<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.2 20190208//EN"  "JATS-archivearticle1-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">85058</article-id><article-id pub-id-type="doi">10.7554/eLife.85058</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Short Report</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Neurexins in serotonergic neurons regulate neuronal survival, serotonin transmission, and complex mouse behaviors</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-191634"><name><surname>Cheung</surname><given-names>Amy</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-4708-0293</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="other" rid="fund3"/><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-191629"><name><surname>Konno</surname><given-names>Kotaro</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-299589"><name><surname>Imamura</surname><given-names>Yuka</given-names></name><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf2"/></contrib><contrib contrib-type="author" id="author-256677"><name><surname>Matsui</surname><given-names>Aya</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-91418"><name><surname>Abe</surname><given-names>Manabu</given-names></name><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-91423"><name><surname>Sakimura</surname><given-names>Kenji</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-8091-8879</contrib-id><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-191636"><name><surname>Sasaoka</surname><given-names>Toshikuni</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-7797-4394</contrib-id><xref ref-type="aff" rid="aff8">8</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-191638"><name><surname>Uemura</surname><given-names>Takeshi</given-names></name><xref ref-type="aff" rid="aff9">9</xref><xref ref-type="aff" rid="aff10">10</xref><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-12290"><name><surname>Watanabe</surname><given-names>Masahiko</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-5037-7138</contrib-id><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-190724"><name><surname>Futai</surname><given-names>Kensuke</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-3433-3407</contrib-id><email>kensuke.futai@umassmed.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con10"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0464eyp60</institution-id><institution>Department of Neurobiology, University of Massachusetts Chan Medical School</institution></institution-wrap><addr-line><named-content content-type="city">Worcester</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00mvwb842</institution-id><institution>Brudnick Neuropsychiatric Research Institute, University of Massachusetts</institution></institution-wrap><addr-line><named-content content-type="city">Worcester</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0260j1g46</institution-id><institution>Medical Scientist Training Program, University of Massachusetts</institution></institution-wrap><addr-line><named-content content-type="city">Worcester</named-content></addr-line><country>United States</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02e16g702</institution-id><institution>Department of Anatomy, Faculty of Medicine, Hokkaido University</institution></institution-wrap><addr-line><named-content content-type="city">Sapporo</named-content></addr-line><country>Japan</country></aff><aff id="aff5"><label>5</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02c4ez492</institution-id><institution>Departments of Pharmacology and Biochemistry &amp; Molecular Biology, Institute for Personalized Medicine, Pennsylvania State University College of Medicine, 500 University Drive</institution></institution-wrap><addr-line><named-content content-type="city">Hershey</named-content></addr-line><country>United States</country></aff><aff id="aff6"><label>6</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/009avj582</institution-id><institution>Vollum Institute, Oregon Health &amp; Science University</institution></institution-wrap><addr-line><named-content content-type="city">Portland</named-content></addr-line><country>United States</country></aff><aff id="aff7"><label>7</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/04ww21r56</institution-id><institution>Department of Animal Model Development, Brain Research Institute, Niigata University</institution></institution-wrap><addr-line><named-content content-type="city">Niigata</named-content></addr-line><country>Japan</country></aff><aff id="aff8"><label>8</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/04ww21r56</institution-id><institution>Department of Comparative and Experimental Medicine, Brain Research Institute, Niigata University</institution></institution-wrap><addr-line><named-content content-type="city">Niigata</named-content></addr-line><country>Japan</country></aff><aff id="aff9"><label>9</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0244rem06</institution-id><institution>Division of Gene Research, Research Center for Advanced Science, Shinshu University</institution></institution-wrap><addr-line><named-content content-type="city">Nagano</named-content></addr-line><country>Japan</country></aff><aff id="aff10"><label>10</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0244rem06</institution-id><institution>Institute for Biomedical Sciences, Interdisciplinary Cluster for Cutting Edge Research, Shinshu University</institution></institution-wrap><addr-line><named-content content-type="city">Nagano</named-content></addr-line><country>Japan</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Brose</surname><given-names>Nils</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/04a7f6w43</institution-id><institution>Max Planck Institute of Experimental Medicine</institution></institution-wrap><country>Germany</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Westbrook</surname><given-names>Gary L</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/009avj582</institution-id><institution>Oregon Health &amp; Science University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><pub-date publication-format="electronic" date-type="publication"><day>25</day><month>01</month><year>2023</year></pub-date><pub-date pub-type="collection"><year>2023</year></pub-date><volume>12</volume><elocation-id>e85058</elocation-id><history><date date-type="received" iso-8601-date="2022-11-21"><day>21</day><month>11</month><year>2022</year></date><date date-type="accepted" iso-8601-date="2023-01-13"><day>13</day><month>01</month><year>2023</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint at bioRxiv.</event-desc><date date-type="preprint" iso-8601-date="2021-12-09"><day>09</day><month>12</month><year>2021</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2021.12.09.471904"/></event></pub-history><permissions><copyright-statement>© 2023, Cheung et al</copyright-statement><copyright-year>2023</copyright-year><copyright-holder>Cheung et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-85058-v1.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-85058-figures-v1.pdf"/><abstract><p>Extensive serotonin (5-hydroxytryptamine, 5-HT) innervation throughout the brain corroborates 5-HT’s modulatory role in numerous cognitive activities. Volume transmission is the major mode for 5-HT transmission but mechanisms underlying 5-HT signaling are still largely unknown. Abnormal brain 5-HT levels and function have been implicated in autism spectrum disorder (ASD). Neurexin (<italic>Nrxn</italic>) genes encode presynaptic cell adhesion molecules important for the regulation of synaptic neurotransmitter release, notably glutamatergic and GABAergic transmission. Mutations in <italic>Nrxn</italic> genes are associated with neurodevelopmental disorders including ASD. However, the role of <italic>Nrxn</italic> genes in the 5-HT system is poorly understood. Here, we generated a mouse model with all three <italic>Nrxn</italic> genes disrupted specifically in 5-HT neurons to study how Nrxns affect 5-HT transmission. Loss of <italic>Nrxns</italic> in 5-HT neurons reduced the number of serotonin neurons in the early postnatal stage, impaired 5-HT release, and decreased 5-HT release sites and serotonin transporter expression. Furthermore, 5-HT neuron-specific <italic>Nrxn</italic> knockout reduced sociability and increased depressive-like behavior. Our results highlight functional roles for Nrxns in 5-HT neurotransmission, 5-HT neuron survival, and the execution of complex behaviors.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>neurexin</kwd><kwd>serotonin</kwd><kwd>neurotransmitters</kwd><kwd>synaptic transmission</kwd><kwd>social behavior</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Mouse</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01MH130582</award-id><principal-award-recipient><name><surname>Futai</surname><given-names>Kensuke</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01NS085215</award-id><principal-award-recipient><name><surname>Futai</surname><given-names>Kensuke</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>T32 GM107000</award-id><principal-award-recipient><name><surname>Cheung</surname><given-names>Amy</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>F30MH122146</award-id><principal-award-recipient><name><surname>Cheung</surname><given-names>Amy</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Neurexins are presynaptic adhesion molecules in the serotonin system which regulate neuron survival and serotonin neuromodulation through active zone formation and serotonin release.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Serotonin (5-hydroxytryptamine, 5-HT) neurons in the raphe nuclei (RN) project their axons throughout the brain and modulate social interactions, stress responses, and valence among other processes. Abnormalities in 5-HT signaling have been extensively reported in neuropsychiatric disorders including depression, anxiety disorders, schizophrenia (SCZ), and autism spectrum disorder (ASD) (<xref ref-type="bibr" rid="bib16">Lesch and Waider, 2012</xref>). 5-HT reaches postsynaptic specializations through volume transmission or at synapses and synaptic triads (<xref ref-type="bibr" rid="bib2">Belmer et al., 2017</xref>). While much work has focused on deciphering receptor and reuptake dynamics in 5-HT signaling, the functional component important for 5-HT release remains undefined.</p><p>Nrxn genes (<italic>Nrxn1-3</italic>) encode alpha-, beta-, and gamma- (<italic>α/βNrxn1-3, γNrxn1</italic>) isoforms, and regulate synapse specification and function (<xref ref-type="bibr" rid="bib27">Südhof, 2017</xref>). Copy number variations and mutations in Nrxns are associated with ASD and SCZ (<xref ref-type="bibr" rid="bib27">Südhof, 2017</xref>). Numerous studies of <italic>α</italic> and <italic>βNrxn</italic> KO mice demonstrate impaired excitatory and inhibitory synaptic transmission (<xref ref-type="bibr" rid="bib27">Südhof, 2017</xref>). While Nrxns regulate fast synaptic transmission, no studies have examined the role of Nrxns in central neuromodulatory systems like the 5-HT system. Therefore, elucidating the impact of Nrxns in 5-HT transmission will allow a better understanding of pathophysiological mechanisms underlying neuropsychiatric disorders.</p><p>In this study, we investigated the functions of Nrxns in the 5-HT system by assessing signaling properties and behavior in 5-HT neuron-specific Nrxn triple knockout (TKO) mice. We demonstrated that the loss of <italic>Nrxn</italic> genes reduced 5-HT release and the number of 5-HT neurons and release sites in the mouse brain. Moreover, the lack of Nrxns in 5-HT neurons altered social behavior and depressive-like phenotypes. Our findings highlight Nrxns as functional regulators of 5-HT signaling and function.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Expression of <italic>Nrxn</italic> isoforms in 5-HT neurons and validation of the Fev/RFP/NrxnTKO mouse line</title><p>To characterize <italic>Nrxn</italic> genes expressed in 5-HT neurons, we analyzed scRNAseq data from a published database consisting of over 900 single-cell 5-HT neuron datasets (~1 million reads/cell) which generated 11 different 5-HT neuron clusters from the principal dorsal raphe nucleus (DRN), caudal DRN (cDRN), and median raphe nucleus (MRN) (<xref ref-type="fig" rid="fig1">Figure 1A</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>; <xref ref-type="bibr" rid="bib22">Ren et al., 2019</xref>). Transcriptional expression of six <italic>Nrxn</italic> isoforms (<italic>α-</italic>, <italic>βNrxn1/2/3</italic>) in 11 clusters indicated that all 5-HT neuron clusters express at least one <italic>α-</italic> and <italic>βNrxn</italic> isoform (<xref ref-type="fig" rid="fig1">Figure 1B, C</xref>). These results suggest that Nrxn proteins are expressed in 5-HT neurons in all RN regions.</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title><italic>Nrxn</italic> expression in the raphe nuclei and confirmation of <italic>Nrxn</italic> deletion in Fev/RFP/NrxnTKO mice.</title><p>Single-cell transcriptomic analysis of <italic>Nrxn</italic> expression in dorsal raphe nucleus (DRN), caudal DRN (cDRN), and median raphe nucleus (MRN) 5-hydroxytryptamine (5-HT) neurons. (<bold>A</bold>) Single-cell t-SNE plot of 999 Tph2-positive neurons representing 5-HT neurons analyzed from a recent publication (<xref ref-type="bibr" rid="bib22">Ren et al., 2019</xref>). Eleven transcriptomic clusters were correlated with anatomical location. DRN, cDRN, and MRN 5-HT neurons have six, one, and four different subclusters, respectively. (<bold>B</bold>) Single-cell t-SNE plots for the expression of six <italic>Nrxn</italic> isoforms in distinct 5-HT neuron populations. Cells are colored by log-normalized expression of each transcript, and the color legend reflects the expression values of ln(CPM + 1). (<bold>C</bold>) Violin plots of six <italic>Nrxn</italic> splice isoforms in 11 clusters. Although there are cluster-dependent <italic>Nrxn</italic> expression patterns (e.g., <italic>α</italic> and <italic>βNrxn3</italic> expression in MRN4), each <italic>Nrxn</italic> isoform is expressed in cells across all clusters. (<bold>D</bold>) Validation of the Fev/RFP/NrxnTKO mouse line. Expression of <italic>Nrxn</italic> genes in tdTomato-positive 5-HT neurons were compared between Fev/RFP (Cntl) and Fev/RFP/NrxnTKO mice. qPCRs against <italic>Nrxn 1</italic>, <italic>2</italic>, <italic>3</italic>, <italic>Tph2</italic>, and <italic>Gapdh</italic> (internal control) were performed for single-cell cDNA libraries prepared from tdTomato-positive neurons. Number of neurons: Fev/RFP (<italic>n</italic> = 23 neurons, 4 mice) and Fev/RFP/NrxnTKO (22, 4). Data are reported as mean ± standard error of the mean (SEM). n.s., not significant, *p &lt; 0.05, ***p &lt; 0.001, ****p &lt; 0.0001; Mann–Whitney <italic>U</italic>-test.</p><p><supplementary-material id="fig1scode1"><label>Figure 1—source code 1.</label><caption><title>Source code R file for t-distributed Stochastic Neighbor Embedding (tSNE) plots.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-85058-fig1-code1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>Source meta data for <xref ref-type="fig" rid="fig1">Figure 1</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-85058-fig1-data1-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig1-v1.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Validation of the Fev/RFP/NrxnTKO mouse line.</title><p>The expression of <italic>Nrxn2</italic> and <italic>Nrxn3</italic> genes in tdTomato-positive 5-hydroxytryptamine (5-HT) neurons were compared between Fev/RFP (Cntl) and Fev/RFP/NrxnTKO mice by dPCRs. Endpoint multiplex PCR was performed for each sample-targeted gene and the absolute copy numbers of <italic>Nrxn 2</italic> and <italic>Nrxn3</italic> (recorded by FAMTM signal) were normalized to that of TBP (recorded by HEX (VIC) signal). Number of neurons: Fev/RFP (<italic>n</italic> = 3, 3 mice) and Fev/RFP/NrxnTKO (3, 3). Data are reported as mean ± standard error of the mean (SEM). Mann–Whitney <italic>U</italic>-test.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig1-figsupp1-v1.tif"/></fig></fig-group><p>To test the roles of Nrxns in 5-HT neurons, we generated 5-HT neuron-specific <italic>Nrxn</italic> TKO mice by crossing <italic>Fev<sup>Cre</sup></italic>, an ETS family transcription factor promoting 5-HT neuron-specific Cre expression, tdTomato (RFP) reporter, and triple Nrxn1/2/3 floxed lines (Fev/RFP/NrxnTKO) (<xref ref-type="bibr" rid="bib24">Scott et al., 2005</xref>; <xref ref-type="bibr" rid="bib30">Uemura et al., 2022</xref>). Cre-negative littermates and Fev/RFP mice were used as control (Cntl) cohorts. The specific deletion of Nrxns in 5-HT neurons was confirmed by single-cell RT-qPCR and -dPCR (<xref ref-type="fig" rid="fig1">Figure 1D</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>). The Fev/RFP/NrxnTKO line was fertile and viable and did not demonstrate obvious differences in gross appearance.</p></sec><sec id="s2-2"><title>Reduced 5-HT release in Fev/RFP/NrxnTKO mice</title><p>While numerous studies indicate that Nrxns regulate fast neurotransmitter release including that of glutamate and GABA, no studies have tested Nrxn function in central neuromodulatory systems. To directly examine the role of Nrxn on 5-HT release, we measured 5-HT transients in the DRN and hippocampus using fast-scan cyclic voltammetry (FSCV) (<xref ref-type="fig" rid="fig2">Figure 2</xref>). 5-HT release was recorded with a voltage ramp delivered through carbon-fiber electrodes (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). Current–voltage (CV) plots displayed the expected currents for 5-HT oxidation and reduction peak potentials, indicating specificity for 5-HT (<xref ref-type="fig" rid="fig2">Figure 2B</xref>).</p><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>The lack of Nrxns in 5-hydroxytryptamine (5-HT) neurons reduces evoked 5-HT release in the dorsal raphe nucleus (DRN) and hippocampus.