<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.2 20190208//EN"  "JATS-archivearticle1-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">86842</article-id><article-id pub-id-type="doi">10.7554/eLife.86842</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Nova proteins direct synaptic integration of somatostatin interneurons through activity-dependent alternative splicing</article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes" equal-contrib="yes" id="author-306113"><name><surname>Ibrahim</surname><given-names>Leena Ali</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-8255-3423</contrib-id><email>leena.ibrahim@kaust.edu.sa</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" equal-contrib="yes" id="author-169705"><name><surname>Wamsley</surname><given-names>Brie</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="equal-contrib1">†</xref><xref ref-type="fn" rid="pa1">‡</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-306114"><name><surname>Alghamdi</surname><given-names>Norah</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-306115"><name><surname>Yusuf</surname><given-names>Nusrath</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="pa2">§</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-306116"><name><surname>Sevier</surname><given-names>Elaine</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-306117"><name><surname>Hairston</surname><given-names>Ariel</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-306118"><name><surname>Sherer</surname><given-names>Mia</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-169708"><name><surname>Jaglin</surname><given-names>Xavier Hubert</given-names></name><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-306119"><name><surname>Xu</surname><given-names>Qing</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-9479-470X</contrib-id><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-306120"><name><surname>Guo</surname><given-names>Lihua</given-names></name><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="fn" rid="con10"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-169710"><name><surname>Khodadadi-Jamayran</surname><given-names>Alireza</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="fn" rid="con11"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-306121"><name><surname>Favuzzi</surname><given-names>Emilia</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con12"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-169712"><name><surname>Yuan</surname><given-names>Yuan</given-names></name><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con13"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-252280"><name><surname>Dimidschstein</surname><given-names>Jordane</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con14"/><xref ref-type="fn" rid="conf2"/></contrib><contrib contrib-type="author" id="author-194995"><name><surname>Darnell</surname><given-names>Robert B</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-5134-8088</contrib-id><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con15"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-94193"><name><surname>Fishell</surname><given-names>Gordon</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-9640-9278</contrib-id><email>gordon_fishell@hms.harvard.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="other" rid="fund4"/><xref ref-type="other" rid="fund3"/><xref ref-type="other" rid="fund2"/><xref ref-type="other" rid="fund5"/><xref ref-type="other" rid="fund6"/><xref ref-type="fn" rid="con16"/><xref ref-type="fn" rid="conf2"/></contrib><aff id="aff1"><label>1</label><institution>Department of Neurobiology, Harvard Medical School</institution><addr-line><named-content content-type="city">Boston</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01q3tbs38</institution-id><institution>Biological and Environmental Sciences and Engineering Division (BESE), King Abdullah University of Science and Technology (KAUST)</institution></institution-wrap><addr-line><named-content content-type="city">Thuwal</named-content></addr-line><country>Saudi Arabia</country></aff><aff id="aff3"><label>3</label><institution>Stanley Center at the Broad</institution><addr-line><named-content content-type="city">Cambridge</named-content></addr-line><country>United States</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0190ak572</institution-id><institution>NYU Neuroscience Institute and the Department of Neuroscience and Physiology, Smilow Research Center, New York University School of Medicine</institution></institution-wrap><addr-line><named-content content-type="city">New York</named-content></addr-line><country>United States</country></aff><aff id="aff5"><label>5</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00e5k0821</institution-id><institution>Center for Genomics &amp; Systems Biology, New York University</institution></institution-wrap><addr-line><named-content content-type="city">Abu Dhabi</named-content></addr-line><country>United Arab Emirates</country></aff><aff id="aff6"><label>6</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/005dvqh91</institution-id><institution>Genome Technology Center, Applied Bioinformatics Laboratories, NYU Langone Medical Center</institution></institution-wrap><addr-line><named-content content-type="city">New York</named-content></addr-line><country>United States</country></aff><aff id="aff7"><label>7</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0420db125</institution-id><institution>Laboratory of Molecular Neuro-Oncology, The Rockefeller University</institution></institution-wrap><addr-line><named-content content-type="city">New York</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Nelson</surname><given-names>Sacha B</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/05abbep66</institution-id><institution>Brandeis University</institution></institution-wrap><country>United States</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Westbrook</surname><given-names>Gary L</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/009avj582</institution-id><institution>Oregon Health &amp; Science University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><author-notes><fn fn-type="con" id="equal-contrib1"><label>†</label><p>These authors contributed equally to this work</p></fn><fn fn-type="present-address" id="pa1"><label>‡</label><p>Department of Neurology, David Geffen School of Medicine, UCLA, Los Angeles, United States</p></fn><fn fn-type="present-address" id="pa2"><label>§</label><p>Rutgers University, New Brunswick, United States</p></fn></author-notes><pub-date publication-format="electronic" date-type="publication"><day>22</day><month>06</month><year>2023</year></pub-date><pub-date pub-type="collection"><year>2023</year></pub-date><volume>12</volume><elocation-id>e86842</elocation-id><history><date date-type="received" iso-8601-date="2023-02-08"><day>08</day><month>02</month><year>2023</year></date><date date-type="accepted" iso-8601-date="2023-04-17"><day>17</day><month>04</month><year>2023</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint at bioRxiv.</event-desc><date date-type="preprint" iso-8601-date="2019-11-16"><day>16</day><month>11</month><year>2019</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/845230"/></event></pub-history><permissions><copyright-statement>© 2023, Ibrahim, Wamsley et al</copyright-statement><copyright-year>2023</copyright-year><copyright-holder>Ibrahim, Wamsley et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-86842-v2.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-86842-figures-v2.pdf"/><abstract><p>Somatostatin interneurons are the earliest born population of cortical inhibitory cells. They are crucial to support normal brain development and function; however, the mechanisms underlying their integration into nascent cortical circuitry are not well understood. In this study, we begin by demonstrating that the maturation of somatostatin interneurons in mouse somatosensory cortex is activity dependent. We then investigated the relationship between activity, alternative splicing, and synapse formation within this population. Specifically, we discovered that the Nova family of RNA-binding proteins are activity-dependent and are essential for the maturation of somatostatin interneurons, as well as their afferent and efferent connectivity. Within this population, Nova2 preferentially mediates the alternative splicing of genes required for axonal formation and synaptic function independently from its effect on gene expression. Hence, our work demonstrates that the Nova family of proteins through alternative splicing are centrally involved in coupling developmental neuronal activity to cortical circuit formation.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>alternative splicing</kwd><kwd>neurodevelopment</kwd><kwd>Activity</kwd><kwd>connectivity</kwd><kwd>synapse</kwd><kwd>Nova2</kwd><kwd>Nova1</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Mouse</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100004052</institution-id><institution>King Abdullah University of Science and Technology</institution></institution-wrap></funding-source><award-id>BRF</award-id><principal-award-recipient><name><surname>Ibrahim</surname><given-names>Leena Ali</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01 NS081297</award-id><principal-award-recipient><name><surname>Fishell</surname><given-names>Gordon</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01 MH071679</award-id><principal-award-recipient><name><surname>Fishell</surname><given-names>Gordon</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>UG3 MH120096</award-id><principal-award-recipient><name><surname>Fishell</surname><given-names>Gordon</given-names></name></principal-award-recipient></award-group><award-group id="fund5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>P01 NS074972</award-id><principal-award-recipient><name><surname>Fishell</surname><given-names>Gordon</given-names></name></principal-award-recipient></award-group><award-group id="fund6"><funding-source><institution-wrap><institution>Simons Foundation SFARI</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Fishell</surname><given-names>Gordon</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>RNA sequencing and conditional <italic>Nova</italic> mutants reveal that Nova protein function is necessary for activity-dependent alternative splicing of synaptic genes within somatostatin cortical interneurons and regulates its afferent and efferent connectivity.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Somatostatin cortical interneurons (SST cINs) constitute ~30% of all inhibitory interneurons in the cerebral cortex. They are crucial for gating the flow of the sensory, motor, and executive information necessary for the proper function of the mature cortex (<xref ref-type="bibr" rid="bib15">Fishell and Rudy, 2011</xref>; <xref ref-type="bibr" rid="bib29">Kepecs and Fishell, 2014</xref>; <xref ref-type="bibr" rid="bib56">Tremblay et al., 2016</xref>). In particular, Martinotti SST cINs, the most prevalent SST cIN subtype, are present in both the infragranular and supragranular layers of the cortex and extend their axons into Layer 1 (L1; <xref ref-type="bibr" rid="bib50">Rudy et al., 2011</xref>; <xref ref-type="bibr" rid="bib36">Lim et al., 2018</xref>; <xref ref-type="bibr" rid="bib4">Ascoli et al., 2008</xref>; <xref ref-type="bibr" rid="bib42">Nigro et al., 2018</xref>; <xref ref-type="bibr" rid="bib44">Pouchelon et al., 2021</xref>). They specifically target the distal dendrites of neighboring excitatory neurons, thus providing the feedback inhibition necessary for modulating dendritic integration (<xref ref-type="bibr" rid="bib1">Adler et al., 2019</xref>; <xref ref-type="bibr" rid="bib27">Kapfer et al., 2007</xref>; <xref ref-type="bibr" rid="bib53">Silberberg and Markram, 2007</xref>). These roles are dependent upon the ability of SST cINs to form specific synaptic connections with select excitatory and inhibitory cell types during development (<xref ref-type="bibr" rid="bib14">Favuzzi et al., 2019</xref>).