAGATTTTTGTGTTAGGTGGATTTAACCAAGGTGGTTTCCTGTCCAGTGTGGAGTGCTACTGTCCCGCCAGTAATGTATGGACGCTTGTAACAGATATGCCCGTGGGACGCAGTGGAATGGGTGTAGCTGTGACCATGGAACCGTGTCCTGGTATCCTGCCAGAGGAGGAGGAAGAAGTGGACGAGGAGATGTGA</named-content></p></list-item></list></sec><sec sec-type="appendix" id="s8-4"><title>Myc-Halo-TEV-3×Flag-zKeap1a (synonymous mutations preventing zKeap1a-ATG-MO binding)</title><list list-type="simple"><list-item><p><named-content content-type="sequence">ATGGAACAAAAACTCATCTCAGAAGAGGATCTGATGGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCTCGAGATTTCCGGCTCAGGGGAAAACTTGTATTTCCAGGGCTCAGGGATGGATTATAAAGATCATGATGGCGATTATAAAGATCATGATATTGATTATAAAGATGATGATGATAAAATGATATGTCCAAGAAAGAAGAGGCCCATCAAAGATGAGGATTTCTCCGCCATCGTGGTCCCCTCCATGAGGGGTCACGGTTACTTGGATTACACGGTTGAAAGTCATCCGTCTAAAGCTCTGCAGAACATGGACGAGCTGCGTCATCATGAAATGCTGTGTGATCTGGTTCTGCATGTCACATACAAGGACAAGATAGTGGATTTTAAGGTGCATAAGCTGGTTCTGGCCGCCTCCAGTCCTTACTTCAAAGCCATGTTCACCAGCAACTTCAAGGAGTGCCACGCGTCGGAAGTCACCCTTCGAGACGTTTGTCCTCAAGTCATCAGCCGTCTCATTGACTTTGCCTACACCTCGCGCATCACAGTTGGCGAGACCTGCGTTCTTCACGTCCTCTTGACCGCCATGCGCTACCAAATGGAAGAAGTGGCCAAAGCCTGCTGCGATTTCCTCATGAAGAACCTGGAGCCATCCAATGTCATCGGCATCTCGAGATTCGCTGAGGAGATCGGCTGCACTGACCTACACCTTCGCACCAGAGAGTATATCAACACTCACTTCAATGAGGTAACCAAAGAAGAAGAGTTCTTCAGCTTGTCCCATTGCCAGCTGCTTGAGCTGATCAGTCAGGACAGTCTGAAGGTGCTCTGCGAGAGCGAGGTCTACAAGGCCTGCATAGACTGGGTACGCTGGGACGCAGAGAGCCGTGCGCAGTACTTCCATGCCCTCCTCAATGCCGTCCACATCTACGCCCTTCCACCCACTTTCCTCAAAAGACAACTGCAGTCCTGCCCCATCCTCAGCAAGGCCAACTCCTGCAAAGACTTCCTATCAAAGATCTTCCATGAAATGGCTCTCCGAAAACCCCTGCCGCCAACACCTCATCGTGGGACGCAGCTCATTTACATAGCGGGAGGTTACAAGCAACACTCTCTGGACACCTTGGAGGCCTTCGACCCGCACAAGAACGTCTGGCTCAAACTAGGTAGCATGATGTCTCCTTGTAGCGGGCTTGGGGCGTGTGTTTTGTTCGGGCTTCTTTATACAGTCGGCGGACGCAATCTCTCCCTGCAGAACAACACAGAATCTGGATCTTTGTCCTGCTACAACCCCATGACTAACCAGTGGACCCAGCTGGCTCCGCTCAACACACCCAGAAACCGAGTGGGCGTCGGGGTCATTGATGGGAGCATTTATGCTGTTGGGGGTTCACATGCCTCTACGCATCACAACAGCGTCGAGAGGTATGACCCAGAAACAAACCGCTGGACGTTTGTGGCCCCTATGTCAGTGGCGCGACTAGGGGCCGGTGTGGCGGCATGTGGAGGTTGCCTGTATGTGGTAGGAGGGTTTGACGGGGACAACCGGTGGAACACAGTGGAGCGATACCAACCAGACACCAACACCTGGCAGCATGTGGCACCTATGAACACAGTGCGCAGCGGGCTGGGGGTGGTGTGTATGGATAACTACCTCTATGCAGTTGGAGGCTATGATGGACAAACCCAACTCAAAACCATGGAGAGATATAACATCACTCGAGATGTGTGGGAACCCATGGCTTCGATGAACCACTGCCGCAGTGCACATGGAGTCTCAGTCTACCAGTGCAAGATTTTTGTGTTAGGTGGATTTAACCAAGGTGGTTTCCTGTCCAGTGTGGAGTGCTACTGTCCCGCCAGTAATGTATGGACGCTTGTAACAGATATGCCCGTGGGACGCAGTGGAATGGGTGTAGCTGTGACCATGGAACCGTGTCCTGGTATCCTGCCAGAGGAGGAGGAAGAAGTGGACGAGGAGATGTGA</named-content></p></list-item></list></sec><sec sec-type="appendix" id="s8-5"><title>Myc-Halo-TEV-3×Flag-zKeap1b</title><list list-type="simple"><list-item><p><named-content content-type="sequence">ATGGAACAAAAACTCATCTCAGAAGAGGATCTGATGGCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCTCGAGATTTCCGGCTCAGGGGAAAACTTGTATTTCCAGGGCTCAGGGATGGATTATAAAGATCATGATGGCGATTATAAAGATCATGATATTGATTATAAAGATGATGATGATAAAATGTTGGCGGCGGCGGGCATGACGGAGTGTAAGGCGGAGGTGACGCCGTCGGCCAGCAATGGGCACCGCGTGTTCAGCTACACGTTGGAGAGCCACACGGCCGCCGCCTTCGCCATCATGAACGAGCTGCGGCGCGAGAGACAGCTGTGTGACGTCACACTCCGCGTGCGCTACTGCCCGCTCGACACACACGTCGACTTCGTGGCGCATAAGGTGGTGCTGGCCTCGTCCTCGCCTGTGTTCCGCGCCATGTTCACCAACGGCCTGAAGGAGTGCGGCATGGAGGTGGTGCCCATCGAGGGGATACACCCCAAGGTCATGGGCCGGCTCATTGAGTTTGCGTACACGGCGAGCATCTCAGTGGGTGAGAAGTGTGTGATCCACGTGATGAACGGCGCCGTGATGTACCAGATCGACAGCGTGGTTCAGGCCTGCTGTGATTTCCTGGTGGAGCAGCTGGACCCCAGTAACGCCATCGGCATCGCCAGCTTCGCCGAGCAGATCGGCTGCACGGAGCTCCACCAGAAGGCCAGAGAGTACATCTACATGAACTTCAGCCAGGTGGCGACGCAGGAGGAGTTCTTCACCCTGTCTCACTGTCAGCTGGTGACCCTGATCAGCCGGGACGAGCTGAACGTGCGCTGCGAGTCGGAGGTGTTCCACGCGTGTGTGGCGTGGGTTCAGTACGACCGTGAGGAGCGGCGTCCGTATGTGCAGGCGCTGCTGCAGGCCGTCCGCTGCCACTCGCTCACGCCGCACTTCCTGCAGCGGCAGCTGGAGCACTTCGAGTGGGACGCGCAGAGCAAAGACTACCTGTCGCAGATCTTCCGGGACCTGACGCTGCACAAGCCCACCAAGGTCATCCCCCTGCGCACGCCCAAGGTGCCGCAGCTGATCTACACGGTGGGCGGATACTTCCGGCAGTCGCTCAGCTTCCTGGAGGCCTTCAACCCCTGCAGCGGCGCGTGGCTGCGGCTGGCGGACCTGCAGGTGCCCCGCAGCGGGCTGGCGGCCTGCGTCATCAGCGGCCTGCTGTACGCCGTGGGCGGACGCAACAACGGGCCCGACGGGAACATGGACTCACACACACTCGACTGCTACAACCCCATGAACAACTGCTGGCGGCCCTGCGCACACATGAGCGTCCCGCGCAACCGCATCGGCGTCGGCGTCATCGACGGCATGATCTACGCCGTGGGCGGATCACACGGCTGCACACACCACAACAGCGTGGAGAGGTATGACCCGGAGCGGGACAGCTGGCAGCTGGTGTCGCCAATGCTGACGCGGCGGATCGGAGTGGGCGTGGCCGTGATCAACCGGCTGCTGTATGCGGTGGGCGGCTTCGATGGGACGCACCGGCTGAGCTCCGCGGAATGCTACAACCCCGAGCGGGACGAGTGGAGGAGCATAGCGGCCATGAACACAGTCCGCAGCGGCGCAGGTGTGTGTGCGCTGGGGAACTACATCTATGTGATGGGTGGATATGACGGCACCAACCAGCTGAACACGGTGGAGCGCTACGATGTGGAGAAGGACAGCTGGAGCTTCAGCGCATCCATGCGGCACCGGCGCAGCGCTCTGGGGGTCACCACACACCACGGACGCATCTATGTGCTGGGTGGCTATGATGGGAACACGTTCCTGGACAGTGTGGAGTGTTTTGACCCAGAGACGGACTCATGGACAGAGGTCACACACATGAAGTCGGGCCGCAGCGGAGTCGGAGTCGCCGTCACCATGGAGCCCTGTCACAAAGAGCTGATCCCCTGTCAGTGCTAA</named-content></p></list-item></list></sec><sec sec-type="appendix" id="s8-6"><title>Self-cloned plasmids*:</title><table-wrap id="inlinetable1" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">pCS2 +8 HA-Nrf2</th></tr></thead><tbody><tr><td align="left" valign="bottom">pCS2 +8 His6-Halo-TEV-hKeap1(C273I)</td></tr><tr><td align="left" valign="bottom">pCS2 +8 His6-Halo-TEV-hKeap1</td></tr><tr><td align="left" valign="bottom">pCS2 +8 His6-Halo-TEV-hKeap1-(2xHA)</td></tr><tr><td align="left" valign="bottom">pCS2 +8 His6-Halo-(2xHA)-P2A-TEV-hKeap1-(2xHA)</td></tr><tr><td align="left" valign="bottom">pCS2 +8 zKeap1a</td></tr><tr><td align="left" valign="bottom">pCS2 +8 myc-Halo-TEV-3xFlag-zKeap1a</td></tr><tr><td align="left" valign="bottom">pCS2 +8 myc-Halo-TEV-3xFlag-zKeap1a, synonymous mutant preventing zKeap1a-ATG-MO binding</td></tr><tr><td align="left" valign="bottom">pCS2 +8 zKeap1b</td></tr><tr><td align="left" valign="bottom">pCS2 +8 myc-Halo-•–3xFlag-zKeap1b</td></tr></tbody></table></table-wrap></sec><sec sec-type="appendix" id="s8-7"><title>Primers for cloning plasmids</title><table-wrap id="inlinetable2" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom" rowspan="3">Primers for cloning pCS2 +8 His<sub>6</sub>-Halo-•-hKeap1-(2×HA)</th><th align="left" valign="bottom">Primers for gene amplification (His<sub>6</sub>-Halo-•-hKeap1)*template: pFN21a Halo-TEV-Keap1</th><th align="left" valign="bottom">Fwd 1:CATGGGCAGCAGCCATCATCATCATCATCATGGGTCAGGGATGGCAGAAATCGGTACTGGRev 1:CCAGCGTAATCTGGAACATCGTATGGGTAGCTGCCACAGGTACAGTTCTGCTGGTCAATC</th></tr><tr><th align="left" valign="bottom">Extension primers 1*template: PCR product from the above amplification step</th><th align="left" valign="bottom">Fwd ext 1:AGGTGACACTATAGAATACAAGCTACTTGTTCTTTTCCACCATGGGCAGCAGCCATCATCRev ext 1:AGCGTAATCTGGAACATCGTATGGGTAGCTGCCAGCGTAATCTGGAACATCGTATG</th></tr><tr><th align="left" valign="bottom">Extension primers 2*template: PCR product from the above extension step*PCR product was inserted into pCS2 +8 empty vector</th><th align="left" valign="bottom">Fwd ext 2:GTCGGAGCAAGCTTGATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTCCACCRev ext 2:CGGCCTTTAATTAATGGCGCGCCACTAGTTTAAGCGTAATCTGGAACATCG</th></tr></thead><tbody><tr><td align="left" valign="bottom" rowspan="5"><bold>Primers for cloning pCS2 +8 His<sub>6</sub>-Halo-(2×HA)-P2A-•-hKeap1-(2×HA</bold>)</td><td align="left" valign="bottom">Primers for gene amplification (Halo)<break/>*template: pFN21a Halo-TEV-Keap1</td><td align="left" valign="bottom">Fwd 1:<break/>CATGGGCAGCAGCCATCATCATCATCATCATGGGTCAGGGATGGCAGAAATCGGTACTGG<break/>Rev 1:<break/>ATGGGTAGCTGCCGGCGTAGTCTGGGACGTCGTAAGGATAGCCGGAAATCTCGAGCGTCG</td></tr><tr><td align="left" valign="bottom">Primers for gene amplification (hKeap1)<break/>*template: pFN21a Halo-TEV-Keap1</td><td align="left" valign="bottom">Fwd 1’:<break/>GCTGGAGACGTGGAGGAGAACCCTGGACCTGGCAGCGAGCCAACCACTGAGGATCTGTAC<break/>Rev 1’:<break/>CCAGCGTAATCTGGAACATCGTATGGGTAGCTGCCACAGGTACAGTTCTGCTGGTCAATC</td></tr><tr><td align="left" valign="bottom">Extension primers 1 (Halo)<break/>*template: PCR product from the above amplification (Halo) step</td><td align="left" valign="bottom">Fwd ext 1:<break/>AGGTGACACTATAGAATACAAGCTACTTGTTCTTTTCCACCATGGGCAGCAGCCATCATC<break/>Rev ext 1:<break/>AAGTTAGTAGCTCCGCTTCCGGCGTAATCTGGAACATCGTATGGGTAGCTGCCGGCGTAG</td></tr><tr><td align="left" valign="bottom">Extension primers 1’ (hKeap1)<break/>*template: PCR product from the above amplification (hKeap1) step</td><td align="left" valign="bottom">Fwd ext 1’:<break/>CGCCGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAA<break/>Rev ext 1’:<break/>AGCGTAATCTGGAACATCGTATGGGTAGCTGCCAGCGTAATCTGGAACATCGTATG</td></tr><tr><td align="left" valign="bottom">Extension primers 2<break/>*template: PCR product from the above extension (hKeap1) step<break/>*Additional PCR with the two extended product (Halo and hKeap1) was done to yield a megaprimer to be inserted into pCS2 +8 empty vector</td><td align="left" valign="bottom">Fwd ext 2:<break/>GTCGGAGCAAGCTTGATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTCCACC<break/>Rev ext 2:<break/>CGGCCTTTAATTAATGGCGCGCCACTAGTTTAAGCGTAATCTGGAACATCG</td></tr><tr><td align="left" valign="bottom" rowspan="2"><bold>Primers for cloning pCS2 +8 zKeap1a</bold></td><td align="left" valign="bottom">Primers for gene amplification (zKeap1a)<break/>*template: zKeap1a cDNA</td><td align="left" valign="bottom">Fwd:<break/>ATTAAAGGCCGGCCAGCGATCGCCGGACCCACC ATGATATGTCCAAGAAAGAAGAGGC<break/>Rev:<break/>TCTAGAGGCTCGAGAGGCCTTGAATTCGATCACATCTCCTCGTCCACTTC</td></tr><tr><td align="left" valign="bottom">Extension primers<break/>*template: PCR product from the above amplification step<break/>*PCR product was inserted into pCS2 +8 empty vector</td><td align="left" valign="bottom">Fwd:<break/>GCTACTTGTTCTTTTTGCAGGATCCACTAGTGGCGCGCCATTAATTAAAGGCCGGCCAGC<break/>Rev:<break/>CTTATCATGTCTGGATCTACGTAATACGACTCACTATAGTTCTAGAGGCTCGAGAGGCCT</td></tr><tr><td align="left" valign="bottom"><bold>Primers for cloning pCS2 +8 myc-Halo-•–3×Flag-zKeap1a</bold></td><td align="left" valign="bottom">Primers for gene amplification (myc-Halo<bold>-•–</bold>3×Flag)<break/>*template (first PCR with Fwd and Rev): pCS2 +8 myc-Halo-TEV-3x Flag<break/>*template (second PCR with Fwd and Rev extender): PCR product from first reaction<break/>*PCR product was inserted into pCS2 +8 zKeap1a</td><td align="left" valign="bottom">Fwd:<break/>GCTACTTGTTCTTTTTGCAGGATCCACTAGTGGCGCGCCATTAATTAAAGGCCGGCCAGC<break/>Rev:<break/>GCCTCTTCTTTCTTGGACATATCATTTTATCATCATCATCTTTATAATCAATATCATGAT<break/>Rev extender:<break/>ACGATGGCGGAGAAATCCTCATCTTTGATGGGCCTCTTCTTTCTTGGACATATCAT</td></tr><tr><td align="left" valign="bottom"><bold>Primers for introducing synonymous mutations in pCS2 +8 myc-Halo-•–3×Flag-zKeap1a, preventing zKeap1a-ATG-MO binding</bold></td><td align="left" valign="bottom">Primers for gene amplification<break/>*template (first PCR with Fwd and Rev): pCS2 +8 myc-Halo-•–3xFlag-zKeap1a<break/>*template (second PCR with Fwd and Rev extender): PCR product from first reaction<break/>*PCR product was inserted into pCS2 +8 myc-Halo-•–3xFlag-zKeap1a</td><td align="left" valign="bottom">Fwd:<break/>CAGAAATCGGTACTGGCTTTCCA<break/>Rev:<break/>GCGTTTCTTGCGCGGGCAGATCATTTTATCATCATCATCTTTATAATCAATATCATGATC<break/>Rev ext:<break/>GTCGGAGCAAGCTTGATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTCCACC</td></tr><tr><td align="left" valign="bottom" rowspan="3"><bold>Primers for cloning pCS2 +8 zKeap1b</bold></td><td align="left" valign="bottom">Primers for gene amplification (zKeap1b)<break/>*template: zKeap1b cDNA</td><td align="left" valign="bottom">Fwd:<break/>ATTAAAGGCCGGCCAGCGATCGCCGGACCCACC ATGTTGGCGGCGGC<break/>Rev:<break/>TCTAGAGGCTCGAGAGGCCTTGAATTCGAGCACTGACAGGGGATCAGC</td></tr><tr><td align="left" valign="bottom">Extension primers<break/>*template: PCR product from the above amplification step<break/>*PCR product was inserted into pCS2 +8 empty vector</td><td align="left" valign="bottom">Fwd:<break/>GCTACTTGTTCTTTTTGCAGGATCCACTAGTGGCGCGCCATTAATTAAAGGCCGGCCAGC<break/>Rev:<break/>CTTATCATGTCTGGATCTACGTAATACGACTCACTATAGTTCTAGAGGCTCGAGAGGCCT</td></tr><tr><td align="left" valign="bottom">Stop codon mutation primers (site-directed mutagenesis)<break/>*template: plasmid obtained from the above gene insertion step</td><td align="left" valign="bottom">Fwd:<break/>CACAAAGAGCTGATCCCCTGTCAGTGC<bold>TAA</bold>TCGAATTCAAGGCCTCTCGAGCCTCTAGA<break/>Rev:<break/>TCTAGAGGCTCGAGAGGCCTTGAATTCG<bold>ATT</bold>AGCACTGACAGGGGATCAGCTCTTTGTG</td></tr><tr><td align="left" valign="bottom"><bold>Primers for cloning pCS2 +8 myc-Halo-•–3×Flag-zKeap1b</bold></td><td align="left" valign="bottom">Primers for gene amplification (myc-Halo<bold>-•–</bold>3×Flag)<break/>*template (first PCR with Fwd and Rev): pCS2 +8 myc-Halo-TEV-3x Flag<break/>*template (second PCR with Fwd and Rev extender): PCR product from first reaction<break/>*PCR product was inserted into pCS2 +8 zKeap1b</td><td align="left" valign="bottom">Fwd:<break/>GCTACTTGTTCTTTTTGCAGGATCCACTAGTGGCGCGCCATTAATTAAAGGCCGGCCAGC<break/>Rev:<break/>CGTCATGCCCGCCGCCGCCAACATTTTATCATCATCATCTTTATAATCAATATCATGAT<break/>Rev ext:<break/>CCATTGCTGGCCGACGGCGTCACCTCCGCCTTACA CTCCGTCATGCCCGC</td></tr></tbody></table></table-wrap></sec><sec sec-type="appendix" id="s8-8"><title>Primers for mRNA preparation from pCS2 +8 vector</title><table-wrap id="inlinetable3" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">RNA-fwd</th><th align="left" valign="bottom">CAATGGGGAGGGGCAATG</th></tr></thead><tbody><tr><td align="left" valign="bottom">RNA-rev</td><td align="left" valign="bottom">CCAAGCGCGCAATTAACC</td></tr></tbody></table></table-wrap></sec><sec sec-type="appendix" id="s8-9"><title>Morpholino sequence</title><table-wrap id="inlinetable4" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="top">Name</th><th align="left" valign="top">Sequence</th></tr></thead><tbody><tr><td align="left" valign="top">Nrf2a ATG Morpholino</td><td align="left" valign="top">5'-CATTTCAATCTCCATCATGTCTCAG-3'</td></tr><tr><td align="left" valign="top">Nrf2a SPL Morpholino</td><td align="left" valign="top">5'-ATTAAATATTATTTACCTGTTGGCT-3'</td></tr><tr><td align="left" valign="top">Nrf2b ATG Morpholino</td><td align="left" valign="top">5'-AGCTGAAAGGTCGTCCATGTCTTCC-3'</td></tr><tr><td align="left" valign="top">Keap1a ATG Morpholino</td><td align="left" valign="top">5'-GCCTCTTCTTTCTTGGACATATCAT-3'</td></tr><tr><td align="left" valign="top">Keap1a SPL Morpholino</td><td align="left" valign="top">5'-GCTGCACTTAAAAATTGACTTACCT-3'</td></tr><tr><td align="left" valign="top">Keap1b ATG Morpholino</td><td align="left" valign="top">5'-CCAACATCAGCGCGGGCACATCC-3’</td></tr><tr><td align="left" valign="top">Keap1b SPL Morpholino</td><td align="left" valign="top">5'-GGCCCATGACCTGGAGACAAGAACA-3'</td></tr><tr><td align="left" valign="top">Control Morpholino 1</td><td align="left" valign="top">Random control morpholino from Gene Tools. It is a mixture of many oligo sequences.</td></tr><tr><td align="left" valign="top">Control Morpholino 2</td><td align="left" valign="top">Standard control oligo from Gene Tools<break/>5'-CCT CTT ACC TCA GTT ACA ATT TAT A 3'</td></tr></tbody></table></table-wrap></sec><sec sec-type="appendix" id="s8-10"><title>Morpholino validation sequence</title><table-wrap id="inlinetable5" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="top">Name</th><th align="left" valign="top">Sequence</th></tr></thead><tbody><tr><td align="left" valign="top">Keap1a MO validation sequence</td><td align="left" valign="top">ATG-ATATGTCCAAGAAAGAAGAGGCCC-GGCAGC-Firefly</td></tr><tr><td align="left" valign="top">Keap1b MO validation sequence</td><td align="left" valign="top">ATG-GGATGTGCCCGCGCTGATGTTGGC-GGCAGC-Firefly</td></tr><tr><td align="left" valign="top" colspan="2"><bold>Schematic of construct:</bold></td></tr><tr><td align="left" valign="top" colspan="2"><inline-graphic mimetype="image" mime-subtype="jpeg" xlink:href="elife-83373-inf001-v4.tif"/></td></tr></tbody></table></table-wrap></sec><sec sec-type="appendix" id="s8-11"><title>Primers for splice-blocking morpholino (SPL-MO) validation</title><table-wrap id="inlinetable6" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="top">Name</th><th align="left" valign="top">Sequence</th></tr></thead><tbody><tr><td align="left" valign="top">Keap1a SPL-MO F</td><td align="left" valign="top">5'–ATGATATGTCCAAGAAAGAAGAGGCCCATC–3'</td></tr><tr><td align="left" valign="top">Keap1a SPL-MO R1</td><td align="left" valign="top">5'–CACATTTCAGTAAACCACAAAGCTGTCACC–3'</td></tr><tr><td align="left" valign="top">Keap1a SPL-MO R2</td><td align="left" valign="top">5'–CATTGAAGTGAGTGTTGATATACTCTCTGGTGC–3'</td></tr><tr><td align="left" valign="top">Keap1b SPL-MO F1</td><td align="left" valign="top">5'–ATGTTGGCGGCGGCGG–3'</td></tr><tr><td align="left" valign="top">Keap1b SPL-MO F2</td><td align="left" valign="top">5'–CACACTCACACACACACACACACAC–3'</td></tr><tr><td align="left" valign="top">Keap1b SPL-MO R</td><td align="left" valign="top">5'–CTGAAGTTCATGTAGATGTACTCTCTGGCC–3'</td></tr></tbody></table></table-wrap></sec><sec sec-type="appendix" id="s8-12"><title>Primers for qRT-PCR</title><table-wrap id="inlinetable7" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="top">Gene of interest</th><th align="left" valign="top">Fwd Primer sequence</th><th align="left" valign="top">Rev Primer sequence</th></tr></thead><tbody><tr><td align="left" valign="top"><italic>gstpi1</italic></td><td align="left" valign="top">CTTCGCAGTCAAAGGCAGATG</td><td align="left" valign="top">CGCCCTTCATCCACTCTTCA</td></tr><tr><td align="left" valign="top"><italic>hmox1</italic></td><td align="left" valign="top">ACAGAGACTGAGAGAGATTGGC</td><td align="left" valign="top">TCTATTGGCGCTCGTCACTC</td></tr><tr><td align="left" valign="top"><italic>gsta.2</italic></td><td align="left" valign="top">AGAGCGAGCCATGATCGAC</td><td align="left" valign="top">ACTGTAGGTCTTTTCCTTGTTTTC</td></tr><tr><td align="left" valign="top"><italic>abcb6a</italic></td><td align="left" valign="top">TACTGGGCAGTAGCTTTCGC</td><td align="left" valign="top">ACTCCATCTGTTGCTCGGAC</td></tr><tr><td align="left" valign="top"><italic>gstpi2</italic></td><td align="left" valign="top">CGTGCTGGCCCTTTGAAGAT</td><td align="left" valign="top">GCTGTCCAAAGAGACATGTGG</td></tr></tbody></table></table-wrap><fig id="app1scheme1" position="float"><label>Appendix 1—scheme 1.</label><caption><title>Workflow for IF-imaging, qRT-PCR, and biotin pulldown experiments.</title></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-app1-scheme1-v4.tif"/></fig></sec></sec></app></app-group></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.83373.sa0</article-id><title-group><article-title>Editor's evaluation</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Cooper</surname><given-names>Jonathan A</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/007ps6h72</institution-id><institution>Fred Hutchinson Cancer Research Center</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group></front-stub><body><p>This is an elegant, solid, carefully performed, and substantial study investigating the divergent functions of two zebrafish paralogs of Keap1, which, in mammals, is the main negative regulator of transcription factor Nrf2, which controls cell responses to antioxidants. Curiously, one zebrafish paralog augments and the other opposes Nrf2 signaling. Creative use is made of photocaged lipid-derived electrophiles to activate one Keap1 paralog at a time without stimulating other electrophile sensors. The results will be of interest to redox biologists and those interested in the regulation of stress responses through Keap1 and Nrf2.