</title><p>(<bold>A</bold>) Voltage ramp protocol for detecting 5-HT with fast-scan cyclic voltammetry (FSCV). Rapid cycling (2.2 ms) of the voltage ramp produced a current based on voltage-dependent oxidation (blue, oxi) and reduction (red) representing real-time 5-HT release. (<bold>B</bold>) Representative current traces when measuring 5-HT (1 µM, blue) or dopamine (DA; 1 µM, orange) using carbon-fiber microelectrodes calibrated on a 5-HT voltage ramp. Insets: Background-subtracted current–voltage (CV) plots of the electrochemical current when 5-HT (left) or DA (right) was applied. Electrically evoked 5-HT transients detected in the DRN of littermate control (Cntl) (<italic>n</italic> = 6 slices, 3 mice) (<bold>C</bold>) and Fev/RFP/NrxnTKO (6, 3) (<bold>D</bold>) mice during perfusion with artificial cerebrospinal fluid (aCSF) (left), serotonin transporter (SERT) blocker fluoxetine (FLX, 10 µM, middle), and action potential-blocking tetrodotoxin (TTX; 1 µM, right). Top: representative CV plots of the electrochemical current in aCSF, FLX, and TTX. Middle: average 5-HT transients under each condition. Bottom: background-subtracted 3D voltammograms (false color scale) as a function of time (<italic>x</italic>-axis, 20 s) and voltage applied (<italic>y</italic>-axis). Note that TTX completely abolished peak transients indicating that FSCV measurements were mediated by action potential-induced 5-HT release. The expected oxidation peaks for 5-HT in the CV plots acquired from Cntl and Fev/RFP/NrxnTKO mice were similar. FLX application prolonged 5-HT transient area which verified that the FSCV transients detected 5-HT signals. Cntl and Fev/RFP/NrxnTKO mice showed similar responses to FLX. (<bold>E</bold>) Peak amplitude of 5-HT transients evoked using a 150- or 250-µA stimulation train (30 pulses, 30 Hz, 1 ms) in the DRN of Cntl (gray) and Fev/RFP/NrxnTKO (green) mice. 5-HT release was significantly different between genotypes (two-way repeated measures analysis of variance [ANOVA]: genotype main effect, <italic>F</italic><sub>1,10</sub> = 12.02, <sup>##</sup>p = 0.006; stimulation strength main effect, <italic>F</italic><sub>1,10</sub> = 26.89, p = 0.0004; stimulus strength × genotype interaction, <italic>F</italic><sub>1,10</sub> = 1.936, p = 0.2648). (<bold>F</bold>) Normalized area of 5-HT transients recorded in the DRN before and after FLX application. 5-HT transient area before and after FLX was significantly different (two-way repeated measures ANOVA: drug main effect, <italic>F</italic><sub>1,10</sub> = 63.88, <sup>####</sup>p &lt; 0.0001; genotype main effect, <italic>F</italic><sub>1,10</sub> = 0.004378, p = 0.9486; drug × genotype interaction, <italic>F</italic><sub>1,10</sub> = 0.1492, p = 0.7074). Electrically evoked 5-HT transients detected in the hippocampus of Cntl (<italic>n</italic> = 3) (<bold>G</bold>) and Fev/RFP/NrxnTKO (<italic>n</italic> = 3) (<bold>H</bold>) mice during perfusion with aCSF (left), SERT blocker FLX (10 µM, middle), and action potential-blocking TTX (1 µM, right). Top: representative CV plots of the electrochemical current in aCSF, FLX, and TTX. Middle: average 5-HT transients under each condition. Bottom: background-subtracted 3D voltammograms (false color scale) as a function of time (<italic>x</italic>-axis, 20 s) and voltage applied (<italic>y</italic>-axis). (<bold>I</bold>) Peak amplitude of 5-HT transients evoked using a 150- or 250-µA stimulation train in the hippocampus of Cntl and Fev/RFP/NrxnTKO mice. 5-HT release at each stimulation strength was significantly different between groups (two-way repeated measures ANOVA with Šidák’s post hoc test following significant stimulation strength × genotype interaction, <italic>F</italic><sub>1,9</sub> = 6.982, p = 0.0268; stimulation strength main effect, <italic>F</italic><sub>1,9</sub> = 11.24, p = 0.0085; genotype main effect, <italic>F</italic><sub>1,9</sub> = 24.56, p = 0.0008). (<bold>J</bold>) Normalized area of 5-HT transients recorded in the hippocampus before and after FLX application. 5-HT transient area before and after FLX differed in Cntl mice (two-way repeated measures ANOVA: drug main effect, <italic>F</italic><sub>1,9</sub> = 3.711, p = 0.0862 genotype main effect, <italic>F</italic><sub>1,9</sub> = 0.01351, p = 0.91; drug × genotype interaction, <italic>F</italic><sub>1,9</sub> = 0.09308, p = 0.7672). n.s., not significant, *p &lt; 0.05, ****p &lt; 0.0001; Cntl vs. Fev/RFP/NrxnTKO: <sup>##</sup>p &lt; 0.01; aCSF vs. FLX: <sup>####</sup>p &lt; 0.0001.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Source data for fast-scan cyclic voltammetry (FSCV) plots in <xref ref-type="fig" rid="fig2">Figure 2E, F, I, J</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-85058-fig2-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig2-v1.tif"/></fig><p>5-HT transients were recorded in the DRN where 5-HT neurons are highly clustered in littermate control and Fev/RFP/NrxnTKO mice (<xref ref-type="fig" rid="fig2">Figure 2C–F</xref>). Electrical stimulation was applied at two different stimulus strengths to evoke 5-HT release in acute brain slices containing the DRN. To confirm that electrically evoked FSCV transients were mediated by 5-HT release, the selective serotonin reuptake inhibitor fluoxetine (FLX) and action potential inhibiting sodium channel blocker tetrodotoxin (TTX) were applied (<xref ref-type="fig" rid="fig2">Figure 2C, D, F</xref>; <xref ref-type="bibr" rid="bib5">Carboni and Di Chiara, 1989</xref>). Importantly, 5-HT peak amplitude was significantly reduced in Fev/RFP/NrxnTKO mice (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). FLX caused a similar increase in 5-HT transient area in each genotype, indicating that Nrxn TKO did not change transporter activity (<xref ref-type="fig" rid="fig2">Figure 2F</xref>). Next, we performed FSCV recordings in the dorsal hippocampal CA3 region to determine whether differences in 5-HT release could be detected in a distal region receiving 5-HT fiber projections (<xref ref-type="fig" rid="fig2">Figure 2G–J</xref>). We observed robust suppression of 5-HT currents in Fev/RFP/NrxnTKO mice and no genotype-specific differences in response to FLX. Taken together, these findings indicate that Nrxns are important for 5-HT release.</p></sec><sec id="s2-3"><title>Reduced 5-HT fiber density and active zone number in Fev/RFP/NrxnTKO mice</title><p>Next, we analyzed whether Nrxns are important for 5-HT innervation in brain regions that receive 5-HT projections by analyzing RFP-positive fibers between Fev/RFP (Cntl) and Fev/RFP/NrxnTKO mice (<xref ref-type="fig" rid="fig3">Figure 3A–I</xref>; <xref ref-type="bibr" rid="bib1">Awasthi et al., 2021</xref>). We found that RFP+ fibers were reduced in the hippocampus, DRN and MRN of Fev/RFP/NrxnTKO mice relative to controls. Interestingly, no differences were seen in the projections to the nucleus accumbens suggesting that 5-HT inputs are not globally altered. In addition, serotonin transporter (SERT) expression in the brain was also reduced in brainstem and hippocampus (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). These findings suggest that Nrxns selectively mediate 5-HT fiber area depending on the innervated circuit.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>The absence of Nrxns in 5-hydroxytryptamine (5-HT) neurons decreases 5-HT fiber density, neuron number, and release sites.</title><p>Representative ×100 images of RFP-positive fibers in the nucleus accumbens core (NAcc) (<bold>A</bold>), nucleus accumbens shell (NAcSh) (<bold>B</bold>), dorsal hippocampal CA1–3 subregions (dCA1, 2, 3) (<bold>C–E</bold>), ventral hippocampal CA1 (vCA1) (<bold>F</bold>), dorsal raphe nucleus (DRN) (<bold>G</bold>), and median raphe nucleus (MRN) (<bold>H</bold>). (<bold>I</bold>) Quantification of the area of RFP-positive fibers revealed that 5-HT innervation was altered in specific brain regions in mice lacking Nrxns (<italic>n</italic> = 4 mice/genotype; for each mouse, 6 fields of view were averaged for each region). *p &lt; 0.05, ***p &lt; 0.001; unpaired two-tailed Student’s <italic>t</italic>-test. Scale bars, 10 µm. (<bold>J–M</bold>) Relative proportion of RFP-expressing 5-HT neurons in the DRN and MRN between Fev/RFP (Cntl, top row) and Fev/RFP/NrxnTKO (triple knockout, TKO, bottom row) mice at different ages: postnatal day 7 (P7) (<bold>J</bold>), 8 weeks (<bold>K</bold>), and &gt;14 months old (<bold>L</bold>). (<bold>M</bold>) Quantification of RFP+ neurons as a fraction of 5-HT+ (green) neurons at three different postnatal ages. Note that the RFP+/5-HT ratio in TKO mice decreased with aging, suggesting that TKO in 5-HT neurons causes postnatal cell death. The numbers of Cntl and TKO mice were (postnatal age, number of mice): Cntl: P7 and 8 w, 4 and 12–13 M, 2; TKO: P7 and 8 w, 4 and 12–13 M, 3. *p &lt; 0.05, two-way analysis of variance (ANOVA) (<bold>N, O</bold>). (<bold>N</bold>) Three consecutive triple immunofluorescence images with 200 nm step for RFP, RIM1/2, and serotonin transporter (SERT) obtained from Fev/RFP (Cntl, left) and TKO (right) brains. (<bold>O</bold>) Summary of RIM1/2 signal density between Cntl and TKO hippocampal CA3 region. ***p &lt; 0.0001; unpaired two-tailed Student’s <italic>t</italic>-test. Scale bars, 10 µm (<bold>A–H</bold>), 100 µm (<bold>J–L</bold>), and 2 µm (<bold>N</bold>).</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Source data for plots in <xref ref-type="fig" rid="fig3">Figure 3I and M</xref>, and <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-85058-fig3-data1-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig3-v1.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>The absence of Nrxns in 5-hydroxytryptamine (5-HT) neurons reduces serotonin transporter (SERT) expression.</title><p>Two brain regions brainstem and hippocampus were dissected from Fev/RFP/NrxnTKO (triple knockout, TKO) and littermate control (Cntl) brains (<italic>n</italic> = 6/genotype) and immunoblotted with anti-SERT and β-actin (βAct) antibodies. The graph shows SERT immunoblot intensity divided by βAct. Data are reported as mean ± standard error of the mean (SEM). **p &lt; 0.01; unpaired two-tailed Student’s <italic>t</italic>-test.</p><p><supplementary-material id="fig3s1sdata1"><label>Figure 3—figure supplement 1—source data 1.</label><caption><title>Source data blots.</title></caption><media mimetype="application" mime-subtype="pdf" xlink:href="elife-85058-fig3-figsupp1-data1-v1.pdf"/></supplementary-material></p><p><supplementary-material id="fig3s1sdata2"><label>Figure 3—figure supplement 1—source data 2.</label><caption><title>Unedited blotting images for brainstem and hippocampal (Hip) P2 proteins.</title></caption><media mimetype="application" mime-subtype="pdf" xlink:href="elife-85058-fig3-figsupp1-data2-v1.pdf"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig3-figsupp1-v1.tif"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 2.</label><caption><title>The expression of RIM1/2 in 5-hydroxytryptamine (5-HT) fibers in 100 nm ultra-thin sections.</title><p>Triple immunofluorescence images for RIM1/2, synaptophysin (Syn), and serotonin transporter (SERT) obtained from four consecutive 100 nm ultra-thin sections (first slice: A–C, second: D–F, third: G–I, fourth: J–L) in Cntl dorsal hippocampal CA3 region. The boxed area in low magnification images (A, D, G, J) is enlarged in the lower panels (B, C, E, F, H, I, K, L). Arrows indicate RIM1/2 immunofluorescent puncta associated with Syn and SERT. Scale bars, 2 µm.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig3-figsupp2-v1.tif"/></fig></fig-group><p>It has been reported that Nrxn TKO in cerebellar granule cells cause cell death (<xref ref-type="bibr" rid="bib30">Uemura et al., 2022</xref>), which raises the possibility that the reduced 5-HT fiber density is due to 5-HT neuron cell death. To address this possibility, we compared the population of RFP-expressing 5-HT-positive 5-HT neurons in the DRN and MRN between Fev/RFP (Cntl) and Fev/RFP/NrxnTKO mice at different ages (<xref ref-type="fig" rid="fig3">Figure 3L, M</xref>). The RFP/5-HT ratio between Cntl and Fev/RFP/NrxnTKO mice was comparable at P7 but reduced by increasing age specifically in Fev/RFP/NrxnTKO mice suggesting the postnatal loss of Cre-positive 5-HT neurons in Fev/RFP/NrxnTKO mice. To further elucidate the mechanism underlying reduced 5-HT release in Fev/RFP/NrxnTKO mice, we confirmed the expression of RIM, a major active zone protein, in synaptophysin-positive 5-HT terminals in ultra-thin sections (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). Next, we performed confocal imaging comparing the expression of RIM1/2 in 5-HT fibers in the hippocampus between Cntl and Fev/RFP/NrxnTKO mice (<xref ref-type="fig" rid="fig3">Figure 3N, O</xref>). The density of RIM1/2 in Fev/RFP/NrxnTKO mice was lower than that in Cntl. These results suggest that Nrxn TKO reduces 5-HT release by decreasing the number of 5-HT neurons and release sites.</p></sec><sec id="s2-4"><title>Mild social behavior impairment in Fev/RFP/NrxnTKO mice</title><p>We investigated the behavior of adult Fev/RFP/NrxnTKO mice in a variety of assays. Basic activities, evaluated by locomotor activity, rotarod performance, and open field, did not differ between Fev/RFP/NrxnTKO mice and Cre-negative littermate controls (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). To examine the role of Nrxns in 5-HT system-related behaviors, we next assessed social behavior. Cntl and Fev/RFP/NrxnTKO underwent a direct social interaction test to examine naturally occurring interactions between a subject mouse and a juvenile stimulus mouse. In trial 1, the stimulus mouse was unfamiliar to the subject mouse. After 24 hr, the subject mouse was re-exposed to the same stimulus mouse (trial 2) (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). Social investigation was measured across both trials and as a reduction in time that the subject mouse spent investigating the stimulus mouse in trial 2. We found that Fev/RFP/NrxnTKO mice spent less time exploring the stimulus mouse in trial 1 (<xref ref-type="fig" rid="fig4">Figure 4B</xref>) and differed in their investigation of the stimulus mouse across trials (<xref ref-type="fig" rid="fig4">Figure 4C</xref>) compared with littermate Ctnl mice. These results suggest that Fev/RFP/NrxnTKO mice have deficits in sociability. To further study sociability in the Fev/RFP/NrxnTKO mice, we performed a three-chamber social interaction test (3CST), in which a stimulus mouse was confined to a cylinder to limit direct interaction (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2A</xref>). Both littermate Cntl and Fev/RFP/NrxnTKO mice showed similar preferences for a stimulus mouse than for a second empty cylinder in a different chamber (days 1 and 2) and for a novel stimulus mouse than for the previously encountered juvenile conspecific (day 3) (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2B, C</xref>). Cntl and Fev/RFP/NrxnTKO mice showed different investigation behavior on day 1. However, there were no differences in exploration time between groups which contrasts the sociability deficits observed in the direct social interaction test. Interestingly, one of the depression tests, the forced swim test but not tail suspension test, revealed increased immobility behavior in Fev/RFP/NrxnTKO compared with littermate Cntl mice (<xref ref-type="fig" rid="fig4">Figure 4D, E</xref>). Other tests addressing learning and memory and repetitive behaviors displayed no abnormalities in Fev/RFP/NrxnTKO mice (<xref ref-type="fig" rid="fig4s3">Figure 4—figure supplement 3</xref>). These results demonstrate that the absence of Nrxns in 5-HT neurons impairs direct social behavior and moderately influences depression-related behavior.</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>The absence of Nrxns in 5-hydroxytryptamine (5-HT) neurons impairs social behavior.</title><p>(<bold>A</bold>) Direct social interaction test using the same juvenile stimulus across two trials. (<bold>B</bold>) Littermate control (Cntl) (gray, <italic>n</italic> = 13) and Fev/RFP/NrxnTKO (green, <italic>n</italic> = 13) mice differed in their investigation of the juvenile stimulus across the two trials. Both groups spent less time exploring the juvenile stimulus during trial 2 than in trial 1 (two-way repeated measures analysis of variance [ANOVA]: trial main effect, <italic>F</italic><sub>1,24</sub> = 7.855, <sup>##</sup>p = 0.0099; genotype main effect, <italic>F</italic><sub>1,24</sub> = 2.086, p = 0.1616; significant trial × genotype interaction, <italic>F</italic><sub>1,24</sub> = 4.344, p = 0.0479). Šidák’s post hoc test identified a significant genotype difference in investigation time in trial 1 (**p = 0.0041). (<bold>C</bold>) The difference score of the interaction time across trials was reduced in Fev/RFPNrxnTKO mice (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>24</sub> = 2.084, *p = 0.0479). (<bold>D</bold>) <italic>Left</italic>, Fev/RFP/NrxnTKO mice displayed increased immobile time compared with Cntl in the forced swim test (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 2.317, *p = 0.0302). <italic>Right</italic>, no difference in the number of immobile episodes was observed (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 1.301, p = 0.2068). (<bold>E</bold>) <italic>Left</italic>, Cntl (<italic>n</italic> = 12) and Fev/RFP/NrxnTKO (<italic>n</italic> = 12) mice showed no difference in time immobile in the tail suspension test (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 1.070, p = 0.2964). <italic>Right</italic>, there was no difference between genotypes in the number of immobile episodes (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 1.001, p = 0.3279).</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Source data for <xref ref-type="fig" rid="fig4">Figure 4</xref>.</title></caption><media mimetype="application" mime-subtype="xlsx" xlink:href="elife-85058-fig4-data1-v1.xlsx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig4-v1.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>5-Hydroxytryptamine (5-HT) neuron-specific Nrxn TKO does not alter basic behavioral activities.</title><p>(<bold>A</bold>) <italic>Left,</italic> Cntl (<italic>n</italic> = 12) and Fev/RFP/NrxnTKO (<italic>n</italic> = 12) mice showed no differences in horizontal locomotor activity (two-way repeated measures analysis of variance [ANOVA]: genotype main effect, <italic>F</italic><sub>1,22</sub> = 0.4666, p = 0.5017; time × genotype interaction, <italic>F</italic><sub>17,374</sub> = 0.9467, p = 0.5188). <italic>Right</italic>, cumulative locomotor activity did not differ between Cntl and Fev/RFP/NrxnTKO mice over the 90-min period (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 0.6831, p = 0.5017). (<bold>B</bold>) Cntl (<italic>n</italic> = 16) and Fev/RFP/NrxnTKO (<italic>n</italic> = 13) mice showed no differences in latency to fall over five trials of accelerating rotarod (two-way repeated measures ANOVA: genotype main effect, <italic>F</italic><sub>1,27</sub> = 0.2204, p = 0.6425; trial × genotype interaction, <italic>F</italic><sub>4,108</sub> = 0.2161, p = 0.929; trial main effect: <italic>F</italic>(2.943,79.47) = 37.52, p &lt; 0.0001). (<bold>C</bold>) <italic>Left</italic>, Cntl (<italic>n</italic> = 12) and Fev/RFP/NrxnTKO (<italic>n</italic> = 12) mice showed no differences in time spent in the center of the open field arena (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 0.04652, p = 0.9633). <italic>Right</italic>, there were no differences for the distance traveled during open field (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 0.1053, p = 0.9171). (<bold>D</bold>) <italic>Left</italic>, the time Cntl (<italic>n</italic> = 12) and Fev/RFP/NrxnTKO (<italic>n</italic> = 12) mice spent in the open arms during the elevated-plus maze was similar between genotypes (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 1.158, p = 0.2592). <italic>Right</italic>, Cntl (<italic>n</italic> = 12) and Fev/RFP/NrxnTKO (<italic>n</italic> = 12) mice both demonstrated similar total arm entries (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 0.3625, p = 0.7204). n.s.: not significant.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig4-figsupp1-v1.