</p><p>The mechanisms responsible for generating the precise functional connectivity of SST cINs are poorly understood. Early neuronal activity has emerged as an important factor in directing the maturation of cINs (<xref ref-type="bibr" rid="bib61">Wamsley and Fishell, 2017</xref>). In addition, recent work has implicated activity as being centrally involved in alternative splicing (<xref ref-type="bibr" rid="bib13">Eom et al., 2013</xref>; <xref ref-type="bibr" rid="bib17">Furlanis and Scheiffele, 2018</xref>; <xref ref-type="bibr" rid="bib25">Iijima et al., 2011</xref>; <xref ref-type="bibr" rid="bib32">Lee et al., 2007</xref>; <xref ref-type="bibr" rid="bib33">Lee et al., 2009</xref>; <xref ref-type="bibr" rid="bib40">Mauger et al., 2016</xref>; <xref ref-type="bibr" rid="bib46">Quesnel-Vallières et al., 2016</xref>; <xref ref-type="bibr" rid="bib59">Vuong et al., 2016</xref>; <xref ref-type="bibr" rid="bib60">Vuong et al., 2018</xref>; <xref ref-type="bibr" rid="bib65">Xie and Black, 2001</xref>). However, whether these processes are coupled within SST cINs has not been explored.</p><p>The Nova family of RNA-binding proteins (Nova1 and Nova2) have been shown to control the splicing and stability of transcripts encoding a variety of neurotransmitter receptors, ion channels, and transmembrane cell adhesion molecules known to affect synaptogenesis and excitability (<xref ref-type="bibr" rid="bib12">Dredge and Darnell, 2003</xref>; <xref ref-type="bibr" rid="bib13">Eom et al., 2013</xref>; <xref ref-type="bibr" rid="bib51">Saito et al., 2016</xref>; <xref ref-type="bibr" rid="bib52">Saito et al., 2019</xref>; <xref ref-type="bibr" rid="bib57">Ule et al., 2005</xref>; <xref ref-type="bibr" rid="bib58">Ule et al., 2006</xref>; <xref ref-type="bibr" rid="bib69">Yano et al., 2010</xref>). Notably both Nova1 and Nova2 are strongly expressed within cINs during periods of synaptogenesis and as such represent promising effectors that may direct the maturation of SST cINs.</p><p>Here, we report that neuronal activity strongly influences efferent SST cIN connectivity. We show that the conditional loss of <italic>Nova1</italic> or <italic>Nova2</italic> phenocopies the effect of dampening activity during circuit assembly, leading to a loss of their efferent inhibitory output. At a molecular level these changes are mediated by a Nova-dependent program, which controls gene expression and alternative splicing of mRNAs encoding for pre- and post-synaptic proteins. Demonstrating a direct link between activity, Nova function, and inhibitory output, increasing activity using NachBac in Nova2 knockouts fails to enhance SST inhibitory output. Conversely, overexpression of <italic>Nova2</italic> within SST cINs marginally increases SST inhibitory output, a phenotype that can be suppressed by damping neuronal activity within these cells. Thus, our work indicates that early activity through a Nova-dependent mechanism is required for the proper establishment of SST cIN connectivity and maturation.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Neuronal activity affects the synaptic development of SST cINs</title><p>The cortex exhibits a variety of dynamic network activity patterns during cortical synaptogenesis (<xref ref-type="bibr" rid="bib3">Allene and Cossart, 2010</xref>; <xref ref-type="bibr" rid="bib19">Garaschuk et al., 2000</xref>; <xref ref-type="bibr" rid="bib66">Yang et al., 2009</xref>). These are comprised by both spontaneous and sensory evoked events (<xref ref-type="bibr" rid="bib19">Garaschuk et al., 2000</xref>; <xref ref-type="bibr" rid="bib41">Minlebaev et al., 2011</xref>; <xref ref-type="bibr" rid="bib67">Yang et al., 2013</xref>; <xref ref-type="bibr" rid="bib44">Pouchelon et al., 2021</xref>; <xref ref-type="bibr" rid="bib24">Ibrahim et al., 2021</xref>). While inhibitory cortical interneurons (cINs) are recruited by these activities (<xref ref-type="bibr" rid="bib8">Cossart, 2011</xref>; <xref ref-type="bibr" rid="bib31">Le Magueresse and Monyer, 2013</xref>), whether this influences somatostatin (SST) cIN development has not been fully established. To address the impact of activity on these cINs, we chose to selectively and cell-autonomously dampen or augment their excitability during the first few weeks of development. This represents a perinatal period in cIN development during nascent circuit formation, where they are robustly forming or losing synaptic contacts (<xref ref-type="bibr" rid="bib2">Allène et al., 2008</xref>; <xref ref-type="bibr" rid="bib41">Minlebaev et al., 2011</xref>; <xref ref-type="bibr" rid="bib67">Yang et al., 2013</xref>; <xref ref-type="bibr" rid="bib66">Yang et al., 2009</xref>). SST cINs in the primary somatosensory cortex (S1) were targeted using AAV viral injections in <italic>Sst<sup>Cre</sup></italic> mice crossed with a conditional synaptophysin1-eGFP (Syp-eGFP) mouse, which functions as a presynaptic reporter (<italic>Rosa26<sup>LSL-tTa</sup></italic>;Tg-TRE::Syp-eGFP, <xref ref-type="fig" rid="fig1">Figure 1A</xref>; <xref ref-type="bibr" rid="bib5">Basaldella et al., 2015</xref>; <xref ref-type="bibr" rid="bib34">Li et al., 2010</xref>; <xref ref-type="bibr" rid="bib62">Wamsley et al., 2018</xref>). To modulate the activity of SST cINs, these mice were injected at P0 with Cre-dependent AAVs that drive the expression of either KIR2.1 (AAV-Syn-DIO-KIR2.1-P2A-mCherry) or NaChBac (AAV-Syn-DIO-NaChBac-P2A-mCherry) channels coupled to mCherry reporter (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Both channels are voltage-sensitive and have proven to be useful tools to manipulate cellular excitability. The KIR2.1 channel is an inward rectifying potassium channel, which upon overexpression lowers the resting membrane potential towards the reversal potential of K<sup>+</sup> (~90 mV) (<xref ref-type="bibr" rid="bib7">Bortone and Polleux, 2009</xref>; <xref ref-type="bibr" rid="bib9">De Marco García et al., 2011</xref>; <xref ref-type="bibr" rid="bib28">Karayannis et al., 2012</xref>; <xref ref-type="bibr" rid="bib45">Priya et al., 2018</xref>; <xref ref-type="bibr" rid="bib70">Yu et al., 2004</xref>), thus reducing neuronal excitability. The NaChBac channel has an activation threshold that is 15 mV more negative than endogenous voltage-gated Na<sup>+</sup> channels and remains open for 10 times longer (<xref ref-type="bibr" rid="bib37">Lin et al., 2010</xref>) and therefore augments excitability.</p><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Neuronal activity affects the synaptic development of SST cINs.</title><p>(<bold>A</bold>) Schematic ( (<bold>A</bold>) has been adapted from the Research Article Summary Schematic from <xref ref-type="bibr" rid="bib6">Bernard et al., 2022</xref>) of genetic alleles (left) and experimental approach (middle), <italic>Sst<sup>Cre</sup>;Syp-eGFP</italic> pups were injected with a conditional virus; either <italic>AAV2/1-Flex-Kir2.1-P2A-mCherry, AAV2/1-Flex-NaChBac-P2A-mCherry,</italic> or Control <italic>AAV2/1-Flex-mCherry</italic> within the S1 cortex at postnatal day 0 (<bold>P0</bold>). Schematic of the efferent connectivity of SST +Martinotti cells (right). (<bold>B</bold>) Upper panels: Immunostaining (IHC) of <italic>Sst<sup>Cre</sup>;Syp-eGFP</italic> in layer 1 (<bold>L1</bold>) of S1 cortex at P21 showing Syp-eGFP (green, anti-GFP) and axons (red, anti-RFP) from <italic>control, Kir2.1, or NaChBac</italic> injected SST +Marintonotti cINs (scale bar 50 um). Lower panels: visualization of Syp-eGFP (green, anti-GFP) and Gephyrin +puncta (blue, anti-Gephyrin) in L1 SST +cINs (scale bar 20 um). Inset shows a higher magnification image of the puncta overap (Red, mCherry axons). (<bold>C</bold>) Quantification of synaptic puncta (RFP+/GFP+/Gephyrin +overlap) of control, Kir2.1, and NaChBac expressing SST +cINs within L1 (n=3–4 mice each, 9 sections each; pVal**=0.008, ***=0.0001). (<bold>D</bold>) Left, schematic of optogenetic activation of SST neurons using <italic>SST<sup>Cre</sup></italic>::Ai32 mice injected with either <italic>AAV2/1-Flex-Kir2.1-P2A-mCherry, AAV2/1-Flex-NaChBac-P2A-mCherry,</italic> or Control <italic>AAV2/1-Flex-mCherry</italic> within the S1 cortex at postnatal day 0 (<bold>P0</bold>) and recording from Pyramidal neurons (clamped at 0 mV) in Layer 5 of Primary Somatosensory cortex (<bold>S1</bold>) at P21. (<bold>E</bold>) Quantification of SST output onto Pyramidal neurons, Peak amplitude of the Inhibitory post synaptic current (IPSC) (Control Peak Amplitude: 663.47±18.7 pA, Kir2.1: 185±19.78 pA, NachBac: 927.7±28.5 pA).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig1-v2.tif"/></fig><p>To assess the development of the synaptic efferents of infected SST cINs, we allowed pups to mature until juvenile age. The somatosensory cortex was then subjected to immunohistochemistry (IHC) to visualize pre-synaptic (SST + cIN-mCherry+-Syp-eGFP+) compartments and post synaptic components and subjected to puncta analysis (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). We quantified SST efferent synapses identified through the colocalization of the virally mediated mCherry reporter, Syp-eGFP and the postsynaptic marker gephyrin (mCherry+/GFP+/gephyrin +puncta), as a proxy for synaptic contacts (<xref ref-type="bibr" rid="bib26">Ippolito and Eroglu, 2010</xref>). In SST cINs, KIR2.1 expression resulted in a significant reduction of L1 SST cIN efferent synaptic puncta in comparison to control cells (0.109±0.009 puncta/µm<sup>2</sup> CTL vs 0.049±0.006 puncta/um<sup>2</sup> KIR2.1; <xref ref-type="fig" rid="fig1">Figure 1C</xref>). By contrast, the overexpression of NaChBac within SST cINs resulted in a robust increase in L1 synaptic puncta (0.109±0.009 puncta/um<sup>2</sup> ctl vs 0.218±0.030 puncta/um<sup>2</sup> NaChBac; <xref ref-type="fig" rid="fig1">Figure 1C</xref>). Additionally, when we optogenetically activated SST neurons using a conditional channelrhodopsin mouse line <italic>Rosa26<sup>LSL-hChR2</sup></italic> (Ai32) and recorded from pyramidal cells (<xref ref-type="fig" rid="fig1">Figure 1D</xref>), the inhibitory output was also affected. Kir2.1 expression resulted in a significant reduction in the output of SST + cINs onto pyramidal cells compared to controls (680±14 pA ctl vs 266.5±21 pA Kir2.1, <xref ref-type="fig" rid="fig1">Figure 1E</xref>). By contrast, the overexpression of NachBac resulted in an increase in the inhibitory output of these cells (680±14 pA ctl vs 989.33±28 pA, <xref ref-type="fig" rid="fig1">Figure 1E</xref>). These results suggest that activity has a profound effect on the density of SST cIN axons, synapses and inhibitory output. Dampening excitability decreases the number of efferent synaptic structures and axonal arbors of SST cINs, while augmenting it increases both.</p></sec><sec id="s2-2"><title>Neuronal activity influences alternative splicing and Nova expression within SST cINs</title><p>A growing number of studies indicate that activity-dependent alterative splicing (AS) contributes to the regulation of gene expression and the fine-tuning of transcriptional programs related to synaptic refinement (<xref ref-type="bibr" rid="bib13">Eom et al., 2013</xref>; <xref ref-type="bibr" rid="bib25">Iijima et al., 2011</xref>; <xref ref-type="bibr" rid="bib16">Fuccillo et al., 2015</xref>, <xref ref-type="bibr" rid="bib40">Mauger et al., 2016</xref>; <xref ref-type="bibr" rid="bib46">Quesnel-Vallières et al., 2016</xref>; <xref ref-type="bibr" rid="bib59">Vuong et al., 2016</xref>). This prompted us to test whether neuronal activity itself changes the level of AS within SST cINs during circuit formation, independent of the changes in gene expression. To do so, we used electro-convulsive shock (ECS) during peak synaptogenesis (P8) in mice with genetically labeled SST cINs (<italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9)). The ECS method generates an acute and reproducible increase in neuronal activity in vivo (<xref ref-type="bibr" rid="bib21">Guo et al., 2011</xref>; <xref ref-type="bibr" rid="bib39">Ma et al., 2009</xref>), resulting in increased expression of immediate early genes (IEG) such as <italic>Fos</italic>, <italic>Egr1</italic>, <italic>Npas4,</italic> and <italic>Arc</italic> (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A–F</xref>), analogous to that observed with KCl treatment in vitro but with the added advantages of being in vivo and transient. Two to 3 hr following ECS, we isolated SST cINs from the S1 cortex of <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9) animals using fluorescence-activated cell sorting (FACS; <xref ref-type="fig" rid="fig2">Figure 2A</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A</xref>). Sorted SST cINs were used to prepare cDNA libraries that were subsequently sequenced in order to investigate changes in AS (spliced exon: SE, mutually exclusive exons: MXE, retained intron: RI, alternative 5’ splice site: A5, alternative 3’ splice site: A3; <xref ref-type="fig" rid="fig2">Figure 2A</xref> right). We found 312 transcripts differentially spliced between sham/control and ECS (FDR &lt;0.05, |∆ψ|≥0.1 threshold), comprised by 139 SE events (57 excluded and 82 included exons), 66 RI events (13 excluded introns and 53 included), 31 MXE events (29 excluded and 26 included exons), 13 A5 events (1 excluded and 12 included exons), and 39 A3 (23 excluded and 16 included exons) (<xref ref-type="fig" rid="fig2">Figure 2B</xref>).