</p></body></sub-article><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.83373.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Cooper</surname><given-names>Jonathan A</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/007ps6h72</institution-id><institution>Fred Hutchinson Cancer Research Center</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text id="sa2-box1"><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Decision letter after peer review:</bold></p><p>[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]</p><p>Thank you for submitting your work entitled &quot;Z-REX uncovers a bifurcation in function of Keap1 paralogs&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.</p><p>Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in <italic>eLife</italic>.</p><p>As you will see, there was a mixed opinion about the manuscript. While Reviewer #3 was enthusiastic, Reviewer #2 identified numerous shortcomings involving the execution and interpretation of the zebrafish experiments. Reviewer #2 also highlighted the lack of accounting for the distinct results reported in a 2008 J Biol Chem paper for functions of Keap1a and Keap1b. Reviewer #1 also raised several important concerns including a discrepancy between the behavior of Cys273 mutation here and in prior work as well as some other experimental weaknesses. Overall, it was felt that, to respond adequately to all of these important issues, the degree of extensive additional work would exceed the two month time frame expected for manuscripts invited for revision at <italic>eLife</italic>. However, if you can satisfactorily address the major criticisms at some point in the future, we would be happy too consider a version of this manuscript at that time.</p><p><italic>Reviewer #1:</italic></p><p>This is a very elegant study implicating a bifurcation in the function of the zebrafish paralogs of Keap1, the main negative regulator of transcription factor Nrf2, which controls the cellular antioxidant response (AR). The authors have used unique approaches and tools that have been previously developed in their laboratory. The findings are new and exciting, and the manuscript was a pleasure to read. However, some of the conclusions are not fully justified by the data. The authors may wish to consider addressing the following points:</p><p>1. Do any of the treatments and/or treatment combinations affect the fluorescence of GFP?</p><p>2. There seems to be induction of both gstp1 and gsta2 (Figure 3B, Figure 4C) by the light exposure alone. Has this been accounted for?</p><p>3. Does the endogenous Keap1/Nrf2 system in HEK293 cells interfere with the AR measurements?</p><p>4. Whereas the study provides an explanation for the lack of AR in the head of the zebrafish, the functional significance and the mechanism by which zKeap1a exerts its 'dominant negative function' have not been addressed and remain unclear. It has been shown for mammalian Keap1 that the substitution of C273 with I makes Keap1 unable/less able to suppress Nrf2-dependent transcription (Saito et al. Mol Cell Biol. 2015;36(2):271-84), thus providing a gain of function for Nrf2 rather than repressing Nrf2-dependent transcription. In this study, the transcriptional activity of Nrf2 (basal AR) is greater in cells expressing the Keap1 C273I mutant compared to WT Keap1 (Figure 7C) as well as in cells expressing zKeap1b compared to zKeap1a (Figure 7C,D and Figure S12), suggesting in both cases partial loss of function for Keap1 and consequently, gain of function for Nrf2. Yet, it is zKeap1a, and not zKeap1b, that has 'I' rather than 'C' at position 273 and thus is expected to resemble the mammalian Keap1 C273I mutant. How could this be rationalized?</p><p>5. The proposed model shown in Figure 8 is difficult to understand. The ascribed 'dominant negative function' of zKeap1a could be not on Nrf2-driven transcription (AR), but rather on Nrf2 turnover. An alternative mechanism to that proposed by the authors could be that a zKeap1a/zKeap1b heterodimer binds Nrf2, but is (partially) impaired to target Nrf2 for degradation thus trapping the zKeap1a/Nrf2/zKeap1b complex in the bound state, and consequently allowing Nrf2 that is synthesized de novo to accumulate and activate Nrf2-dependent transcription (AR). Testing this potential mechanism requires additional experiments.</p><p><italic>Reviewer #2:</italic></p><p>This manuscript by Long et al. investigates the functionality of T-REX in zebrafish, using a HaloTag-functionalized form of human KEAP1. The authors also examine the zebrafish homologs Keap1a and Keap1b, and they propose with a model in which: (1) Keap1a is the primary antagonist of Nrf2 under basal conditions; and (2) electrophile-modified Keap1a suppresses the Nrf2 activation that results from Keap1b modification/suppression. The authors further speculate that differences between Keap1a and Keap1b function are due to the absence of the cysteine residue that is equivalent to C273 in human KEAP1.</p><p>The authors' demonstration that T-REX works in zebrafish is fairly compelling, although it is not clear to this reviewer why extending T-REX from previous work in cultured cells and worms merits a new name for this approach (Z-REX). Ht-PreHNE conveys light-inducible expression of Nrf2 targets in zebrafish overexpressing HaloTag-functionalized KEAP1, whereas bolus HNE does not. These findings extend to other T-REX electrophiles such as Ht-PreNE and Ht-PreDE. It also appears that Nrf2 signaling in the tail but not head is responsive to these exogenous electrophiles, though the mechanistic basis for this difference remains unknown.</p><p>The authors' studies of Keap1/Nrf2 signaling in zebrafish are problematic, and my specific concerns are summarized below:</p><p>(1) The authors inexplicably fail to cite the 2008 paper by Li et al. (J. Biol. Chem., 266:3248-3255), which examines Keap1a and Keap1b function in zebrafish. This prior study demonstrates: (1) both Keap1a and Keap1b suppress Nrf2 activity in zebrafish upon their transient overexpression by mRNA injection (as assessed by gstp1 transcription); (2) both Keap1a and Keap1b promote Nrf2 degradation; (3) keap1b is the predominant homolog expressed during the first day of zebrafish development, and keap1a is transcribed at much lower levels; (4) Keap1a and Keap1b form homodimers and heterodimers; (5) cysteine residues corresponding to C288 and C273 in mammalian KEAP1 are important for the anti-Nrf2 activities of Keap1a and Keap1b, respectively.</p><p>(2) Long et al. fail to validate reagents that are essential for their studies. For example, they do not confirm that the functionality of nrf2a, nrf2b, keap1a, or keap1b MOs against their endogenous targets. Nor do they disclose the MO doses used for their studies. They instead show that keap1a and keap1b MOs can block the in vitro translation of a synthetic luciferase-encoding construct. However, the reagents are only effective at very high MO:RNA ratios for reasons that are not explained (and the actual concentrations of RNA and MO used for these studies are not described).</p><p>(3) Even if these MO reagents are truly effective, the authors over-interpret their morphant phenotypes. For instance, they state that the keap1a/keap1b double knockdown increases GFP reporter expression in the tails of Tg(gstp1:GFP) embryos relative to a control MO (Figure 2A). While the change may be statistically significant (P value = 0.0014), the magnitude appears to be only ~1.3-fold. It is unclear that this difference is biologically significant or mechanistically meaningful. The authors also state that nrf2b knockdown leads to &quot;hyperelevated AR response in the tail.&quot; Again, the P value may be &lt;0.0001, but fold-change is ~1.6 and the individual data points are broadly distributed. How confident can we really be that &quot;Nrf2b countermands electrophile-induced AR-upregulation&quot;? These issues extend to their cell culture experiments as well. For example, since co-expression of Keap1a and Keap1b does not suppress basal antioxidant responses to a greater extent than Keap1a alone (Figure 7D), the authors conclude that Keap1a affects the ability of Keap1b to affect these responses. An alternative explanation (and arguably more likely) is that Keap1a overexpression alone can maximally suppress basal antioxidant responses, especially since Keap1b appears to be less active in these assays (Figure 7C).</p><p>(4) Some of the other MO phenotypes are difficult understand in light of other results in the paper and/or missing information. For instance, Figure 1D shows that nrf2a is expressed at much higher levels than nrf2b in the zebrafish embryo tails. Yet nrf2a and nrf2b MOs have essentially the same effects on tail GFP expression in Tg(gstp1:GFP) embryos (Figure 2A)-a surprising result if &quot;Nrf2b is a minor contributor&quot; as described by the authors in the Discussion section. Were the nrf2a and nrf2b MOs used at the same dose? Do they have the same knockdown efficiency? Also, in Figure 2A-B. the keap1b MO does not alter tail GFP expression in Tg(gstp1:GFP) embryos in basal conditions, but it suppresses the differential effects of NE and DMSO on this reporter. If the morphant phenotypes reflect on-target activities, this means that Keap1b must promote NE-mediated activation of antioxidant responses, an idea that counters the conventional wisdom that NE directly suppresses the ability of Keap1 proteins to induce Nrf2 degradation. The authors should provide a mechanism that can account for these findings.</p><p>(5) Important controls are missing from some experiments. For example, the authors examine how &quot;bolus LDE treatment results in different extent of hKEAP1-labeling&quot; in Figure 6. Presumably they are using the HNE(alkyne) and NE(alkyne) labeling and Cy5 click chemistry results as evidence that these electrophiles efficiently modify KEAP1 expressed in zebrafish embryos. However, without testing the effects of these electrophiles on embryos that are not expressing exogenous KEAP1, it is not possible to know how much of the observed Cy5 signal is due to KEAP1 labeling vs. non-specific labeling of endogenous proteins.</p><p>(6) The authors overlook inconsistencies in their observations. For example, the ability of Ht-PreHNE to convey light-inducible endogenous antioxidant responses in both the tail and head of zebrafish embryos expressing HaloTag-functionalized KEAP1 (Figure 3B) seems to contradict the inability of Ht-PreHNE to convey light-inducible GFP expression in the heads of Tg(gstp1:GFP) embryos expressing the same construct (Figure 3C-D). If the GFP reporter does not faithfully recapitulate endogenous antioxidant responses, what do the differences in tail and head GFP expression mean? This is a particularly important question since the Tg(gstp1:GFP) embryos are used extensively in the authors' study.</p><p>(7) Even if the gstp1:GFP reporter is a reliable surrogate for endogenous antioxidant signaling, the authors' reliance on immunofluorescence imaging to quantify these responses is questionable. This approach is complicated by the autofluorescence and non-specific antibody binding of zebrafish embryos, and a more rigorous approach would be to assess reporter expression by quantitative western blots or qRT-PCR.</p><p>(8) The authors should also explain why their studies of KEAP1 function have focused on zebrafish embryos that are at least 24 hours post fertilization (hpf) (and certain T-REX experiments utilized 48-hpf embryos). Zebrafish studies using mRNA-mediated overexpression ae typically limited to the first 24 hours of development since the exogenous mRNA is rapidly degraded. Accordingly, the 2008 J. Biol. Chem. paper by Li et al. examined Keap1a and Keap1b activity in zebrafish gastrulae (8 hpf).</p><p>(9) The electrophile-labeling results for Ht-PreHNE and Ht-PreNE shown in Figure 7B and Supp. Figure 13 are puzzling. They suggest that ~20% of KEAP1 is HNE(alkyne)-modified and ~12% is NE(alkyne)-modified. Since it is believed that electrophile-mediated activation of NRF2 acts by stoichiometrically suppressing KEAP1 function, the authors should explain how these results relate to the ability of Ht-PreHNE and Ht-PreNE to induce antioxidant responses in embryos expressing HaloTag-functionalized KEAP1 (e.g., Figure 3, Figure 4, Supp. Figure 4, Supp. Figure 7, and Supp. Figure 9).</p><p>(10) The authors' studies of Keap1a and Keap1b function in HEK293T cells assumes that both zebrafish proteins maintain their functions in mammalian cells. There is no guarantee that this will be the case, as there will be species-specific structural differences in E3 ligase components and their substrates (not to mention different culture temperatures). Based on these cell-based assays, the authors claim that Keap1b is less efficient than Keap1a at suppressing antioxidant responses. However, this interpretation is at odds with the previous studies by Li et al. (J. Biol. Chem., 2008) that show Keap1a and Keap1b have comparable effects on Nrf2 stability and antioxidant responses in zebrafish embryos. The authors should comment on this difference.</p><p>(11) In general this manuscript is very challenging to read, and as a result, mechanisms proposed by the authors are difficult to follow. For example, the scheme in Figure 8 suggests that the electrophile-modified form of Keap1b potentiates Nrf2 function. Is this really what the authors mean to convey, as opposed to proposing that electrophile modifications of Keap1b prevent this E3 ligase component from promoting Nrf2 degradation? Or are the authors proposing that modified Keap1b can negatively regulate a suppressor of Nrf2 function? The authors also suggest the Keap1a is &quot;a dominant-negative regulator of the antioxidant response in both basal and electrophile-stimulated states.&quot; However, Keap1-mediated Nrf2 degradation under basal conditions is believed to be a catalytic rather than a dominant-negative mechanism. And if electrophile-modified Keap1a acts as a dominant-negative regulator, what is it inhibiting in a stoichiometric manner?</p><p>(12) For the multiple reasons described above, authors' model for Keap1a and Keap1b function (Figure 8) does not have strong experimental support. Their model is also mechanistically counterintuitive. If Keap1a is the primary antagonist of Nrf2/antioxidant responses under basal conditions, then electrophile-induced Nrf2 signaling should be predominantly due to Keap1a modification and suppression. The authors propose instead that electrophile modification of the purportedly less effective antagonist, Keap1b, is the primary driver of increased Nrf2 activity and that modified Keap1a actually suppresses Nrf2 function further. It is difficult to see how electrophiles could mount 3- to 4-fold increases in antioxidant responses under these mechanistic constraints.</p><p><italic>Reviewer #3:</italic></p><p>Investigating specific protein functions in electrophile sensing pathways in cells is challenging in terms of deciphering on vs off-target interaction of electrophiles with your target of interest vs other targets. In this study, the authors investigate the specific function of Keap1 paralogs in zebrafish using their Z-REX system and show different functions between Keap1a and Keap1b paralogs, which they also recapitulate in cell culture models. The study is performed very rigorously and the conclusions of the paper are supported by the data. This review recommends publication as is.</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Z-REX uncovers a bifurcation in function of Keap1 paralogs&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by three reviewers, including a a new reviewer with zebrafish expertise who substituted for the prior zebrafish specialist.</p><p>Summary:</p><p>This is a very interesting study implicating a bifurcation in the function of the zebrafish paralogs of Keap1, the main negative regulator of transcription factor Nrf2, which controls the cellular antioxidant response (AR). The authors' experimental approach is unique and very elegant. The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below. The principal remaining concern relates to the zebrafish experiments, and in particular, ruling out off-targets in the morpholino knockdown studies. As stated below, it is important to meet the Stanier guidelines paper to ensure the robustness of these experiments. In addition, we hope you can address the other issues by text revision, eg. toning down the conclusions and/or providing alternative explanations for the findings as indicated.</p><p>Essential revisions:</p><p>– The revised document includes a number of 'validation' studies, but they are not consistent with expectations in the field in terms of controls and other validation. That does not mean their interpretation is necessarily wrong, it's that from the controls they do present, we do not know the boundaries where the work is likely limited in interpretation. Morpholino validation includes on-targeting and off-targeting questions. The authors present A LOT of work, but there are issues with both. (A) the authors appear to spend all of their time worried about on-targeting/efficacy measurements. For the translational blocking reagents, they do appear to be inhibiting their targets (and they now report their dosing per embryo). But their splice-site reagents are showing 30% or more wt RNA still present in all but one circumstance. Will only 70% knockdown be enough to show a phenotype? Not clear. (B) Off-targeting questions. In the Stainier guidelines paper, there are clear approaches to experimental design to address this question. Comparing to a mutant is the preferred approach, followed by RNA Rescue etc. We see none of this in this manuscript, or even a reason why they did not do these logical experiments.