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Social behavior in the three-chamber social interaction test is preserved in Fev/RFP/NrxnTKO mice.</title><p>(<bold>A</bold>) Protocol for three-chamber social interaction test. (<bold>B</bold>) Littermate Cntl (<italic>n</italic> = 13) and Fev/RFP/NrxnTKO (<italic>n</italic> = 13) preferred the social stimulus over the nonsocial stimulus on day 1 (two-way repeated measures analysis of variance [ANOVA]: stimulus main effect, <italic>F</italic><sub>1,24</sub> = 77.08, p &lt; 0.0001; stimulus × genotype interaction, <italic>F</italic><sub>1,24</sub> = 0.6324, p = 0.4243) and day 2 (two-way repeated measures ANOVA: stimulus main effect, <italic>F</italic><sub>1,24</sub> = 83.16, p &lt; 0.0001; stimulus × genotype interaction, <italic>F</italic><sub>1,24</sub> = 0.03609, p = 0.8509). Both groups preferred the novel stimulus over the familiar stimulus on day 3 (two-way repeated measures ANOVA: stimulus main effect, <italic>F</italic><sub>1,24</sub> = 18.3, p = 0.0003; stimulus × genotype interaction, <italic>F</italic><sub>1,24</sub> = 0.4758, p = 0.4969). Genotype differences were observed only on day 1 (two-way repeated measures ANOVA on day 1: genotype main effect, <italic>F</italic><sub>1,24</sub> = 4.798, <sup>#</sup>p = 0.0384; day 2: genotype main effect, <italic>F</italic><sub>1,24</sub> = 0.05209, p = 0.8214; day 3: genotype main effect, <italic>F</italic><sub>1,24</sub> = 0.4063, p = 0.5299). (<bold>C</bold>) The preference ratio for a social stimulus differed across days (two-way repeated measures ANOVA: day main effect, <italic>F</italic><sub>1.951,46.82</sub> = 20.67, p &lt; 0.0001), but no differences were seen between groups (two-way repeated measures ANOVA: genotype main effect, <italic>F</italic><sub>1,24</sub> = 0.1992, p = 0.6594; day × genotype interaction, <italic>F</italic><sub>2,48</sub> = 0.5837, p = 0.5617).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig4-figsupp2-v1.tif"/></fig><fig id="fig4s3" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 3.</label><caption><title>5-Hydroxytryptamine (5-HT) neuron-specific Nrxn TKO mice display normal learning and memory and repetitive behaviors.</title><p>(<bold>A</bold>) Protocol for fear conditioning. Fear conditioning was p×erformed over 4 days. Mice were presented with two different auditory cues, one paired (yellow speaker) with a foot shock (yellow thunderbolt) and one unpaired (green speaker). ITI: intertrial interval. (<bold>B</bold>) Cntl (<italic>n</italic> = 14) and Fev/RFP/NrxnTKO (<italic>n</italic> = 11) mice both showed differences in freezing behavior across the presentations associated with the foot shock (CS+) (two-way repeated measures analysis of variance [ANOVA]: stimulus main effect, <italic>F</italic><sub>2.607,59.97</sub> = 45.06, <sup>####</sup>p &lt; 0.0001). No differences were seen between groups (two-way repeated measures ANOVA: genotype main effect, <italic>F</italic><sub>1,23</sub> = 0.00339, p = 0.9541; stimulus × genotype interaction, <italic>F</italic><sub>4,92</sub> = 0.2652, p = 0.8996). (<bold>C</bold>) Among Cntl and Fev/RFP/NrxnTKO, freezing to the CS+ was increased relative to the CS− (stimulus with no association between auditory cue and foot shock) (two-way repeated measures ANOVA: stimulus main effect, <italic>F</italic><sub>1,23</sub> = 85.22, <sup>####</sup>p &lt; 0.0001), but no differences were detected between groups (two-way repeated measures ANOVA: genotype main effect, <italic>F</italic><sub>1,23</sub> = 1.67, p = 0.2091; stimulus × genotype interaction, <italic>F</italic><sub>1,23</sub> = 0.03121, p = 0.8613). (<bold>D</bold>) Fev/RFP/NrxnTKO mice showed no altered freezing behavior during contextual recall (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>23</sub> = 0.01457, p = 0.9885). (<bold>E</bold>) Protocol for object interaction test. (<bold>F</bold>) Cntl (<italic>n</italic> = 15) and Fev/RFP/NrxnTKO (<italic>n</italic> = 12) showed no preference for identical objects on day 1 (two-way repeated measures ANOVA: stimulus main effect, <italic>F</italic><sub>1,25</sub> = 2.606, p = 0.119; genotype main effect, <italic>F</italic><sub>1,25</sub> = 0.02422, p = 0.8776; stimulus × genotype interaction, <italic>F</italic><sub>1,25</sub> = 0.1923, p = 0.6648) and day 2 (two-way repeated measures ANOVA: stimulus main effect, <italic>F</italic><sub>1,25</sub> = 3.18, p = 0.0867; genotype main effect, <italic>F</italic><sub>1,25</sub> = 0.27, p = 0.6079; stimulus × genotype interaction, <italic>F</italic><sub>1,25</sub> = 0.1825, p = 0.6729) and preferred the novel object over the familiar object on day 3 (two-way repeated measures ANOVA: stimulus main effect, <italic>F</italic><sub>1,25</sub> = 129.6, p &lt; 0.0001; genotype main effect, <italic>F</italic><sub>1,25</sub> = 0.1452, p = 0.7064; stimulus × genotype interaction, <italic>F</italic><sub>1,25</sub> = 0.03164, p = 0.8603). (<bold>G</bold>) The preference ratio for the objects differed across days (two-way repeated measures ANOVA: day main effect, <italic>F</italic><sub>1.932,48.3</sub> = 47.7, p &lt; 0.0001), but no differences were seen between groups (two-way repeated measures ANOVA: genotype main effect, <italic>F</italic><sub>2,50</sub> = 0.008519, p = 0.9272; day × genotype interaction, <italic>F</italic><sub>2,50</sub> = 0.1781, p = 0.8374). (<bold>H</bold>) Cntl (<italic>n</italic> = 12) and Fev/RFP/NrxnTKO (<italic>n</italic> = 12) mice showed no differences in the number of marbles buried (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 1.491, p = 0.1502). (<bold>I</bold>) <italic>Left</italic>, no differences in grooming time were observed between groups (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 0.04104, p = 0.9676). <italic>Right</italic>, the number of grooming episodes was similar between groups (unpaired two-tailed Student’s <italic>t</italic>-test: <italic>t</italic><sub>22</sub> = 0.5443, p = 0.5917).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-85058-fig4-figsupp3-v1.tif"/></fig></fig-group></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Nrxns regulate the release of fast neurotransmitters such as glutamate and GABA by coupling Ca<sup>2+</sup> channels to presynaptic release machinery (<xref ref-type="bibr" rid="bib27">Südhof, 2017</xref>). The study of cerebellins, secreted protein-binding partners of Nrxns, indirectly implicates Nrxns in serotonergic system development (<xref ref-type="bibr" rid="bib25">Seigneur et al., 2021</xref>). While cerebellin knockout was shown to alter DRN 5-HTergic circuits, Nrxn roles in central neuromodulatory systems have never been addressed. Here, we provide evidence that Nrxns control neuromodulatory 5-HT release. We found that the DRN and hippocampus displayed &gt;40% reduction in 5-HT release in Fev/RFP/NrxnTKO mice. Fev expression begins in the embryonic stage and is found in a subpopulation of 5-HT neurons (~60% of 5-HT neurons) (<xref ref-type="bibr" rid="bib24">Scott et al., 2005</xref>; <xref ref-type="fig" rid="fig3">Figure 3M</xref>). Therefore, the impact of Nrxn TKO during development and non-Cre expressing 5-HT neurons should be noted. However, consistent with the robust functional deficit observed in Fev/RFP/NrxnTKO mice, the structural deficit identified by RFP-positive fiber and release site densities were significant (&gt;50%), suggesting that the roles of Nrxns in the 5-HT system are cell survival and the formation of functional components important for 5-HT release.</p><p>Given the predominance of non-junctional specializations, we speculate that Nrxns reside at 5-HT release sites that lack a direct postsynaptic target. The ability of Nrxns to couple with release machinery triggering 5-HT vesicle exocytosis and their roles in postsynaptic differentiation at synapses are yet to be explored. Decreased 5-HT neuron number and release sites suggest that 5-HTergic Nrxns contribute to cell survival and fiber formation. Indeed, Nrxns are important for cerebellar granule cell survival through regulating the autocrine neurotrophic-factor (NTF) secretory machinery (<xref ref-type="bibr" rid="bib30">Uemura et al., 2022</xref>). Sparse pan-Nrxn deletion has also been shown to blunt inferior olive neuron climbing fiber projections in the cerebellum while complete removal of Nrxns at climbing fiber synapses did not alter climbing fiber axons but impaired synaptic transmission (<xref ref-type="bibr" rid="bib6">Chen et al., 2017</xref>). It is interesting that the loss of Cre+ 5-HT Nrxn TKO neurons is limited to the early postnatal stage. This may suggest that matured 5-HT neurons use the NTF supply from surrounding non-5-HT and Cre-negative 5-HT neurons. The possibility of Cre expression altering properties related to 5-HT neuron function in place of Nrxn deletion cannot be excluded. Further investigation is essential to understand the molecular mechanisms underlying cell death in Nrxn TKO 5-HT neurons.</p><p>Overall behavioral phenotypes reminiscent of ASD in Fev/RFP/NrxnTKO mice are milder than null Nrxn KO mouse lines, suggesting that Nrxns in other cell types are also important in complex behaviors (<xref ref-type="bibr" rid="bib3">Born et al., 2015</xref>; <xref ref-type="bibr" rid="bib7">Dachtler et al., 2014</xref>; <xref ref-type="bibr" rid="bib8">Etherton et al., 2009</xref>; <xref ref-type="bibr" rid="bib9">Grayton et al., 2013</xref>). The observed deficits in sociability in the direct social interaction test and in the depressive-related forced swim test contrast the normal behaviors of Fev/RFP/NrxnTKO mice in the 3CST and tail suspension tests. The 3CST limits direct interaction with a stimulus mouse and it is possible that the mode and novelty, as there were genotype differences observed on initial encounter, of social interaction are critical to Fev/RFP/NrxnTKO mice. Additionally, the forced swim test was performed following the tail suspension test, and it is possible that Fev/RFP/NrxnTKO mice are more susceptible to stress rather than despair-associated coping responses. Of note, the <italic>Fev<sup>Cre</sup></italic> line limits Cre expression in up to 60% of 5-HT neurons (<xref ref-type="fig" rid="fig3">Figure 3M</xref>), indicating a need for a more 5-HT neuron-specific Cre line to fully understand the roles of 5-HTergic Nrxns in animal behaviors.</p><p>Our results reveal that Nrxns expressed in midbrain 5-HT neurons are important for cell survival and maintaining the presynaptic molecular function of 5-HT release sites. Further studies are necessary to decipher Nrxn-mediated 5-HT release machinery, examine the consequences of Nrxn deletion in RN-innervated circuits in other brain regions, and address whether 5-HT therapeutics can improve behavioral deficits.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Animals</title><p>All experiments were conducted under approved animal protocols from the Institutional Animal Care and Use Committee (IACUC) at the University of Massachusetts Chan Medical School. 5-HT neuron-specific tdTomato mice (Fev/RFP) were generated by crossing Rosa26 with <italic>LSL-tdTomato</italic> (<italic><sup>lox-STOP-lox</sup>TdTomato</italic>, Ai9 line: Jax #007905) and <italic>Fev<sup>cre</sup></italic> mice (<italic>ePet<sup>Cre</sup></italic>: Jax #012712) (<xref ref-type="bibr" rid="bib24">Scott et al., 2005</xref>). Both <italic>Fev<sup>Cre</sup></italic> and RFP lines were backcrossed with C57BL/6J line for at least 10 generations. Fev/RFP mice were crossed with Nrxn1<sup>f/f</sup>/2 <sup>f/f</sup>/3 <sup>f/f</sup> mouse line (<xref ref-type="bibr" rid="bib28">Uchigashima et al., 2020a</xref>; <xref ref-type="bibr" rid="bib30">Uemura et al., 2022</xref>) to generate 5-HT neuron-specific triple Nrxn knockout mouse line (Fev<sup>Cre/lox-STOP-lox/lox-STOP-lox</sup>tdTomato/Nrxn1<sup>f/f</sup>/2<sup>f/f</sup>/3<sup>f/f</sup>: Fev/RFP/NrxnTKO). The Fev/RFP/NrxnTKO line was maintained by breeding Fev/RFP/NrxnTKO mice with littermate Cre-negative (<sup>lox-STOP-lox</sup>tdTomato/Nrxn1<sup>f/f</sup>/2<sup>f/f</sup>/3<sup>f/f</sup>: Cntl) mice. Unless specified, Cre-negative littermates were used as controls. Male mice were used in all experiments. For social behavioral experiments, juvenile mice used as stimuli were 4- to 6-week-old male mice on a C57BL/6J background. Unless otherwise noted, 8- to 10-week-old mice were used for experiments.</p><p>Mice were group housed (2–5 per cage) and maintained in ventilated cages with ad libitum access to food and water on a standard 12-hr light/12-hr dark cycle (lights ON at 7 AM) in a temperature-controlled (20–23°C) facility. One to two weeks prior to experimentation, mice were acclimated to a reversed light/dark cycle (lights ON at 7 PM).</p></sec><sec id="s4-2"><title>Single-cell RNA extraction and RT-qPCR and -dPCR</title><p>All RT-qPCR and -dPCR experiments were performed on male mice aged 10 weeks or older. The whole procedure was done based on our recently developed protocol (<xref ref-type="bibr" rid="bib17">Mao et al., 2018</xref>; <xref ref-type="bibr" rid="bib28">Uchigashima et al., 2020a</xref>; <xref ref-type="bibr" rid="bib29">Uchigashima et al., 2020b</xref>). Briefly, cytosol from RFP+ 5-HT neurons in the DRN and MRN were harvested from Fev/RFP (Cntl) and Fev/RFP/NrxnTKO mice using the whole-cell patch-clamp approach. A SMART-Seq HT Kit (TAKARA Bio) was used to prepare the amplified cDNA templates following the manufacturer’s instructions (<xref ref-type="bibr" rid="bib28">Uchigashima et al., 2020a</xref>; <xref ref-type="bibr" rid="bib29">Uchigashima et al., 2020b</xref>). To assess Nrxn expression in individual 5-HT neurons of control and Fev/RFP/NrxnTKO mice, the following TaqMan gene expression assays (Applied Biosystems) with a FAM dye on their probes were used: <italic>Nrxn1</italic> (Mm03808857_m1), <italic>Nrxn2</italic> (Mm01236856_m1), <italic>Nrxn3</italic> (Mm00553213_m1), <italic>Tph2</italic> (Mm00557715_m1), and <italic>Gapdh</italic> (Mm99999915_g1). Additionally, a custom PrimeTime Std qPCR Assay, which provides the same type of quantitative PCR assay as TaqMan assays by utilizing hydrolysis probes in conjunction with gene-specific primer pairs, was designed for the TATA-box-binding protein (TBP) housekeeping gene with a HEX (VIC) dye on its probe (Integrated DNA Technologies, Inc). The assay consisted of a forward primer (5′-<named-content content-type="sequence">GGGAGAATCATGGACCAGAACA</named-content>-3′), a reverse primer (5′-<named-content content-type="sequence">GGTGTTCTGAATAGGCTGTGG</named-content>-3′), and a probe (/5HEX/<named-content content-type="sequence">CCTTCCACC</named-content>/Zen/T <named-content content-type="sequence">TATGCTCAGGGC </named-content>TT/3IABkFQ/). All the PCR reactions and analyses were performed blind to genotype. For the real-time quantitative PCR (qPCR) analysis, StepOnePlus qPCR system (Applied Biosystems) and the relative expression of <italic>Nrxns</italic> or <italic>Tph2</italic> were calculated as: Relative expression = 2<sup>Ct,Gapdh</sup>/2<sup>Ct,Nrxns or Tph2</sup>; Ct, threshold cycle for target gene amplification, and presented as fold changes relative to that of Cntl. For the digital PCR (dPCR) analysis, a QuantStudio 3D Digital PCR System and its accompanying consumables were used and data were analyzed with QuantStudio 3D AnalysisSuite Cloud Software (Thermo Fisher). The absolute copy number of Nrxn2, Nrxn3, and TBP was measured and the relative abundance of Nrxn2 and Nrxn3 was calculated by normalizing their copy numbers to that of TBP.</p></sec><sec id="s4-3"><title>Transcriptome analysis</title><p>Single-cell RNA-seq data were obtained from a recent publication (<xref ref-type="bibr" rid="bib22">Ren et al., 2019</xref>). See <xref ref-type="bibr" rid="bib22">Ren et al., 2019</xref> for the single-cell isolation and sequencing.</p><sec id="s4-3-1"><title>Data processing and clustering</title><p>Datasets were downloaded from NCBI Gene Expression Omnibus (GSE135132). Reads were aligned to a mouse reference transcriptome (Mus_musculus.GRCm38.cdna.all.fa) using kallisto (<xref ref-type="bibr" rid="bib4">Bray et al., 2016</xref>). Tximport R package (<xref ref-type="bibr" rid="bib26">Soneson et al., 2015</xref>) was used to summarize the reads to the gene level. Each isoform was summarized manually to account for inclusion of spliced exons in the α or β Nrxn isoforms. The manually curated transcript IDs are provided in <xref ref-type="table" rid="table1">Table 1</xref>. Gene count data were analyzed using Seurat R package v4.0.1 (<xref ref-type="bibr" rid="bib10">Hao et al., 2021</xref>). After excluding cells with low sequencing depth (50,000 reads) and low number of detected genes (cut-off was set at 7500 genes), the remaining 945 cells were assigned to clusters according to <xref ref-type="bibr" rid="bib22">Ren et al., 2019</xref>. Counts were normalized for each cell using the natural logarithm of 1 + counts per 10,000 [ln(1 + counts/10k)]. Cells were visualized using a two-dimensional t-distributed Stochastic Neighbor Embedding (tSNE) and violin plots. The R code is provided as codeR (<xref ref-type="supplementary-material" rid="fig1scode1">Figure 1—source code 1</xref>).</p><table-wrap id="table1" position="float"><label>Table 1.</label><caption><title><italic>Nrxn</italic> transcript IDs used for quantification.