</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Neuronal activity influences alternative splicing and Nova expression within SST cINs.</title><p>(<bold>A</bold>) Schematic of experimental approach: Postnatal day 8 (<bold>P8</bold>) <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9) pups were subjected to electroconvulsive shock (ECS) (left). Following 2–3 hours the S1 cortex was isolated and SST + cINs were FACS purified (middle). SST + cINs were then prepared for RNAseq to assess changes in gene expression and alternative splicing. Splicing changes are divided into the major alternative structural motifs: single exon, SE, retained intron, RI, mutually exclusive exons, MXE, alternative 5’ splice site, A5, alternative 3’ splice site, A3 (right). (<bold>B</bold>) Histogram of the magnitude of activity-dependent splicing changes within SST + cINs subjected to ECS compared to sham SST + cINs (FDR &lt;0.5, fold &lt;0.1&gt; ), depicting 139 differential spliced SE (82 SE included, 57 SE excluded), 66 differential spliced RI (53 RI included, 13 RI excluded), 55 differential spliced MXE (26 included, 29 excluded), 13 differential spliced A5 (12 included, 1 excluded), 39 differential spliced A3 (16 included, 23 excluded). (<bold>C</bold>) Gene Ontology (GO) analysis of differentially alternatively spliced (AS) genes (Orange color) under synaptic categories. (<bold>D</bold>) Gene Ontology (GO) analysis of differentially expressed genes (GE) (Teal color) under synaptic categories. (<bold>E</bold>) Overlap of all differentially expressed (teal) and differentially spliced (orange) genes under ECS vs control conditions. Below: overlap for synaptic gene only. (<bold>F</bold>) Comparison of activity level of the overlapped synaptic genes (genes that have both AS and GE changes). Activity level is calculated by considering both FC and pvalue. (<bold>G</bold>) Sashimi plot illustrating <italic>Nxrn1</italic> exon 10 exclusion in activity-induced SST cINs in green (bottom) compared to sham SST cINs in grey (top). Reads per kilobase of transcripts (RPKM) gives the count of the number of transcripts for a specfic isoform. (<bold>H</bold>) Histogram of the average motif enrichment score of known activity-regulated splicing factors KHDRBS1 (Sam68), KHDRBS2 (SLM2), Rbfox1 and Nova1/2 (right). Green dots represent -log10 adjusted p value (right Y-axis) for motif enrichment scores, only significant enrichment shown.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig2-v2.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Acute increases in neuronal activity induces immediate early gene expression and differential splicing within SST + cINs in vivo.</title><p>(<bold>A</bold>) Schematic of experimental approach: P8 tgLhx6eGFP animals were subjected to ECS (left)’ then following a time course of 1 Hr, 3 hr, or 7 hr the S1 cortex was dissected (middle) and GFP +cINs were isolated by FACS for qPCR, Western blot, and RNAseq analysis and IHC (right). (<bold>B</bold>) Quantification of relative mRNA expression (RQ) of cFOS (normalized to housekeeping gene PPIA) in ctl/sham animals (black), 1 hr (yellow), 3 hr (orange), and 7 hr (red) following ECS within cINs. (<bold>C</bold>) Immunostaining of cFOS in sham (red) and eGFP vs ECS-treated animals, showing the expression of cFOS 1.5 hr post ECS activity induction. (<bold>D</bold>) Representative western blot of ARC protein expression within sham treated (two replicates), 1 hr (two replicates), 3 hr (two replicates), and 7 hr (two replicates) following ECS within cINs (Source Data not available due to loss of data file during lab move). (<bold>E</bold>) Fold of ARC protein expression (normalized to b-actin) in ctl/sham treated (black), 1 hr (yellow), 3 hr (orange), and 7 hr (red) following ECS within cINs. (<bold>F</bold>) Magnitude of differential alternative splicing events from the comparison of sham cINs to cINs 1 hr (yellow, 268 events), 3 hr (orange, 349 events), and 7 hr (red, 241 events) following ECS.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig2-figsupp1-v2.tif"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 2.</label><caption><title>Neuronal activity influences alternative splicing and Nova expression within SST cINs.</title><p>(<bold>A</bold>) Normalized counts of SST, Prox1, Emx1 and Vip gene expression from the RNA sequencing analysis from control tissue indicating the purity of our sample preparation to be specific for SST + cINs. (<bold>B</bold>) Bubble dot plot of gene ontology (GO) most significant terms for the genes subjected to activity-dependent alternative splicing within SST + cINs (false discovery rate (FDR)&lt;0.05), x-axis is the enrichment of the activity-dependent AS genes in the GO category (# of genes in GO category from SST transcriptome/ # of genes activity-dependent AS in category). Color of dot indicates magnitude of significance (-log10 transform FDR, none shown above FDR &lt;0.05) and size corresponds to number of genes in category. (<bold>C</bold>) Protein-protein interaction (PPI) network formed from 312 activity-dependent spliced genes in SST cINs with Disease Association Protein-Protein Link Evaluator (DAPPLE; <xref ref-type="bibr" rid="bib49">Rossin et al., 2011</xref>) and performed over 10,000 permutations (pVal &lt;0.00009). Green shading- post-synaptic gene network, pink shading- pre-synaptic gene network.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig2-figsupp2-v2.tif"/></fig></fig-group><p>Utilizing the SST cIN transcriptome as a reference, we performed gene ontology (GO) analysis to ask if the genes subject to alternative splicing (AS) were enriched for specific functional categories within these neurons. GO analysis of the genes that underwent activity dependent AS belong to specific ontological categories, such as synapse maturation, synaptic transmission, and axonal growth (<xref ref-type="fig" rid="fig2">Figure 2C</xref> and <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2B</xref>). In addition, and as expected we also observed activity-dependent changes in gene expression (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). However, the overlap between the genes subjected to AS vs GE was only ~1.2% of all differentially expressed genes (<xref ref-type="fig" rid="fig1">Figure 1E</xref>). When we compared the overlapped genes (those that underwent both GE and AS changes), we observed that for many synaptic genes, the level of AS changes was higher than the changes of the same genes at the transcript level (<xref ref-type="fig" rid="fig1">Figure 1F</xref>). This suggests that the changes observed in synaptic genes for AS are independent of their changes in transcription level. For example, we observed and validated (<xref ref-type="supplementary-material" rid="supp2">Supplementary file 2b</xref>) that within activity-stimulated SST cINs the <italic>Nrxn1</italic> mRNAs exclude exon 10. Notably, this exon lies within a laminin-protein coding domain important for the cell adhesion properties of Nrxn1 at the synapse (<xref ref-type="fig" rid="fig2">Figure 2G</xref>, control, grey vs ECS, green). In contrast, while we also observed GE changes in Nrxn1, the level of AS change was higher.</p><p>We next asked whether the activity-dependent AS genes formed a protein-protein interacting network (PPI) based on previously established direct protein interactions in vivo (<xref ref-type="bibr" rid="bib49">Rossin et al., 2011</xref>). Notably, the genes subjected to activity-dependent AS within SST cINs form highly connected networks illustrating they likely function together to support pre-synaptic vesicle function (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C</xref>, pink), post-synaptic organization and receptor-associated synaptic components (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C</xref>, blue; pVal &lt;0.0009, 1000 permutations). These genes among others include: <italic>Hspa8, Nrxn1, Syngap1, Cacna1c, Ppp3ca,</italic> and <italic>Grin1</italic> (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C</xref>). These results indicate that augmenting activity within SST cINs during nascent circuit development robustly increases AS events and most of the spliced mRNAs are genes specifically related to axonal development and synaptic transmission (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C</xref>, pink and blue, respectively).</p><p>We next sought to identify RNA-binding proteins (RNABPs) that could mediate activity-dependent AS events within SST cINs. To do so, we utilized the RNAseq experiments described above (control vs. ECS) to perform a motif enrichment analysis that utilizes position probability matrices of binding motifs from 102 RNABPs (e.g. PTBP1/2, FUS, ELAVL4, SRRM4, Rbfox1, FMR1, Nova1, Nova2) (<xref ref-type="bibr" rid="bib38">Liu et al., 2017</xref>; <xref ref-type="bibr" rid="bib43">Park et al., 2016</xref>; <xref ref-type="bibr" rid="bib68">Yang et al., 2016</xref>). Previous HITS-CLIP analysis has revealed that Nova1 and Nova2 share an almost identical RNA-binding domain (YCAY) (<xref ref-type="bibr" rid="bib35">Licatalosi et al., 2008</xref>; <xref ref-type="bibr" rid="bib58">Ule et al., 2006</xref>; <xref ref-type="bibr" rid="bib71">Yuan et al., 2018</xref>). Strikingly, the Nova-binding motif was found to be significantly enriched within activity-dependent targets and at a higher frequency than other neuronal splice factors (e.g. Sam68 (KHDRBS1), SLM2 (KHDRBS2), and Rbfox1) (pVal &lt;0.0001; <xref ref-type="fig" rid="fig2">Figure 2H</xref>). This finding implicates Nova proteins as playing a fundamental role in directing SST cIN activity-dependent AS.</p></sec><sec id="s2-3"><title>Neuronal activity during cortical development influences the expression and localization of Nova proteins in SST cINs</title><p>We next examined the expression of Nova1 and Nova2 within SST cINs across development and whether their expression is affected by changes in neuronal activity. Utilizing IHC and genetic fate mapping, we observed that the expression of the Nova family (Nova1 and Nova2) proteins begins within cIN populations soon after they become postmitotic and expressed in 100% of SST and PV cINs by adulthood (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A–B</xref>). For comparison, we also examined Nova expression in 5HT3aR cINs (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1B</xref>) within this same region. To specifically examine the expression of Nova1 and Nova2 during SST cIN synaptogenesis, we performed quantitative-PCR (qPCR) on FACS isolated cINs from the S1 cortex of Tg-Lhx6::eGFP mice at P2, P8, and P15. The Tg-Lhx6::eGFP mice express eGFP in both SST and Parvalbumin (PV) cINs (medial ganglionic eminence derived cINs) soon after they become postmitotic. We found that both <italic>Nova1</italic> and <italic>Nova2</italic> are expressed within all SST and PV cINs across the first two weeks of postnatal development, coinciding with nascent circuit development (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1C</xref>). Taken together, we find that both Nova1 and Nova2 proteins are highly expressed in all SST cINs during circuit integration and may therefore control integral aspects of their development through activity-dependent alternative splicing.