</p><p>– Statistical assessment – We are concerned about the confidence interval numbers (we think that's what's shown) compared to the data distribution shown in this manuscript. Just one example – Figure 2A: comparing control MO1 with Keap1a+Keap1b MO injections. This should show the largest differential. Seems to be about 30 individual data points. The authors claim these distributions are 99.86% likely to be different. But the visual data set suggests that the only primary difference is that 1/30 data points are above 1.6x in control MO1 versus 4/30 data points are above 1.6x. Visually, the numerical value just does not align with the graphical representation they present. This same issue is found throughout the manuscript. Indeed, the data distribution graphs raise a key question of study design – how many times were these experiments independently run? We are not sure combining biological replicates is the best way to go, if that's what they did. It is not clear from the text how they derived the data points they show.</p><p>– Why was myc-Nrf2 used for the experiments shown in Figure 7, whereas HA-Nrf2 was used for the experiments shown in Figure 8?</p><p>– Figure 7. The authors say in the text (beginning on line 454): 'Intriguingly, when zKeap1b was co-transfected with sub-saturating amounts of zKeap1a, no decrease in basal AR was observed relative to zKeap1a alone (Figure 7D), implying that zKeap1a somehow affects the ability of zKeap1b to suppress AR.' Is it possible that the absence of C273 makes zKeap1a a more efficient repressor, because this cysteine when present (as in zKeap1b) senses endogenous electrophile(s)/oxidant(s) at basal state? If repression of AR by zKeap1a is already maximal (as suggested by the data), is co-transfection with zKeap1b expected to have any further effect?</p><p>– Figure 8. The authors say in the text (beginning on line 490): 'We found that zKeap1b accumulated Nrf2 in the basal (i.e., non-electrophile-stimulated) state, whereas relative to zKeap1b, zKeap1a accumulated less Nrf2, and zKeap1a/zKeap1b accumulated an amount of Nrf2 that was significantly more than Keap1a alone and less than zKeap1b alone (Figure 8A-B).'</p><p>• Could these data be interpreted that zKeap1a degrades Nrf2 better whereas zKeap1b does not? This would be consistent with a scenario where the absence of C273 makes zKeap1a a more efficient repressor, because this cysteine senses endogenous electrophiles/oxidants at basal state, causing partial inactivation of zKeap1b.</p><p>• Is the presence of less Nrf2 bound to zKeap1b upon treatment with NE necessarily a consequence of release of Nrf2? Was an 18-h treatment necessary to see this effect? It seems a very long time; we would have thought that if NE was causing a release of Nrf2 from zKeap1b, the release should be evident at a much earlier time point. Can the authors be fully confident that release does occur when the released protein has not been observed/accounted for?</p><p>• There seems to be less HA-Nrf2 following NE treatment in the input samples (Suppl Figure 15), and it is thus possible that the NE treatment affects the turnover of HA-Nrf2. The normalization for the input addresses this; nonetheless, the semi-quantitative nature of the immunoblotting technique should be kept in mind.</p><p>• Do the authors know the identity of the ~37 kDa fragment in the anti-FLAG blot?</p><p>• The results from the zKeap1a/zKeap1b co-transfection experiment are not straightforward to interpret, because Keap1 is a dimer, and thus the simultaneous presence of several dimeric combinations (e.g. zKeap1a/zKeap1b, zKeap1a/zKeap1a, zKeap1b/zKeap1b) is possible.</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for submitting your work entitled &quot;Z-REX uncovers a bifurcation in function of Keap1 paralogs&quot; for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.</p><p>Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.</p><p>While two of the original three reviewers are now satisfied, the third reviewer who is an expert on zebrafish has indicated that the zebrafish morpholino experiments are insufficiently rigorous to be acceptable. Below are the latest reviewer comments. We regret having to communicate this disappointing news. We hope that if you ultimately choose to address Reviewer 3's concerns with the requisite additional experimental data, that you will come back to eLife with a manuscript that includes this information when ready.</p><p><italic>Reviewer #1:</italic></p><p>The authors have addressed my remaining concerns appropriately.</p><p><italic>Reviewer #3:</italic></p><p>None of my technical concerns tied to either the on-target or off-target effects were addressed.</p><p>1) On-target. The maximal described knockdown was 70%. In our experience, effective morpholinos are readily able to go well beyond 90 or 95% knockdown - one of the key distinguishing features of MOs over siRNA is the normal ability to be well beyond 80% knockdown.</p><p>2) Off-target. The authors were given several options to address this concern, and they chose to not offer any new data. The specific suggestion to follow the Stainier guidelines was rebutted, arguing they did not have mutants etc.</p><p>I recommend rejection of this manuscript. The zebrafish work does not achieve the level of rigor expected in the field. If the authors were to come back after confirming their results using mutants and/or true rescue experiments with morpholinos that show strong on-target efficacy, the paper could be considered appropriate to publish in eLife.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.83373.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]</p><disp-quote content-type="editor-comment"><p>As you will see, there was a mixed opinion about the manuscript. While Reviewer #3 was enthusiastic, Reviewer #2 identified numerous shortcomings involving the execution and interpretation of the zebrafish experiments. Reviewer #2 also highlighted the lack of accounting for the distinct results reported in a 2008 J Biol Chem paper for functions of Keap1a and Keap1b. Reviewer #1 also raised several important concerns including a discrepancy between the behavior of Cys273 mutation here and in prior work as well as some other experimental weaknesses. Overall, it was felt that, to respond adequately to all of these important issues, the degree of extensive additional work would exceed the two month time frame expected for manuscripts invited for revision at eLife. However, if you can satisfactorily address the major criticisms at some point in the future, we would be happy too consider a version of this manuscript at that time.</p><p>Reviewer #1:</p><p>This is a very elegant study implicating a bifurcation in the function of the zebrafish paralogs of Keap1, the main negative regulator of transcription factor Nrf2, which controls the cellular antioxidant response (AR). The authors have used unique approaches and tools that have been previously developed in their laboratory. The findings are new and exciting, and the manuscript was a pleasure to read.</p></disp-quote><p>We are most grateful to the Reviewer for a series of mostly very fair and careful points. We have amended the manuscript with some data and in areas of the text where necessary. We were, however, a little perplexed by the Reviewer’s final main point.</p><p>We hope our response is satisfactory. We would be very happy to engage with the reviewers in further open discussion.</p><disp-quote content-type="editor-comment"><p>However, some of the conclusions are not fully justified by the data. The authors may wish to consider addressing the following points:</p><p>1. Do any of the treatments and/or treatment combinations affect the fluorescence of GFP?</p></disp-quote><p>We are not detecting GFP fluorescence; we are using IF (please see legend to Figure 2, for example, where we stated “Note: GFP expression was detected using immunofluorescence (IF) in fixed fish, analyzed by red fluorescence. The IF protocol is used because auto-fluorescence in the green channel is high in fish and prevents accurate quantitation”). This strategy also obviates the need to worry about GFP quenching (or even activation), which is another benefit of using the IF strategy (above reducing background, etc.). GFP is also not labeled by HNE under Z-REX, and GFP and other FPs<sup>1</sup> are also compatible with T-REX in cell culture, giving similar outputs to what is observed using luciferase as a reporter<sup>2</sup>. Furthermore, for the most part, these outputs are also independently supported by qRT-PCR experiments assessing endogenous genes (please see Figure 3B, Figure 4C, Supporting Figure 2B, Supporting Figure 7B). We further note that we can modulate the changes/lack thereof (often in both directions) observed using MOs, arguing these results are independent of GFP; these data correlate with known outputs and also data from IP studies now newly added (Figure 8A-B and Supporting Figure 15).</p><p>To further support the statements above, we provide <xref ref-type="fig" rid="sa2fig1">Author response image 1</xref>:</p><fig id="sa2fig1" position="float"><label>Author response image 1.</label><caption><title>Comparison between live imaging (A) and whole-mount immunofluorescence (IF) (B).</title><p>Scale bars, 500 μm. (A) Live <italic>Tg(gstp1:GFP)</italic> embryos (1.5 dpf, injected with control MOs) were dechorionated and placed on an agarose pad and imaged using GFP fluorescence (Ex. 470 nm, Em. 525 nm) and bright field. Signal to noise (S/N) ratio was estimated by dividing fluorescence intensity of the fluorescent signal by the fluorescence intensity of the surrounding area for 4-6 fluorescent areas using Image-J (NIH). (B) <italic>Tg(gstp1:GFP)</italic> embryos (1.5 dpf, injected with control MOs) were dechorionated, fixed, and immunostained for GFP as described in the original manuscript. AlexaFluor568 (Ex. 560 nm, Em. 630 nm) channel shows GFP signal. GFP localization reported by GFP intrinsic fluorescence [in (A)] is similar to that reported by red fluorescence from IF in this figure. S/N ratio was calculated as in (A).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-sa2-fig1-v4.tif"/></fig><disp-quote content-type="editor-comment"><p>2. There seems to be induction of both gstp1 and gsta2 (Figure 3B, Figure 4C) by the light exposure alone. Has this been accounted for?</p></disp-quote><p>The fold-induction by light alone (which is only seen in qPCR) is minimal, compared to that which occurs upon Z-REX. Unfortunately, the effect of light alone and the effect of compound alone cannot account for what occurs during Z-REX as there may other hidden variables that such simple comparisons cannot account for. Thus, to fully account for all potential hidden variables, we also deploy ‘perfect’ negative controls for Z-REX, by deploying a P2A-mediated ‘non-fused construct’ (Figure 3C). We note that this control takes into account both single variables (light and small-molecule probe), and also other “hidden variables”, such as effect of photouncaging itself, released of HNE to system. Data with this non-fused construct unambiguously validate that the responses observed are due to on-target LDE modification [please see Figure 3C-E (IF-imaging data) and also Supporting Figure 7A-B (qRT-PCR data sets) in the revised manuscript]. We showed this control using two different readouts (IF-imaging and qRT-PCR), two different Z-REX-LDE-precursor probes, evaluating multiple endogenous downstream AR-genes (Supporting Figure 7B) and also compared the outcomes under bolus dosing (Figure 3D-E). We have now made these more clearly with an accompanying illustration in Figure 3C.</p><disp-quote content-type="editor-comment"><p>3. Does the endogenous Keap1/Nrf2 system in HEK293 cells interfere with the AR measurements?</p></disp-quote><p>This is a fair question, which also worried us for some time in the past. However, our data are consistent between fish and cells (in this current manuscript as well as in our recent publications and ongoing manuscripts that involve the use of both cells and fish<sup>3</sup>) in instances where the endogenous : ectopic protein component differs widely. They further agree with overexpression of the different-paralogs in zebrafish embryos, derived from another laboratory<sup>4</sup>. Such consistency is the first clear piece of evidence that there is little interference between the different ectopic constructs and the endogenous copy.</p><p>Furthermore, our data from 7 recent publications and additional work pending publications involving Keap1/Nrf2/AR-pathway studies<sup>5</sup>, where we used multiple orthogonal assays investigating endogenous AR-driven downstream genes as well as using ectopic transfection systems all point to the fact that there is no such interference. In each case, we have also consistently established the optimum plasmid ratios for desired ectopic transgenes (typically Keap1, Nrf2, and reporters) such that measurements are made well within the dynamic range of the AR-reporter assay. In the current manuscript, Figure S14B showed such a determination of the amounts/ratios of Keap1a/b-plasmids.</p><p>We also assessed the importance of the endogenous copy of Keap1 in cells as follows: western blot analyses show that ectopic Keap1-overexpression is significantly higher than the endogenous construct for any situation examined (<xref ref-type="fig" rid="sa2fig2">Author response image 2A</xref>). Thus, one would expect endogenous human Keap1 to be unimportant in our cell-based assays. <italic>We investigated this proposition systematically as follows:</italic> Nrf2-alone-overexpression gives a high level of basal AR (around 1000-fold higher than in a transfection with an empty vector) (<xref ref-type="fig" rid="sa2fig2">Author response image 2B</xref>, left panel). Under these conditions, AR is not dependent on endogenous Keap1, as 50% Keap1-knockdown by 2 different siRNAs targeting Keap1 had no overall significant effect suppressed (up to 100-fold) by co-overexpression of the specific Halo-Keap1 construct (data in our original manuscript). This ectopic Keap1-dependent AR-state is also independent of endogenous Keap1-activity, as knockdown of the endogenous protein has no effect on AR either (50% knockdown by 2 different siRNAs targeting Keap1) (<xref ref-type="fig" rid="sa2fig2">Author response image 2B</xref> right panel, and <xref ref-type="fig" rid="sa2fig2">Author response image 2C</xref>). Thus, we conclude based on stoichiometry and effect on AR; that endogenous Keap1 causes no issue for our interpretations of these data. Taken together, we believe that both our previously published work and additional reviewers’ data relevant to this current manuscript fully address this reviewer’s concern.</p><fig id="sa2fig2" position="float"><label>Author response image 2.</label><caption><title>Endogenous human Keap1/Nrf2 expression does not interfere with AR measurement in cell-based assays.</title><p>(<bold>A</bold>) <italic>Left</italic>, Expression of ectopic Keap1 (labeled here as ‘HTK’, designating the construct used: Halo-TeV-Keap1) is large relative to endogenous hKEAP1 present in cells. HEK293T cells were transfected as indicated in the dual luciferase assay described in Figure 7C-F (original manuscript) and after 42 hours harvested for western blotting. <italic>Right</italic>, quantification of endogenous (blue bars) and overexpressed Keap1 (red bars) for each transfection condition from n=6 replicates. The affinity of the antibody to each Keap1 variant (Supp. Figure 1D, original manuscript) was used to normalize the Keap1 signal for zKeap1a and zKeap1b. The horizontal dotted line represents the average level of overexpressed hKEAP1. (<bold>B</bold>) <italic>Left,</italic> introduction of ectopic Nrf2 alone increases the AR signal by 1000-fold (note: maximal AR is normalized to 100; lowest AR is 0.1). <italic>Center and Right</italic>; using the dual luciferase assay described in Figure 7C-F (original manuscript), two different siRNAs targeting endogenous hKEAP1 were used to reduce endogenous hKEAP1 levels, while the cells were also transfected to express hNrf2 (<italic>Graph at center</italic>) only, or low levels of zKeap1a/b (<italic>Graph on right</italic>), using transfection conditions as in Figure 7D,F (original manuscript). siRNAs have little effect on AR output in either condition. si(control) i, ii, iii correspond to Santa Cruz siRNA controls “A, C, and E (vendor’s labels)”, respectively. si(hKEAP1) i and ii correspond to Dharmacon siGENOME human KEAP1 siRNAs D-012453-03 and D-012453-04. Dharmafect Duo was used for transfection. (<bold>C</bold>) <italic>Left,</italic> representative blot for siRNA knockdown efficiency assessment under assay conditions deployed in the original manuscript (data shown is from a single continuous blot); <italic>Right,</italic> quantification (n=4). Horizontal dotted line represents average level of Keap1 signal of all siControls.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-sa2-fig2-v4.tif"/></fig><disp-quote content-type="editor-comment"><p>4. Whereas the study provides an explanation for the lack of AR in the head of the zebrafish, the functional significance and the mechanism by which zKeap1a exerts its 'dominant negative function' have not been addressed and remain unclear. It has been shown for mammalian Keap1 that the substitution of C273 with I makes Keap1 unable/less able to suppress Nrf2-dependent transcription (Saito et al. Mol Cell Biol. 2015;36(2):271-84), thus providing a gain of function for Nrf2 rather than repressing Nrf2-dependent transcription. In this study, the transcriptional activity of Nrf2 (basal AR) is greater in cells expressing the Keap1 C273I mutant compared to WT Keap1 (Figure 7C) as well as in cells expressing zKeap1b compared to zKeap1a (Figure 7C,D and Figure S12), suggesting in both cases partial loss of function for Keap1 and consequently, gain of function for Nrf2. Yet, it is zKeap1a, and not zKeap1b, that has 'I' rather than 'C' at position 273 and thus is expected to resemble the mammalian Keap1 C273I mutant. How could this be rationalized?</p></disp-quote><p>Our newly-acquired data (Figure 8A-B and Supporting Figure 15) show that following electrophile treatment, Keap1a is unable to release Nrf2 bound to it (explaining a previous report on the non-permissivity of zKeap1a to electrophile-induced AR<sup>4</sup>). Keap1b can release a large amount of bound Nrf2 upon electrophile treatment. In the heterodimer (a mix of Keap1a and Keap1b), release of Nrf2 is also inhibited. This explains how Keap1a can regulate AR in a dominant-negative fashion, as the AR increase upon electrophile labeling of zKeap1b is ascribable to release of Nrf2 from zKeap1b.</p><p>Our data in the basal state for cells overexpressing only hKEAP1(C273I) are overall qualitatively consistent with that reported in Saito et al. <italic>Mol Cell Biol.