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">ENSMUST00000072671.13</th><th align="left" valign="bottom"><italic>αNrxn1</italic></th></tr></thead><tbody><tr><td align="left" valign="bottom">ENSMUST00000160844.9</td><td align="left" valign="bottom"><italic>αNrxn1</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000174331.7</td><td align="left" valign="bottom"><italic>αNrxn1</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000159778.7</td><td align="left" valign="bottom"><italic>βNrxn1</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000174337.7</td><td align="left" valign="bottom"><italic>βNrxn1</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000161402.9</td><td align="left" valign="bottom"><italic>αNrxn1</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000054059.14</td><td align="left" valign="bottom"><italic>αNrxn1</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000172466.7</td><td align="left" valign="bottom"><italic>βNrxn1</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000160800.8</td><td align="left" valign="bottom"><italic>αNrxn1</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000113462.7</td><td align="left" valign="bottom"><italic>αNrxn2</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000236635.1</td><td align="left" valign="bottom"><italic>αNrxn2</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000113461.7</td><td align="left" valign="bottom"><italic>αNrxn2</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000235714.1</td><td align="left" valign="bottom"><italic>αNrxn2</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000137166.7</td><td align="left" valign="bottom"><italic>αNrxn2</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000167734.7</td><td align="left" valign="bottom"><italic>αNrxn3</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000190626.6</td><td align="left" valign="bottom"><italic>αNrxn3</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000167103.7</td><td align="left" valign="bottom"><italic>αNrxn3</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000057634.13</td><td align="left" valign="bottom"><italic>αNrxn3</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000238943.1</td><td align="left" valign="bottom"><italic>βNrxn3</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000110133.8</td><td align="left" valign="bottom"><italic>βNrxn3</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000110130.3</td><td align="left" valign="bottom"><italic>βNrxn3</italic></td></tr><tr><td align="left" valign="bottom">ENSMUST00000167887.7</td><td align="left" valign="bottom"><italic>αNrxn3</italic></td></tr></tbody></table></table-wrap></sec></sec><sec id="s4-4"><title>Immunoblotting</title><p>Membrane fractions (P2 fraction) were used for immunoblottings. The whole experiments and analyses were performed blind to genotype. Adult mouse brains (8–10 weeks old) were homogenized in ice-cold buffer (5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) [pH 7.4], 1 mM MgCl<sub>2</sub>, 0.5 mM CaCl<sub>2</sub>, 1 mM NaF), and protease inhibitors (Roche cOmplete protease inhibitor: 05892970001) with a Teflon homogenizer (12 strokes). The homogenate extract was centrifuged at low speed (1400 × <italic>g</italic> for 10 min). The supernatant was centrifugated at 13,800 × <italic>g</italic> for 10 min. The supernatant was removed, and the P2 was resuspended in modified Radio Immunoprecipitation Assay (RIPA) buffer (50 mM Tris–HCl pH 8.0, 150 mM NaCl, 0.1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 1 mM sodium orthovanadate, 1 mM NaF, Protease inhibitor tablet). Homogenates (15 µg) were mixed with Sample Buffer (4% SDS, 20% glycerol, 0.004% bromophenol blue, 0.125 M Tris–Cl, pH 6.8, 2.5% 2-mercaptoethanol) to undergo SDS–polyacrylamide gel electrophoresis. Proteins were transferred to PVDF membranes (0.2 μm, Bio-Rad) and all remaining steps were performed at room temperature. Membranes were blocked in 5% skim milk and 5% bovine serum albumin in Tris-buffered saline (TBS) for 1 hr and then washed in TBS with 0.1% Tween 20 detergent (TBST) for 10 min. Membranes were incubated with primary antibodies prepared in 1% skim milk and 1% bovine serum albumin in TBST for 2 hr (mouse anti-SERT 1:7000, MAb Technologies, ST51-2; rabbit anti-Tph2 1:1000, Abcam, ab184505, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2892828">AB_2892828</ext-link>; mouse anti-βActin 1:5000, Sigma, A1978, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_476692">AB_476692</ext-link>). After washing with TBST, membranes were incubated with secondary antibodies for 1 hr (mouse and rabbit HRP, 1:1000, Millipore). Immunoblot signals were detected using an ECL detection kit (PerkinElmer Life Sciences) and the Bio-Rad Chemdoc system (Li-Cor). Quantification was performed by ImageJ software.</p></sec><sec id="s4-5"><title>Immunohistochemistry</title><p>All mice (8–10 weeks old) were transcardially perfused with ice-cold 4% paraformaldehyde (PFA)/0.1 M phosphate buffer (PB, pH 7.4) under isoflurane anesthesia. Brains were dissected and post-fixed at 4°C in PFA for 2 hr, then cryo-protected in 30% sucrose/0.1 M PB. Coronal 40-µm-thick brain sections were cut on a cryostat (CM3050 S, Leica Biosystems). All immunohistochemical incubations were carried out at room temperature. Sections were permeabilized for 10 min in 0.1% Tween 20/0.01 M phosphate-buffered saline (PBS, pH 7.4), blocked for 30 min in 10% normal donkey serum and incubated overnight in anti-SERT (guinea pig, 1 µg/ml, Frontier Institute, HTT-GP-Af1400, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2571777">AB_2571777</ext-link>), anti-5-HT (goat, 1:1000, Abcam, ab66047, AB_1142794), anti-RIM1/2 (rabbit, 1:1000, Synaptic Systems, Rb 140203, AB_887775), or anti-RFP (Rabbit, 1:1000, Rockland, 21513) antibodies. The following day, sections were washed extensively then incubated in donkey anti-guinea pig-Alexa488, goat-Alexa488, and mouse-Alexa405 antibodies for 2 hr at a dilution of 1:500 (Jackson ImmunoResearch Laboratories). Sections were then mounted on slides (ProLong Gold, Invitrogen, P36930) and viewed for acquisition and analysis. Immunohistochemistry for neurotransmitter release machinery was confirmed using consecutive ultra-thin (100 nm) sections. Modified PFA (4% PFA and 0.1% glutaraldehyde in PB)-fixed brains were embedded in durcupan (Sigma) and consecutive ultra-thin sections were prepared by Ultracut ultramicrotome (Leica Microsystems). After etching with saturated sodium ethanolate solution for 1–5 s, ultra-thin sections on slides were treated with ImmunoSaver (Nisshin EM) at 95°C for 30 min. Sections were permeabilized for 10 min in 0.1% Triton X-100/0.01 M PBS (pH 7.4), blocked for 30 min in 10% normal donkey serum, and incubated overnight in anti-SERT (goat, 1 µg/ml, Frontier Institute, MSFR103270, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2571776">AB_2571776</ext-link>), RIM1/2 (Rabbit, Synaptic Systems, 140203, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_887775">AB_887775</ext-link>, 1:1000), synaptophysin (guinea pig, 1 µg/ml, Frontier Institute, MSFR105690, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2571843">AB_2571843</ext-link>), and anti-RFP (guinea pig, Frontier Institute, MSFR101410, RRID: <ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:AB_2571648">AB_2571648</ext-link>) antibodies. The following day, sections were washed extensively then incubated with a mixture of Alexa 488-, Cy3-, or Alexa 647-labeled species-specific secondary antibodies for 2 hr at a dilution of 1:200 (Invitrogen; Jackson ImmunoResearch, West Grove, PA). Sections were then mounted on slides (ProLong Gold, Invitrogen, P36930) and viewed for acquisition and analysis.</p></sec><sec id="s4-6"><title>Imaging</title><p>Image acquisition and analysis were performed blind to genotype. RFP density analysis: We analyzed 5-HT fiber innervation to the nucleus accumbens core and shell (NAcc, NAcSh; Bregma 1.18 ± 0.3 mm), stratum oriens of the CA1, CA2, and CA3 subregions of the dorsal hippocampus (dCA1, dCA2, dCA3; Bregma −1.46 ± 0.4 mm), stratum oriens of the CA1 subregion of the ventral hippocampus (vCA1; −3.16 ± 0.4 mm), DRN (Bregma −4.56 ± 0.4 mm), and MRN (Bregma −4.5 ± 0.4 mm). To assess the density of RFP fiber inputs, four stained sections from each of four Fev/RFP (Cntl) and Fev/RFP/NrxnTKO brains containing the nucleus accumbens, hippocampus, or RN were imaged (1024 × 1024 pixels) using a laser scanning confocal microscope (LSM700, Zeiss) with a ×63 oil-immersion objective (NA 1.4) at an optical zoom of 1.6 and Zen black image acquisition software (Zeiss). For each brain, six randomly chosen ×100 fields of view within the region of interest were acquired with 21 z-stack steps at 0.35 µm spacing providing a 7-µm z-depth to generate maximum intensity projections (MIPs) of the z-stacks. Images from all brains for a particular region were acquired using identical settings, and data analyses were performed using ImageJ as previously described (<xref ref-type="bibr" rid="bib31">Werneburg et al., 2020</xref>). The six images from each region per animal were averaged to generate a mean for that region in each animal, with <italic>n</italic> = 4 animals per genotype. A consistent threshold range was determined by subjecting images, blinded to genotype, to background subtraction and manual thresholding for each MIP within one experiment (IsoData segmentation method, 15–225). Using the analyze particles function, the thresholded images were used to calculate the total area of RFP fiber inputs.</p><sec id="s4-6-1"><title>RFP-positive cell density analysis</title><p>We analyzed the relative expression of RFP- and 5-HT-positive neurons in the DRN (Bregma −4.6 ± 0.3 mm) and MRN (Bregma −4.5 ± 0.4 mm). The ratio was derived by dividing the number of RFP- and 5-HT-positive neurons (<italic>n</italic> = 2–5 mice per cohort). To assess the density of RFP-positive 5-HT neurons, three stained sections from each of four or five Fev/RFP (Cntl) and Fev/RFP/NrxnTKO brains containing the DRN or MRN were imaged (1024 × 1024 pixels) using a laser scanning confocal microscope (LSM700, Zeiss) with a ×20 water-immersion objective (NA 1.0) at an optical zoom of 0.5 and Zen black image acquisition software (Zeiss). For each section, two z-stack steps at 10–15 µm spacing were used to image the different 5-HT neuron populations. The ratios obtained from four to six images from each brain were averaged to generate a mean for the MRN and DRN of each animal. Images from the DRN and MRN were acquired using identical settings, and data analyses were performed using ImageJ as previously described (<xref ref-type="bibr" rid="bib28">Uchigashima et al., 2020a</xref>).</p></sec><sec id="s4-6-2"><title>RIM1/2 density analysis</title><p>We analyzed RIM1/2 expression in 5-HT terminals projected in the CA1 pyramidal layer. To assess the density of RIM1/2 puncta in RFP- and SERT-positive fibers, four stained sections from each of four Fev/RFP (Cntl) and Fev/RFP/NrxnTKO brains containing the dorsal hippocampus were imaged (1024 × 1024 pixels) using a laser scanning confocal microscope (Olympus, FV1200) with a ×60 oil-immersion objective (NA 1.4). For each brain, 10–15 consecutive images were acquired with 0.2 µm steps and 18–33 RPF-/SERT-positive fibers were chosen. Because confocal microscopes can reach <italic>z</italic>-axis resolutions of 500 nm (<xref ref-type="bibr" rid="bib23">Schermelleh et al., 2010</xref>), we measured the RIM signal found in two or more consecutive RFP-/SERT-positive terminals. RPF-/SERT-positive fibers in Cntl (81 fibers) and Fev/RFP/NrxnTKO (78) mice (<italic>n</italic> = 3 mice per genotype), respectively, were subjected to imaging analysis using MetaMorph software (Molecular Devices, Foster City, CA).</p></sec></sec><sec id="s4-7"><title>Electrophysiology</title><sec id="s4-7-1"><title>Slice preparation</title><p>All electrophysiological experiments were performed on male mice aged 10 weeks or older. Mice were anesthetized with isoflurane and decapitated. Brains were removed and quickly cooled in ice-cold, pre-oxygenated (95% O<sub>2</sub>/5% CO<sub>2</sub>) aCSF containing the following (in mM): 126 NaCl, 2.5 KCl, 1.2 NaH<sub>2</sub>PO<sub>4</sub>, 1.2 MgCl<sub>2</sub>, 2.4 CaCl<sub>2</sub>, 25 NaHCO<sub>3</sub>, 20 HEPES, 11 <sc>D</sc>-glucose, 0.4 ascorbic acid, pH adjusted to 7.4 with NaOH. Coronal slices (400 µm) containing the dorsal hippocampus or DRN were prepared in ice-cold aCSF using a vibratome (VT1200 S, Leica Biosystems). Slices were recovered in oxygenated aCSF at room temperature (22–24°C) for at least 1 hr before use. Slices were then transferred to a recording chamber perfused at a rate of 1 ml/min with room temperature, oxygenated aCSF.</p></sec><sec id="s4-7-2"><title>Fast-scan cyclic voltammetry</title><p>5-HT measurements were performed in the radiatum of dorsal CA3 and DRN. All experiments and analyses were performed blind to genotype. To detect 5-HT release, carbon-fiber electrodes were prepared as previously described (<xref ref-type="bibr" rid="bib11">Hashemi et al., 2009</xref>; <xref ref-type="bibr" rid="bib18">Matsui and Alvarez, 2018</xref>). Carbon-fiber electrodes consisted of 7-µm diameter carbon fibers (Goodfellow) inserted into a glass pipette (A-M Systems, cat# 602500) with ~150–200 µm of exposed fiber. The exposed carbon fibers were soaked in isopropyl alcohol for 30 min to clean the surface. Next, the exposed fibers were coated with Nafion solution (Sigma) to improve detection sensitivity by inserting the carbon fiber into Nafion solution dropped in a 3-mm diameter circle of twisted reference Ag/AgCl wire for 30 s with constant application of +1.0 V potential. The carbon-fiber electrodes were air dried for 5 min and then placed in a 70°C oven for 10 min. A modified 5-HT voltage ramp was used, in which the carbon-fiber electrode was held at +0.2 V and scanned to +1.0 V, down to −0.1 V, and back to +0.2 V at 1000 V/s delivered every 100ms. Prior to recording, the electrodes were conditioned in aCSF with a voltage ramp delivered at 60 Hz for 10 min.</p><p>5-HT release was evoked with electrical stimulation (30 pulses, 30 Hz, 150 or 250 µA, 1 ms) from an adjacent custom-made bipolar tungsten electrode every 10 min. The stimulating electrode was placed ~100–200 µm away from the carbon-fiber electrode (<xref ref-type="bibr" rid="bib14">John et al., 2006</xref>). Recordings were performed using a Chem-Clamp amplifier (Dagan Corporation) and Digidata 1550B after low-pass filter at 3 kHz and digitization at 100 kHz. Data were acquired using pClamp10 (Molecular Devices) and analyzed with custom written VIGOR software using Igor Pro 8 (32-bit; Wavemetrics) running mafPC (courtesy of M.A. Xu-Friedman). Carbon-fiber electrodes were calibrated with 1 µM 5-HT (Serotonin HCl, Sigma) at the end of the experiment to convert peak current amplitude of 5-HT transients to concentration. Three consecutive traces were averaged from each recording condition for analysis. Background-subtracted peak 5-HT transients and area under the curve were determined by subtracting the current remaining after TTX (tetrodotoxin citrate, Hello Bio) application from the maximum current measured. Dopamine HCl and FLX HCl were obtained from Sigma.</p></sec></sec><sec id="s4-8"><title>Behavioral assays</title><p>All behavioral experiments were performed on male mice aged 8 weeks or older. Animals were habituated to the testing room for at least 30 min before each experiment and all tests were conducted under dim red-light conditions and white noise to maintain a constant ambient sound unless otherwise noted. All experiments and analyses were performed blind to genotype. Animals were used in only one behavioral paradigm for the direct social interaction test and fear conditioning. Mice underwent tests for locomotion, anxiety, repetitive behaviors, and depression in the following order: locomotor activity, open field, elevated plus-maze, grooming, marble burying, tail suspension test, and forced swim test. At least 2 days of rest were given in between all tests except for the tail suspension test and forced swim test, during which mice were allowed to rest for at least 7 days in between. Another cohort of mice completed the object interaction test followed by at least 2 days of rest before undergoing rotarod. Behavioral testing apparatuses were cleaned with 0.1% Micro-90 (International Products Corporation) between each mouse.</p><sec id="s4-8-1"><title>Locomotor activity</title><p>Locomotor activity of each mouse was tracked in photobeam activity chambers (San Diego Instruments) for 90 min. Total horizontal movement was measured in 5-min bins.</p></sec><sec id="s4-8-2"><title>Rotarod</title><p>Motor coordination and balance were evaluated on a rotarod apparatus (San Diego Instruments) with an accelerating rotarod test. In each trial, mice were habituated to a rod rotating at 6 rpm for 30 s, then the rotation was increased to 60 rpm over 5 min. The latency to fall was measured over five trials with an interval of 10 min between each trial. Any mice that remained on the apparatus after 5 min were removed and their time was scored as 5 min.</p></sec><sec id="s4-8-3"><title>Open field</title><p>Mice were placed in the center of an open arena (41 × 38 × 30.5 cm) facing the furthest wall and allowed to freely explore the arena for 10 min. Time spent in the center of the arena (20.5 × 19 cm) was automatically tracked with EthoVision XT 11.5 (Noldus).</p></sec><sec id="s4-8-4"><title>Elevated plus-maze</title><p>The apparatus (Med Associates) consists of four arms, two enclosed with black walls (19 cm high) and two open (35 × 6 cm), connected by a central axis (6 × 6 cm) and elevated 74 cm above the floor. Mice were placed in the intersection of the maze facing the furthest open arm and allowed to freely explore the maze for 5 min. Time spent in the open and closed arms (index of anxiety-like behavior) and total entries into the open and closed arms (index of locomotor activity) were automatically measured with MED-PC IV software.</p></sec><sec id="s4-8-5"><title>Direct social interaction test</title><p>The test was adapted from <xref ref-type="bibr" rid="bib13">Hitti and Siegelbaum, 2014</xref>. Each mouse was placed individually into a standard mouse cage and allowed to habituate for 5 min followed by the introduction of a novel male juvenile mouse. The activity was monitored for 10 min and social behavior initiated by the subject mouse was measured by an experimenter sitting approximately 2 m from the testing cage with a silenced stopwatch. Scored behaviors were described previously (<xref ref-type="bibr" rid="bib15">Kogan et al., 2000</xref>): direct contact with the juvenile including grooming and pawing, sniffing including the anogenital area and mouth and close following (within 1 cm) of the juvenile. After 24 hr, the 10 min test was run again with the previously encountered mouse. Any aggressive encounters observed between animals led to exclusion of the subject mouse from analysis.</p></sec><sec id="s4-8-6"><title>Three-chamber social interaction test</title><p>Using a standard three-chamber design (<xref ref-type="bibr" rid="bib21">Moy et al., 2004</xref>), the apparatus consisted of a neutral central zone (18 × 40.5 × 22 cm) connecting two identical compartments (each 19.5 × 40.5 × 22 cm) (<xref ref-type="bibr" rid="bib20">Molas et al., 2017</xref>). Each of the outer compartments housed a caged cylinder (8 cm diameter, 18 cm height; 1 cm between each vertical rod) to allow limited, but direct physical contact between the subject and stimulus animals. Subject mice were placed in the central zone and habituated to an empty apparatus for 5 min then briefly removed to place a juvenile mouse under one of the two caged cylinders while the other caged cylinder remained empty (counterbalanced). The subject mouse was then returned to the apparatus to freely explore all three compartments for 5 min/day for three consecutive days using the same juvenile placed in the same compartment. On day 3, a novel juvenile mouse was placed in the empty caged cylinder. On days 1 and 2, the preference ratio was calculated as: (total social stimulus investigation − total nonsocial stimulus investigation)/(total investigation). On day 3, the preference ratio was calculated as: (total novel stimulus investigation − total familiar stimulus investigation)/(total investigation).</p></sec><sec id="s4-8-7"><title>Tail suspension test</title><p>Mice were placed in a rectangular TST apparatus (28 × 28 × 42 cm) and suspended by their tails which were wrapped in red lab tape at around 3/4 the distance from the base. Movement was monitored for 6 min and the last 4 min were scored for immobility behavior (absence of righting attempt).</p></sec><sec id="s4-8-8"><title>Forced swim test</title><p>Mice were placed in a plexiglass cylinder (20 cm diameter, 40 cm height) containing 22 ± 1°C water at a depth of 20 cm to prevent them from escaping or touching the bottom. Immobility, measured as floating in the absence of movement except for those necessary to keep the head above water, was measured during the last 4 min of a 6-min session. Following the test, mice were gently dried with a clean paper towel and placed in a fresh cage on top of a heating pad for around 10–15 min after which they were returned to their home cage (<xref ref-type="bibr" rid="bib33">Yankelevitch-Yahav et al., 2015</xref>).