</p><p>We next investigated whether Nova1 and Nova2 are activity-regulated within SST cINs by examining both their expression and localization during the peak of nascent circuit integration. To do so, we subjected <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9) mice to ECS during synaptogenesis, similar to what was done in <xref ref-type="fig" rid="fig2">Figure 2</xref>. Next, we performed both RNA Sequencing and qPCR for <italic>Nova1</italic> and <italic>Nova2</italic> within FAC sorted cINs from S1 cortex of either control or ECS-treated animals. Following 2 hr post seizure-induction (2 HRPS), we found that the mRNA expression levels of both <italic>Nova1</italic> and <italic>Nova2</italic> were increased in ECS-treated SST cINs compared to controls (<italic>Nova1:</italic> 28.4±5.59 ECS vs 7.61±0.25 control; <italic>Nova2</italic> pVal = 0.002: 10.32±1.80 ECS vs 6.59±0.28 control pVal = 0.005, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1E</xref> and <xref ref-type="fig" rid="fig3">Figure 3A</xref>). Next, we probed Nova1 and Nova2 protein levels using western blot (WB) of sorted SST cINs from S1 cortex. Consistent with an activity-mediated upregulation in Nova expression, we found a significant increase in both Nova1 and Nova2 protein levels (0.824±0.0412 pixel density (pd) Nova1 control vs 5.62±0.969 pd Nova1 2HRPS, pVal = 0.038 and 0.997±0.409 pd Nova2 control vs 5.7±0.582 pixel density Nova2 2HRPS, pVal = 0.022, pixel densities normalized to <italic>ß-</italic>Actin; <xref ref-type="fig" rid="fig3">Figure 3B</xref>). Thus, these results confirm an increase in Nova mRNA and Nova protein expression in SST cINs following an acute increase in neuronal activity.</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Neuronal activity during cortical development influences the expression and localization of Nova proteins in SST cINs.</title><p>(<bold>A</bold>) Volcano plot of RNA seq data showing Nova1 and Nova2 upregulation in SST-cINs in ECS vs control. (<bold>B</bold>) Upper panel, western blot showing Nova1 and Nova2 protein expression in control (lanes 2 and 3) versus ECS induced SST cINs (lanes 4 and 5). Lower panel, same western blot showing expression of b-actin across lanes. Right, Quantification of the western blot data. Nova1 and Nova2 protein expression relative to β-actin in control versus ECS induced SST cINs (n=3 mice, S1 cortex only; *pVal = 0.038, Nova1; *pVal = 0.022, Nova2; Source Data not available due to loss of data file during lab move). (<bold>C</bold>) Representative scoring criteria for Nova1/2 localization within SST cINs: IHC of Nova1/2 (blue, anti-Nova1/2) in selective SST + cINS exemplifying the Nova1/2 expression in: cytoplasm only (top), nucleus only (middle) and in both cytoplasm and nucleus (bottom). (<bold>D</bold>) Left, representative images of Nova1/2 expression (blue) in SST cINs (red) under normal versus ECS. Right, Quantification of the ratio of nuclear to cytoplasmic localization of Nova1/2 in SST + cINs of control animals (grey) and ECS animals (green) (n=3 mice, S1 cortex; **pVal = 0.001). (<bold>E</bold>) Left, representative images of Nova1/2 expression (blue) in SST cINs (red) using control mCherry versus Kir2.1-mCherry virus injection. Right, Quantification of the ratio of nuclear to cytoplasmic localization of Nova1/2 in SST + cINs of control AAV2/1-Syn-DIO-mCherry (grey) versus AAV2/1-Syn-DIO-NaChBac-P2A-mCherry (pink) versus AAV2/1-Syn-DIO-Kir2.1- P2A-mCherry (blue) injected animals. (n=11 mice, S1 cortex,~30 cells each; ***pVal = 0.0004, NachBac; ***pVal = 0.0001, KIR2.1).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig3-v2.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Nova 1 and 2 alternative splicing factors expression within cortical interneurons (cINs).</title><p>(<bold>A</bold>) Representative IHC image of brain section at P21 from Dlx6aCre;RCEeGFP, Lhx6::eGFP and 5HT3aR::eGFP. Anti-Nova1/2 (red); GFP (green). (<bold>B</bold>) Quantification of eGFP cells expressing Nova1/2. 100% of Lhx6::eGFP cells express Nova1/2. (<bold>C</bold>) Relative gene expression of Nova1 (orange) and Nova2 (pink), normalized to house-keeping gene Peptidyl prolyl isomerase A (PPIA) using qPCR from Lhx6-eGFP sorted cINs at Postnatal age (<bold>P</bold>) P2, P8, and P15 (n=4 mice each, S1 cortex only). (<bold>D</bold>) Fold change of the relative expression of Nova1 and Nova2 between cINs and excitatory neurons (cExt) showing an enrichment of Nova expression in cINs at early developmental ages (n=4 mice each, S1 cortex only). (<bold>E</bold>) Relative expression of Nova1 and Nova2 genes (using qPCR) of ECS induced SST cINs relative to controls (n=4–6 mice, S1 cortex only; **pVal = 0.002, Nova1; **pVal = 0.005, Nova2). (<bold>F</bold>) Quantification of the number of Nova1/2-expressing SST +cINs of control AAV2/1-Flex-mCherry (grey) and AAV2/1-Flex-Kir2.1- P2A-mCherry (blue) injected animals. (n=7, S1 cortex,~27 cells each; ***pVal = 0.0001). (<bold>G</bold>) Representative images of Nova1/2 expression, Left: control SST cIN (injected with mCherry), Right: KIR2.1+SSt cIN at P21. Right, Quantification of Nova1/2 protein pixel intensity (normalized to area) from ctl SST cINs (grey) and KIR2.1+SST cINs (blue) (n=10; **pVal = 0.006).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig3-figsupp1-v2.tif"/></fig></fig-group><p>Following seizure activity Nova proteins have been shown to translocate into the nucleus within excitatory neurons (<xref ref-type="bibr" rid="bib13">Eom et al., 2013</xref>). We next sought to explore whether manipulating activity also influences intracellular localization of Nova proteins within SST cINs (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). We hypothesized that an activity-mediated increase would direct Nova proteins to the nucleus. We therefore analyzed the ratio of Nova expression within the nucleus versus the cytoplasm of SST cINs following ECS (<xref ref-type="fig" rid="fig3">Figure 3D</xref>) or after constitutive activity-modulation across the first postnatal month (DIO: AAV injections of KIR2.1 or NaChBac into <italic>Sst<sup>cre</sup></italic> animals at P0; <xref ref-type="fig" rid="fig3">Figure 3E</xref>). First, we examined Nova localization using IHC 2 HRPS following ECS within the S1 cortex of P8 <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9) mice (<xref ref-type="fig" rid="fig3">Figure 3C–D</xref>). We quantified the proportions of SST cINs that express Nova proteins most prominently within the nucleus versus the cytoplasm by taking multi-Z-stack images of SST cINs and utilizing DAPI to demark the nuclear boundary. We found that Nova localization was observed in three basic patterns in SST cINs: restricted to the cytoplasm, nuclear restricted, or a combination of both nuclear and cytoplasmic expression (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). At P8, in the majority of SST cINs, Nova is either restricted to the cytoplasm or expressed in both the nucleus and cytoplasm (<xref ref-type="fig" rid="fig3">Figure 3D</xref>). Following an acute increase in activity (ECS), we found a significant increase in the ratio of nuclear to cytoplasmic Nova protein within SST cINs (0.948±0.055 ratio in control versus 3.65±0.465 ratio in ECS, pVal = 0.001, <xref ref-type="fig" rid="fig3">Figure 3D</xref> right). Next, by utilizing the same analytical approach, we examined Nova protein localization in S1 of P21 mice that express either KIR2.1 or NaChBac along with a mCherry reporter (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). We found a substantial increase in the ratio of SST cINs that localized Nova protein in the nucleus compared to the cytoplasm in NaChBac-expressing expressing SST cINs compared to control cells (4.75±0.678 ratio control vs 40.91±8.41 ratio NaChBac, pVal = 0.0004; <xref ref-type="fig" rid="fig3">Figure 3E</xref> right). In contrast, we found a significant decrease in the ratio of nuclear to cytoplasmic Nova protein expression within SST cINs injected with KIR2.1 (4.75±0.678 ratio control vs 0.265±0.104 ratio KIR2.1, pVal=&lt;0.0001; <xref ref-type="fig" rid="fig3">Figure 3E</xref> right). Most strikingly, we also observed more than half of SST cINs subjected to KIR2.1 either do not express Nova or have substantially reduced levels of Nova protein expression (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1F–G</xref>), suggesting that normal levels of activity are needed for maintaining Nova protein expression in the cell. Altogether these data indicate that during synaptogenesis Nova protein expression and localization within SST cINs is strongly modulated by acute or persistent changes in activity.</p></sec><sec id="s2-4"><title>Nova1 and Nova2 control distinct AS networks within SST cINs</title><p>To address whether Nova1 and Nova2 differentially affect connectivity and maturation<bold>,</bold> we asked what AS networks they control within SST cINs during development. Given that they share a very similar RNA-binding motif and are found associated with one another in vivo, they were thought to function cooperatively (<xref ref-type="bibr" rid="bib35">Licatalosi et al., 2008</xref>; <xref ref-type="bibr" rid="bib48">Racca et al., 2010</xref>; <xref ref-type="bibr" rid="bib71">Yuan et al., 2018</xref>). However recently, it has been shown that in addition to their synergistic roles, Nova1 and Nova2 proteins each control distinct AS gene networks (<xref ref-type="bibr" rid="bib52">Saito et al., 2019</xref>; <xref ref-type="bibr" rid="bib51">Saito et al., 2016</xref>). We thus chose to examine changes in AS within SST cINs in Nova1, Nova2 or Nova1/2 compound conditional knockout (cKO) mice (<xref ref-type="bibr" rid="bib52">Saito et al., 2019</xref>; <xref ref-type="bibr" rid="bib71">Yuan et al., 2018</xref>). Using FAC sorting, we isolated SST cINs from <italic>Sst<sup>Cre</sup>;Nova1<sup>F/F</sup></italic> or <italic>Sst<sup>Cre</sup>;;Nova2<sup>F/F</sup></italic> or <italic>Sst<sup>Cre</sup>;Nova1<sup>F/F</sup>; Nova2<sup>F/F</sup></italic> double knockout (dKO) mice on an Ai9 reporter background (referred to henceforth at <italic>Sst-Nova1-</italic>cKO, <italic>Sst-Nova2-</italic>cKO and <italic>Sst-Nova1/2-</italic>dKO<italic>,</italic> respectively) at P8 (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). We prepared cDNA libraries from FAC sorted SST cINs, performed RNA sequencing and assessed AS changes between control SST cINs versus each of these mutant alleles. Compared to wild type controls, <italic>Nova1</italic> loss resulted in 124 altered AS events (81 excluded and 43 included), <italic>Nova2</italic> loss led to 339 altered AS events (217 excluded and 122 included) and <italic>Nova1/2</italic>-dKO exhibited 270 altered AS events (162 excluded and 108 included) (FDR &lt;0.05; <xref ref-type="fig" rid="fig4">Figure 4B</xref>). Notably, within SST cINs, the loss of <italic>Nova2</italic> results in the largest number of changes in mRNA splicing events compared to compound loss of either <italic>Nova1</italic> or both <italic>Nova</italic> genes. Interestingly, the loss of <italic>Nova1</italic>, <italic>Nova2,</italic> or <italic>Nova1/2-</italic>dKO also resulted in significant gene expression changes within SST-cIN (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A–F</xref>). However, similar to what we observed with ECS, many of the genes that were subjected to AS (<xref ref-type="fig" rid="fig4">Figure 4C</xref>) were independent from the genes that underwent changes in gene expression (<xref ref-type="fig" rid="fig4">Figure 4D</xref>). Amongst the common genes (between AS and GE), many synaptic genes showed higher levels of AS changes compared to gene expression changes (<xref ref-type="fig" rid="fig4">Figure 4D</xref>).</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Nova1 and Nova2 control distinct alternative splicing (AS) networks within SST cINs.</title><p>(<bold>A</bold>) Schematic demonstrating the mouselines used for FACS sorting and subsequent RNA sequencing and splice variant analysis: SST cINs from <italic>Sst-Cre;Nova1F/F</italic> (<italic>Sst-Nova1-</italic>cKO) or <italic>Sst-Cre;Nova2F/F</italic> (<italic>Sst-Nova2-</italic>cKO) or <italic>Sst-Cre;Nova1F/F/Nova2F/F</italic> (<italic>Sst-Nova1/2-</italic>dKO) mice on an Ai9 reporter background (referred to henceforth at <italic>Sst-Nova1-</italic>cKO, <italic>Sst-Nova2-</italic>cKO and <italic>Sst-Nova1/2-</italic>dKO<italic>,</italic> respectively). (<bold>B</bold>) Plot showing the number of alternative splicing (AS) events in <italic>Sst-Nova1-</italic>cKO, <italic>Sst-Nova2-</italic>cKO or <italic>Sst-Nova1/2-</italic>dKOs. <italic>Nova1</italic> loss resulted in 124 altered AS events (81 excluded and 43 included), <italic>Nova2</italic> loss led to 339 altered AS events (217 excluded and 122 included) and double mutants exhibited 270 altered AS events (162 excluded and 108 included; FDR &lt;0.05). (<bold>C</bold>) Gene Ontology (GO) analysis of differentially alternatively spliced (AS) genes under synaptic categories for <italic>SST-Nova1-</italic>cKO (orange label, top panel); <italic>Sst-Nova2-</italic>cKO (pink label, middle panel) and for <italic>Sst-Nova1/2-</italic>dKO (green label, bottom panel). Color bar indicated q-adjusted values for splice variant expression. (<bold>D</bold>) Comparison of the level of alternative splicing activity vs gene expression for the overlapped synaptic genes (i.e., genes that show both AS and GE changes) for <italic>Sst-Nova1-</italic>cKO (top panel), <italic>Sst-Nova2-</italic>cKO (middle panel) and for <italic>Sst-Nova1/2-</italic>dKO (bottom panel). Activity level is calculated by considering both Fold change and pValue for each gene. (<bold>E</bold>) Percentage of genes that overlap between gene expression and alternative splicing changes FC &gt;0.5 for <italic>Sst-Nova1</italic>-cKO (top), <italic>Sst-Nova2-</italic>cKO (middle) and <italic>Sst-Nova1/2-</italic>dKO (bottom panels).