</italic> 2015; 36(2):271-84 on mKeap1(C273I). These authors did not look at interaction between different Keap1 constructs, like we did.</p><p>In our mixing studies, we found that hKEAP1(C273I) mutant shows dampening of the electrophilic response of hKEAP1(WT), similarly to how zKeap1a exerts a dampening of the electrophilic response of zKeap1b [or hKEAP1(WT)], both in cells and fish (i.e., suppression of electrophile-induced AR-upregulation in mixed-plasmid systems in cells, compared to zKeap1b [or hKEAP1(WT)]-overexpression alone in Figure 7F, and alleviation of electrophile-induced AR-upregulation in double-knockdown systems in fish, compared to Keap1b-knockdown alone, in Figure 2B left panel). Note that the fact that hKEAP1(C273I) and zKeap1a show the same effect even though their respective abilities to suppress basal AR are dissimilar, shows that the effect of C273I is independent of basal AR (Figure 7C).</p><p>We believe that this difference in basal AR-suppression abilities is due to other mutations that allow zKeap1a to retain its basal function better than hKEAP1 C273I. We have tried to ID the specific residue in zKeap1a that would allow for this increase in Nrf2suppression function in the basal state (through analysis of structural and sequence data), but it appears to be not due to a single mutation/residue. We show these data as <xref ref-type="fig" rid="sa2fig3">Author response image 3</xref>. We decided to not include these data/discussions as we feel they deviate from the main focus of the manuscript as we try to frame the Discussion back to heterozygous systems both in fish and human. What these data do tell us though is that overall it is quite surprising that a single mutation (C273I) is responsible for the regulatory role of Keap1/paralogs (and how they bifurcate) under electrophile-stimulated state.</p><p>Similar reasoning applies to zKeap1a/1b. As shown in Figure 7E and 7F, Keap1b can mount a 2-3-fold response in electrophileinduced AR, although zKeap1b shows a lower level of basal AR suppression (Figure 7C). However, in the presence of zKeap1a, where if anything, basal AR is lower (Figure 7D), indicating that the output in terms of AR-upregulation is muted. Accordingly, the electrophile-induced AR upregulation due to zKeap1b [which was ~3-fold (Figure 7E), even though basal AR due to zKeap1b was higher (Figure 7C)] is weakened.</p><p>Given that release of Nrf2 appears to be the predominant means through which AR is mounted, at least in the fish, understanding how zKeap1a functions in conjunction with zKeap1b in regulating Nrf2/AR is itself an important advancement. However, given the complexity of the system, the overall poor understanding of Keap1 structurally, and the fact that we have covered a large amount of ground already in this revised manuscript, we think that some of the remaining interesting questions that the reviewer raised in this specific query are questions that can be pursued in another paper.</p><p>We hope that our rationalization herein, supported further by additional data and newly-acquired revision data, fully address the reviewer’s concern.</p><fig id="sa2fig3" position="float"><label>Author response image 3.</label><caption><title>Initial explorations regarding potential rescue of basal AR-activity of hKEAP1 C273I through mutation.</title><p>(A) <italic>Top;</italic> No full-length hKEAP1 crystal structure is available, therefore crystal structure of human Kelch-like protein-11 (PDB: 4AP2) was used as a model onto which the hKEAP1 sequence was threaded using Swiss-Prot. <italic>Bottom;</italic> Amino acid sequence alignment (performed using MEGA-X) between hKEAP1, zKeap1a, and zKeap1b. Residues with side chains within 5 Å of C273 (magenta) are shown and boxed in red in the sequence alignment shown below. These residues served as putative residues for potentially rescuing the basal AR-activity of hKEAP1 C273I. (B) The cell-based AR assay from Figure 7 C-F (original manuscript) was used to determine the extent of basal AR suppression elicited by each double/triple mutant. C273I is the single point mutant that recapitulated zKeap1a behavior but lost the ability to suppress basal AR to the same extent as hKEAP1 WT can do. The double, quadruple, and triple mutants (last three sets of hKEAP1-mutant on graph) introduce additional zKeap1a residues into hKEAP1 C273I.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-sa2-fig3-v4.tif"/></fig><disp-quote content-type="editor-comment"><p>5. The proposed model shown in Figure 8 is difficult to understand. The ascribed 'dominant negative function' of zKeap1a could be not on Nrf2-driven transcription (AR), but rather on Nrf2 turnover. An alternative mechanism to that proposed by the authors could be that a zKeap1a/zKeap1b heterodimer binds Nrf2, but is (partially) impaired to target Nrf2 for degradation thus trapping the zKeap1a/Nrf2/zKeap1b complex in the bound state, and consequently allowing Nrf2 that is synthesized de novo to accumulate and activate Nrf2-dependent transcription (AR). Testing this potential mechanism requires additional experiments.</p></disp-quote><p>We have now performed experiments where we measured release of Nrf2 from zKeap1-paralogs post electrophile treatment (Figure 8A-B, and Supporting Figure 15). We found that only zKeap1b of the two zKeap1-paralogs, could release Nrf2 following electrophile exposure. Furthermore, zKeap1b could build up a larger amount of associated Nrf2 than zKeap1a in the steady state (Supporting Figure 15). The mixed state, consisting of equal amounts of Keap1a and Keap1b relative to above, was able to accumulate Nrf2 bound to Keap1, but could <italic>not</italic> release Nrf2 following electrophile treatment (Figure 8A-B, and Supporting Figure 15). Given these data, we believe that the release model is sufficient to explain our data. It is worth noting however that we cannot rule out that the zKeap1b protein is also more susceptible to inhibition than zKeap1a, although clearly this would at most have to be due to a partitioning since zKeap1a has the same extent of electrophile-labeling/sensing as zKeap1b (Figure 7B), and around 40% of Nrf2 bound to zKeap1b is released (Figure 8B) and less than ~40% occupancy on Kzeap1b (Figure 7B) is sufficient to trigger maximal AR-upregulation. However, as the heterodimeric state does not release Nrf2 bound to it (Figure 8B), and no AR increase is observed in this state either (Figure 7F), these data could not be fully explained by the alternative model proposed by the reviewer.</p><p>Nonetheless, we do understand that complex processes do not always break down to a single factor, so we have written our revised Discussion section to mention that other factors (such as inhibition of zKeap1b, or zKeap1a marginally) could contribute to AR.</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>This manuscript by Long et al. investigates the functionality of T-REX in zebrafish, using a HaloTag-functionalized form of human KEAP1. The authors also examine the zebrafish homologs Keap1a and Keap1b, and they propose with a model in which: (1) Keap1a is the primary antagonist of Nrf2 under basal conditions; and (2) electrophile-modified Keap1a suppresses the Nrf2 activation that results from Keap1b modification/suppression. The authors further speculate that differences between Keap1a and Keap1b function are due to the absence of the cysteine residue that is equivalent to C273 in human KEAP1.</p><p>The authors' demonstration that T-REX works in zebrafish is fairly compelling, although it is not clear to this reviewer why extending T-REX from previous work in cultured cells and worms merits a new name for this approach (Z-REX).</p></disp-quote><p>The change in name allows us to more clearly distinguish and/or refer to experiments performed in fish and cells in a paper where the twain is conducted.</p><disp-quote content-type="editor-comment"><p>Ht-PreHNE conveys light-inducible expression of Nrf2 targets in zebrafish overexpressing HaloTag-functionalized KEAP1, whereas bolus HNE does not.</p></disp-quote><p>With respect, this is untrue. Please see Figure 3A, B, C-D, and Figure 5B for example. However, the reviewer may be aware that permeation is a large issue for drug efficacy in general. Hence in live organisms, often REX-technologies are more able to efficiently target the intended protein than bolus dosing, as we showed, for instance, with ectopic human-Keap1 in <italic>C. elegans</italic><sup>6</sup>.</p><disp-quote content-type="editor-comment"><p>These findings extend to other T-REX electrophiles such as Ht-PreNE and Ht-PreDE.</p></disp-quote><p>This is partly true but we would like to clarify that these other electrophiles, where studied, also upregulate AR upon bolus exposure.</p><disp-quote content-type="editor-comment"><p>It also appears that Nrf2 signaling in the tail but not head is responsive to these exogenous electrophiles, though the mechanistic basis for this difference remains unknown.</p></disp-quote><p>We believe that we have explained the basis for the differences in the responsivity. This and many of the reviewer’s comments were below appear to stem from misunderstanding: e.g., aspects of data that the reviewer stated to be missing were actually present in our original manuscript, and issues that the reviewer stated that we had ignored were explained in the text. We have also doubled our input to make all of the points more obvious and improve clarity in our data discussion.</p><disp-quote content-type="editor-comment"><p>The authors' studies of Keap1/Nrf2 signaling in zebrafish are problematic, and my specific concerns are summarized below:</p><p>1) The authors inexplicably fail to cite the 2008 paper by Li et al. (J. Biol. Chem., 266:3248-3255),</p></disp-quote><p>The cited paper (for which we believe the citation volume is incorrect, and should be <italic>J Biol Chem</italic> 2008; 283:3248-3255) is from Yamamoto, whose more recent work (building on these and other data from his laboratory) is cited by us in the original manuscript (2011 Tsujita et al. <italic>Genes Cells</italic>). We note that the timescales, differentiation, and modus operandi of the experiments were largely different between our own paper and the aforementioned JBC paper. That being said, overall where there are, albeit minor, overlaps between the two papers, our data and the data from the JBC paper do agree. Note that our paper is much more quantitative and investigates the interplay between the two proteins, especially in the electrophile-stimulated state. The JBC paper does <italic>not</italic> study electrophile-regulated state.</p><disp-quote content-type="editor-comment"><p>which examines Keap1a and Keap1b function in zebrafish. This prior study demonstrates: (1) both Keap1a and Keap1b suppress Nrf2 activity in zebrafish upon their transient overexpression by mRNA injection (as assessed by gstp1 transcription);</p></disp-quote><p>This experiment was performed using overexpression (of Keap1 individually, in the presence of ectopic Nrf2) <italic>at a very early stage of development, where AR is often globally high</italic> (see Figure 4B of the JBC paper referred by the reviewer, but since this is with Nrf2(<italic>fragment</italic>)-GFP injected fish, the direct relevance is not clear), and cells have clearly not differentiated, so regulation/responsivity may be very different to our systems. However, the overall message is the same as we conclude, namely that, both Keap1 molecules <italic>are active</italic> in the basal state.</p><p>As the JBC paper did not look to a huge extent to the interplay between the two, nor does it look at electrophile sensitivity, nor does it perform much quantitative analysis, the data therein are not directly relatable to nor comparable against our data.</p><disp-quote content-type="editor-comment"><p>(2) both Keap1a and Keap1b promote Nrf2 degradation;</p></disp-quote><p>We respectfully do question the relevance of this (and the above) point, unless it is to say that our analysis agrees with previously published literature. We have now cited the JBC 2008 paper, but in the spirit of experimental rigor and to avoid misleading the readers, we are reluctant to not draw comparisons where experimental setup/conditions are not directly comparable and/or quantitative analyses have not been performed. In this specific degradation-related data in the JBC paper, the data have not been validated using any standard protein degradation controls (e.g., inhibitors, ubiquitination), so it does not directly show degradation per se.</p><disp-quote content-type="editor-comment"><p>(3) keap1b is the predominant homolog expressed during the first day of zebrafish development, and keap1a is transcribed at much lower levels;</p></disp-quote><p>Our experiment was done at 36 hpf, and indeed our overall expression agrees with the data in the JBC paper at this time point as much as it is possible to do so, as expression varies quite significantly at this time (See Figure 6B of the JBC paper; these data are also derived from only a single data point).</p><disp-quote content-type="editor-comment"><p>(4) Keap1a and Keap1b form homodimers and heterodimers;</p></disp-quote><p>These experiments were performed in vitro and do not show that dimerization occurs in embryos. This outcome is, in any case, <italic>not</italic> at odds with our model, and the dimerization of Keap1 was never called into question by us (and is indeed it is known that Keap1 is a dimeric protein).</p><disp-quote content-type="editor-comment"><p>(5) cysteine residues corresponding to C288 and C273 in mammalian KEAP1 are important for the anti-Nrf2 activities of Keap1a and Keap1b, respectively.</p></disp-quote><p>We are not sure what the relevance of this statement is (as we do not change these residues in Keap1a/b).</p><p>We do apologize if we somehow offended the reviewer by not citing this paper (which mostly deals with information that is covered in the other literature we cited). As stated above, we are happy to cite this work and hope that the reviewers and the Editors can see that there is an overall agreement between our data and the JBC paper data in basal-AR state, but it is clearly unreasonable for the reasons delineated above to make direct comparisons neither at quantitative level, nor at electrophilestimulated state which was not at all touched upon in the JBC paper.</p><disp-quote content-type="editor-comment"><p>2) Long et al. fail to validate reagents that are essential for their studies. For example, they do not confirm that the functionality of nrf2a, nrf2b, keap1a, or keap1b MOs against their endogenous targets. Nor do they disclose the MO doses used for their studies. They instead show that keap1a and keap1b MOs can block the in vitro translation of a synthetic luciferase-encoding construct. However, the reagents are only effective at very high MO:RNA ratios for reasons that are not explained (and the actual concentrations of RNA and MO used for these studies are not described).</p></disp-quote><p>We have now additional independent validation of MOs targeting zKeap1a and zKeap1b, using whole-mount immunofluorescence analysis (Supporting Figure 5A-B) [using anti-Keap1 antibodies that we also in parallel validated through ectopic expression in cell culture (Figure 7, Supporting Figure 1D, 14A-B; and Author response images 2 and 3)], as well as by RT-PCR for SPL-MOs (Supporting Figure 4A-B). These additional data have added robust validations, beyond the original data validating zKeap1a and zKeap1b-targeting MOs using luciferase translational assays (Supporting Figure 3B; figure numbering in the revised manuscript) which are also routinely used in the zebrafish field for validating translationally-blocking MOs.</p><p>In the revised manuscript, we have now listed the MOs all clearly: in figure legends beyond the Source Data file; including the mRNA amount injected (1.3-1.6 mg/ml; 2 nl volume) [0.5 mM, (approximately 2.8 mg/ml), 2 nl] (Figure 2; Supporting Figure 2, 3, 4, and 5).</p><p>The reviewer likely missed our validation data of Nrf2-MOs and they may not also be aware of the state of Nrf2 antibodies in the field. Briefly, Nrf2 antibodies, except for the mouse protein, are <italic>not</italic> considered effective (even in mammalian cells on the human protein), and so AR effects are the best way to validate Nrf2 manipulation. Given the number of papers citing how much Nrf2 antibodies have misled people even in cells (e.g., see Lau et al., 2013 <italic>Antioxid Redox Signal</italic> 18 91-93), we do not use them in our lab. But our previous manuscript clearly showed that zNrf2a/b-gene knockdown negatively impacts AR in the tail in the basal (or non-electrophile-stimulated) state, a standard phenotype expected by these MOs, and hence the validation was not an issue for us (e.g., see Supporting Figure 3A in revised manuscript). Furthermore, these MOs have been very widely used<sup>7</sup>, and agree with previously-reported knockout fish where appropriate<sup>8</sup> and consistent with previously-reported<sup>9</sup>, as well as our own observations from Keap1-overexpression (e.g., see Supporting Figure 1C,2AB,7A)</p><disp-quote content-type="editor-comment"><p>3) Even if these MO reagents are truly effective,</p></disp-quote><p>Our validation data (Supporting Figure 3A-B, 4A-B, 5A-B) collectively showed that all MOs employed are effective, based on standard assays that we and others have used in the past as well as and are accepted in the zebrafish community, and also by phenotypic assays on expected downstream response. On the other hand, as we explained above, antibodies to fish/human proteins are not always available/of high-quality, and isoform specific.</p><disp-quote content-type="editor-comment"><p>The authors over-interpret their morphant phenotypes. For instance, they state that the keap1a/keap1b double knockdown increases GFP reporter expression in the tails of Tg(gstp1:GFP) embryos relative to a control MO (Figure 2A). While the change may be statistically significant (P value = 0.0014), the magnitude appears to be only ~1.3-fold.</p></disp-quote><p>We note that the observed magnitude is actually the same as the magnitude of GFP-signal upregulation following HNE treatment of fish not treated with MO (Figure 5A,B,C), and thus these responses are genuine. Furthermore, the dynamic range of AR responses in cells and animals is known to be modest across studies made by independent labs; please see our responses to Reviewer 1 (Query #3) and to Guest Editor (Point #2) where we discussed the dynamic range of AR in detail, and our further explanations below.