</p></sec><sec id="s4-8-9"><title>Fear conditioning</title><p>The fear conditioning paradigm was adapted from <xref ref-type="bibr" rid="bib12">Herry et al., 2008</xref>. Animals were not habituated in the testing room to avoid untimely association with auditory cues. Using the ANY-maze fear conditioning system (Ugo Basile SRL), mice were placed in a fear conditioning cage (17 × 17 × 25 cm) in a sound-attenuating box. The paradigm was performed under no light conditions using two different contexts (context A and B). Mice underwent four phases with 24 hr in between each session: habituation, acquisition, auditory recall, and contextual recall. On day 1 (context A), mice were habituated to five 30-s presentations of the CS+ and CS− (white noise) at 80 dB sound pressure level. The inter-cue interval was pseudorandomized and each session with the CS+ or CS− was 10 min. The presentation order of the CS+ and CS− trials were counterbalanced across animals. On day 2 (context A), discriminative fear conditioning was performed by pairing the CS+ with a US (1 s foot shock, 0.75 mA, 5 CS+/US pairings; intertrial interval: 22–125 s). The onset of the US coincided with the last second of the CS+. On day 3, auditory recall was measured in context B with five presentations of CS+ and CS−. On day 4, the contextual recall was measured in context A for 10 min. ANY-maze software was used to analyze freezing behavior (no movement detected for 1 s), which was scored automatically with an infrared photobeam assay in the fear conditioning cage.</p></sec><sec id="s4-8-10"><title>Object interaction test</title><p>The test was adapted from <xref ref-type="bibr" rid="bib20">Molas et al., 2017</xref>. The apparatus consisted of a custom-made white Plexiglass T-shaped maze (three arms, each 9 × 29.5 × 20 cm, connected through a central 9 × 9 cm zone). Mice were placed in the start arm to habituate to the apparatus for 5 min. Following habituation, they were presented with identical inanimate objects located at opposite ends of the T-maze arms for 5 min/day on two consecutive days. On day 3, one of the inanimate objects was replaced with a novel inanimate object placed in the same location (counterbalanced) for 5 min. The preference ratio was calculated from day 3 data as: (total novel stimulus investigation − total familiar stimulus investigation)/(total investigation).</p></sec><sec id="s4-8-11"><title>Marble burying</title><p>Fifteen sterilized 1.5-cm glass marbles evenly spaced 2 cm apart in three rows of five were placed in a standard mouse cage with a layer of bedding at a depth of 5–6 cm. A mouse was placed in the cage for 30 min, then returned to its home cage. The number of marbles buried (2/3 of their depth covered with bedding) was counted.</p></sec><sec id="s4-8-12"><title>Grooming</title><p>Self-grooming behavior was scored as previously described (<xref ref-type="bibr" rid="bib19">McFarlane et al., 2008</xref>; <xref ref-type="bibr" rid="bib32">Yang et al., 2007</xref>). Mice were habituated for 5 min in an empty mouse cage with no bedding, then grooming behavior was observed for 10 min by an experimenter sitting approximately 2 m from the testing cage. Cumulative time spent grooming during the 10-min session was recorded using a silenced stopwatch.</p></sec></sec><sec id="s4-9"><title>Statistical analyses</title><p>Results are represented as mean ± standard error of the mean. Statistical significance was set at p &lt; 0.05 and evaluated using paired and unpaired two-tailed Student’s <italic>t</italic>-tests and two-way analysis of variance (ANOVA or two-way repeated measures ANOVA with Šidák’s post hoc testing for normally distributed data). Mann–Whitney <italic>U</italic>-tests were used for nonparametric data. Analyses were carried out with GraphPad Prism (GraphPad Software). No statistical methods were used to determine sample sizes prior to the experiments. Sample sizes were comparable to many studies using the similar experimental approaches and animal models. All observed data points were used for statistics.</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn><fn fn-type="COI-statement" id="conf2"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Software, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing - review and editing</p></fn><fn fn-type="con" id="con2"><p>Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft</p></fn><fn fn-type="con" id="con3"><p>Data curation, Software, Validation, Investigation, Visualization, Methodology, Writing – original draft</p></fn><fn fn-type="con" id="con4"><p>Data curation, Software, Supervision, Validation, Visualization, Methodology, Writing – original draft</p></fn><fn fn-type="con" id="con5"><p>Resources, Funding acquisition, Investigation, Writing – original draft</p></fn><fn fn-type="con" id="con6"><p>Resources, Funding acquisition, Investigation, Writing – original draft</p></fn><fn fn-type="con" id="con7"><p>Resources, Data curation, Funding acquisition, Writing – original draft</p></fn><fn fn-type="con" id="con8"><p>Resources, Data curation, Writing – original draft</p></fn><fn fn-type="con" id="con9"><p>Supervision, Investigation, Visualization, Methodology, Writing – original draft</p></fn><fn fn-type="con" id="con10"><p>Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing - review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>All experiments were conducted under approved animal protocols, including protocols #202200005 and #201900338, from the Institutional Animal Care and Use Committee (IACUC) at the University of Massachusetts Chan Medical School.</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="mdar"><label>MDAR checklist</label><media xlink:href="elife-85058-mdarchecklist1-v1.pdf" mimetype="application" mime-subtype="pdf"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>Figure 1: published sequencing data set (GSE135132) was used (see below). All data generated or analyzed during this study are included in the manuscript, figures, supporting file, and supporting figures. The meta data set is provided for Figure 1. Previously Published Datasets: Single-cell transcriptomes and whole-brain projections of serotonin neurons in the mouse dorsal and median raphe nuclei: Ren, J. Isakova, A. Friedmann, D. Zeng, J.Grutzner, S. M. Pun, A. Zhao, G. Q. Kolluru, S. S. Wang, R. Lin, R. Li, P. Li, A. Raymond, J. L. Luo, Q.Luo, M. Quake, S. R. Luo, L., 2019, <ext-link ext-link-type="uri" xlink:href="https://elifesciences.org/articles/49424">https://elifesciences.org/articles/49424</ext-link>, GSE135132.</p><p>The following previously published dataset was used:</p><p><element-citation publication-type="data" specific-use="references" id="dataset1"><person-group person-group-type="author"><name><surname>Ren</surname><given-names>J</given-names></name><name><surname>Isakova</surname><given-names>A</given-names></name><name><surname>Friedmann</surname><given-names>D</given-names></name><name><surname>Zeng</surname><given-names>J</given-names></name><name><surname>Grutzner</surname><given-names>SM</given-names></name><name><surname>Pun</surname><given-names>A</given-names></name><name><surname>Zhao</surname><given-names>GQ</given-names></name><name><surname>Kolluru</surname><given-names>SS</given-names></name><name><surname>Wang</surname><given-names>R</given-names></name><name><surname>Lin</surname><given-names>R</given-names></name><name><surname>Li</surname><given-names>P</given-names></name><name><surname>Li</surname><given-names>A</given-names></name><name><surname>Raymond</surname><given-names>JL</given-names></name><name><surname>Luo</surname><given-names>Q</given-names></name><name><surname>Luo</surname><given-names>M</given-names></name><name><surname>Quake</surname><given-names>SR</given-names></name><name><surname>Luo</surname><given-names>L</given-names></name></person-group><year iso-8601-date="2019">2019</year><data-title>Single-cell transcriptomes and whole-brain projections of serotonin neurons in the mouse dorsal and median raphe nuclei</data-title><source>NCBI Gene Expression Omnibus</source><pub-id pub-id-type="accession" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE135132">GSE135132</pub-id></element-citation></p></sec><ack id="ack"><title>Acknowledgements</title><p>This work was supported by grants from the National Institutes of Health (R01NS085215 and R01MH130582 to KF, T32 GM107000 and F30MH122146 to AC), the Global Collaborative Research Project of Brain Research Institute, Niigata University (G2905 to KF), and Riccio Neuroscience Fund to KF. The authors thank Ms. Naoe Watanabe for skillful technical assistance. We thank Drs. Veronica Alvarez, Jacqueline N Crawley, Gilles Martin, Motokazu Uchigashima, and David Weaver for comments on an earlier draft of the manuscript.</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Awasthi</surname><given-names>JR</given-names></name><name><surname>Tamada</surname><given-names>K</given-names></name><name><surname>Overton</surname><given-names>ETN</given-names></name><name><surname>Takumi</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Comprehensive topographical map of the serotonergic fibers in the male mouse brain</article-title><source>The Journal of Comparative Neurology</source><volume>529</volume><fpage>1391</fpage><lpage>1429</lpage><pub-id pub-id-type="doi">10.1002/cne.25027</pub-id><pub-id pub-id-type="pmid">32892368</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Belmer</surname><given-names>A</given-names></name><name><surname>Klenowski</surname><given-names>PM</given-names></name><name><surname>Patkar</surname><given-names>OL</given-names></name><name><surname>Bartlett</surname><given-names>SE</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Mapping the connectivity of serotonin transporter immunoreactive axons to excitatory and inhibitory neurochemical synapses in the mouse limbic brain</article-title><source>Brain Structure &amp; Function</source><volume>222</volume><fpage>1297</fpage><lpage>1314</lpage><pub-id pub-id-type="doi">10.1007/s00429-016-1278-x</pub-id><pub-id pub-id-type="pmid">27485750</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Born</surname><given-names>G</given-names></name><name><surname>Grayton</surname><given-names>HM</given-names></name><name><surname>Langhorst</surname><given-names>H</given-names></name><name><surname>Dudanova</surname><given-names>I</given-names></name><name><surname>Rohlmann</surname><given-names>A</given-names></name><name><surname>Woodward</surname><given-names>BW</given-names></name><name><surname>Collier</surname><given-names>DA</given-names></name><name><surname>Fernandes</surname><given-names>C</given-names></name><name><surname>Missler</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Genetic targeting of nrxn2 in mice unveils role in excitatory cortical synapse function and social behaviors</article-title><source>Frontiers in Synaptic Neuroscience</source><volume>7</volume><elocation-id>3</elocation-id><pub-id pub-id-type="doi">10.3389/fnsyn.2015.00003</pub-id><pub-id pub-id-type="pmid">25745399</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bray</surname><given-names>NL</given-names></name><name><surname>Pimentel</surname><given-names>H</given-names></name><name><surname>Melsted</surname><given-names>P</given-names></name><name><surname>Pachter</surname><given-names>L</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Near-optimal probabilistic RNA-seq quantification</article-title><source>Nature Biotechnology</source><volume>34</volume><fpage>525</fpage><lpage>527</lpage><pub-id pub-id-type="doi">10.1038/nbt.3519</pub-id><pub-id pub-id-type="pmid">27043002</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Carboni</surname><given-names>E</given-names></name><name><surname>Di Chiara</surname><given-names>G</given-names></name></person-group><year iso-8601-date="1989">1989</year><article-title>Serotonin release estimated by transcortical dialysis in freely-moving rats</article-title><source>Neuroscience</source><volume>32</volume><fpage>637</fpage><lpage>645</lpage><pub-id pub-id-type="doi">10.1016/0306-4522(89)90285-6</pub-id><pub-id pub-id-type="pmid">2481242</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname><given-names>LY</given-names></name><name><surname>Jiang</surname><given-names>M</given-names></name><name><surname>Zhang</surname><given-names>B</given-names></name><name><surname>Gokce</surname><given-names>O</given-names></name><name><surname>Südhof</surname><given-names>TC</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Conditional deletion of all neurexins defines diversity of essential synaptic organizer functions for neurexins</article-title><source>Neuron</source><volume>94</volume><fpage>611</fpage><lpage>625</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2017.04.011</pub-id><pub-id pub-id-type="pmid">28472659</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dachtler</surname><given-names>J</given-names></name><name><surname>Glasper</surname><given-names>J</given-names></name><name><surname>Cohen</surname><given-names>RN</given-names></name><name><surname>Ivorra</surname><given-names>JL</given-names></name><name><surname>Swiffen</surname><given-names>DJ</given-names></name><name><surname>Jackson</surname><given-names>AJ</given-names></name><name><surname>Harte</surname><given-names>MK</given-names></name><name><surname>Rodgers</surname><given-names>RJ</given-names></name><name><surname>Clapcote</surname><given-names>SJ</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Deletion of α-neurexin II results in autism-related behaviors in mice</article-title><source>Translational Psychiatry</source><volume>4</volume><elocation-id>e484</elocation-id><pub-id pub-id-type="doi">10.1038/tp.2014.123</pub-id><pub-id pub-id-type="pmid">25423136</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Etherton</surname><given-names>MR</given-names></name><name><surname>Blaiss</surname><given-names>CA</given-names></name><name><surname>Powell</surname><given-names>CM</given-names></name><name><surname>Südhof</surname><given-names>TC</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Mouse neurexin-1alpha deletion causes correlated electrophysiological and behavioral changes consistent with cognitive impairments</article-title><source>PNAS</source><volume>106</volume><fpage>17998</fpage><lpage>18003</lpage><pub-id pub-id-type="doi">10.1073/pnas.0910297106</pub-id><pub-id pub-id-type="pmid">19822762</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Grayton</surname><given-names>HM</given-names></name><name><surname>Missler</surname><given-names>M</given-names></name><name><surname>Collier</surname><given-names>DA</given-names></name><name><surname>Fernandes</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Altered social behaviours in neurexin 1α knockout mice resemble core symptoms in neurodevelopmental disorders</article-title><source>PLOS ONE</source><volume>8</volume><elocation-id>e67114</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0067114</pub-id><pub-id pub-id-type="pmid">23840597</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hao</surname><given-names>Y</given-names></name><name><surname>Hao</surname><given-names>S</given-names></name><name><surname>Andersen-Nissen</surname><given-names>E</given-names></name><name><surname>Mauck</surname><given-names>WM</given-names></name><name><surname>Zheng</surname><given-names>S</given-names></name><name><surname>Butler</surname><given-names>A</given-names></name><name><surname>Lee</surname><given-names>MJ</given-names></name><name><surname>Wilk</surname><given-names>AJ</given-names></name><name><surname>Darby</surname><given-names>C</given-names></name><name><surname>Zager</surname><given-names>M</given-names></name><name><surname>Hoffman</surname><given-names>P</given-names></name><name><surname>Stoeckius</surname><given-names>M</given-names></name><name><surname>Papalexi</surname><given-names>E</given-names></name><name><surname>Mimitou</surname><given-names>EP</given-names></name><name><surname>Jain</surname><given-names>J</given-names></name><name><surname>Srivastava</surname><given-names>A</given-names></name><name><surname>Stuart</surname><given-names>T</given-names></name><name><surname>Fleming</surname><given-names>LM</given-names></name><name><surname>Yeung</surname><given-names>B</given-names></name><name><surname>Rogers</surname><given-names>AJ</given-names></name><name><surname>McElrath</surname><given-names>JM</given-names></name><name><surname>Blish</surname><given-names>CA</given-names></name><name><surname>Gottardo</surname><given-names>R</given-names></name><name><surname>Smibert</surname><given-names>P</given-names></name><name><surname>Satija</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Integrated analysis of multimodal single-cell data</article-title><source>Cell</source><volume>184</volume><fpage>3573</fpage><lpage>3587</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2021.04.048</pub-id><pub-id pub-id-type="pmid">34062119</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hashemi</surname><given-names>P</given-names></name><name><surname>Dankoski</surname><given-names>EC</given-names></name><name><surname>Petrovic</surname><given-names>J</given-names></name><name><surname>Keithley</surname><given-names>RB</given-names></name><name><surname>Wightman</surname><given-names>RM</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Voltammetric detection of 5-hydroxytryptamine release in the rat brain</article-title><source>Analytical Chemistry</source><volume>81</volume><fpage>9462</fpage><lpage>9471</lpage><pub-id pub-id-type="doi">10.1021/ac9018846</pub-id><pub-id pub-id-type="pmid">19827792</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Herry</surname><given-names>C</given-names></name><name><surname>Ciocchi</surname><given-names>S</given-names></name><name><surname>Senn</surname><given-names>V</given-names></name><name><surname>Demmou</surname><given-names>L</given-names></name><name><surname>Müller</surname><given-names>C</given-names></name><name><surname>Lüthi</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Switching on and off fear by distinct neuronal circuits</article-title><source>Nature</source><volume>454</volume><fpage>600</fpage><lpage>606</lpage><pub-id pub-id-type="doi">10.1038/nature07166</pub-id><pub-id pub-id-type="pmid">18615015</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hitti</surname><given-names>FL</given-names></name><name><surname>Siegelbaum</surname><given-names>SA</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>The hippocampal ca2 region is essential for social memory</article-title><source>Nature</source><volume>508</volume><fpage>88</fpage><lpage>92</lpage><pub-id pub-id-type="doi">10.1038/nature13028</pub-id><pub-id pub-id-type="pmid">24572357</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>John</surname><given-names>CE</given-names></name><name><surname>Budygin</surname><given-names>EA</given-names></name><name><surname>Mateo</surname><given-names>Y</given-names></name><name><surname>Jones</surname><given-names>SR</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Neurochemical