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig4-v2.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Nova2 controls most of the gene expression and splicing events of the Nova1/2 family within SST + cINs and these events coalesce into GO categories and PPI networks related to pre- and post-synaptic development of SST cINs.</title><p>(<bold>A–C</bold>) Gene ontology analysis of differentially expressed synaptic genes in <italic>Nova1</italic>-cKO (<bold>A</bold>), <italic>Nova2</italic>-cKO (<bold>B</bold>), and <italic>Nova1/2</italic>-dKO (<bold>C</bold>) Color bar indicates adjusted q-value. (<bold>D–F</bold>) Examples of some upregulated and downregulated genes in <italic>Nova1</italic>-cKO (<bold>D</bold>), <italic>Nova2</italic>-cKO (<bold>E</bold>) and <italic>Nova1/2</italic>-dKO (<bold>F</bold>). (<bold>G</bold>) Bubble dot plot of most significant GO terms for the genes subjected to AS within SST-<italic>Nova1</italic>-cKO, x-axis is the percent enrichment of the AS genes in the GO category (#genes SST-Nova1 AS in category divided by #genes in GO category from SST transcriptome). Color of dot indicates magnitude of significance (-log10 FDR, none shown above FDR &lt;0.05) and size corresponds to number of genes in category. (<bold>H</bold>) Bubble plot of most significant GO terms of <italic>SST-Nova2</italic>-cKO genes subjected to AS illustrating the substantial enrichment of Nova2-dependent events to synaptic development. (<bold>I</bold>) Same as G-H but for <italic>Nova1/2</italic>-dKO (<bold>J</bold>) Protein-protein interaction (PPI) network formed from 124 Nova1-cKO spliced genes in SST cINs with DAPPLE (10,000 permutations, pVal &lt;0.09), pink shading labels genes that belong in synapse related GO categories. (<bold>K</bold>) PPI network formed from 339 <italic>Nova2</italic>-cKO spliced genes in SST-cINs with DAPPLE (10,000 permutations, pVal &lt;0.00009). Black dots indicate shared genes with <italic>Nova1</italic>-cKO, green shading labels postsynaptic genes that belong in synapse-related GO categories, pink shading labels pre-synaptic genes in synapse GO categories. (<bold>L</bold>) PPI network in <italic>Nova1/2</italic>-dKO. 270 <italic>Nova1/2</italic>-dKO splice genes in SST cINs with DAPPLE (pVal &lt;0.00009) Red dots indicate overlap with Nova2, whereas black dots indicate overlap with <italic>Nova1</italic>-cKO.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig4-figsupp1-v2.tif"/></fig><fig id="fig4s2" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 2.</label><caption><title>Overlap in Alternative Splice events between SST-Nova 1, SST-Nova 2 and SST-Nova1/2 dKO.</title><p>(<bold>A</bold>) Quantification of the overlap of <italic>SST-Nova1</italic>-cKO and <italic>SST-Nova2-</italic>cKO splicing events. Bottom left horizontal bars indicate the number of genes subjected to AS events for each data set: Nova1_inclusion splice events (43), Nova1_exclusion splicing events (81), Nova2_inclusion splicing events (122), Nova2_exclusion splicing events (217). Top histogram bars indicate the magnitude of overlap between the data sets indicated by a filled black circle below (i.e. 136 of Nova2_exclusion events overlap with other sets, 28 of Nova1_exclusion events overlap with Nova2_exclusion etc.) (<bold>B</bold>) Similar to A, but <italic>Nova1</italic>-cKO and <italic>Nova1/2</italic>-dKO overlap. Bottom left horizontal bars indicate number of genes subjected to AS events in each dataset. Nova1_inlcusion splicing events (43), Nova1_exclusion (81). Nova1/2_inclusion (108), Nova1/2_exclusion (162). Top histogram bars indicate the magnitude of overlap between the two datasets. Twenty-five of Nova1_exclusion events overlap with Nova1/2_exclusion; 19 of Nova1_inclusion overlaps with Nova1/2_inclusion etc. (<bold>C</bold>) Similar to B, but <italic>Nova2</italic>-cKO and <italic>Nova1/2</italic>-dKO overlap. 62 of Nova2_exclusion events overlap with <italic>Nova1/2</italic>; 34 of <italic>Nova2</italic>_inclusion events overlap with <italic>Nova1/2</italic>. (<bold>D</bold>) Overall correlation between <italic>Nova1</italic>, <italic>Nova2,</italic> and <italic>Nova1/2</italic>-dKO for each type of splice event.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig4-figsupp2-v2.tif"/></fig></fig-group><p>We next assessed the overlap of changes in AS events observed within each mutant (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2A–C</xref>). We found the number of alterations in <italic>Sst-Nova2-</italic>cKO AS events that overlap with <italic>Sst-Nova1/2-</italic>dKO is almost three times higher than that observed when comparing the overlap between <italic>Sst-Nova1/2-</italic>dKO and <italic>Sst-Nova1-</italic>cKO (i.e. 62 altered <italic>Sst-Nova2-</italic>cKO AS events coincided with the 162 observed in <italic>Sst-Nova1/2-</italic>dKO versus an overlap of only 25 AS events that were altered in <italic>Sst-Nova1-</italic>cKO mutants, <xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2B and C</xref>). By contrast, less than 15% of the altered <italic>Sst-Nova1</italic> AS genes overlap with changes observed in <italic>Sst-Nova2-</italic>cKO mutants (i.e. only 28 of the 217 <italic>Sst-Nova2-</italic>cKO events were altered in <italic>Sst-Nova1-</italic>cKO mutants; <xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2A and B</xref>). Interestingly, <italic>Sst-Nova1/2-</italic>dKO mutants exhibited less altered splicing events than the single <italic>Sst-Nova2-</italic>cKO mutant, suggesting that some inclusion and exclusion AS events are antagonistically directed by Nova1 and Nova2. Additionally, we performed a correlation analysis within and between <italic>Nova1, Nova2,</italic> and <italic>Nova1/2-</italic>dKO to assess whether the type of splicing events is correlated. Similar to above, we observed a higher correlation in exclusion events between <italic>Nova2</italic> and <italic>Nova1/2-</italic>dKO, compared to <italic>Nova1</italic> and <italic>Nova1/2-</italic>dKO (<xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2D</xref>).</p><p>To infer their specific biological functions, we performed GO analysis on the altered AS events from each mutant and then asked whether the affected AS events form direct PPI networks. GO analysis of the <italic>Sst-Nova1-</italic>cKO targets did not result in any significant enrichment of specific functional categories (below an FDR of 0.05) however it did organize genes into categories such as RNA binding, ion binding, and catalytic activity (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1G</xref>). <italic>Sst-Nova1-</italic>cKO AS genes formed a relatively indistinct small sparse PPI network (pVal &lt;0.09) representing vesicle-transport and nucleic-acid binding pathways (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1J</xref>, pink shaded). In contrast, <italic>Sst-Nova2-</italic>cKO and <italic>Sst-Nova1/2-</italic>dKO AS genes organized into several shared significant GO categories such as neuron projection, axon, cell-cell junction, and synaptic function (FDR &lt;0.05) (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1H, I</xref>). <italic>Sst-Nova1/2-</italic>dKO AS genes also organized into some unique categories, which were involved in postsynaptic specialization, dendrite, and synaptic vesicle membrane (FDR &lt;0.05) (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1H</xref>). We next asked if the AS genes affected in <italic>Sst-Nova2-</italic>cKO and <italic>Sst-Nova1/2-</italic>dKO were predicted to function together in a PPI network representing specific biological processes (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1K–L</xref>). Perhaps not surprisingly both formed highly connected significant PPI networks (pVal &lt;0.0009, 1000 permutations) representing multiple pathways for vesicle-transport, pre- and post-synaptic function and organization, as well as Ca<sup>2+</sup> signaling (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1K–L</xref>, pink and green respectively). Interestingly, the PPI network for <italic>Sst-Nova2-</italic>cKO uniquely includes numerous glutamate receptors and their adaptors, respectively (e.g. Grin2b, Grik1, Gria3, Grm5 and Grip1, Sharpin, Dlg2) (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1K</xref>, highlighted pre-synaptic genes in pink and post-synaptic genes in green). Altogether these results suggest that considering the Nova family as a whole, Nova2 (compared to Nova1) is the main driver of AS and importantly, may be most relevant for synaptic development of SST cINs.</p></sec><sec id="s2-5"><title><italic>Sst-Nova1 and Sst-Nova2</italic> mutants have impaired afferent and efferent connectivity</title><p>To confirm our predictions from the AS analysis of conditional <italic>Nova</italic> mutants, we next sought to determine the effect of the loss of <italic>Nova1</italic> and <italic>Nova2</italic> on SST cIN synaptic development and function. To this end, we assessed the requirement for <italic>Nova1</italic> and/or <italic>Nova2</italic> for both the anatomical connectivity and physiological properties of SST cINs. <italic>Sst-Nova1/2-</italic>dKO mice were smaller in size and while generated at Mendelian ratios, many died as early as P8, and offspring often exhibited seizures (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A</xref>). In the single KO mutants, we used IHC to quantify the density of SST cIN efferent synapses, defined as the apposition of VGAT+ (vesicle GABA transporter) and gephyrin + puncta from an SST cIN axon within L1 of the S1 cortex at P8 (<xref ref-type="fig" rid="fig5">Figure 5A</xref>, black asterisks mark example puncta). We found that both <italic>Sst-Nova1-</italic>cKO (0.281±0.041 puncta/µm<sup>2</sup> <italic>Sst-Nova1-</italic>cKO vs 0.454±0.037 puncta/um<sup>2</sup> ctl, pVal = 0.003) and <italic>Sst-Nova2-</italic>cKO (0.197±0.016 puncta/um<sup>2</sup> <italic>Sst-Nova2-</italic>cKO vs 0.454±0.037 puncta/µm<sup>2</sup> ctl, pVal = &lt;0.0001) exhibited a significant reduction in SST +synapses compared to control SST synapses within L1 (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). To confirm the synaptic phenotype observed, we recorded the inhibitory outputs from SST cINs onto pyramidal cells in L2/3 and L5 using <italic>Rosa26<sup>LSL-hChR2</sup></italic> (Ai32) crossed with <italic>Sst-Nova1-</italic>cKO, <italic>Sst-Nova2</italic>-cKO<italic>, Sst-Nova1/2-</italic>dKO or SST-control mice (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). While this experiment does not measure quantal postsynaptic currents, using a transgenic channelrhodopsin line ensures similar level of channel rhodopsin expression under mutant and control conditions. Using this strategy, we observed a significant reduction in the light evoked IPSC peak amplitude in <italic>Sst-Nova1-</italic>cKO (283±36 pA in <italic>Sst-Nova1-</italic>cKO vs 623±120 pA in ctl, pVal = 0.0037, <xref ref-type="fig" rid="fig5">Figure 5D</xref>), <italic>Sst-Nova2-</italic>cKO (340±85 pA in <italic>Sst-Nova2-</italic>cKO <italic>vs</italic> 766±211 pA ctl, pVal = 0.0021, <xref ref-type="fig" rid="fig5">Figure 5E</xref>), and <italic>Sst-Nova1/2-</italic>dKO (248.9 pA in <italic>Sst-Nova1/2-</italic>dKO vs 663 pA in ctl, <xref ref-type="fig" rid="fig5">Figure 5F</xref>) confirming that the anatomically observed reduction in synaptic output density is functionally significant in all mutants and did not differ between L2/3 and L5 pyramidal neurons, at least in the case of <italic>Sst-Nova2-</italic>cKO (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1J</xref>).