</p><disp-quote content-type="editor-comment"><p>It is unclear that this difference is biologically significant or mechanistically meaningful. The authors also state that nrf2b knockdown leads to &quot;hyperelevated AR response in the tail.&quot; Again, the P value may be &lt;0.0001, but fold-change is ~1.6 and the individual data points are broadly distributed. How confident can we really be that &quot;Nrf2b countermands electrophile-induced AR-upregulation&quot;?</p></disp-quote><p>Please also see our responses above and those to Reviewer 1 (Query #3) and to Guest Editor (Point #2). First, Nrf2b is known to countermand AR, “Nrf2b represses activity of an ARE-GFP reporter construct in vivo”<sup>10</sup>. Second, it is well-known in the field that AR has a relatively low dynamic range in most organisms and cells. The maximum output from the AR reporter is around 2-3 fold in many orthogonal assays (targeting both ectopic and endogenous genes), as well as within the same readouts such as ARreporter assay used across many laboratories in multiple model animals. This is true even when bolus dosing with excess electrophiles is performed. So, indeed, the values the reviewer claims to be “irrelevant” are 10-20% of maximal output. Our lab is able to recapitulate the same fold change of response that was reported by other independent labs under bolus flavonol-derived Michaelacceptor electrophile in Figure 4B: Zhang et al. <italic>Molecules</italic> 2019;24(4):708; in zebrafish, following treatment with nitro-olefin-derived Michael acceptor electrophiles in Figure 5A-B: Tsujita et al. <italic>Genes Cells</italic> 2011;16(1):46-57.</p><p>In the paper that the Reviewer cites above (2008 JBC) Nrf2-mRNA-injection was used, which can give higher AR fold changes. But tampering with the regulation to such an extent, especially in an embryo, is typically not a good idea, especially for MO experiments where we are trying to examine specific changes. (Note: we are careful to ensure that our Keap1-expression in zebrafish embryos, under Z-REX setting, is similar to endogenous levels; see Supporting Figure 1C).</p><p>Statistical significance is indeed the standard tool used to define whether a change is real or not; without this level of numerical insight and the concept of statistical power, in real biological experiments, often no objective would be gleaned. The necessity of using statistical significance to help assign biological significance is actually due to the inherent variation of biological data. We believe that it would be not be of responsible nature for any researcher to brush off such statistically-significant effects by passing them off as ‘not biologically significant’, when they are significant with respect to the tolerance of the system, and are carefully controlled for. <italic>We would point out that there was no significant change in the head, even in the same fish under at least some of the conditions mentioned.</italic> That being said, our focus is to examine the reason behind the interesting head versus tail responsivity, for which we performed correct and careful analyses and came to realize that Nrf2 expression is not closely linked to responsivity differences between head and tail, and zKeap1-paralog expression. Finally, as the p-value gives an estimate of the chances of being fooled by the experimental data and thus the level of confidence, we are perplexed by the question “how confident can we really be…”.</p><disp-quote content-type="editor-comment"><p>These issues extend to their cell culture experiments as well. For example, since co-expression of Keap1a and Keap1b does not suppress basal antioxidant responses to a greater extent than Keap1a alone (Figure 7D), the authors conclude that Keap1a affects the ability of Keap1b to affect these responses. An alternative explanation (and arguably more likely) is that Keap1a overexpression alone can maximally suppress basal antioxidant responses, especially since Keap1b appears to be less active in these assays (Figure 7C).</p></disp-quote><p>This conclusion proposed by the reviewer is ruled out by supporting Figure 12B wherein we went at length to ensure a good dynamic window of the assay is maintained and saturation is not reached in our system. Please also see <xref ref-type="fig" rid="sa2fig2">Author response image 2</xref> and 3.</p><p>We also explained this point clearly within the original manuscript text.</p><disp-quote content-type="editor-comment"><p>4) Some of the other MO phenotypes are difficult understand in light of other results in the paper and/or missing information. For instance, Figure 1D shows that nrf2a is expressed at much higher levels than nrf2b in the zebrafish embryo tails. Yet nrf2a and nrf2b MOs have essentially the same effects on tail GFP expression in Tg(gstp1:GFP) embryos (Figure 2A)-a surprising result if &quot;Nrf2b is a minor contributor&quot; as described by the authors in the Discussion section.</p></disp-quote><p>This question stems from misunderstanding/the reviewer missing a section of our text:</p><p>On Page 7 of the manuscript, we explained clearly: “Note: the data here (<italic>referring to qPCR data</italic>) are for the <italic>whole</italic> tail and <italic>whole</italic> head, and thus, do not necessarily reflect the expression levels in responsive tissues, or those present in the areas where GFP is expressed”; that is tail- versus head-sectioning (which is also clearly diagramed in Figure 1C, original manuscript) in qPCR experiments, is <italic>not</italic> the same as the reporter fish [for which images , and schematics (note the green patches denoting expression of GFP therein) are provided are provided], since the latter (reporter fish) only report on a fraction of the head and the tail.</p><p>We are sorry for the confusion: Nrf2b is not mentioned in the Discussion section, but if the reviewer were referring to the statement in the relevant section in the body of the text, Nrf2b is referred to as a minor contributor <italic>in the whole of the tail</italic>; <italic>not in the part of the tail where we measure AR</italic>. We hope this is now clear.</p><disp-quote content-type="editor-comment"><p>Were the nrf2a and nrf2b MOs used at the same dose? Do they have the same knockdown efficiency?</p></disp-quote><p>MOs injected were standardized (we have now expanded the section). The effects on Nrf2a/b on basal AR are similar, although how this correlates with magnitude of knockdown depends on numerous factors that are beyond the scope of this paper.</p><disp-quote content-type="editor-comment"><p>Also, in Figure 2A-B. the keap1b MO does not alter tail GFP expression in Tg(gstp1:GFP) embryos in basal conditions, but it suppresses the differential effects of NE and DMSO on this reporter. If the morphant phenotypes reflect on-target activities, this means that Keap1b must promote NE-mediated activation of antioxidant responses, an idea that counters the conventional wisdom that NE directly suppresses the ability of Keap1 proteins to induce Nrf2 degradation. The authors should provide a mechanism that can account for these findings.</p></disp-quote><p>The reviewer appears to have missed the point of the paper. We also point out that these data are consistent with previous reports derived from mRNA injection<sup>8</sup>. We show that zKeap1b can upregulate AR to a higher extent than zKeap1a upon electrophile treatment in cells (Figure 7E and 7F). This would explain why knockdown of zKeap1b suppresses electrophile-induced AR-upregulation (Figure 2B). zKeap1a also suppresses zKeap1b’s ability to mount AR (Figure 7F), hence zKeap1a’s knockdown would stimulate AR in the electrophile-stimulated state (Figure 2B). These outputs are therefore self-consistent, and consistent with previous data.</p><disp-quote content-type="editor-comment"><p>5) Important controls are missing from some experiments. For example, the authors examine how &quot;bolus LDE treatment results in different extent of hKEAP1-labeling&quot; in Figure 6. Presumably they are using the HNE(alkyne) and NE(alkyne) labeling and Cy5 click chemistry results as evidence that these electrophiles efficiently modify KEAP1 expressed in zebrafish embryos. However, without testing the effects of these electrophiles on embryos that are not expressing exogenous KEAP1, it is not possible to know how much of the observed Cy5 signal is due to KEAP1 labeling vs. non-specific labeling of endogenous proteins.</p></disp-quote><p>The corresponding result section title (page 13, original manuscript) indicates: “Extent of the fish proteome labeling following bulk LDE exposure closely mirrors that of AR Induction”, and the subsequent goal of the stated experiments details (Click labeling of LDE treated fish). These specific experiments are <italic>only to examine electrophile permeation into the fish</italic>; <italic>not to assess Keap1 labeling</italic>. We have also doubly ensured that the associated figure legends are also as clear as possible.</p><p>The reviewer might have missed the data where Keap1-specific labeling in vivo was directly assessed by Click-Biotin pulldown experiments (see Supporting Figure 8,9,11), using hKeap1 as a proxy (which we know is overall a similarly good sensor to zKeap1’s).</p><disp-quote content-type="editor-comment"><p>6) The authors overlook inconsistencies in their observations. For example, the ability of Ht-PreHNE to convey light-inducible endogenous antioxidant responses in both the tail and head of zebrafish embryos expressing HaloTag-functionalized KEAP1 (Figure 3B) seems to contradict the inability of Ht-PreHNE to convey light-inducible GFP expression in the heads of Tg(gstp1:GFP) embryos expressing the same construct (Figure 3C-D). If the GFP reporter does not faithfully recapitulate endogenous antioxidant responses, what do the differences in tail and head GFP expression mean? This is a particularly important question since the Tg(gstp1:GFP) embryos are used extensively in the authors' study.</p></disp-quote><p>We are sorry that the reviewer is of the opinion that we “overlook” this point. In reality, we actually ceded in the original manuscript that the head can weakly show upregulation of some endogenous genes as assessed by qPCR (which is consistent with the spirit of the reporter data, but not the completely muted response) thus, we wrote in the original manuscript:</p><p>“Representative genes associated with drug metabolism under control of Nrf2 (Gst-isoforms, Hmox1, and Abcb6) were activated to similar levels between Z-REX and bulk HNE-treatment, and AR modulation was most prominent in the tail (Figure 3B). Z-REX mounted a weak but measurable AR in the head. We ascribe this modest AR-upregulation in the head [seen only by qRT-PCR analysis, and not by imaging of <italic>Tg(gstp1:GFP</italic>)] to increased sensitivity of qRT-PCR analysis compared to in vivo fluorescence-imaging, and the fact that the <italic>gstp1</italic> locus (used in the GFP-reporter fish) is not the most responsive in the head. By contrast, bolus HNE yielded mixed responses in most cases (Figure 3B).:”</p><p>We have also added additional illustrations (e.g., Figure 1B-C, and insets with similar illustration in all other applicable figures) and further clarified the figure legends such that the above point is now clear.</p><p>The fold changes in the qPCR are sometimes larger than in the reporter assay, hence some more fine detail can be gleaned from these experiments; furthermore tissues where GFP expression is not high, or GFP is degraded may not be taken into account in this assay. However, overall, the response to a good number of these genes is muted in the head relative to the tail, and many other genes are very clearly trending that way. To explain these minor differences, we would like to point out once again that in the qRT-PCR, we are looking at many different tissues than what we are looking at in the reporter assay, but overall trend/results remain consistent between the two readouts.</p><p>We would like to also point out that the reviewer appears to have missed one of the much-important controls: the data sets in Figure 3C (now Figure 3D) and 3D (now Figure 3E) (see from 6<sup>th</sup> to 9<sup>th</sup> bar from left) integrate a genuine control for Z-REX induction of AR, where Halo and hKEAP1 are expressed as two separate proteins. This control construct is shown schematically in Supporting Figure 4A in the original manuscript (and we further expanded to have it featured as a main figure, Figure 3C); and this system represents the best control for Z-REX setup in studying signaling downstream and to rule out off-target responses. (Note: it is also clearly demarked that these fish do not express the same construct as in Figure 3A or 3B). Using this split-control construct, we saw no upregulation, in neither head nor tail (Figure 3C-D and 3E), analyzed by independent readouts (qRT-PCR vs. IF-imaging).</p><p>Taken together, there is a consistent vein of logic from fish, to human cells, using several varied orthogonal approaches via which we have carefully measured AR and cell/animal responses in this work.</p><disp-quote content-type="editor-comment"><p>7) Even if the gstp1:GFP reporter is a reliable surrogate for endogenous antioxidant signaling, the authors' reliance on immunofluorescence imaging to quantify these responses is questionable. This approach is complicated by the autofluorescence and non-specific antibody binding of zebrafish embryos, and a more rigorous approach would be to assess reporter expression by quantitative western blots or qRT-PCR.</p></disp-quote><p>We first stress that The GFP reporter fish was developed by the same authors as the paper cited by the reviewer and this reporter line is widely available, have been validated by numerous labs, and show expected responses upon treatment with ARstimulating agents: e.g., Tsujita et al. Genes Cells 2011;16(1):46-57; Zhu et al. Free Radical Biol and Med 2016; 95:243-254.</p><p>Importantly, our original manuscript did show all the qPCR data on endogenous genes that are broadly consistent with our interpretations. We do not think that the reviewer missed these qPCR data since the reviewer’s points above (see reviewer 2 Query#6 above) mentioned some of these qPCR-data.</p><p>Furthermore, the reviewer thinks that western blot (for tail only?) would be more accurate than imaging? Or for head only? We can explain precisely why we used IF, and indeed Reviewer 1 specifies further reasons for using IF [please see our responses to Reviewer 1 Query (1) above and <xref ref-type="fig" rid="sa2fig1">Author response image 1]</xref>. We can rule out non-specific binding by comparing signal in wt/wt fish relative to gst:GFP/wt fish (<xref ref-type="fig" rid="sa2fig4">Author response image 4</xref>). Hence, we know precisely the background of the antibody.</p><fig id="sa2fig4" position="float"><label>Author response image 4.</label><caption><title>Comparison of GFP immunofluorescence (IF) staining between WT and transgenic fish.</title><p>WT (top) or <italic>Tg(gstp1:GFP)</italic> (bottom) embryos (1.5 dpf, injected with control MOs) were dechorionated, fixed, and immunostained for GFP as described in the original manuscript. Scale bars, 500 μm.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-83373-sa2-fig4-v4.tif"/></fig><disp-quote content-type="editor-comment"><p>8) The authors should also explain why their studies of KEAP1 function have focused on zebrafish embryos that are at least 24 hours post fertilization (hpf) (and certain T-REX experiments utilized 48-hpf embryos). Zebrafish studies using mRNA-mediated overexpression ae typically limited to the first 24 hours of development since the exogenous mRNA is rapidly degraded. Accordingly, the 2008 J. Biol. Chem. paper by Li et al. examined Keap1a and Keap1b activity in zebrafish gastrulae (8 hpf).</p></disp-quote><p>The reviewer unfortunately missed the data: hKeap1 protein is still present at the time points we use (See Figure 4C, and Supporting Figures 1C, 8B, 9, 11); we also have very clear and well-designed controls to show that the expressed protein is necessary for our phenotypes, ruling out effects of the compound alone, light alone, etc. (see the same figures cited above). Indeed, we have used a similar set up/time-scale, to study Akt signaling and Ube2V2 signaling also in zebrafish [Long et al. <italic>Nat Chem Biol</italic> 2017; 13:333338; Zhao et al. <italic>ACS Cent Sci</italic> 2018; 4(2):246-259], where both these proteins were shown to be labeled following Z-REX execution 36 h post fertilization and mRNA-injection.</p><p>Aside from what has been done in the past (papers cited above), there are also experimental reasons to study fish at the 36 h stage. Had we followed the 2008 JBC paper the reviewer refers to frequently, where experiments are performed at 8 h post fertilization (<italic>where the tail etc., are not visible</italic>), we would <italic>not</italic> have been able to perform our intended experiments looking at tissue-specific variation in responses… Around 36 h these structures are obvious, rendering our intended experiments actually achievable.</p><p>As for the experiments performed 48 h post injection, our intention was to examine <italic>the latency</italic> of AR upregulation following ZREX-assisted Keap1-specific modification, which we recognize is a function of the duration of the expressed protein, and the mRNA, but in reality, is the only fair way to examine longevity of the signal, and to show that we have not in some way seriously impacted zebrafish development. We believe that we are better off not ignoring these potential issues.</p><p>We hope that these explanations collectively clarify why the timing we chose was relevant and necessary.</p><disp-quote content-type="editor-comment"><p>9) The electrophile-labeling results for Ht-PreHNE and Ht-PreNE shown in Figure 7B and Supp. Figure 13 are puzzling. They suggest that ~20% of KEAP1 is HNE(alkyne)-modified and ~12% is NE(alkyne)-modified. Since it is believed that electrophile-mediated activation of NRF2 acts by stoichiometrically suppressing KEAP1 function, the authors should explain how these results relate to the ability of Ht-PreHNE and Ht-PreNE to induce antioxidant responses in embryos expressing HaloTag-functionalized KEAP1 (e.g., Figure 3, Figure 4, Supp. Figure 4, Supp. Figure 7, and Supp. Figure 9).