characterization of the release and uptake of dopamine in ventral tegmental area and serotonin in substantia nigra of the mouse</article-title><source>Journal of Neurochemistry</source><volume>96</volume><fpage>267</fpage><lpage>282</lpage><pub-id pub-id-type="doi">10.1111/j.1471-4159.2005.03557.x</pub-id><pub-id pub-id-type="pmid">16300629</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kogan</surname><given-names>JH</given-names></name><name><surname>Frankland</surname><given-names>PW</given-names></name><name><surname>Silva</surname><given-names>AJ</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Long-term memory underlying hippocampus-dependent social recognition in mice</article-title><source>Hippocampus</source><volume>10</volume><fpage>47</fpage><lpage>56</lpage><pub-id pub-id-type="doi">10.1002/(SICI)1098-1063(2000)10:1&lt;47::AID-HIPO5&gt;3.0.CO;2-6</pub-id><pub-id pub-id-type="pmid">10706216</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lesch</surname><given-names>KP</given-names></name><name><surname>Waider</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Serotonin in the modulation of neural plasticity and networks: implications for neurodevelopmental disorders</article-title><source>Neuron</source><volume>76</volume><fpage>175</fpage><lpage>191</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2012.09.013</pub-id><pub-id pub-id-type="pmid">23040814</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mao</surname><given-names>W</given-names></name><name><surname>Salzberg</surname><given-names>AC</given-names></name><name><surname>Uchigashima</surname><given-names>M</given-names></name><name><surname>Hasegawa</surname><given-names>Y</given-names></name><name><surname>Hock</surname><given-names>H</given-names></name><name><surname>Watanabe</surname><given-names>M</given-names></name><name><surname>Akbarian</surname><given-names>S</given-names></name><name><surname>Kawasawa</surname><given-names>YI</given-names></name><name><surname>Futai</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Activity-induced regulation of synaptic strength through the chromatin reader L3MBTL1</article-title><source>Cell Reports</source><volume>23</volume><fpage>3209</fpage><lpage>3222</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2018.05.028</pub-id><pub-id pub-id-type="pmid">29898393</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Matsui</surname><given-names>A</given-names></name><name><surname>Alvarez</surname><given-names>VA</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Cocaine inhibition of synaptic transmission in the ventral pallidum is pathway-specific and mediated by serotonin</article-title><source>Cell Reports</source><volume>23</volume><fpage>3852</fpage><lpage>3863</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2018.05.076</pub-id><pub-id pub-id-type="pmid">29949769</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>McFarlane</surname><given-names>HG</given-names></name><name><surname>Kusek</surname><given-names>GK</given-names></name><name><surname>Yang</surname><given-names>M</given-names></name><name><surname>Phoenix</surname><given-names>JL</given-names></name><name><surname>Bolivar</surname><given-names>VJ</given-names></name><name><surname>Crawley</surname><given-names>JN</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Autism-like behavioral phenotypes in BTBR T+tf/J mice</article-title><source>Genes, Brain, and Behavior</source><volume>7</volume><fpage>152</fpage><lpage>163</lpage><pub-id pub-id-type="doi">10.1111/j.1601-183X.2007.00330.x</pub-id><pub-id pub-id-type="pmid">17559418</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Molas</surname><given-names>S</given-names></name><name><surname>Zhao-Shea</surname><given-names>R</given-names></name><name><surname>Liu</surname><given-names>L</given-names></name><name><surname>DeGroot</surname><given-names>SR</given-names></name><name><surname>Gardner</surname><given-names>PD</given-names></name><name><surname>Tapper</surname><given-names>AR</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>A circuit-based mechanism underlying familiarity signaling and the preference for novelty</article-title><source>Nature Neuroscience</source><volume>20</volume><fpage>1260</fpage><lpage>1268</lpage><pub-id pub-id-type="doi">10.1038/nn.4607</pub-id><pub-id pub-id-type="pmid">28714952</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moy</surname><given-names>SS</given-names></name><name><surname>Nadler</surname><given-names>JJ</given-names></name><name><surname>Perez</surname><given-names>A</given-names></name><name><surname>Barbaro</surname><given-names>RP</given-names></name><name><surname>Johns</surname><given-names>JM</given-names></name><name><surname>Magnuson</surname><given-names>TR</given-names></name><name><surname>Piven</surname><given-names>J</given-names></name><name><surname>Crawley</surname><given-names>JN</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Sociability and preference for social novelty in five inbred strains: an approach to assess autistic-like behavior in mice</article-title><source>Genes, Brain, and Behavior</source><volume>3</volume><fpage>287</fpage><lpage>302</lpage><pub-id pub-id-type="doi">10.1111/j.1601-1848.2004.00076.x</pub-id><pub-id pub-id-type="pmid">15344922</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ren</surname><given-names>J</given-names></name><name><surname>Isakova</surname><given-names>A</given-names></name><name><surname>Friedmann</surname><given-names>D</given-names></name><name><surname>Zeng</surname><given-names>J</given-names></name><name><surname>Grutzner</surname><given-names>SM</given-names></name><name><surname>Pun</surname><given-names>A</given-names></name><name><surname>Zhao</surname><given-names>GQ</given-names></name><name><surname>Kolluru</surname><given-names>SS</given-names></name><name><surname>Wang</surname><given-names>R</given-names></name><name><surname>Lin</surname><given-names>R</given-names></name><name><surname>Li</surname><given-names>P</given-names></name><name><surname>Li</surname><given-names>A</given-names></name><name><surname>Raymond</surname><given-names>JL</given-names></name><name><surname>Luo</surname><given-names>Q</given-names></name><name><surname>Luo</surname><given-names>M</given-names></name><name><surname>Quake</surname><given-names>SR</given-names></name><name><surname>Luo</surname><given-names>L</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Single-cell transcriptomes and whole-brain projections of serotonin neurons in the mouse dorsal and median raphe nuclei</article-title><source>eLife</source><volume>8</volume><elocation-id>e49424</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.49424</pub-id><pub-id pub-id-type="pmid">31647409</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schermelleh</surname><given-names>L</given-names></name><name><surname>Heintzmann</surname><given-names>R</given-names></name><name><surname>Leonhardt</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>A guide to super-resolution fluorescence microscopy</article-title><source>The Journal of Cell Biology</source><volume>190</volume><fpage>165</fpage><lpage>175</lpage><pub-id pub-id-type="doi">10.1083/jcb.201002018</pub-id><pub-id pub-id-type="pmid">20643879</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Scott</surname><given-names>MM</given-names></name><name><surname>Wylie</surname><given-names>CJ</given-names></name><name><surname>Lerch</surname><given-names>JK</given-names></name><name><surname>Murphy</surname><given-names>R</given-names></name><name><surname>Lobur</surname><given-names>K</given-names></name><name><surname>Herlitze</surname><given-names>S</given-names></name><name><surname>Jiang</surname><given-names>W</given-names></name><name><surname>Conlon</surname><given-names>RA</given-names></name><name><surname>Strowbridge</surname><given-names>BW</given-names></name><name><surname>Deneris</surname><given-names>ES</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>A genetic approach to access serotonin neurons for in vivo and in vitro studies</article-title><source>PNAS</source><volume>102</volume><fpage>16472</fpage><lpage>16477</lpage><pub-id pub-id-type="doi">10.1073/pnas.0504510102</pub-id><pub-id pub-id-type="pmid">16251278</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seigneur</surname><given-names>E</given-names></name><name><surname>Wang</surname><given-names>J</given-names></name><name><surname>Dai</surname><given-names>J</given-names></name><name><surname>Polepalli</surname><given-names>J</given-names></name><name><surname>Südhof</surname><given-names>TC</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Cerebellin-2 regulates a serotonergic dorsal raphe circuit that controls compulsive behaviors</article-title><source>Molecular Psychiatry</source><volume>26</volume><fpage>7509</fpage><lpage>7521</lpage><pub-id pub-id-type="doi">10.1038/s41380-021-01187-x</pub-id><pub-id pub-id-type="pmid">34158618</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Soneson</surname><given-names>C</given-names></name><name><surname>Love</surname><given-names>MI</given-names></name><name><surname>Robinson</surname><given-names>MD</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences</article-title><source>F1000Research</source><volume>4</volume><elocation-id>1521</elocation-id><pub-id pub-id-type="doi">10.12688/f1000research.7563.2</pub-id><pub-id pub-id-type="pmid">26925227</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Südhof</surname><given-names>TC</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Synaptic neurexin complexes: a molecular code for the logic of neural circuits</article-title><source>Cell</source><volume>171</volume><fpage>745</fpage><lpage>769</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2017.10.024</pub-id><pub-id pub-id-type="pmid">29100073</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Uchigashima</surname><given-names>M</given-names></name><name><surname>Konno</surname><given-names>K</given-names></name><name><surname>Demchak</surname><given-names>E</given-names></name><name><surname>Cheung</surname><given-names>A</given-names></name><name><surname>Watanabe</surname><given-names>T</given-names></name><name><surname>Keener</surname><given-names>DG</given-names></name><name><surname>Abe</surname><given-names>M</given-names></name><name><surname>Le</surname><given-names>T</given-names></name><name><surname>Sakimura</surname><given-names>K</given-names></name><name><surname>Sasaoka</surname><given-names>T</given-names></name><name><surname>Uemura</surname><given-names>T</given-names></name><name><surname>Imamura Kawasawa</surname><given-names>Y</given-names></name><name><surname>Watanabe</surname><given-names>M</given-names></name><name><surname>Futai</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2020">2020a</year><article-title>Specific neuroligin3-αneurexin1 signaling regulates gabaergic synaptic function in mouse hippocampus</article-title><source>eLife</source><volume>9</volume><elocation-id>e59545</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.59545</pub-id><pub-id pub-id-type="pmid">33355091</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Uchigashima</surname><given-names>M</given-names></name><name><surname>Leung</surname><given-names>M</given-names></name><name><surname>Watanabe</surname><given-names>T</given-names></name><name><surname>Cheung</surname><given-names>A</given-names></name><name><surname>Le</surname><given-names>T</given-names></name><name><surname>Pallat</surname><given-names>S</given-names></name><name><surname>Dinis</surname><given-names>ALM</given-names></name><name><surname>Watanabe</surname><given-names>M</given-names></name><name><surname>Kawasawa</surname><given-names>YI</given-names></name><name><surname>Futai</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2020">2020b</year><article-title>Neuroligin3 splice isoforms shape inhibitory synaptic function in the mouse hippocampus</article-title><source>The Journal of Biological Chemistry</source><volume>295</volume><fpage>8589</fpage><lpage>8595</lpage><pub-id pub-id-type="doi">10.1074/jbc.AC120.012571</pub-id><pub-id pub-id-type="pmid">32381505</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Uemura</surname><given-names>T</given-names></name><name><surname>Suzuki-Kouyama</surname><given-names>E</given-names></name><name><surname>Kawase</surname><given-names>S</given-names></name><name><surname>Kurihara</surname><given-names>T</given-names></name><name><surname>Yasumura</surname><given-names>M</given-names></name><name><surname>Yoshida</surname><given-names>T</given-names></name><name><surname>Fukai</surname><given-names>S</given-names></name><name><surname>Yamazaki</surname><given-names>M</given-names></name><name><surname>Fei</surname><given-names>P</given-names></name><name><surname>Abe</surname><given-names>M</given-names></name><name><surname>Watanabe</surname><given-names>M</given-names></name><name><surname>Sakimura</surname><given-names>K</given-names></name><name><surname>Mishina</surname><given-names>M</given-names></name><name><surname>Tabuchi</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Neurexins play a crucial role in cerebellar granule cell survival by organizing autocrine machinery for neurotrophins</article-title><source>Cell Reports</source><volume>39</volume><elocation-id>110624</elocation-id><pub-id pub-id-type="doi">10.1016/j.celrep.2022.110624</pub-id><pub-id pub-id-type="pmid">35385735</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Werneburg</surname><given-names>S</given-names></name><name><surname>Jung</surname><given-names>J</given-names></name><name><surname>Kunjamma</surname><given-names>RB</given-names></name><name><surname>Ha</surname><given-names>SK</given-names></name><name><surname>Luciano</surname><given-names>NJ</given-names></name><name><surname>Willis</surname><given-names>CM</given-names></name><name><surname>Gao</surname><given-names>G</given-names></name><name><surname>Biscola</surname><given-names>NP</given-names></name><name><surname>Havton</surname><given-names>LA</given-names></name><name><surname>Crocker</surname><given-names>SJ</given-names></name><name><surname>Popko</surname><given-names>B</given-names></name><name><surname>Reich</surname><given-names>DS</given-names></name><name><surname>Schafer</surname><given-names>DP</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Targeted complement inhibition at synapses prevents microglial synaptic engulfment and synapse loss in demyelinating disease</article-title><source>Immunity</source><volume>52</volume><fpage>167</fpage><lpage>182</lpage><pub-id pub-id-type="doi">10.1016/j.immuni.2019.12.004</pub-id><pub-id pub-id-type="pmid">31883839</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname><given-names>M</given-names></name><name><surname>Zhodzishsky</surname><given-names>V</given-names></name><name><surname>Crawley</surname><given-names>JN</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Social deficits in BTBR T+tf/J mice are unchanged by cross-fostering with C57BL/6J mothers</article-title><source>International Journal of Developmental Neuroscience</source><volume>25</volume><fpage>515</fpage><lpage>521</lpage><pub-id pub-id-type="doi">10.1016/j.ijdevneu.2007.09.008</pub-id><pub-id pub-id-type="pmid">17980995</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yankelevitch-Yahav</surname><given-names>R</given-names></name><name><surname>Franko</surname><given-names>M</given-names></name><name><surname>Huly</surname><given-names>A</given-names></name><name><surname>Doron</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>The forced swim test as a model of depressive-like behavior</article-title><source>Journal of Visualized Experiments</source><volume>1</volume><elocation-id>52587</elocation-id><pub-id pub-id-type="doi">10.3791/52587</pub-id><pub-id pub-id-type="pmid">25867960</pub-id></element-citation></ref></ref-list></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.85058.sa0</article-id><title-group><article-title>Editor's evaluation</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Brose</surname><given-names>Nils</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/04a7f6w43</institution-id><institution>Max Planck Institute of Experimental Medicine</institution></institution-wrap><country>Germany</country></aff></contrib></contrib-group></front-stub><body><p>Neurexins control the assembly, maturation, and function of nerve cell synapses, and their genetic loss causes multiple neuropsychiatric diseases, including schizophrenia and autism spectrum disorder (ASD). This manuscript makes an important contribution, by showing convincingly that deletion of all neurexins specifically in serotonergic neurons causes a defect in the survival of serotonergic neurons, in the establishment of serotonergic axonal inputs in various brain regions, in the generation of serotonin release sites, and in serotonin secretion in various brain regions, resulting in ASD-like and depression-related behavioral defects. Thus, not only fast-acting transmitter systems but also modulatory ones depend on neurexin function, and serotonergic signaling contributes to the clinical features of neuropsychiatric disorders caused by neurexin loss. These findings will be interesting to experts in basic neuroscience, psychiatry, and neurology alike.</p></body></sub-article><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.85058.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Brose</surname><given-names>Nils</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/04a7f6w43</institution-id><institution>Max Planck Institute of Experimental Medicine</institution></institution-wrap><country>Germany</country></aff></contrib></contrib-group></front-stub><body><boxed-text id="sa2-box1"><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Decision letter after peer review:</bold></p><p>[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]</p><p>Thank you for submitting the paper &quot;Neurexins in serotonergic neurons regulate serotonin transmission and complex mouse behaviors&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Senior Editor. The reviewers have opted to remain anonymous.</p><p>We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by <italic>eLife</italic> at this juncture. As you will see from the detailed reviews below, all three reviewers agree that your study addresses – in an experimentally elegant manner – a very interesting and important neuroscientific problem at the interface between synapse biology and translational psychiatry. However, all three reviewers also identified a major shortcoming that prevents further consideration by <italic>eLife</italic> at this juncture: It remains unclear exactly how serotonergic axons and release sites are altered upon neurexin loss. If this issue can be addressed experimentally, along the lines indicated by the reviewers, <italic>eLife</italic> would be willing to consider a new submission of the manuscript.