</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title><italic>SST-Nova1 and SST-Nova2</italic> mutants have impaired afferent and efferent connectivity.</title><p>(<bold>A</bold>) SST +cINs efferent structure: IHC of anti-RFP (red), anti-VGAT (green), and anti-Gephyrin (blue) to label the SST +cIN axonal synaptic puncta (RFP+/VGAT+/Gephyrin +puncta, white) in L1 S1 cortex of <italic>Sst-</italic>Ctl<italic>, Sst-Nova1-</italic>cKO<italic>,</italic> and <italic>Sst-Nova2</italic>-cKO mutant animals. (<bold>B</bold>) Quantification of the density of SST +cIN efferent synaptic puncta (RFP+/VGAT+/Gephyrin+) in L1 S1 cortex of <italic>Sst-</italic>Ctl (<italic>n=26, S1 cortex from 3 mice), Sst-Nova1-</italic>cKO (<italic>n=26, S1 cortex, from 3 mice</italic>) and <italic>Sst-Nova2-</italic>cKO (<italic>n=15, S1 cortex from 3 mice</italic>) mutant animals. **pVal = 0.003, <italic>Sst-Nova1-</italic>cKO; ***pVal &lt;0.0001, <italic>Sst-Nova2-</italic>cKO. (<bold>C</bold>) Schematic of channelrhodopsin (ChR2) experimental approach: <italic>Sst<sup>Cre</sup></italic> control, <italic>Sst-Nova1-</italic>cKO, <italic>Sst-Nova2-</italic>cKO or <italic>Sst-Nova1/2-</italic>dKO mutant mice were crossed with the Ai32 reporter line that expresses ChR2 in a Cre-dependent manner. Blue light was delivered through the objective to record inhibitory response (IPSC) in neighboring excitatory neuron (grey). (<bold>D–F</bold>) Quantification of the peak IPSC amplitudes recorded in excitatory neurons following SST stimulation in <italic>Sst-Nova1</italic>-cKO (<bold>D</bold>), <italic>Sst-Nova2</italic>-cKO (<bold>E</bold>) and <italic>Nova1/2</italic>-dKO (<bold>F</bold>) (n=20 cells from 3 mice each; **pVal = 0.0037, <italic>Sst-Nova1-cKO</italic>; **pVal = 0.0021, <italic>Sst-Nova2-cKO,</italic> ***pVal &lt;0.001).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig5-v2.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>Conditional loss of <italic>Nova1/2</italic> within SST +cINs impacts animal survival and disrupts their afferent synaptic connectivity.</title><p>(<bold>A</bold>) Survival plot of conditional knockouts within <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9) animals (WT Sst<sup>Cre</sup>; Ai9 animals black line, double heterozygous (het) <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9); <italic>Nova1<sup>f/+</sup>, Nova2<sup>f/+</sup></italic> slashed purple line (Dbl,cHet), <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova1</italic><sup>f/f</sup> black line, <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic><sup>Nova2</sup></italic><sup>f/f</sup> black line, double knockout <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9) <italic>Nova1</italic><sup>f/f</sup> <italic>Nova2</italic><sup>f/f</sup> turquoise line) at P8 50% of double conditional <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova1<sup>f/f</sup> Nova2<sup>f/f</sup></italic> (dKO) animals have deceased by P50 90% of double conditional animals have deceased. Whereas at P30 40% of Dbl, cHet animals and by P60 50% have deceased. WT and singular conditional mutants do not exhibit decreased survival. (<bold>B</bold>) SST +afferents: IHC of representative SST +cIN dendrite of anti-RFP (red), anti-VGLUT1 (green), and anti-Homer1c (blue) to label excitatory synaptic puncta overlapping with SST +cINs dendrites (RFP+/VGLUT1+/Homer1c+puncta, white) in S1 cortex of SST-ctl, <italic>SST-Nova1-</italic>cKO and <italic>SST-Nova2-</italic>cKO mutant animals. (<bold>C</bold>) Quantification of the density of excitatory afferent synapses onto SST +cINs within L2/3 and L5/6 of S1 cortex of SST-ctl, <italic>Sst-Nova1-</italic>cKO and <italic>Sst-Nova2-</italic>cKO mutant animals. (n=23, 3 mice each; *pVal = 0.028, <italic>SST-Nova1-</italic>cKO; *pVal = 0.012, <italic>SST-Nova2-</italic>cKO). (<bold>D</bold>) Schematic of experimental approach recording mini-excitatory postsynaptic potentials (mEPSCs) in SST +cINs in the S1 cortex (red). (<bold>H</bold>) Quantification of mEPSCs frequencies from SST +cIN Ctl, <italic>Sst-Nova1-</italic>cKO and <italic>Sst-Nova2-</italic>cKO mutant animals (n=15 cells from 3 mice of each genotype) (<bold>E</bold>) Representative mEPSCs recordings from SST cINs from: Top to bottom: wt animals, grey traces (<italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9) or <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9); <italic>Nova1</italic><sup>f/+</sup> or <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova2</italic><sup>f/+</sup>), <italic>Nova1</italic>-cKO animals, orange traces (<italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova1</italic><sup>f/f</sup>), <italic>Nova2</italic>-cKO animals, pink traces (<italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9); <italic>Nova2</italic><sup>f/f</sup>), and double <italic>Nova1/2</italic>-dKO, turquoise traces (<italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova1</italic><sup>f/f</sup><italic>Nova2</italic><sup>f/f</sup>). Scale bar: 20 pA and 2 s. (<bold>F</bold>) Quantification of mEPSC frequencies and amplitude recorded from SST cINs in control animals, grey dot (<italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9) or <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova1<sup>f/+</sup></italic> or <italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova2<sup>f/+</sup></italic>), <italic>Nova1-</italic>cKO animals, orange square (<italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova1<sup>f/f</sup></italic>), <italic>Nova2-</italic>cKO animals, pink triange (<italic>Sst<sup>Cre</sup>; Rosa26<sup>LSL-tdTomato</sup></italic> (Ai9), <italic>Nova2<sup>f/f</sup></italic>), and double <italic>Nova1/2</italic>-dKO, turquoise upside-down triangle. **pVal=&lt;0.005 for wt vs. <italic>Nova2</italic>-cKO and wt vs. <italic>Nova1/2-</italic>dKO. (<bold>G</bold>) Cumulative probablility distributions of mEPSC amplitudes from recordings of wt SST cINs, grey line, and <italic>Nova1-</italic>cKO SST cINs, orange line, exhibiting no difference. (<bold>H</bold>) Cumulative probability distributions of mEPSC amplitudes from recordings of wt SST cINs, grey line, and <italic>Nova2-</italic>cKO SST cINs, pink line, exhibiting a significant increase in the amplitude of mEPSCs in <italic>Nova2-</italic>cKO SST cINs. (<bold>I</bold>) Cumulative probability distributions of mEPSC amplitudes from recordings of wt SST cINs, grey line, and <italic>Nova1/2-</italic>cKO SST cINs, turquoise line, exhibiting no difference. (<bold>J</bold>) <italic>Nova2-</italic>cKO SST cINs output to L2/3 or L5 pyramidal neurons shows no significant difference. ns, pVal = 0.8 for L2/3 vs L5.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig5-figsupp1-v2.tif"/></fig></fig-group><p>We also investigated whether the density of excitatory synapses onto SST cINs is affected by the loss of <italic>Nova1</italic> or <italic>Nova2</italic>. We performed IHC for Vglut1 (vesicular glutamate transporter) and Homer1c on <italic>Sst-Nova1-</italic>cKO and <italic>Sst-Nova2-</italic>cKO dendrites within the S1 cortex at P8 (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1B</xref>, black asterisks mark example puncta). We quantified the density of putative excitatory synapses by the overlap of Vglut1 +and Homer1c+puncta onto mCherry + dendrites of SST cINs. We found that the number of putative excitatory afferent synapses onto <italic>Sst-Nova1-</italic>cKO and <italic>Sst-Nova2-cKO</italic> is significantly reduced compared to control SST cINs (0.144±0.016 puncta/µm<sup>2</sup> <italic>Sst-Nova1-</italic>cKO vs 0.207±0.022 puncta/µm<sup>2</sup> ctl, pVal = 0.028 and 0.137±0.013 puncta/µm<sup>2</sup> <italic>Sst-Nova2-</italic>cKO vs 0.207±0.022 puncta/µm<sup>2</sup> ctl, pVal = 0.012; <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1C</xref>). To examine whether these anatomical abnormalities observed in <italic>Sst-Nova1-</italic>cKO and <italic>Sst-Nova2-</italic>cKO mutants affected synaptic function, we performed whole-cell patch clamp recordings to measure miniature excitatory postsynaptic currents (mEPSCs) within SST cINs (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1D–I</xref>). In accordance with the puncta analysis, both <italic>Sst-Nova1-</italic>cKO and <italic>Sst-Nova2-</italic>cKO exhibited significant reductions in the mEPSC frequency (<italic>Sst-Nova1-</italic>cKO: 1.16±0.08 Hz vs <italic>Sst-Nova2-</italic>cKO: 0.39±0.05 Hz vs ctl: 2.43±0.2 Hz, pVal = 0.0025, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1F</xref>). In addition, we observed a significantly increased mEPSC amplitude in <italic>Sst-Nova2-</italic>cKO (<italic>Sst-Nova2-</italic>cKO: –40±15.7 pA vs <italic>Sst-Nova1</italic>-cKO: –30.12±13.15 pA vs ctl: –30.36±13.34 pA, pVal = 0.005, <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1F</xref> right and <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1H</xref>). Thus, while <italic>Sst-Nova2-</italic>cKO cINs have a striking reduction in their excitatory inputs, the remaining excitatory synapses are functionally stronger than <italic>Nova1</italic> or control cINs. Moreover, the intrinsic properties of both KO alleles were differentially affected. Specifically, we observed that the rheobase was significantly lower for <italic>Sst-Nova2-</italic>cKO compared with either controls or <italic>Sst-Nova1-</italic>cKO (<italic>Sst-Nova2-</italic>cKO: 25±3 pA vs ctl:120±25 pA vs <italic>Sst-Nova1-</italic>cKO: 70±15 pA; pVal = 0.01, <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1</xref>). As rheobase is a measurement of the minimum current required to produce an action potential, <italic>Sst-Nova2-</italic>cKO cIN<italic>s</italic> are potentially compensating for the loss of excitatory synapses by lowering the minimal current amplitude required for depolarization. Altogether these results solidify the role of both Nova1 and Nova2 in the synaptic development of SST cINs. Furthermore, consistent with the AS analysis, these results suggest that within SST cINs Nova2 has a larger impact on the changes in synaptic connectivity compared to Nova1.</p></sec><sec id="s2-6"><title>Nova RNA binding proteins control-activity-dependent AS in SST cINS during development</title><p>Given that activity increases the expression level and nuclear localization of both Nova proteins, we hypothesized that their loss would result in changes in activity-dependent AS. To this end, we repeated our investigation of how Nova-dependent AS isoforms are altered in mutant mice. This time we examined the changes specifically following ECS within SST cINs during synaptogenesis in vivo. Two to 3 hr following ECS, we isolated SST cINs from <italic>Sst-Nova1/2-</italic>dKO mice (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). Following augmentation of neuronal activity, we found that the loss of both <italic>Nova</italic> genes results in the differential splicing of 346 transcripts (FDR &lt;0.05, |∆ψ|≥0.1). These are comprised by 166 SE events (60 excluded and 106 included exons), 72 RI events (21 excluded and 51 included introns), 70 MXE events (33 excluded and 37 included exons), 9 A5 events (2 excluded and 7 included exons), and 29 A3 (20 excluded and 9 included exons; <xref ref-type="fig" rid="fig6">Figure 6B</xref>). Many of these genes were categorized into synaptic gene ontology categories both in AS and GE data with a small degree of overlap (<xref ref-type="fig" rid="fig6">Figure 6C–E</xref>). As demonstrated previously, many synaptic genes exhibited higher AS change level compared to GE (<xref ref-type="fig" rid="fig6">Figure 6F</xref> and <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1E</xref>). For example, the synaptic gene Nrxn1 was shown to have 4-fold difference in the AS level compared to GE (<xref ref-type="fig" rid="fig6">Figure 6F</xref> inset). Independent fluorescent RT-PCR amplifications with primers flanking the alternatively spliced segments confirmed the observed AS changes. We were able to validate 70% of targets tested. For example, we validated the activity-dependent inclusion of exon 4 in <italic>Nrxn1</italic>. As predicted from RNAseq, SST cINs subjected to acute increases in activity from <italic>Sst-Nova1/2-</italic>dKO animals, compared to control SST cINs, exhibit a significant reduction in the expression of <italic>Nrxn1</italic> exon 4 (<xref ref-type="fig" rid="fig6">Figure 6G–H</xref>). Similarly, we validated the activity-dependent inclusion of exon 14 in <italic>Syngap1,</italic> a gene associated in multiple disorders including epilepsy and important for excitatory post-synaptic function (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1C–D</xref>). Both activity-mediated gene expression and splicing changes are partially abolished by <italic>Nova1/2-</italic>dKO (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1F–G</xref>). A list of exon coverage and inclusion levels for synaptic genes is presented in <xref ref-type="supplementary-material" rid="supp2">Supplementary file 2a</xref>.