</p></disp-quote><p>Our published work on multiple systems and pathways collectively indicate that substoichiometric labeling of a host of electrophile-sensor proteins by HNE and other native reactive lipid-derived metabolites is sufficient to elicit either gain-offunction or dominant-negative signaling; in this aspect, native electrophile signaling behaves similarly to typical signalamplification mechanisms operative for classical enzymatic-PTMs such as phosphorylation:</p><p>Liu et al. ACS Central Science 2020 <italic>in press</italic> 10.1021/acscentsci.9b00893</p><p>Long et al. RSC Chemical Biology 2020 <italic>in press</italic> 10.1039/D0CB00041H</p><p>Poganik et al. Helv Chim Acta 2020 <italic>103</italic>, e2000041</p><p>Poganik et al. Front Aging Neurosci 2020 <italic>12</italic>, 1</p><p>Long et al. Methods in Enzymology 2020 <italic>633,</italic> 203-230</p><p>Poganik et al. FASEB Journal 2019 <italic>33,</italic> 14636-14652</p><p>Poganik et al. Trends in Biochem Sci 2019; 44(4):380-381</p><p>Long et al. Antioxid Redox Signal 2019.7894</p><p>Long et al. Curr Opin Chem Biol 2019; 51:48-56</p><p>Long et al. Front Chem 2019; 7:125</p><p>Liu et al. Trends Biochem Sci 2019; 44(1):75-89</p><p>Parvez et al. Chem Rev 2018; 118(18):8798-8888</p><p>Surya et al. ACS Chem Biol 2018; 13(7):1824-1831</p><p>Van Hall-Beauvais et al. Curr Protoc Chem Biol 2018;10(3):e43</p><p>Zhao et al. ACS Central Science 2018; 4(2):246-259</p><p>Poganik et al. Bioessays 2018; 40(5)</p><p>Long et al. Biochemistry 2018; 57(2):216-220</p><p>Long et al. Cell Chem Biol 2017; 28(8):944-957</p><p>Long et al. Cell Chem Biol 2017; 24(7):787-800</p><p>Long et al. Nat Chem Biol 2017; 13:333-338</p><p>Long et al. ACS Chem Biol 2017; 12(3):586-600</p><p>Parvez et al. Nat Protoc 2016; 11:2328-2356</p><p>Long et al. Chem Res Toxicol 2016 29(10):1575-1582</p><p>Long et al. J Am Chem Soc 2016 138(11):3610-3622</p><p>Lin et al. J Am Chem Soc 2015; 137(19):6232-6244</p><p>Parvez et al. J Am Chem Soc 2015; 137(1):10-13</p><p>Fang et al. J Am Chem Soc 2013; 135(39):14496-9</p><p>We are working hard to understand molecular reasons for these effects but based on the published and ongoing work, precise mechanisms are also system-dependent. In the case of Keap1, one simple possibility is that the free Nrf2 is much less than the ~20% Keap1 that is modified, hence making “substoichiometric Keap1-labeling” super-stoichiometric compared to free Nrf2.</p><p>However, this simple mechanism is not possible in many of the other proteins we have studied.</p><p>Our added data (Figure 8A-B, Supporting Figure 15), show that zKeap1b can release Nrf2 upon electrophile labeling. Clearly going from a degrader, and cytosolic anchor to a releasor can explain how relatively small amount of labeling can raise AR.</p><disp-quote content-type="editor-comment"><p>10) The authors' studies of Keap1a and Keap1b function in HEK293T cells assumes that both zebrafish proteins maintain their functions in mammalian cells. There is no guarantee that this will be the case, as there will be species-specific structural differences in E3 ligase components and their substrates (not to mention different culture temperatures).</p></disp-quote><p>The reviewer unfortunately missed the validation data in our original manuscript where we actually demonstrated that zebrafish Keap1 paralogs are both functional and electrophile responsive when expressed in cultured human cells: they were able to suppress AR in HEK293T (Figures 7C, 7D and Supporting Figures S14 and Author response images 2 and 3) and they were labeled efficiently by T-REX (a feat that is only possible to the most active electrophile-sensor proteins) (Figure 7B, Supporting Figure 13). Keap1a and Keap1b are also expressed similarly at similar plasmid loads (indicative of, although not proof of, similar stability) but certainly meaning that we are comparing the same amount of active protein. Finally, our latest data (Figure 8A-B, Supporting Figure 15), would indicate that release of Nrf2 from Keap1b is responsible for AR upregulation, meaning that Cul3 etc in human is likely not important.</p><disp-quote content-type="editor-comment"><p>Based on these cell-based assays, the authors claim that Keap1b is less efficient than Keap1a at suppressing antioxidant responses. However, this interpretation is at odds with the previous studies by Li et al. (J. Biol. Chem., 2008) that show Keap1a and Keap1b have comparable effects on Nrf2 stability and antioxidant responses in zebrafish embryos. The authors should comment on this difference.</p></disp-quote><p>As explained above, several key validation data sets that we presented in our original manuscript were unfortunately overlooked. Ignoring this, we can break down the reviewer’s question above to two questions: (i) whether the data we presented here are necessarily different from the 2008 JBC paper the reviewer quotes; and (ii), whether the reviewer’s demand for comparison is a relevant question.</p><p>As for the first point, as we point out above, the 2008 JBC paper is not really quantitative (see explanations above, Page 8-19), did not compare even equal amounts of mRNA injected between the two constructs, (although this was claimed to give similar protein expression, this trend was not examined for each concentration, and could readily be variable), and we do not know what aspect of Keap1 dominates these assays <italic>when excess GFP-Nrf2 (not full length) is introduced in developing embryos</italic>. As we do know that the data derived from the cell culture experiments with Keap1-isoforms is recapitulated in the fish AND in human mutants, we personally think that the reviewer’s concerns are, with respect, not borne out by the data. Finally, the same authors later showed in a follow up paper that overexpressed Keap1a/Keap1b in zebrafish embryos behave similarly to how we propose in terms of electrophile responsivity as single proteins (the heterozygous state was not investigated) <sup>8</sup>.</p><p>As for the second point, the key relevance here is to investigate the effect in the “mixed” system (although we did first characterize the single expression constructs and ensure that individual plasmid amounts when used alone as well as in combination were such that the dynamic range of the assay was maintained; see Supporting Figure 14A-B; note, Y-axis in 14B is in log-scale; and also see Author response images 2 nd 3). This mixed system shows properties, in both the hKeap1-C273I state as well as the Keap1a/1b state (Figure 7 C-F), that are consistent with our model. Given that all our Keap1 proteins are active in two assays, the human/human-mutant system accounts for the E3-machinery, and the fish data are consistent with the data derived from zKeap1a/1b, we do not see how such variables are relevant or even reasonably fair to raise. <italic>These points further ring true in the light of data showing that it is release of Nrf2 from zKeap1b that is responsible for the AR upregulation properties of zKeap1b upon exposure to electrophiles. As this behavior has also been reported in zebrafish as well, altogether these data fully resolve reviewer’s questions/concerns.</italic></p><p>Finally, we note that the human Keap1-protein is also active when injected into the fish (as is true for most human proteins studied in zebrafish, hence its use as a model system in the field). This observation also indicates the interchangeability of the Keap1/Nrf2 system, as is commonly found for zebrafish/human, as the Guest Editor mentioned regarding human mRNA injection to rescue the deficiency of the corresponding endogenous gene in fish (Page 29).</p><disp-quote content-type="editor-comment"><p>11) In general this manuscript is very challenging to read,</p></disp-quote><p>With respect, having read the reviewer’s comments, we are concerned that they may not have read the manuscript. Respectfully we note that this does not appear to be an issue shared by Reviewers 1 and 3 or the Guest Editor. We also, with respect, note that a lot of the issues that the Reviewer 2 has stemmed, as we explained above and below, from misunderstanding/confusion.</p><p>We have thus redoubled our effort to make the manuscript as clear as possible.</p><disp-quote content-type="editor-comment"><p>and as a result, mechanisms proposed by the authors are difficult to follow. For example, the scheme in Figure 8 suggests that the electrophile-modified form of Keap1b potentiates Nrf2 function. Is this really what the authors mean to convey, as opposed to proposing that electrophile modifications of Keap1b prevent this E3 ligase component from promoting Nrf2 degradation? Or are the authors proposing that modified Keap1b can negatively regulate a suppressor of Nrf2 function?</p></disp-quote><p>Please also see our responses to Reviewer 1 Query no. 5 (above). In the electrophile modified state, Nrf2 that is built up on zKeap1b is released. It is this release that promotes AR. zKeap1a (presumably in both modified and unmodified states) suppresses this behavior. We have expanded the figure legends in Figure 8C and indeed throughout the manuscript for improved clarity.</p><disp-quote content-type="editor-comment"><p>The authors also suggest the Keap1a is &quot;a dominant-negative regulator of the antioxidant response in both basal and electrophile-stimulated states.&quot; However, Keap1-mediated Nrf2 degradation under basal conditions is believed to be a catalytic rather than a dominant-negative mechanism. And if electrophile-modified Keap1a acts as a dominant-negative regulator, what is it inhibiting in a stoichiometric manner?</p></disp-quote><p>The presence of zKeap1a suppresses the AR upregulation induced upon electrophile modification of Keap1b. This is apparent in both the fish MO experiments (Figure 2A, Supporting Figure 3,4,5) and in the cell-based experiments (when plasmids are mixed) Figure 7D,F, and Author response images 2 and 3. It is now clear that zKeap1a is able to prevent zKeap1b from releasing Nrf2 to allow AR to be upregulated (Figure 8A-B, Supporting Figure 15). This behavior is related to zKeap1a’s inability to release Nrf2 upon electrophile labeling, which has been reported by others. We have now improved the figure/legends in Figure 8C to make things more clear.</p><disp-quote content-type="editor-comment"><p>12) For the multiple reasons described above, authors' model for Keap1a and Keap1b function (Figure 8) does not have strong experimental support. Their model is also mechanistically counterintuitive. If Keap1a is the primary antagonist of Nrf2/antioxidant responses under basal conditions, then electrophile-induced Nrf2 signaling should be predominantly due to Keap1a modification and suppression.</p></disp-quote><p>We are unsure why this should hold true in general, especially seeing as fold-increase in AR upon zKeap1b-modification is higher than what occurs upon Keap1a-modification in cell culture (Figure 7E); (note ability to suppress AR in the basal state and ability to upregulate AR during electrophile treatment are NOT necessarily positively correlated, especially as fold changes induced by electrophiles are small and ability to suppress AR of each paralog is significant). The permissively of zKeap1b for AR upregulation, and the inability of zKeap1a to do likewise has also been previously reported<sup>8</sup>. Thus, in fact, the absolute magnitude of AR stimulated following zKeap1b-modification is significantly higher than that with Keap1a (Figure 7E, and indeed this observation is also very clear in Reviewer’s only figure 4 above), and one may hence naively expect the AR-upregulation to be greater in the “heterozygotic” state, where the AR is lower than in the case where there is only zKeap1b (Figure 7F). But it is not the case since the response is muted in the heterozygotic state. Remarkably, our latest data investigating the respective binding interaction with Nrf2 mirror these observations Figure 8A-B, Supporting Figure 15.</p><disp-quote content-type="editor-comment"><p>The authors propose instead that electrophile modification of the purportedly less effective antagonist, Keap1b, is the primary driver of increased Nrf2 activity and that modified Keap1a actually suppresses Nrf2 function further. It is difficult to see how electrophiles could mount 3- to 4-fold increases in antioxidant responses under these mechanistic constraints.</p></disp-quote><p>The changes in cell culture are more like 2-3 fold (observed when zKeap1b was expressed) (Figure 7E and F). For the most part, this amount of change is sufficient to cover the gamut of AR we measured in the fish. These low dynamic range/magnitude of changes are common in the field and we have ourselves considered and validated extensively; please see our responses to Reviewer 1 (Query 3), and to Guest Editor (Point 2).</p><p>To restate this differently, for clarity, as shown in Figure 7E and 7F, zKeap1b can mount a 2-3-fold response in electrophile-induced AR (despite showing a lower suppression effect on basal AR, Figure 7C). However, in the presence of zKeap1a, where if anything, basal AR is <italic>lower</italic> (Figure 7D), i.e., the output in terms of AR-upregulation is muted. Clearly, the electrophile-induced AR upregulation due to zKeap1b [which was ~3-fold (Figure 7E), even though basal AR due to Keap1b was higher, Figure 7C] is thus weakened.</p><list list-type="bullet"><list-item><p>Long et al. Akt3 is a privileged first responder in isozyme-specific electrophile response 2017 Nat Chem Biol, 13, 333-338; Liu et al. Precision Targeting of pten-Null Triple-Negative Breast Tumors Guided by Electrophilic Metabolite Sensing 2020 ACS Central Science, in press, DOI: 10.1021/acscentsci.9b00893</p></list-item><list-item><p>Parvez, et al. T-REX on-demand redox targeting in live cells 2016 Nature Protoc. 11, 2328-2356.</p></list-item><list-item><p>For instance, see Long et al. 2017 Nat Chem Biol 13, 333-338; Zhao et al. 2018 ACS Cent Sci 4, 246-259; Poganik et al. 2019 FASEB J 33, 14636-14652.</p></list-item><list-item><p>Kobayashi, et al. The Antioxidant Defense System Keap1-Nrf2 Comprises a Multiple Sensing Mechanism for Responding to a Wide Range of Chemical Compounds 2009, Mol. Cell Biol. 29, 493-502</p></list-item><list-item><p>Parvez et al. 2015 J Am Chem Soc 137, 10-13; Lin et al. 2015 J Am Chem Soc; 137, 6232-6244; Parvez et al. 2016 Nat Protoc 11, 2328-2356; Long et al. 2017 Cell Chem Biol 28, 944-957; Poganik et al. 2019 FASEB J 33, 14636-14652; Poganik et al. 2020 Helv Chim Acta 103, e2000041; Fang et al. 2013 J Am Chem Soc 135 14496-14499; Poganik et al. 2020 in revision in Nat Commun; Long et al. 2020 in revision in Nat Protoc.</p></list-item><list-item><p>Long and Urul, et al. Precision Electrophile Tagging in <italic>Caenorhabditis elegans</italic> 2018 Biochemistry 57, 216-220</p></list-item><list-item><p>For instance, see: Sant et al. The Role of Nrf1 and Nrf2 in the Regulation of Glutathione and Redox Dynamics in the Developing Zebrafish Embryo 2017 Redox Biol 13, 207-218; Fuse et al. Nrf2 activation attenuates genetic endoplasmic reticulum stress induced by a mutation in the phosphomannomutase 2 gene in zebrafish 2018 PNAS 115, 2758-2763; Goessling et al. S-Nitrosothiol Signaling Regulates Liver Development and Improves Outcome following Toxic Liver Injury 2014 Cell Rep, 6, 56-69; Timme-laragy et al. Nrf2b, Novel Zebrafish Paralog of Oxidant-responsive Transcription Factor NF-E2-related Factor 2 (NRF2) 2012 J. Biol. Chem. 287, 4609-4627</p></list-item><list-item><p>16 Mills et al. CRISPR-Generated Nrf2a Loss- And Gain-of-Function Mutants Facilitate Mechanistic Analysis of Chemical Oxidative Stress-Mediated Toxicity in Zebrafish 2020 Chem Res Toxicol 33 426-435</p></list-item><list-item><p>7 Kobayashi et al. The Antioxidant Defense System Keap1-Nrf2 Comprises a Multiple Sensing Mechanism for Responding to a Wide Range of Chemical Compounds 2009 Mol Cell Biol 29, 493-502</p></list-item><list-item><p>18 Timme-Laragy, et al. Nrf2b, Novel Zebrafish Paralog of Oxidant-responsive Transcription Factor NF-E2-related Factor 2 (NRF2) 2012 J Biol. Chem. 287, 4609-4627.</p></list-item></list><p>[Editors’ note: what follows is the authors’ response to the second round of review.]</p><disp-quote content-type="editor-comment"><p>Essential revisions:</p><p>– The revised document includes a number of 'validation' studies, but they are not consistent with expectations in the field in terms of controls and other validation. That does not mean their interpretation is necessarily wrong, it's that from the controls they do present, we do not know the boundaries where the work is likely limited in interpretation. Morpholino validation includes on-targeting and off-targeting questions. The authors present A LOT of work, but there are issues with both. (A) the authors appear to spend all of their time worried about on-targeting/efficacy measurements.</p></disp-quote><p>We are pleased that the reviewer noticed that we focused on on-target validations and made this section robust. We are sorry we did not explain why we eschewed looking at “off-target” effects in this specific manuscript, as we thought that the manifold reasons, as we now explain below, were apparent and because we believe that explaining why any of the panoply of possible experiments were eschewed is typically uncommon in a manuscript. Respectfully, we would also point out that off-target effects can also be validated by studying a simpler and/or an alternative model system; in this case, we use cultured cells.</p><disp-quote content-type="editor-comment"><p>For the translational blocking reagents, they do appear to be inhibiting their targets (and they now report their dosing per embryo). But their splice-site reagents are showing 30% or more wt RNA still present in all but one circumstance. Will only 70% knockdown be enough to show a phenotype? Not clear.</p></disp-quote><p>We are confused by this question.</p><p>– Firstly, the reviewer is likely aware that MOs rarely suppress 100% of their target protein expression. Indeed, this trait is shared by most RNAi methods, especially in higher eukaryotes, where we and others have reported typically 90-50% knockdown. Even with 90-50% knockdown, we have observed phenotypically-relevant outputs (. Fu et al., 2018 Nature Chemical Biology <italic>14</italic> 943-954 <italic>Nuclear RNR-α antagonizes cell proliferation by directly inhibiting ZRANB3</italic>; Zhao et al., 2018 ACS Central Science <italic>4</italic> 246-259 <italic>Ube2V2 Is a Rosetta Stone Bridging Redox and Ubiquitin Codes, Coordinating DNA Damage Responses</italic>; Poganik et al., 2019 FASEB J <italic>33</italic> 14636-14652 <italic>Post-transcriptional regulation of Nrf2-mRNA by the mRNA-binding proteins HuR and AUF1</italic>; Liu et al., 2020 ACS Central Science <italic>6</italic> 892-902 <italic>Precision Targeting of pten-Null Triple-Negative Breast Tumors Guided by Electrophilic Metabolite Sensing</italic>; Long et al., 2020 Cell Chemical Biology <italic>27</italic> 122-133 <italic>Clofarabine Commandeers the RNR-α-ZRANB3 Nuclear Signaling Axis</italic>.). Furthermore, knockout/mutagenesis typically creates truncations/modified proteins that could retain partial activity, so this issue is not unique to RNAi, although it is more easily quantifiable in RNAi.