</p><p>Essential Revisions</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>Neurexins are adhesion proteins of transmitter-releasing presynaptic compartments that interact with multiple partner proteins to control the assembly, maturation, and function of various types of nerve cell synapses. Neurexin loss-of-function has been linked to multiple neuropsychiatric diseases, including schizophrenia and autism spectrum disorder (ASD), but it is unknown which synapses are affected upon Neurexin loss to cause the characteristic clinical features. It is in this context that the present paper makes an interesting contribution. The manuscript shows that deletion of all Neurexins specifically in serotonergic neurons causes a defect in serotonin release in various brain regions and subtle ASD-like and depression-related behavioural defects. These interesting observations show that not only fast-acting transmitter systems but also modulatory ones depend on Neurexin function, and they are in accord with the notion that defects in serotonergic signalling contribute critically to the clinical features of neuropsychiatric disorders caused by Neurexin loss. However, the present study contains several loose ends that prevent clear-cut conclusions. Most importantly, (i) it remains unclear whether Neurexin loss causes a genuine defect in the serotonin release machinery or simply a reduction of serotonergic axons and release sites, and (ii) the behavioral data require complementary readouts to bolster the still preliminary findings.</p><p>The present paper clearly has potential, but appears premature in its current form, even for a short-report-like submission. It documents two interesting initial discoveries, but contains several related loose ends that prevent clear-cut conclusions, as the authors themselves concede in the second and the last paragraphs of their discussion.</p><p>1. The voltammetry data in Figure 2 show nicely and convincingly that 5-HT release is reduced in Fev-Cre- Neurexin-TKO dorsal raphe nucleus and hippocampus. It remains unclear, though, whether this phenotype is due to a genuine defect in the 5-HT release machinery or to a reduction of 5-HT axons and release sites in the two brain regions tested, as Figure 3 would indicate. Given the known functions of Neurexins, this is an important distinction that needs to be assessed. This issue could, for instance, be addressed in tissue or neurons of Fev-Cre- Neurexin-TKO and control mice by (i) directly measuring triggered synaptic vesicle fusion in 5-HT terminals using SynaptopHluorin or a related reporter after cell-type specific expression, or by (ii) quantitatively assessing components of the transmitter release machinery or of synaptic vesicle clusters in SERT-positive axons. Furthermore, the data shown in Figure 3 should be complemented by Western blot analyses of SERT levels in hippocampus and dorsal raphe nucleus, which is more sensitive and easier to quantify than immunolabeling in tissue.</p><p>2. The behavioral data in Figure 4 indicate subtle ASD-like and depression-related defects in the Fev-Cre- Neurexin-TKO. This is clearly interesting. However, complementary readouts would bolster the still preliminary findings, e.g. the three-chamber test to study sociability and social memory.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>Cheung et al. investigate the role of the Neurexin family of synaptic adhesion proteins in regulating the function of serotonergic neurotransmission. The function of presynaptic Neurexins has been extensively characterized in the regulation of fast synaptic transmission, but whether they also play a role in neuromodulatory systems such as the serotonergic system remains largely unknown. This question is particularly pertinent given that both Neurexins and serotonergic signaling have been linked to the etiology of psychiatric disorders, including schizophrenia and autism spectrum disorders. To address this issue, the authors first demonstrate that serotonergic neurons in the dorsal raphe nucleus express multiple Neurexin isoforms. The authors then delete all Neurexin isoforms specifically from these neurons, and investigate the consequences on 5-HT (serotonin) release, serotonergic innervation, and behavior. They report a substantial reduction in 5-HT release in the dorsal raphe nucleus and hippocampus, accompanied by a modest reduction in serotonin receptor (SERT)-positive fibers as well as alterations in social and depression-like behaviors.</p><p>This study addresses an important and timely question. While the molecular mechanisms that govern fast synaptic neurotransmission have been the subject of extensive investigation over several decades, the equivalent mechanisms at neuromodulatory release sites have received far less attention. In recent years this is beginning to change, and the present observation that Neurexins regulate serotonergic neurotransmission provides an interesting contribution to this growing field. The experiments appear thoroughly and carefully conducted, and the manuscript and figures are very well prepared and clearly presented. The behavioral characterization is comprehensive and well executed, even though only a few selective behavioral abnormalities were observed.</p><p>However, the conclusions that can be drawn from the present study are somewhat limited in scope, due to the lack of any mechanistic experiments that may begin to explain the observed phenotypes. The study is purely descriptive, and the analysis of serotonergic signaling is essentially limited to the analysis of two relatively general functional parameters, i.e. 5-HT release and density of SERT-positive fibers. Given what is previously known about the role of Neurexin in fast synaptic transmission, many questions arise regarding the mechanisms by which Neurexins may function in a system that is primarily geared toward volume transmission and in which most release sites do not have an associated postsynaptic structure. Importantly, the authors do acknowledge the need for detailed mechanistic studies, and they are careful to present only conclusions that are supported by their data. Nevertheless, additional mechanistic experiments would help to strengthen the notion that Neurexins are important players in serotonergic signaling.</p><p>1. The authors state that &quot;Given the predominance of non-junctional specializations, we speculate that Nrxns reside at 5-HT release sites that lack a direct postsynaptic target&quot; (Discussion, p. 7). This is an interesting point and one that could be expanded further, including experimentally. Could it be shown experimentally that Neurexins are present at non-synaptic structures? What extracellular interaction partners might they bind to here?</p><p>2. The authors state that their data indicate &quot;that the primary role of Nrxns in the 5-HT system is the formation of functional components important for 5-HT release&quot; (Discussion, p. 7). This too could be tested experimentally, e.g. through immunohistochemical oder ultrastructural analysis of presynaptic terminals.</p><p>3. What are the consequences of conditional single deletion of Nrxn1, 2 or 3 on the key phenotypes?</p><p>4. Please state whether all experiments were conducted blind to genotype. This is mentioned in some but not in other sections, leaving the impression that not all experiments were conducted blind to genotype – is this true? If so, it should be stated explicitly.</p><p>5. Were any controls conducted with Fev-Cre mice alone to exclude an effect of Cre expression on serotonergic synaptic transmission and behavior, or have these controls been previously published? If not, please discuss the possibility that the observed changes may result from Fev-Cre expression rather than from the deletion of Neurexins.</p><p>6. For the behavioral experiments, mice were used at age 8 weeks or older. Is this also true for the other experiments? Please state the age range used for each experiment.</p><p>7. Please state the genetic background for the mice.</p><p><italic>Reviewer #3 (Recommendations for the authors):</italic></p><p>This manuscript is the first to report effects of genetic deletion of neurexins from serotonergic neurons. The authors used a nice combination of fast-scan cyclic voltammetry with electrical stimulation to assess serotonin release, immunofluorescence for serotonin transporter, and a wide range of behavioral assays. Loss of neurexins reduced serotonin release and serotonin transporter immunoreactivity in the dorsal raphe nucleus and dorsal hippocampus. The conditional knockout mice showed reduced social interaction and increased depressive-like behavior in the forced swim test. These data constitute strong evidence for a function of neurexins in serotonergic neurons in neurotransmission and in a subset of behaviors. Overall, the conclusions are well supported by the data. This analysis of the role of neurexins in serotonergic neurons is an important contribution to the field.</p><p>1. One aspect which would benefit from further analysis is a more in-depth study of exactly how serotonergic axons and release sites are altered upon loss of neurexins. As the authors discuss, the observed difference in SERT immunofluorescence could reflect a difference in axon arbors or a difference in SERT overall expression or local aggregation. Since the conditional KO mice include a tdTomato reporter, is there enough signal from the tdTomato (alone or amplified by immunostaining) to determine whether loss of neurexins affects the axon arbors? Overall expression of SERT could be assessed by Western blot. It would also be interesting to assess the localization of active zone proteins in the serotonergic axons. Co-labeling of bassoon, ELKS, or RIM with SERT could be assessed by a super-resolution or expansion microscopy approach. Co-labeling of SERT with VGlut3 might also be informative. I do not expect all of these additional experiments to be performed but some further information would strengthen the manuscript.</p><p>2. While I follow the reason for studying the DRN, it is puzzling to me why the authors focused additionally on the dorsal hippocampus rather than a region with stronger serotonergic innervation. The effect of fluoxetine on the FSCV signal is substantial in DRN but weak in the hippocampus raising some question about specificity of the signal for serotonin.</p><p>3. There is a related publication that was not cited. Seigneur et al. (2021; Molecular Psychiatry; https://doi.org/10.1038/s41380-021-01187-x) found that Cbln-2 functions in dorsal raphe serotonergic neurons in regulating serotonin release and behavior. Since the only known signaling mechanism for Cbln-2 is through a neurexin-Cbln-GluD complex, this indirectly implicates neurexins. It would be a valuable discussion point to compare the current results with those of Seigneur et al. (2021).</p><p>4. It may be best to refer to the control mice as 'control' or 'Con' rather than 'WT' since these were Cre-negative littermates and Fev/RFP mice, thus mostly not strictly WT.</p><p>5. There seems to be very low sensitivity in the Q-PCR assay in Figure 1D, as only 2 or 4 of the 23 control cells showed signal for Nrxn2 and Nrxn3, respectively, although a greater fraction of cells express these genes (panel C). Pooling cells may be preferable. The more effective detection of Nrxn1 in control cells confirms its deletion with Fev-Cre, so it is likely that Nrxn 2 and 3 were also deleted.</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Neurexins in serotonergic neurons regulate serotonin transmission and complex mouse behaviors&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Gary Westbrook (Senior Editor) and a Reviewing Editor.</p><p>The manuscript has been improved but there are three remaining issues that need to be addressed, and a suggestion, as outlined below:</p><p>1. To demonstrate the involvement of Nrxns in 5HT release in the hippocampus, the authors change the statistical analysis in Figures 2F and 2J from a two-way repeated measure ANOVA to a paired t-test. This new statistical analysis now supposedly shows that fluoxetine treatment increases 5HT transients in control mice but not in TKO mice in the hippocampus, leading to the conclusion that &quot;the lack of statistical significance in the TKO group is due to greatly reduced 5-HT release in TKO slices that reaches the limitation of FSCV sensitivity&quot;. However, there is no justification for changing this statistical analysis. The original analysis, which used a two-way repeated measures ANOVA, was fully correct and convincingly demonstrated a lack of a genotype effect (genotype main effect, F1,9 = 0.01351, p = 0.91; drug x genotype interaction, F1,9 = 0.09308, p = 0.7672). The paired t-test now conducted for the revised manuscript is an inappropriate statistical analysis, since there is no statistical comparison of genotypes, only of drug effect within each genotype, making it impossible to make any statistical claims on a genotype effect. This analysis must be corrected back to the original version, i.e. the two-way repeated measures ANOVA, to avoid falsifying the conclusions.</p><p>2. The authors must provide information on the age of the mice used for the RT-PCR and voltammetry experiments (Figures 1 and 2). The only information on the age of mice is given for data in Figures 3 and 4, it appears. To facilitate finding this information, the authors must add a summary of the ages of the mice for all experiments to the 'Animals' section of the Methods part. Given that Nrxns are differentially involved at different time points of synapse development and function, it is important to know at which developmental time points analyses were performed.</p><p>3. As regards additional behavioral experiments, the reviewers acknowledge that the authors did the three-chamber test to assess social interaction, but did not obtain further evidence for ASD-like behavior in the mutants. This warrants a more conservative, differentiated, discussion of the role of defects in the serotonergic system in neuropsychiatric conditions caused by Nrxn loss.</p><p>4. The reviewers suggest including the effect on neuron survival in the title as it is a rather surprising and important finding.</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.85058.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]</p><disp-quote content-type="editor-comment"><p>Essential Revisions</p><p>Reviewer #1 (Recommendations for the authors):</p><p>Neurexins are adhesion proteins of transmitter-releasing presynaptic compartments that interact with multiple partner proteins to control the assembly, maturation, and function of various types of nerve cell synapses. Neurexin loss-of-function has been linked to multiple neuropsychiatric diseases, including schizophrenia and autism spectrum disorder (ASD), but it is unknown which synapses are affected upon Neurexin loss to cause the characteristic clinical features. It is in this context that the present paper makes an interesting contribution. The manuscript shows that deletion of all Neurexins specifically in serotonergic neurons causes a defect in serotonin release in various brain regions and subtle ASD-like and depression-related behavioural defects. These interesting observations show that not only fast-acting transmitter systems but also modulatory ones depend on Neurexin function, and they are in accord with the notion that defects in serotonergic signalling contribute critically to the clinical features of neuropsychiatric disorders caused by Neurexin loss. However, the present study contains several loose ends that prevent clear-cut conclusions. Most importantly, (i) it remains unclear whether Neurexin loss causes a genuine defect in the serotonin release machinery or simply a reduction of serotonergic axons and release sites, and (ii) the behavioral data require complementary readouts to bolster the still preliminary findings.</p></disp-quote><p>We thank the reviewer for this comment. In the revised manuscript, we address (i) by exploring deficits in serotonin release machinery, and (ii) by reporting the results of an additional behavioral approach (see below) and discussing the mild behavioral effects.</p><disp-quote content-type="editor-comment"><p>The present paper clearly has potential, but appears premature in its current form, even for a short-report-like submission. It documents two interesting initial discoveries, but contains several related loose ends that prevent clear-cut conclusions, as the authors themselves concede in the second and the last paragraphs of their discussion.</p></disp-quote><p>We appreciate the Reviewer’s interest in our initial discoveries. The updated manuscript provides more clear-cut conclusions. Notably, serotonergic Nrxns are important for 5-HT neuron survival and release machinery.</p><disp-quote content-type="editor-comment"><p>1. The voltammetry data in Figure 2 show nicely and convincingly that 5-HT release is reduced in Fev-Cre- Neurexin-TKO dorsal raphe nucleus and hippocampus. It remains unclear, though, whether this phenotype is due to a genuine defect in the 5-HT release machinery or to a reduction of 5-HT axons and release sites in the two brain regions tested, as Figure 3 would indicate. Given the known functions of Neurexins, this is an important distinction that needs to be assessed. This issue could, for instance, be addressed in tissue or neurons of Fev-Cre- Neurexin-TKO and control mice by (i) directly measuring triggered synaptic vesicle fusion in 5-HT terminals using SynaptopHluorin or a related reporter after cell-type specific expression, or by (ii) quantitatively assessing components of the transmitter release machinery or of synaptic vesicle clusters in SERT-positive axons. Furthermore, the data shown in Figure 3 should be complemented by Western blot analyses of SERT levels in hippocampus and dorsal raphe nucleus, which is more sensitive and easier to quantify than immunolabeling in tissue.</p></disp-quote><p>We appreciate this comment. Our collaborators, Drs. Konno and Watanabe, are experts in high-resolution immunohistochemistry imaging and performed confocal imaging against control and TKO tissues given our limited experience with super-resolution microscopy. We first confirmed the expression of active zone proteins, RIM1/2, in SERT-positive fibers in the dorsal hippocampal CA1 region in ultra-thin (100 nm) sections (Figure 3—figure supplement 2) and then measured the density of RIM1/2 in SERT/RFP-positive fibers (Figure 3N and 3O). We believe that using ultra-thin sections as a confirmational experiment allowed us to use our existing resource of confocal microscopy to quantify RIM1/2 proteins localized in serotonergic terminals. Importantly, we found that RIM1/2 density is significantly reduced in Fev/RFP/NrxnTKO mice compared with control mice. This imaging study suggests that Nrxn TKO in 5-HT fibers reduced active zone density and therefore 5-HT release sites.</p><disp-quote content-type="editor-comment"><p>2. The behavioral data in Figure 4 indicate subtle ASD-like and depression-related defects in the Fev-Cre- Neurexin-TKO. This is clearly interesting. However, complementary readouts would bolster the still preliminary findings, e.g. the three-chamber test to study sociability and social memory.