</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>Nova RNA binding proteins control-activity-dependent AS in SST cINS during development.</title><p>(<bold>A</bold>) Schematic of experimental approach: Control and <italic>Sst-Nova1/2-</italic>dKO P8 animals were subjected to ECS then the S1 cortex was isolated to FACS purify SST + cINs followed by RNAseq and splicing analysis. (<bold>B</bold>) Magnitude of activity-dependent splicing changes within <italic>Sst-Nova1/2-</italic>dKO subjected to ECS compared to Ctr <italic>SST-</italic> cINs subjected to ECS (FDR &lt;0.5, fold &lt;0.1 &gt; ), depicting 166 differential spliced SE (106 SE included, 60 SE excluded), 72 differential spliced RI (51 RI included, 21 RI excluded), 70 differential spliced MXE (37 included, 33 excluded), 9 differential spliced A5 (7 included, 2 excluded), 29 differential spliced A3 (9 included, 20 excluded). (<bold>C</bold>) Synaptic gene ontology (GO) for the differentially spliced genes between ECS control vs ECS <italic>Nova1/2-</italic>dKO conditions. Color bar indicates adjusted q-value. (<bold>D</bold>) Synaptic gene ontology (GO) for the differentially expressed synaptic gene categories in the ECS control vs ECS <italic>Nova1/2</italic>-dKO conditions. (<bold>E</bold>) Number and percentage of overlap between all differentially expressed genes (FC &gt;0.5, pVal &lt;0.05) and alternatively splice genes. (<bold>F</bold>) Comparison of the activity level (Fold Change) of alternative splicing (AS) and gene expression (GE) amongst the shared genes that are both differentially expressed and differentially spliced. Inset shows that in the Nrxn1 gene AS level is larger (FC = 2.16) compared to the change in GE level (FC = 0.359). (<bold>G</bold>) Example RT-PCR validation of alternative splicing (AS) events of activity- and Nova1/2- dependent alternative exon usage within the gene <italic>Nrxn1</italic> (top), Gel image of RT-PCR product from the amplification of exon 3 to exon 5 within Sst-ctl cINs (Ctl) (left), ECS-treated Ctl (middle), and ECS- treated <italic>Sst-Nova1/2-</italic>dKO (right). (<bold>H</bold>) Quantification of RT-PCR AS events of <italic>Nrxn1</italic>. *pVal = 0.0194 Ctl vs Ctl + ECS; **pVal = 0.0087 Ctl + ECS vs <italic>SST-Nova1/2-</italic>dKO+ECS.</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>Gel showing Nrxn1 Exon 4 expression in different conditions.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-86842-fig6-data1-v2.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig6-v2.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Nova RNA binding proteins control-activity-dependent AS in SST cINs during development.</title><p>(<bold>A</bold>) Bubble dot plot of the most significant GO terms for the genes undergoing Nova1/2 activity-dependent AS splicing within SST +cINs (all GO terms shown FDR &lt;0.05). (<bold>B</bold>) Schematic of an SST +cIN presynaptic inhibitory axonal puncta (top right) and a SST +cIN excitatory post-synaptic density (middle) overlaid on top of the significant DAPPLE generated PPI direct network from the 356 genes undergoing Nova1/2-dependent activity induced AS (***pVal = 0.00009, 10,1000 permutations). (<bold>C</bold>) Example RT-PCR validation of alternative splicing (AS) events of activity- and Nova1/2-dependent alternative exon usage within the gene <italic>Syngap1</italic> (top), bottom, Gel image of RT-PCR product from the amplification of exon13 to exon 15 within SST-ctl cINs (Ctl) (left), ECS-treated Ctl (middle), and ECS-treated <italic>SST-Nova1/2-</italic>dKO (right). (<bold>D</bold>) Quantification of RT-PCR AS events of Syngap1. **pVal = 0.0001 Ctl vs Ctl +ECS; **pVal = 0.004 Ctl +ECS vs <italic>SST-Nova1/2-</italic>dKO+ECS. (<bold>E</bold>) Examples of genes with both GE and AS changes. Y-axis represents activity level (FC and pValue) of either GE (teal) or AS (orange). (<bold>F</bold>) Gene expression changes observed in ECS vs control are partially abolished by <italic>Nova1/2-</italic>dKO (<bold>G</bold>) Alternative splicing changes due to activity induction (ECS) are significantly abolished in the <italic>Nova1/2-</italic>dKO (with ECS). A few example genes are presented showing the activity-dependent exclusion/inclusion of certain exons are no longer present in the <italic>Nova1/2-</italic>dKO Red: Control; Blue: ECS; Green: <italic>Nova1/2-</italic>dKO+ECS.</p><p><supplementary-material id="fig6s1sdata1"><label>Figure 6—figure supplement 1—source data 1.</label><caption><title>Gel showing Syngap Exon 14 expression.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-86842-fig6-figsupp1-data1-v2.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig6-figsupp1-v2.tif"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 2.</label><caption><title>Nova1/2 controls the activity-dependent splicing of large and unique pool of mRNAs compared to Rbfox1 within SST cINs and SST-specific Nova2 AS genes overlap well with pan-cIN Nova2 AS genes.</title><p>(<bold>A</bold>) Quantification of the overlap of <italic>SST-Rbfox-</italic>cKO+ECS (differential splicing events from the comparison of SST-cIN +ECS to <italic>SST-Rbfox-</italic>cKO+ECS) and <italic>SST-Nova1/2-</italic>dKO (differential splicing events from the comparison of SST-cINS +ECS to <italic>SST-Nova1/2-</italic>dKO+ECS). Bottom left horizontal bars indicate the number of genes subjected to AS events for each data set. Top vertical bars indicate the number of overlapping genes corresponding to the black dot below indicating the data set identity. (<bold>B</bold>) Quantification of the overlap of <italic>SST-Nova2-</italic>cKO cIN splicing events (differential splicing events from the comparison of Ctrl SST cINs to <italic>SST-Nova2-</italic>cKO) with the dataset generated by <xref ref-type="bibr" rid="bib52">Saito et al., 2019</xref> utilizing a mouse cross <italic>Gad-Cre</italic> and <italic>Nova2</italic><sup>f/f</sup> (differential splicing events from Ctrl cINs vs cINs-<italic>Nova2-</italic>cKO).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig6-figsupp2-v2.tif"/></fig></fig-group><p>We found the majority of genes which undergo activity-induced Nova-dependent differential splicing were significantly enriched for GO categories such as pre-synaptic vesicular function, synapse organization, synaptic transmission, and neuronal growth (<xref ref-type="fig" rid="fig6">Figure 6C</xref> and <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1A</xref>). Many of the genes within these categories are known to have important functions for axon organization and synaptogenesis such as, <italic>Nrxn1, Nrxn3, Plxna2,</italic> and <italic>Epha5</italic>. Interestingly, the activity-dependent Nova AS targets were strikingly enriched for excitatory post-synaptic specializations such as, <italic>Shank1</italic>, <italic>Syngap1, Dlg3, Grin1,</italic> and <italic>Gria1</italic>. Furthermore, these genes are predicted to function together in a direct PPI network representing specific pre-synaptic and post-synaptic biological processes (direct network pVal = 0.0009, 10,000 permutations, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1B</xref>). For example, the loss of <italic>Nova</italic> leads to an altered activity-dependent splicing program of multiple genes important to NMDA receptor-mediated signaling (<italic>Grin1</italic>) connected with PSD organization (e.g. <italic>Dlg3, Shank1</italic>) and Ca<sup>2+</sup> -dependent signaling (e.g. <italic>Hras, Rapgef1</italic>) (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1B</xref>).</p><p>In sum, the activity-mediated Nova-dependent AS changes within SST cINs are central for fine-tuning of synaptic development. We previously found that another important RNABP, Rbfox1, influences axonal development and also shuttles from the cytoplasm to the nucleus upon increase in activity in SST cINs (<xref ref-type="bibr" rid="bib33">Lee et al., 2009</xref>; <xref ref-type="bibr" rid="bib62">Wamsley et al., 2018</xref>). However, upon comparing the activity-dependent splicing programs within SST cINs of Rbfox1 (69 activity-dependent events) to Nova1/2 (346 activity-dependent events), we found Nova proteins control a much larger number of activity-dependent splicing events. This supports our hypothesis that Nova proteins are key players in the control of activity-dependent alternative splicing (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>).</p></sec><sec id="s2-7"><title>Augmenting activity in Nova2 KO fails to enhance SST inhibitory output</title><p>Activity increases both the expression of Nova proteins as well as synapse formation, while conversely loss of Nova function causes a striking decrease in synaptogenesis and SST inhibitory output. Moreover, from our analysis of SST cIN KOs, it was evident that of the two Nova proteins, <italic>Nova2</italic> has the more profound effect on the AS of genes involved in synaptogenesis. We therefore examined whether the loss of <italic>Nova2</italic> impaired the ability of augmented neuronal activity in SST cINs to promote the formation of efferent synaptic connectivity. To that end, we expressed NachBac in SST neurons in <italic>Sst</italic><sup>Cre</sup>::<italic>Rose26</italic><sup>LSL-hChR2</sup> (Ai32) mice with <italic>Nova2</italic> deletions, compared with controls (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). As previously shown, enhancing activity using NachBac resulted in increased Nova1/2 expression and localization into the nucleus in control mice (No Nova2-deletion, <xref ref-type="fig" rid="fig7">Figure 7A</xref> right). When we recorded from the pyramidal neurons in all conditions (control-No NachBac, control +NachBac, or <italic>Nova2-</italic>cKO+NachBac), we observed that enhancing activity in the <italic>Nova2</italic>-cKO did not result in an increase in inhibitory output of SST cINs (<xref ref-type="fig" rid="fig7">Figure 7B</xref>, right). This suggests that the activity-dependent changes of synaptic strength depend upon the presence of Nova2.</p><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Augmenting activity in Nova2 KO fails to enhance SST inhibitory output.