</p><p>– Secondly, as the reviewer is likely aware, both zKeap1a, a suppressor, and zKeap1b, a promoter, are present in the tissues we are interested in. So, 70% (global) suppression of one isoform likely <italic>underestimates</italic> the perturbation that occurs in the system as a whole. In line with this logic, there is ample evidence that many more genes than previously thought are haplo-insufficient (e.g., Elledge et al. 2013 Cell <italic>155</italic> 948-962; Hurles et al. 2010 PLoS Genetics <italic>6</italic> e1001154). Hence 50% loss has come to be a minimum standard in fields such as targeted protein degradation and RNAi. 70% (which is a pessimistic estimate) suppression healthily exceeds this criterion.</p><disp-quote content-type="editor-comment"><p>B) Off-targeting questions. In the Stainier guidelines paper, there are clear approaches to experimental design to address this question. Comparing to a mutant is the preferred approach, followed by RNA Rescue etc. We see none of this in this manuscript, or even a reason why they did not do these logical experiments.</p></disp-quote><p>Like all <italic>guidelines,</italic> those of Stainier et al. need to be implemented with care and understanding of the apposite caveats, both general and those intrinsic to the specific experiments at hand. <italic>In our particular situation,</italic> we are presented with a system wherein, overexpression of each zKeap1-isoform separately by mRNA injection in fish mirrors the phenotypes we observe upon knockdown; i.e., zKeap1a shows dominant-negative behavior for electrophile-induced AR in fish [work from elsewhere, (Kobayashi et al. 2009 Mol Cell Bio, cited as Ref. 29 in the previous manuscript version) performed with high statistical power/penetrance] and in cells (work in this manuscript), and zKeap1b is permissive for electrophile-induced AR when in excess, relative to zKeap1a in fish (work from elsewhere, i.e., by kobayashi et al. 2009 cited above). Indeed, at several places in the previous version of revised manuscript, these aspects were discussed (with Ref. 29 cited).</p><p>We note in passing that these data are already well in agreement with our own, which should have assuaged any concerns from the reviewer. However, Keap1 isoforms are the major upstream regulators of Nrf2, occupying the major node of AR regulation orchestrated by HNE-like electrophile, lying immediately upstream of AR-upregulation. Hence, in the light of the previously published data involving isoform-specific mRNA-overexpression, we will see “rescue” of our phenotypes, irrespective of whether or not such observation stems from MOs functioning on expected targets only: that is, irrespective of whether or not zKeap1a-knockdown has occurred, (over)expression of zKeap1a will suppress electrophile-induced AR in the tail, as zKeap1a levels will be elevated; similarly, irrespective of whether or not zKeap1b knockdown has occurred, (over)expression of zKeap1b will elevate electrophile-induced AR.</p><p>The use of human KEAP1, whose function cannot complement loss of zKeap1a anyway, is equally unlikely to be informative (as we show in the T-REX experiments in HEK293T cells). Thus, we have no unequivocal way to rule out that “rescue” is observed simply as a consequence of overexpression, and likely grounds to suspect that any reasonable effort to rescue would be confounding. Taken together, the rescue experiment with the respective targeted zKeap1-isoform is inherently likely to produce desired results. We thus believe that by default, such scenarios should be avoided when planning experiments and data so derived are not valid for MO validations, and thus in our opinion should not be requested by the reviewers.</p><p>These concerns are magnified given the poor dynamic range of AR. Such confounding outputs are common, even intrinsic, when dominant-negative effects are at play. We do not believe Stainier mentioned such a system as a case where RNA-rescue may be confounding in their paper, but as they are not uncommon in the biological canon, we should be aware of such caveats. Hence, we rightly obviated RNA-rescue experiments, and in the previous revision, we are sorry that an explanation for this was not included, as our concerns are generic, and that further work in an independent model system was also performed in the manuscript. Nonetheless, upon reviewers’ request, we have now added the reasons in this current revised manuscript.</p><p>The reviewer is correct that comparison to, or more correctly, replication of MO experiments in “mutants” may assuage concerns of off-target behavior. However, in the case of zKeap1a/b, such mutants are <italic>not</italic> available. Furthermore, we have found significant issues with implementation/use of Keap1 mutants in general. In electrophile/developmentally-responsive systems, where other regulators can assume important roles upon knockout, such as AR, such mutants are unlikely informative anyway. But more importantly, there are further issues with RNA-based rescue in the specific context of this manuscript. Unlike rescue of RNAi in cell culture, where expression levels of the protein upon rescue can be readily quantified and normalized (even at the single cell level), mRNA injection in fish does not mirror canonical tissue distribution. Hence, one cannot be sure if putative “rescue” or otherwise, be due to severe localized overexpression/system perturbation, or the replenishment of the wild-type state. As we are investigating divergent tissue-specific effects in a complex and delicately balanced binary system oscillating between dominance of a suppressive or permissive paralog, mRNA-based rescue is further likely to be uninformative.</p><p>Finally, as we are investigating Keap1/Nrf2 system, which is held as the principal mechanism through which cells defend against electrophile stress (note: overexpression of zKeap1a suppresses all AR stimulation spurred by HNE-like electrophiles), we believe our interpretations and plans of action are logical and with ample precedent. The fact that in embryos, zKeap1a behaves as a dominant-negative regulator of electrophile response underscores this point, just as much as the same data render RNA “rescue” improper.</p><p>In the wake of these logical issues, we further submit that performing mRNA-based rescue just for the sake of adhering to Stainier guidelines is likely contrary to the spirit of the guidelines themselves. Indeed Stainier et al. say:</p><p>“Of course, there will be exceptions when the full set of guidelines cannot be followed.”</p><p>We therefore moved to a more controlled system and investigated the specific effects of the individual zebrafish proteins or a mixture of the twain. We would also point out that the fish and cell-based data are reinforcing (a key point of the paper that may have been missed by the reviewer): our data from cell culture, a well-controlled system, are strongly consistent with our own MO data and those from overexpression by mRNA injection carried out by an independent laboratory (Kobayashi et al. 2009 Mol Cell Biol, cited as Ref. 29). As we see congruence between the trine, we submit that our data are compelling.</p><p>We have now added the following to the text:</p><p>In the Results section:</p><disp-quote content-type="editor-comment"><p>“In the light of previous data indicating Keap1a suppresses electrophile-induced AR and Keap1b performs an opposing function, and our own data that showed a complex interplay between the two isoforms in the same tissues, we recognized that rescue of the effects of these MOs by mRNA injection is prone to dominant factors associated with the expression of the specific Keap1 isoforms. Hence, although rescue is a control suggested in the Stainier guidelines for MO usage, where possible, we eschewed further experimentation using MOs, and investigated these effects using complementary methods in fish and cell culture.”</p></disp-quote><p>In the Discussion section:</p><disp-quote content-type="editor-comment"><p>“We point out that such systems are indeed apposite for study by this combination of fish and ectopic expression in human cells. This is because of the control offered by ectopic expression, and because of the overall dominant-negative effects conferred by the zKeap1a isoform. The latter render interpretation of data derived from MO rescue, particularly in a tissue specific manner difficult to interpret.”</p></disp-quote><p>In sum, we reiterate that the Stainier paper is actually quite definitive that none of its suggestions are set in stone. In our opinion, advocating such criteria be blindly followed would devalue what is overall a thoughtful, measured, and realistically cautious piece of scientific opinion. We further point out, respectfully, that the Stainier paper focused <italic>entirely</italic> on experiments carried out exclusively in fish, which is manifestly not the case in our manuscript either.</p><disp-quote content-type="editor-comment"><p>– Statistical assessment – We are concerned about the confidence interval numbers (we think that's what's shown) compared to the data distribution shown in this manuscript. Just one example – Figure 2A: comparing control MO1 with Keap1a+Keap1b MO injections. This should show the largest differential.</p></disp-quote><p>We first apologize for not being clear what the numbers above each set of points represent. They represent P values derived from a two-tailed t-test between the points shown (this has now been specified in each figure legend).</p><p>Respectfully, the assertion above made by the reviewer is untrue. Taking Figure 2A as an example, we would like to clarify several points. Firstly, the magnitude of <italic>suppression</italic> (e.g., by Nrf2a MO) may be larger than the elevation induced by zKeap1a/b suppression (and the largest differential should always be between the highest and the lowest points, neither of which is the Control-MO1 in Figure 2A); secondly, and more importantly, the difference between the mean of one set and another is not the only factor defining statistical significance. The spread of the datasets being compared (assuming this is what the reviewer meant by ‘data distribution’) also intrinsically affects ability to define if two points differ significantly; hence small differences between sets with low spread may be significantly different, whereas larger differences with higher spread may not be.</p><disp-quote content-type="editor-comment"><p>Seems to be about 30 individual data points. The authors claim these distributions are 99.86% likely to be different.</p></disp-quote><p>We are again sorry that the legend did not make it clear that what these numbers represent. P values derived as such may (although strictly <italic>not</italic> correctly) be used to infer the likelihood of the two data sets being different by chance. Either way, there is reasonable confidence that there is a difference between the twain that is not present for the Control-MO relative to zKeap1a- or Keap1b-alone-MOs.</p><disp-quote content-type="editor-comment"><p>But the visual data set suggests that the only primary difference is that 1/30 data points are above 1.6x in control MO1 versus 4/30 data points are above 1.6x.</p></disp-quote><p>Below we provide the individual data points. However, respectfully, the “visual data” is some oblique reference to the viewer’s eyeballing of how specific data points are distributed. Furthermore, we would respectfully point out that it is rarely informative to use &lt;10% of the data sets as a gauge for the bulk thereof.</p><table-wrap id="sa2table1" position="float"><label>Author response table 1.</label><table frame="hsides" rules="groups"><thead><tr><th>Control MO1:</th><th>Keap1a+ Keap1b MOs:</th></tr></thead><tbody><tr><td align="left" valign="top">0.718147</td><td align="left" valign="top">1.207962</td></tr><tr><td align="left" valign="top">0.878549</td><td align="left" valign="top">0.994521</td></tr><tr><td align="left" valign="top">0.948409</td><td align="left" valign="top">1.913047</td></tr><tr><td align="left" valign="top">1.186984</td><td align="left" valign="top">1.378654</td></tr><tr><td align="left" valign="top">0.884733</td><td align="left" valign="top">0.940147</td></tr><tr><td align="left" valign="top">2.546936</td><td align="left" valign="top">1.047857</td></tr><tr><td align="left" valign="top">0.951229</td><td align="left" valign="top">1.642165</td></tr><tr><td align="left" valign="top">0.754858</td><td align="left" valign="top">1.062155</td></tr><tr><td align="left" valign="top">0.851931</td><td align="left" valign="top">1.152548</td></tr><tr><td align="left" valign="top">0.92753</td><td align="left" valign="top">0.849358</td></tr><tr><td align="left" valign="top">0.824372</td><td align="left" valign="top">1.882668</td></tr><tr><td align="left" valign="top">0.846983</td><td align="left" valign="top">2.276351</td></tr><tr><td align="left" valign="top">0.881814</td><td align="left" valign="top">0.776578</td></tr><tr><td align="left" valign="top">0.835752</td><td align="left" valign="top">1.685852</td></tr><tr><td align="left" valign="top">1.077839</td><td align="left" valign="top">1.445002</td></tr><tr><td align="left" valign="top">1.096838</td><td align="left" valign="top">1.091</td></tr><tr><td align="left" valign="top">0.561753</td><td align="left" valign="top">0.992839</td></tr><tr><td align="left" valign="top">0.978788</td><td align="left" valign="top">1.430555</td></tr><tr><td align="left" valign="top">1.246553</td><td align="left" valign="top">1.413931</td></tr><tr><td align="left" valign="top">0.439883</td><td align="left" valign="top">0.520341</td></tr><tr><td align="left" valign="top">0.74971</td><td align="left" valign="top">2.35952</td></tr><tr><td align="left" valign="top">0.914093</td><td align="left" valign="top">1.018022</td></tr><tr><td align="left" valign="top">1.073679</td><td align="left" valign="top">1.400721</td></tr><tr><td align="left" valign="top">1.111666</td><td align="left" valign="top">1.259565</td></tr><tr><td align="left" valign="top">1.065044</td><td align="left" valign="top">1.550881</td></tr><tr><td align="left" valign="top">0.872091</td><td align="left" valign="top">1.638009</td></tr><tr><td align="left" valign="top">1.359449</td><td align="left" valign="top">1.074574</td></tr><tr><td align="left" valign="top">1.50905</td><td align="left" valign="top">1.613914</td></tr><tr><td align="left" valign="top">1.068633</td><td align="left" valign="top">1.139783</td></tr><tr><td align="left" valign="top">0.718333</td><td align="left" valign="top"/></tr><tr><td align="left" valign="top">0.920063</td><td align="left" valign="top"/></tr><tr><td align="left" valign="top">1.123783</td><td align="left" valign="top"/></tr><tr><td align="left" valign="top">0.880229</td><td align="left" valign="top"/></tr><tr><td align="left" valign="top">1.310766</td><td align="left" valign="top"/></tr><tr><td align="left" valign="top">1.520599</td><td align="left" valign="top"/></tr><tr><td align="left" valign="top">0.810581</td><td align="left" valign="top"/></tr><tr><td align="left" valign="top">1.49313</td><td align="left" valign="top"/></tr><tr><td align="left" valign="top">0.776006</td><td align="left" valign="top"/></tr></tbody></table></table-wrap><disp-quote content-type="editor-comment"><p>Visually, the numerical value just does not align with the graphical representation they present. This same issue is found throughout the manuscript.</p></disp-quote><p>In Figure 2A as well as the rest of the data in the manuscript, the mean and s.e.m are shown on the plots. The Control-MO and double-MO sets are clearly different with error bars that are non-overlapping (unlike the zKeap1a- and zKeap1b-MO-only sets, which are, consistent with this observation, not significantly different). It is clear that there is one outlier in the Control-MO set, which is highly elevated in AR, augmenting the spread of the control, and winnowing the chances of observing statistical significance. However, even given this outlier (and we can confirm we did not remove any outlier in any data sets), it is clear that the majority of points in the Control-MO group lie around 1, whereas the points in the double-MO set are more dispersed, with many above 1 (see Table above).</p><p>The discussion we made here using Figure 2A as an example extends to all data sets in corollary and should assuage any similar concerns.</p><disp-quote content-type="editor-comment"><p>Indeed, the data distribution graphs raise a key question of study design – how many times were these experiments independently run? We are not sure combining biological replicates is the best way to go, if that's what they did. It is not clear from the text how they derived the data points they show.</p></disp-quote><p>Once again, we sincerely apologize for this confusion.</p><p>Briefly, the raw data values for each set were then divided by the mean of the control data set. We are not sure what the reviewer means by “combining biological replicates”. Does this suggestion imply only one fish be shown; or that data sets on different days be ignored; or the variation between different sets on different days not be taken into account (as happens when data sets are not combined)? Neither of these options sounds best scientific practice to us.</p><p>We have now expanded the “data quantification and analysis” (on Page 29 of previous manuscript), to include additional sentences:</p><p>“Data quantitation and analysis: Imaging data was quantitated using ImageJ (NIH). For assessing AR upregulation in <italic>Tg</italic>(<italic>gstp1</italic>:<italic>GFP)</italic> fish, the area around the head (excluding the eyes) or the tail (median fin fold) were selected using freeform selection tool. Corresponding illustrations are included in each sub-figure for clarity. The mean red fluorescence intensity of the selected region was measured and subtracted from the mean background fluorescence intensity (region with no fish). Any non-transgenic fish larvae were excluded from the quantitation. The mean value for the control group was calculated from the raw, background-subtracted, values within that control group. Then all raw values were divided by the mean for the control. n for imaging experiments represent the number of single cells or fish embryos quantified from at least 7-8 fields of view with controls (empty vector controls for ectopically-overexpressed proteins, shRNA knockdown cell controls for endogenous proteins) shown in the figures. Unless specified, all <italic>t</italic> tests were two-tailed analysis. n for western blot/gels, qRT-PCR, and luciferase assays represents the number of lanes on western blots/gels under identical experimental conditions and each lane is from a separate individual replicate, no. of independent biological replicates as indicated in the figure legends.”