</p></disp-quote><p>We performed a three-chamber social interaction test (3CST) as presented in Figure 4—figure supplement 2. Fev/RFP/NrxnTKO mice showed similar performance to Cntl mice. However, Cntl and Fev/RFP/NrxnTKO mice showed different investigation behavior on Day 1. There were no differences in exploration time between groups which contrasts the sociability deficits observed in the direct social interaction test. We consider that the different results of the direct social interaction test and 3CST can be due to two possibilities: (i) 3CST limits direct interaction with a stimulus mouse and it is possible that the mode and novelty of social interaction are critical to Fev/RFP/NrxnTKO mice, as there were genotype differences observed on initial encounter in both experiments, and (ii) the mild behavioral deficit in Fev/RFP/NrxnTKO mice can be due to intact serotonergic circuitry mediated by Cre-negative 5-HT neurons (which constitute approximately 40% of the total 5-HT neurons, Figure 3M). We state these possibilities in the Discussion section (page 8).</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>Cheung et al. investigate the role of the Neurexin family of synaptic adhesion proteins in regulating the function of serotonergic neurotransmission. The function of presynaptic Neurexins has been extensively characterized in the regulation of fast synaptic transmission, but whether they also play a role in neuromodulatory systems such as the serotonergic system remains largely unknown. This question is particularly pertinent given that both Neurexins and serotonergic signaling have been linked to the etiology of psychiatric disorders, including schizophrenia and autism spectrum disorders. To address this issue, the authors first demonstrate that serotonergic neurons in the dorsal raphe nucleus express multiple Neurexin isoforms. The authors then delete all Neurexin isoforms specifically from these neurons, and investigate the consequences on 5-HT (serotonin) release, serotonergic innervation, and behavior. They report a substantial reduction in 5-HT release in the dorsal raphe nucleus and hippocampus, accompanied by a modest reduction in serotonin receptor (SERT)-positive fibers as well as alterations in social and depression-like behaviors.</p><p>This study addresses an important and timely question. While the molecular mechanisms that govern fast synaptic neurotransmission have been the subject of extensive investigation over several decades, the equivalent mechanisms at neuromodulatory release sites have received far less attention. In recent years this is beginning to change, and the present observation that Neurexins regulate serotonergic neurotransmission provides an interesting contribution to this growing field. The experiments appear thoroughly and carefully conducted, and the manuscript and figures are very well prepared and clearly presented. The behavioral characterization is comprehensive and well executed, even though only a few selective behavioral abnormalities were observed.</p><p>However, the conclusions that can be drawn from the present study are somewhat limited in scope, due to the lack of any mechanistic experiments that may begin to explain the observed phenotypes. The study is purely descriptive, and the analysis of serotonergic signaling is essentially limited to the analysis of two relatively general functional parameters, i.e. 5-HT release and density of SERT-positive fibers. Given what is previously known about the role of Neurexin in fast synaptic transmission, many questions arise regarding the mechanisms by which Neurexins may function in a system that is primarily geared toward volume transmission and in which most release sites do not have an associated postsynaptic structure. Importantly, the authors do acknowledge the need for detailed mechanistic studies, and they are careful to present only conclusions that are supported by their data. Nevertheless, additional mechanistic experiments would help to strengthen the notion that Neurexins are important players in serotonergic signaling.</p></disp-quote><p>We appreciate this Reviewer’s supportive comments and have updated our revised manuscript with more mechanistic experiments to strengthen the role of Nrxns in serotonergic signaling, as discussed above.</p><disp-quote content-type="editor-comment"><p>1. The authors state that &quot;Given the predominance of non-junctional specializations, we speculate that Nrxns reside at 5-HT release sites that lack a direct postsynaptic target&quot; (Discussion, p. 7). This is an interesting point and one that could be expanded further, including experimentally. Could it be shown experimentally that Neurexins are present at non-synaptic structures? What extracellular interaction partners might they bind to here?</p></disp-quote><p>It is certainly interesting to address the expression of postsynaptic targets in Fev/RFP/NrxnTKO mouse brain. Unfortunately, we have had issues with mouse breeding related to the construction of a new research building next to our animal facility. So far, we have a limited number of animals and have established reliable imaging setting only for triple staining RFP, RIM1/2, and SERT proteins. While we have continuously tried to address this question by establishing multi-color imaging protocols that stain RFP (or SERT), active zone marker (RIM1/2 and others), and postsynaptic targets, including Neuroligin 1, 2 and 3, we haven’t established the staining conditions yet.</p><p>The staining of Nrxns has been a significant challenge in our field. We have tested 5 commercially available Nrxn antibodies, however, none of them were validated by our KO tissue.</p><disp-quote content-type="editor-comment"><p>2. The authors state that their data indicate &quot;that the primary role of Nrxns in the 5-HT system is the formation of functional components important for 5-HT release&quot; (Discussion, p. 7). This too could be tested experimentally, e.g. through immunohistochemical oder ultrastructural analysis of presynaptic terminals.</p></disp-quote><p>We appreciate this suggestion. We performed high-resolution immunohistochemistry imaging against control and TKO tissues. We first confirmed the expression of the active zone marker, RIM1/2, in SERT-positive fibers in ultra-thin (100 nm) sections, and then performed triple staining against RFP, SERT, and RIM1/2 in ultra-thin sections prepared from Fev/RFP (Cntl) and Fev/RFP/NrxnTKO mice. Importantly, NrxnTKO in 5-HT neurons reduced RIM1/2 density in Fev/RFP/NrxnTKO mice. These results are presented in Figure 3N, 3O, and Figure 3—figure supplement 2.</p><disp-quote content-type="editor-comment"><p>3. What are the consequences of conditional single deletion of Nrxn1, 2 or 3 on the key phenotypes?</p></disp-quote><p>We agree that it is important to find Nrxn isoform(s) responsible for the phenotypes we found in this manuscript. However, this manuscript focuses on the general role of Nrxns in the 5-HT signaling. This comment requires significant time and budget to generate single or double Nrxn KO mouse lines. Our school has begun construction for a new research building right next to our animal facility which has caused considerable issues with mouse breeding. Therefore, we would like to address this comment as a future project.</p><disp-quote content-type="editor-comment"><p>4. Please state whether all experiments were conducted blind to genotype. This is mentioned in some but not in other sections, leaving the impression that not all experiments were conducted blind to genotype – is this true? If so, it should be stated explicitly.</p></disp-quote><p>Addressed. All experiments and data analysis were performed in a blind manner and we refer to this in the Materials and methods section.</p><disp-quote content-type="editor-comment"><p>5. Were any controls conducted with Fev-Cre mice alone to exclude an effect of Cre expression on serotonergic synaptic transmission and behavior, or have these controls been previously published? If not, please discuss the possibility that the observed changes may result from Fev-Cre expression rather than from the deletion of Neurexins.</p></disp-quote><p>Fev-Cre mice were used as controls in experiments that are specified in the manuscript, including for RFP-positive cell density and fiber analysis and validation of the Fev/RFP/NrxnTKO mouse line. The effect of Cre expression on 5-HT function has not been previously published and we have discussed the unlikely possibility that the observed changes may result from Fev-Cre expression rather than from the deletion of Nrxns in the Discussion section (page 8).</p><disp-quote content-type="editor-comment"><p>6. For the behavioral experiments, mice were used at age 8 weeks or older. Is this also true for the other experiments? Please state the age range used for each experiment.</p></disp-quote><p>We now state clearly the age range of mice for each experiment in the Materials and methods section.</p><disp-quote content-type="editor-comment"><p>7. Please state the genetic background for the mice.</p></disp-quote><p>Fev-Cre and TdTomato reporter lines were backcrossed with C57BL6 line for at least 10 generations. The Nrxn floxed line was generated using C57BL6 ES cells (T. Uemura et al., 2022). We have included these details in the Animals section in the Materials and methods section.</p><disp-quote content-type="editor-comment"><p>Reviewer #3 (Recommendations for the authors):</p><p>This manuscript is the first to report effects of genetic deletion of neurexins from serotonergic neurons. The authors used a nice combination of fast-scan cyclic voltammetry with electrical stimulation to assess serotonin release, immunofluorescence for serotonin transporter, and a wide range of behavioral assays. Loss of neurexins reduced serotonin release and serotonin transporter immunoreactivity in the dorsal raphe nucleus and dorsal hippocampus. The conditional knockout mice showed reduced social interaction and increased depressive-like behavior in the forced swim test. These data constitute strong evidence for a function of neurexins in serotonergic neurons in neurotransmission and in a subset of behaviors. Overall, the conclusions are well supported by the data. This analysis of the role of neurexins in serotonergic neurons is an important contribution to the field.</p></disp-quote><p>We are grateful for this Reviewer’s comment about our manuscript.</p><disp-quote content-type="editor-comment"><p>1. One aspect which would benefit from further analysis is a more in-depth study of exactly how serotonergic axons and release sites are altered upon loss of neurexins. As the authors discuss, the observed difference in SERT immunofluorescence could reflect a difference in axon arbors or a difference in SERT overall expression or local aggregation. Since the conditional KO mice include a tdTomato reporter, is there enough signal from the tdTomato (alone or amplified by immunostaining) to determine whether loss of neurexins affects the axon arbors? Overall expression of SERT could be assessed by Western blot. It would also be interesting to assess the localization of active zone proteins in the serotonergic axons. Co-labeling of bassoon, ELKS, or RIM with SERT could be assessed by a super-resolution or expansion microscopy approach. Co-labeling of SERT with VGlut3 might also be informative. I do not expect all of these additional experiments to be performed but some further information would strengthen the manuscript.</p></disp-quote><p>We appreciate this comment. First, we performed western blotting against SERT and found that NrxnTKO in 5-HT neurons reduced SERT expression in the brainstem and hippocampus, but not in the midbrain. These results are incorporated in Figure 3—figure supplement 1. Next, we performed confocal imaging labeling RFP, SERT, and RIM1/2 (active zone marker) in Fev/RFP/NrxnTKO and Fev/RFP (control) mice. Because our department is not equipped to perform super-resolution microscopy, we overcame the z-axis resolution issue by imaging ultra-thin sections (100 nm) and confirmed RIM1/2 expression in SERT fibers. Our new findings strongly support that Nrxn TKO in 5-HT neurons reduces the number of release sites in serotonergic terminals. These results are included in Figures 3N and 3O, and Figure 3—figure supplement 2.</p><disp-quote content-type="editor-comment"><p>2. While I follow the reason for studying the DRN, it is puzzling to me why the authors focused additionally on the dorsal hippocampus rather than a region with stronger serotonergic innervation. The effect of fluoxetine on the FSCV signal is substantial in DRN but weak in the hippocampus raising some question about specificity of the signal for serotonin.</p></disp-quote><p>We focused on the hippocampal circuit because first, we observed reduced SERT expression in the hippocampus, and second, we observed abnormal direct social interaction which can be regulated by the dorsal hippocampal circuit (Hitti &amp; Siegelbaum, 2014). We apologize that we chose the wrong statistical method to quantify the effect of fluoxetine to confirm 5-HT release in FSCV. In the initial manuscript, we chose a two-way repeated measures ANOVA for this experiment. However, since we are comparing FSCV transients before and after fluoxetine treatment within the genotype, a paired t-test for each genotype should be applied. The new statistical analysis using paired t-test demonstrates statistical significance in control but not Fev/RFP/NrxnTKO hippocampus. We consider that the reason for the lack of statistical significance in the TKO group is due to greatly reduced 5-HT release in TKO slices that reaches the limitation of FSCV sensitivity.</p><disp-quote content-type="editor-comment"><p>3. There is a related publication that was not cited. Seigneur et al. (2021; Molecular Psychiatry; https://doi.org/10.1038/s41380-021-01187-x) found that Cbln-2 functions in dorsal raphe serotonergic neurons in regulating serotonin release and behavior. Since the only known signaling mechanism for Cbln-2 is through a neurexin-Cbln-GluD complex, this indirectly implicates neurexins. It would be a valuable discussion point to compare the current results with those of Seigneur et al. (2021).</p></disp-quote><p>We appreciate this suggestion. We included this paper in the Discussion section (page 7).</p><disp-quote content-type="editor-comment"><p>4. It may be best to refer to the control mice as 'control' or 'Con' rather than 'WT' since these were Cre-negative littermates and Fev/RFP mice, thus mostly not strictly WT.</p></disp-quote><p>We appreciate this suggestion. We switched our abbreviation from WT to control (Cntl).</p><disp-quote content-type="editor-comment"><p>5. There seems to be very low sensitivity in the Q-PCR assay in Figure 1D, as only 2 or 4 of the 23 control cells showed signal for Nrxn2 and Nrxn3, respectively, although a greater fraction of cells express these genes (panel C). Pooling cells may be preferable. The more effective detection of Nrxn1 in control cells confirms its deletion with Fev-Cre, so it is likely that Nrxn 2 and 3 were also deleted.</p></disp-quote><p>We appreciate this suggestion. We performed digital PCR against pooled single-cell cDNA libraries and confirmed that pooled Nrxn TKO in 5-HT neurons express significantly lower levels of Nrxn2 and Nrxn3 genes compared with that of control neurons. These results are included in Figure 1—figure supplement 1.</p><p>[Editors’ note: what follows is the authors’ response to the second round of review.]</p><disp-quote content-type="editor-comment"><p>The manuscript has been improved but there are three remaining issues that need to be addressed, and a suggestion, as outlined below:</p><p>1. To demonstrate the involvement of Nrxns in 5HT release in the hippocampus, the authors change the statistical analysis in Figures 2F and 2J from a two-way repeated measure ANOVA to a paired t-test. This new statistical analysis now supposedly shows that fluoxetine treatment increases 5HT transients in control mice but not in TKO mice in the hippocampus, leading to the conclusion that &quot;the lack of statistical significance in the TKO group is due to greatly reduced 5-HT release in TKO slices that reaches the limitation of FSCV sensitivity&quot;. However, there is no justification for changing this statistical analysis. The original analysis, which used a two-way repeated measures ANOVA, was fully correct and convincingly demonstrated a lack of a genotype effect (genotype main effect, F1,9 = 0.01351, p = 0.91; drug x genotype interaction, F1,9 = 0.09308, p = 0.7672). The paired t-test now conducted for the revised manuscript is an inappropriate statistical analysis, since there is no statistical comparison of genotypes, only of drug effect within each genotype, making it impossible to make any statistical claims on a genotype effect. This analysis must be corrected back to the original version, i.e. the two-way repeated measures ANOVA, to avoid falsifying the conclusions.</p></disp-quote><p>We appreciate this comment. As suggested by the reviewers, we changed our statistical method for the FLX experiment in Figures 2F and 2J back to two-way repeated measures ANOVA test.</p><disp-quote content-type="editor-comment"><p>2. The authors must provide information on the age of the mice used for the RT-PCR and voltammetry experiments (Figures 1 and 2). The only information on the age of mice is given for data in Figures 3 and 4, it appears. To facilitate finding this information, the authors must add a summary of the ages of the mice for all experiments to the 'Animals' section of the Methods part. Given that Nrxns are differentially involved at different time points of synapse development and function, it is important to know at which developmental time points analyses were performed.</p></disp-quote><p>We apologize that we did not include the age information of animals that were tested in RT-qPCR and voltammetry experiments. The revised manuscript includes the ages of animals in these experiments in the Materials and methods section, including the Animals and other sections.</p><disp-quote content-type="editor-comment"><p>3. As regards additional behavioral experiments, the reviewers acknowledge that the authors did the three-chamber test to assess social interaction, but did not obtain further evidence for ASD-like behavior in the mutants. This warrants a more conservative, differentiated, discussion of the role of defects in the serotonergic system in neuropsychiatric conditions caused by Nrxn loss.</p></disp-quote><p>We agree with the reviewers’ comment that our new behavior data doesn’t provide further evidence for ASD-like behavior in the mutant mice. Our revised manuscript includes conservative statements in the Discussion section.</p><disp-quote content-type="editor-comment"><p>4. The reviewers suggest including the effect on neuron survival in the title as it is a rather surprising and important finding.</p></disp-quote><p>Addressed. The revised title is “Neurexins in serotonergic neurons regulate neuronal survival, serotonin transmission, and complex mouse behaviors”.</p></body></sub-article></article>