</p><disp-quote content-type="editor-comment"><p>– Why was myc-Nrf2 used for the experiments shown in Figure 7, whereas HA-Nrf2 was used for the experiments shown in Figure 8?</p></disp-quote><p>In our experience HA tagging is the most sensitive and indeed it is well established that anti-HA antibody we use is one of the most high-affinity and effective known, hence it is best used for delicate experiments. We find Myc less effective in these situations. <italic>We have now noted these reasons in the revised manuscript text, in the corresponding figure legends.</italic></p><disp-quote content-type="editor-comment"><p>– Figure 7. The authors say in the text (beginning on line 454): 'Intriguingly, when zKeap1b was co-transfected with sub-saturating amounts of zKeap1a, no decrease in basal AR was observed relative to zKeap1a alone (Figure 7D), implying that zKeap1a somehow affects the ability of zKeap1b to suppress AR.' Is it possible that the absence of C273 makes zKeap1a a more efficient repressor, because this cysteine when present (as in zKeap1b) senses endogenous electrophile(s)/oxidant(s) at basal state? If repression of AR by zKeap1a is already maximal (as suggested by the data), is co-transfection with zKeap1b expected to have any further effect?</p></disp-quote><p>It appears to us that the reviewer may be claiming that zKeap1b is somehow already partly-electrophile-inhibited in the basal state (prior to electrophile exposure/modification) (leading to impaired AR suppression). We would like to clarify that zKeap1b remains responsive to electrophiles, as shown by our data in cells (and also by mRNA-injection data by Kobayashi et al.). Indeed, zKeap1b is significantly more responsive to electrophiles than zKeap1a, which was also shown by Kobayashi et al. 2009.</p><disp-quote content-type="editor-comment"><p>– Figure 8. The authors say in the text (beginning on line 490): 'We found that zKeap1b accumulated Nrf2 in the basal (i.e., non-electrophile-stimulated) state, whereas relative to zKeap1b, zKeap1a accumulated less Nrf2, and zKeap1a/zKeap1b accumulated an amount of Nrf2 that was significantly more than Keap1a alone and less than zKeap1b alone (Figure 8A-B).'</p></disp-quote><p>The suppression by zKeap1a is sub-saturating, as the reviewer also mentioned in the statement directly above. We point out that we get the same effect with the humanized mutant, where basal AR suppression is quite small.</p><disp-quote content-type="editor-comment"><p>• Could these data be interpreted that zKeap1a degrades Nrf2 better whereas zKeap1b does not?</p></disp-quote><p>Given that basal levels of Nrf2 are higher in cells expressing similar levels of zKeap1b than zKeap1a (Supplemental Figure 15; relabeled as ‘Figure 8—figure supplement 1’ in revised manuscript), zKeap1b appears to be less efficient at <italic>promoting</italic> proteasomal degradation of Nrf2. However, whether this is due to an effect on the E3 ligase, how Nrf2 is presented to the ligase, how ubiquitin accumulates on Nrf2, or slow release of Nrf2 from Keap1, among numerous possibilities, is beyond the scope of this paper.</p><disp-quote content-type="editor-comment"><p>This would be consistent with a scenario where the absence of C273 makes zKeap1a a more efficient repressor, because this cysteine senses endogenous electrophiles/oxidants at basal state, causing partial inactivation of zKeap1b.</p></disp-quote><p>Our data show that zKeap1b retains electrophile sensitivity (most models, as well as data from T-REX single-protein-specific electrophile-labeling system, propose a single electrophile modification event), and that zKeap1b upregulates AR better than zKeap1a. We do not believe that this alternative model is at all consistent with zKeap1b being attenuated through electrophile-inactivation in the ground state (non-electrophile-stimulated state).</p><disp-quote content-type="editor-comment"><p>• Is the presence of less Nrf2 bound to zKeap1b upon treatment with NE necessarily a consequence of release of Nrf2? Was an 18-h treatment necessary to see this effect? It seems a very long time; we would have thought that if NE was causing a release of Nrf2 from zKeap1b, the release should be evident at a much earlier time point. Can the authors be fully confident that release does occur when the released protein has not been observed/accounted for?</p></disp-quote><p>As related in our previously-revised manuscript version, the two models that are proposed are release of Nrf2 (prevention of Nrf2’s binding to Keap1), and formation of a permanently-bound state, which could also be referred to as an “abortive ternary complex” (preventing Nrf2 of Keap1-dependent proteasomal degradation). Of the twain, only the former is consistent with our data; indeed, the data are strongly consistent with electrophile-modified zKeap1b having significantly lower affinity for Nrf2 (noting also that, affinity is a function of on- and off-rates). [Nrf2 levels are not greatly affected by electrophile treatment in this system as based on the ‘input’ lanes of the western blot (Supplemental Figure 15; relabeled as ‘Figure 8—figure supplement 1’ in revised manuscript), but amount of Nrf2 pulled down is significantly reduced (Figure 8A-B)]. Given that turnover of Nrf2 on zKeap1b is slow (as otherwise the zKeap1b state would not build up Nrf2 in the first place; Supplemental Figure 15; relabeled as ‘Figure 8—figure supplement 1’ in revised manuscript), release of bound-Nrf2 actually seems likely (unless exclusively on-rate of Nrf2 to zKeap1b were affected by electrophile modification, and off-rate were particularly slow relative to degradation). Although we, accordingly, find it highly likely that release be contributing to AR-upregulation measured, to assuage the reviewer’s concerns, we have now referred to this as “<italic>net release</italic>”.</p><p>In our previous revised manuscript, we did certainly discuss that other possible interpretations such as inhibition of binding (which would likely lead to release of Nrf2 anyway, unless degradation were rapid, which it is clearly not) or inhibition of activity (which in isolation would lead to a build-up of NRf2 on zKeap1b, which is not observed) are possible/contributing.</p><p>We have expanded on the already existing context below, and qualified the word “release” with the adjective “net” throughout.</p><p>“To investigate this matter further, we showed that there are subtle differences in the way zKeap1a and zKeap1b function upon electrophile treatment. Whereas zKeap1a does not undergo net release of Nrf2 upon electrophile treatment, and further does not accumulate a large amount of Nrf2 in the steady-state prior to electrophile treatment, zKeap1b net relinquishes around 40% bound-Nrf2 upon electrophile treatment, and accrues a large amount of bound-Nrf2 in the basal state prior to electrophile treatment. The mixture of zKeap1a/zKeap1b also does not undergo net release of Nrf2 upon electrophile treatment, although it can still accrue substantial bound-Nrf2 in the state prior to electrophile treatment. These data allow rationalization of our results both from zebrafish and human cell culture, and favor a model in which decrease in affinity of electrophile-modified zKeap1b for Nrf2 is a means to upregulate AR in response to electrophilic stress. It is likely that such a mode of action leads to release of bound-Nrf2 from zKeap1b upon electrophile modification, given that turnover of Nrf2 on Keap1b is slow [or otherwise build-up of Nrf2 would not occur upon zKeap1b overexpression (just as it does not occur on zKeap1a)] and generally AR-upregulation is observed even at low-electrophile occupancy on Keap1 (See, for example, (i) Parvez, et al. T-REX on-demand redox targeting in live cells 2017 Nature Protoc. 11, 2328-2356; (ii) Long et al. β-TrCP1 is a vacillatory regulator of Wnt signaling 2017 Cell Chem Biol 24 944-957; (iii) Lin et al. A generalizable platform for interrogating target- and signal-specific consequences of electrophilic modifications in redox-dependent cell signaling 2015 J Am Chem Soc 137 6232-6244; (iv) Parvez et al. Substoichiometric hydroxynonenylation of a single protein recapitulates whole-cell-stimulated antioxidant response 2015 J Am Chem Soc 137 10-13.). Inhibition of rebinding of Nrf2 post dissociation, and inhibition of newly-synthesized Nrf2 binding to zKeap1b may also contribute to AR increase in such circumstances, as binding also contributes to zKeap1b–Nrf2 affinity. The contribution of zKeap1b re(binding) to Nrf2 to AR-upregulation vis-à-vis the contribution of release of bound-Nrf2 is difficult to parse, and indeed beyond the scope of this paper. Of course, other potential/synergistic mechanisms—such as inhibition of zKeap1b-promoted Nrf2 degradation—could occur in tandem. But the comparison of zKeap1a/zKeap1b and zKeap1b systems argues in favor of net release being the key component of AR upregulation.”</p><disp-quote content-type="editor-comment"><p>• There seems to be less HA-Nrf2 following NE treatment in the input samples (Suppl Figure 15), and it is thus possible that the NE treatment affects the turnover of HA-Nrf2. The normalization for the input addresses this; nonetheless, the semi-quantitative nature of the immunoblotting technique should be kept in mind.</p></disp-quote><p>We are unfortunately unsure if the reviewer were suggesting that less HA-Nrf2 indicates a slower turnover, or that increased Nrf2 turnover could lead to an upregulation of AR? We hope that the expanded discussion above alleviates any remaining concerns from the reviewer. We are aware of general issues with western blots including dynamic range, and fully understand the reviewer’s concern. We thus performed multiple independent replicates (6x). We would also like to respectfully note that quantitation of western blots is a valid and trusted way to ascertain changes quantitatively.</p><disp-quote content-type="editor-comment"><p>• Do the authors know the identity of the ~37 kDa fragment in the anti-FLAG blot?</p></disp-quote><p>We thank the reviewer for raising this point. Given the nature of the construct used we cannot be sure what the nature of this band be. However, as it is present almost equally in both zKeap1b and zKeap1b + zkeap1a, its presence cannot be sufficient to explain the differences between these two data sets. We have expanded the corresponding figure legends both in main figure legends and supporting figure legends, to include this statement.</p><disp-quote content-type="editor-comment"><p>• The results from the zKeap1a/zKeap1b co-transfection experiment are not straightforward to interpret, because Keap1 is a dimer, and thus the simultaneous presence of several dimeric combinations (e.g. zKeap1a/zKeap1b, zKeap1a/zKeap1a, zKeap1b/zKeap1b) is possible.</p></disp-quote><p>We see almost complete suppression of the effect of NE on zKeap1b when zKeap1a is present, both in terms of release of Nrf2 from bound-Keap1 (Figure 8A-B), and in terms of AR (Figure 7F). Thus, the vast majority of zKeap1b is affected by the presence of equal amounts of zKeap1a. If this were not the case, we should have seen release/loss of bound Nrf2 from the complex if nothing else (as occurs with zKeap1b alone). As the bound Nrf2 is due to zKeap1b, we would expect release similarly to what we described in zKeap1b, if zKeap1b were behaving independently. To make this more clear, we have now added the below to the revised manuscript:</p><p>“There are further <italic>potential</italic> complications in data interpretation due to there being three possible zKeap1 dimeric forms (ignoring higher-order structures) in the zKeap1a/zKeap1b-mixed system. However, an appreciable amount of Nrf2 is built up on zKeap1 in the zKeap1a/Keap1b system (unlike upon expression of zKeap1a alone), and <italic>no</italic> release of Nrf2 was observed upon NE treatment (unlike upon expression of zKeap1b alone). Thus, zKeap1a exerts a significant direct effect on how zKeap1b responds to electrophiles, and hence the heterodimer, or higher-order state(s) containing both proteins, must be a significant component of the zKeap1 present in the assay.”</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><disp-quote content-type="editor-comment"><p>While two of the original three reviewers are now satisfied, the third reviewer who is an expert on zebrafish has indicated that the zebrafish morpholino experiments are insufficiently rigorous to be acceptable. Below are the latest reviewer comments. We regret having to communicate this disappointing news. We hope that if you ultimately choose to address Reviewer 3's concerns with the requisite additional experimental data, that you will come back to eLife with a manuscript that includes this information when ready.</p><p>Reviewer #3:</p><p>None of my technical concerns tied to either the on-target or off-target effects were addressed.</p></disp-quote><p>We have used mRNA injection of the targeted gene to rescue the effects of the relevant MOs in the paper: please see Figure 2—figure supplement 1 and 2 in revised manuscript. We are sorry that the reviewer saw fit to ignore cell culture experiments, and judge the zebrafish experiments independently of other experiments carried out in the paper. Although we think that experiments should be independently rigorous, we do not believe that it is particularly fair to ignore other evidence presented in a paper, especially when those experiments were performed precisely to answer some of the questions the reviewer raised. We would like to also point out that we are indeed generally very familiar with RNAi and the reviewer’s suggested experiments (indeed, responsible use of KD/KO approaches as can be seen, for instance, in our recent publications<sup>1</sup>).</p><disp-quote content-type="editor-comment"><p>1) On-target. The maximal described knockdown was 70%. In our experience, effective morpholinos are readily able to go well beyond 90 or 95% knockdown - one of the key distinguishing features of MOs over siRNA is the normal ability to be well beyond 80% knockdown.</p></disp-quote><p>Respectfully, the point above has several issues in reality. First, as the principal goal of an siRNA experiment is to elicit a phenotype, the success of an RNAi experiment should be judged by that metric. In our case, we see phenotypes (that are rescuable by mRNA injection). Second, we hope the reviewer can understand that with two paralogs that are similarly expressed, the absolute magnitude of knockdown is likely underestimated in this specific context under study.</p><disp-quote content-type="editor-comment"><p>2) Off-target. The authors were given several options to address this concern, and they chose to not offer any new data. The specific suggestion to follow the Stainier guidelines was rebutted, arguing they did not have mutants etc.</p></disp-quote><p>We have used mRNA to rescue phenotypes attributed to knockdown of the two paralogs of zebrafish Keap1. In the case of Keap1b, this was successful on 34 hpf-old embryos, identical to those used in other experiments in the paper (Figure 2—figure supplement 2). In the case of Keap1a, mRNA injection was not successful on 34 hpf-old embryos, possibly due to instabilities of Keap1a mRNA, or due to effects incurred due to tissue non-specific expression of Keap1a. We thus examined 8 hpf-old embryos. In this instance, the effects of Keap1a-knockdown were rescuable with Keap1a-mRNA injection (Figure 2—figure supplement 1). We submit that these latest data are sufficient to adhere to the guidelines the reviewer requested that we follow.</p><disp-quote content-type="editor-comment"><p>I recommend rejection of this manuscript. The zebrafish work does not achieve the level of rigor expected in the field. If the authors were to come back after confirming their results using mutants and/or true rescue experiments with morpholinos that show strong on-target efficacy, the paper could be considered appropriate to publish in eLife.</p></disp-quote><p>We would like to point out that in the interim, we have published another paper on zebrafish that used a similar method (Poganik, Huang, et al. 2021 <italic>Nat Commun</italic>, 2021<bold>,</bold> <italic>12</italic> (1), 5736). This paper was able to answer numerous questions about the mechanism of an approved pleomorphic drug, Tecfidera. We submit that such success underscores that our approach is sound.</p><p>References</p><p>1. See, for example:</p><p>(a) Zhao, Y.; Miranda Herrera, P. A.; Chang, D.; Hamelin, R.; Long, M. J. C.; Aye, Y., Function-guided proximity mapping unveils electrophilic-metabolite sensing by proteins not present in their canonical locales. <italic>Proc Natl Acad Sci U S A</italic> 2022, <italic>119</italic> (5).</p><p>(b) Poganik, J. R.; Huang, K. T.; Parvez, S.; Zhao, Y.; Raja, S.; Long, M. J. C.; Aye, Y., Wdr1 and cofilin are necessary mediators of immune-cell-specific apoptosis triggered by Tecfidera. <italic>Nat Commun</italic> 2021, <italic>12</italic> (1), 5736.</p><p>(c) Fu, Y.; Long, M. J. C.; Wisitpitthaya, S.; Inayat, H.; Pierpont, T. M.; Elsaid, I. M.; Bloom, J. C.; Ortega, J.; Weiss, R. S.; Aye, Y., Nuclear RNR-alpha antagonizes cell proliferation by directly inhibiting ZRANB3. <italic>Nat Chem Biol</italic> 2018, <italic>14</italic> (10), 943-954.</p><p>(d) Liu, X.; Long, M. J. C.; Hopkins, B. D.; Luo, C.; Wang, L.; Aye, Y., Precision Targeting of pten-Null Triple-Negative Breast Tumors Guided by Electrophilic Metabolite Sensing. <italic>ACS Cent Sci</italic> 2020, <italic>6</italic> (6), 892-902.</p><p>(e) Poganik, J. R.; Long, M. J. C.; Disare, M. T.; Liu, X.; Chang, S. H.; Hla, T.; Aye, Y., Post-transcriptional regulation of Nrf2-mRNA by the mRNA-binding proteins HuR and AUF1. <italic>FASEB J</italic> 2019, <italic>33</italic> (12), 14636-14652.</p><p>(f) Zhao, Y.; Long, M. J. C.; Wang, Y.; Zhang, S.; Aye, Y., Ube2V2 Is a Rosetta Stone Bridging Redox and Ubiquitin Codes, Coordinating DNA Damage Responses. <italic>ACS Cent Sci</italic> 2018, <italic>4</italic> (2), 246-259.</p></body></sub-article></article>