</title><p>(<bold>A</bold>) Left, experimental model: Injection of AAV-Syn-DIO-NachBac-P2A-mCherry (activating) in either control mice or <italic>Sst-Nova2-</italic>cKO mice at P0 (analysis at P21). Right, example images showing the impact of NachBac activation (red) on Nova1/2 expression in controls. Note the translocation of Nova proteins (blue) to the nucleus (grey) in SST-cINs (green). Scale bar = 10 µm. (<bold>B</bold>) Left, schematic of the recording scheme: <italic>SST<sup>Cre</sup></italic>::Ai32 optogenetic activation and recording from L5 pyramidal neurons. Right, quantification of the peak IPSC amplitude recorded from pyramidal neurons under no NachBac control conditions (grey), NachBac injections in SST-Ctrl animals (red dots) or NachBac injections in <italic>Sst-Nova2</italic>-cKO animals (pink). (n=10–15 cells from each condition, N=3 mice; **≤0.01, ****≤0.001). (<bold>C</bold>) Left, experimental model: Overexpression (OE) of Nova2 using the AAV-Syn-DIO-Nova2-tagBFP virus was injected into <italic>SST<sup>Cre</sup></italic>::Ai32 mice either alone or while suppressing activity using Kir2.1 AAV-Syn-DIO-Kir2.1-P2A-mCherry. Middle, an image showing the co-expression of Nova2-tagBFP (blue) and Kir2.1-mCherry (red). Inset shows co-localization of both proteins in SST neurons. Scale bar of inset = 10 µm. Right, percentage of overlap between the two viruses in SST neurons, quantified as percentage of Nova2-OE neurons that also express Kir2.1-mCherry (~85%). (<bold>D</bold>) Left panels, Representative images of IHC against tagBFP (red), and Nova1/2 (anti-Nova1/2, blue) in SST-Nova2-OE cells in <italic>SST<sup>Cre</sup></italic>::Ai32 mice (green labels Ai32 expression). Right panels, SST-Nova2OE +KIR2.1 cell. Bottom right panels represent merged images. Note the exclusion of Nova proteins from the nucleus in Nova2-OE+Kir2.1 conditions. (<bold>E</bold>) Quantification of the relative pixel intensity of Nova1/2 expression in SST cINs (n=25/26 cells for each condition, pVal=**≤0.01, ****≤0.001). (<bold>F</bold>) Quantification of the Ratio of Nova1/2 localization within the nucleus to cytoplasm from Nova2OE SSt cINs (pink) and Nova2-OE+KIR2.1 (blue). (n=10 cells from 3 mice; pVal=*≤0.05). (<bold>G</bold>) Right, recording schematic. Left, Peak IPSC amplitude recorded from pyramidal neurons in response to optogenetic stimulation of SST-cINs in either the Nova2-OE condition or Nova2-OE+Kir2.1 condition (n=19–25 cells in each condition, pVal=**≤0.01, ***≤0.005). (<bold>H</bold>) Model of experimental findings: center is a cartoon wild type SST cIN depicting normal expression of Nova1/2 with the soma (red) whereas, on the left, the conditional loss of <italic>Nova1, Nova2,</italic> or the expression of KIR2.1 alone or dual overexpression of Nova2 and KIR2.1 results in the reduction in Nova expression and restricts Nova localization to the cytoplasm (In the case of KO animals the protein is lost completely). This effect is accompanied by a reduction in the connectivity of SST cINs. To the contrary, Expression of NaChBac and/or overexpression of Nova2 alone results in expression of Nova throughout the cell and nucleus and is accompanied by an increase in the SST cINs output. (<bold>I</bold>) Summary table of experimental findings in all conditions tested.</p><p><supplementary-material id="fig7sdata1"><label>Figure 7—source data 1.</label><caption><title>Summary table for major experimental findings.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-86842-fig7-data1-v2.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-86842-fig7-v2.tif"/></fig><p>Conversely, we examined whether over-expression (OE) of Nova2 alone could phenocopy the observed changes in connectivity within SST cINs and whether that was affected by reducing the activity level of the cell (using Kir2.1). To that end, we either overexpressed <italic>Nova2</italic> alone specifically in SST + neurons using an AAV virus (AAV-Syn-Nova2-P2A-mCherry) in <italic>Sst<sup>Cre</sup></italic> mice within the S1 cortex or in conjunction with Kir2.1 OE (<xref ref-type="fig" rid="fig7">Figure 7C</xref>). As in the case of increasing activity (either constitutively, NaChBac, or acutely, ECS), the nuclear localization of Nova was robustly increased when Nova2 was overexpressed (Nova2-OE) in the SST cINs (<xref ref-type="fig" rid="fig7">Figure 7D–F</xref>). The increased nuclear localization of Nova that was observed with the Nova2<italic>-</italic>OE was abolished when the activity of the cells was cell-autonomously reduced using KIR2.1.</p><p>We next also examined whether suppressing activity while overexpressing Nova2 impacts the inhibitory output of SST neurons (<xref ref-type="fig" rid="fig7">Figure 7G</xref> left). The dual expression of Nova2-OE and KIR2.1 within SST cINs prevented the small increase of peak IPSC amplitude observed with Nova2-OE alone. Perhaps most strikingly, as with our initial KIR2.1 experiment, the levels of Nova2 protein despite being constitutively OE were reduced in cells co-expressing KIR2.1 (<xref ref-type="fig" rid="fig7">Figure 7E</xref>). This provides strong evidence that the stability and nuclear localization of Nova protein is dependent on the level of basal activity within SST cINs. Therefore, a certain level of activity is needed to maintain Nova protein function, and conversely, Nova proteins are needed to mediate activity-dependent changes in alternative splicing of synaptic proteins.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>In the present study, we have examined the interacting contributions of neuronal activity and the Nova RNABPs on synaptogenesis of SST cINs. Our analysis began with the observation that activity levels strongly influence the maturation of SST cINs. Acutely evoking activity during circuit integration with ECS resulted in both transcriptional and translational upregulation of Nova proteins and promoted their localization to the nucleus. This was accompanied by a striking change in both the GE and AS of synaptic genes and culminated in enhanced synaptogenesis within SST cINs. We then systematically examined the interdependence between these three observations.</p><p>Our results indicate that during circuit formation, activity levels within SST cINs correlate with changes in AS and together act to regulate the formation of afferent/efferent connectivity. These events appear to be tightly linked to Nova function, as the expression, localization and splicing activity of both Nova1 and Nova2 proteins are strongly modulated by activity. Examination of how splicing events are impacted by <italic>Nova</italic> single and compound KOs in SST cINs demonstrates that developmental RNA splicing events in these cells are particularly impacted by the loss of <italic>Nova2</italic>. This is mirrored by the magnitude in reduction of excitatory input and inhibitory output within <italic>Nova2</italic> null SST cINs, as evidenced by a structural and functional decrease in their synaptic contacts. The relationship between activity and Nova2 function during development is interdependent. During these periods, boosting activity cell autonomously within <italic>Nova2</italic>-cKOs fails to increase the structural or physiological output of SST-cINs. Conversely, over-expression of Nova2 in SST cINs can enhance these activities but this phenomenon can be suppressed by simultaneous dampening their excitability. Together these findings demonstrate that activity is coupled to synaptogenesis in SST cINs by a mechanism involving Nova proteins. Whether these effects are regulated through their contributions to AS, GE or a combination of both remains to be determined.</p><p>With regards to AS in particular, Nova function is a core regulator of alternative splicing in many cell types, including SST cINs. It however represents only one of a host of RNABPs within the CNS. Indeed, a recent study demonstrated that within the mature brain many classes of neurons, including SST cINs, can be classified both by their expression levels of RNABPs and their corresponding repertoire of alternatively spliced mRNAs (<xref ref-type="bibr" rid="bib18">Furlanis et al., 2019</xref>). Comparison of this work to our present findings illustrate that both the expression of RNABPs and the patterns of AS are strongly regulated across development, a phenomenon that may reflect developmental changes in neuronal activity. Consistent with this RNA binding splice factors have previously been shown to promote alternative splicing of synaptic proteins in response to neuronal depolarization and Ca<sup>2+</sup> signaling (<xref ref-type="bibr" rid="bib13">Eom et al., 2013</xref>; <xref ref-type="bibr" rid="bib40">Mauger et al., 2016</xref>; <xref ref-type="bibr" rid="bib46">Quesnel-Vallières et al., 2016</xref>; <xref ref-type="bibr" rid="bib59">Vuong et al., 2016</xref>), For example, previous research demonstrated that the splicing of neurexins, a gene family known to function in synaptogenesis, are mediated through the actions of the SAM68 splicing factor (<xref ref-type="bibr" rid="bib25">Iijima et al., 2011</xref>). Similarly, It has also been illustrated that neuronal activity reduces the expression of the SRRM4 RNA-binding protein, which resulted in altered RNA splicing and a corresponding decrease in excitatory synapses (<xref ref-type="bibr" rid="bib46">Quesnel-Vallières et al., 2016</xref>). As such AS represents a largely unexplored but central genetic mechanism, capable of directing cell-type development and synaptic formation specifically.</p><p>Understanding both the repertoire of splice factors and the cell-specific patterns of splicing across development will undoubtedly provide further insight into how AS influences cIN development. One could imagine systematically examining the role of these differential splice mRNA variants through combinatorial knockdown or over-expression. However, this would face enormous technical challenges, even if restricted to only those that are Nova-dependent. As we show here many of these genes have been shown to function together (PPI networks). As such AS appears to coordinately target specific biological mechanisms. Given that the abundance of the specific splice forms of different genes within SST cINs is relative rather than absolute, it appears that AS has been coopted by development as an effective mechanism to fine-tune particular biological phenomena. The flexibility of AS to regulate the composition and levels of genes allows cells to adjust their biological function in accordance with both their identity and state (e.g. developmental period, neuronal activity, etc.). As a result, the abundance of specific splice forms co-varies as a function of both transcription and AS. Taken together, this argues that conditional removal of RNABPs, such as Nova2, provides an effective approach for understanding the role of AS within discrete cell types. Additionally, Nova proteins have a yet unexplored role in regulating gene expression, most likely through their ability to regulate the stability of RNA molecules.</p><p>In sum, our results show a clear interdependence between activity, Nova function and synaptic formation/strength in SST cINs. The interaction between activity and Nova function is bidirectional. Activity regulates the RNA, protein levels and intracellular localization of Nova proteins within SST cINs, while Nova proteins are in turn required for the activity-dependent regulation of synaptic formation and function (see model <xref ref-type="fig" rid="fig7">Figure 7H</xref>). When SST cIN activity is increased with ECS or with NaChBac expression, <italic>Nova</italic> transcripts as well as protein are upregulated and shuttled to the nucleus. The mechanisms for activity-dependent changes in Nova expression and localization are unknown. It is possible that the <italic>Nova</italic> gene loci may contain binding sites for immediate-early-genes (e.g. <italic>cFOS, Jak/Jun, EGF</italic>) or specific activity-dependent transcription factors (e.g. NPAS4, Satb1). With regard to control of its localization, previous work has discovered a nuclear-localization signal (NLS) within the Nova protein domains. It is however unknown whether their activation is also mobilized by splicing or post-translational modifications. For instance, <italic>Rbfox1</italic> undergoes activity-dependent mRNA splicing that results in exposure of an NLS and localization to the nucleus (<xref ref-type="bibr" rid="bib33">Lee et al., 2009</xref>; <xref ref-type="bibr" rid="bib62">Wamsley et al., 2018</xref>). Furthermore, our results indicate that activity itself regulates Nova2 RNA and protein stability. In the presence of KIR2.1, the levels of Nova protein appear to be dramatically reduced, even when Nova2 is over-expressed. In this latter context, clearly Nova2 levels are not constrained by mRNA production. These results indicate that the stability of Nova protein is at least partly dependent on activity. Taken together, these findings indicate that there exist multiple mechanisms by which cell activity is coupled to Nova function and AS within SST cINs.</p><p>We and others have shown that activity regulates programmed cell death (<xref ref-type="bibr" rid="bib45">Priya et al., 2018</xref>; <xref ref-type="bibr" rid="bib10">Denaxa et al., 2018</xref>; <xref ref-type="bibr" rid="bib64">Wong et al., 2018</xref>). However, we observed no indication that the loss of <italic>Nova2</italic> impacted SST cIN survival. In addition, we observed that NaChBac and KIR2.1 could modulate synaptogenesis in SST cINs both during and after the peak of cell death in this region (data not shown). Conversely, the number of phenotypic changes observed in conditional <italic>Nova</italic> loss of function mutants suggests that these genes have effects beyond synaptogenesis. Nova2 also targets genes involved in protein trafficking to the membrane, cell-cell signaling, and neurotransmitter/ion channel function, indicating it influences multiple aspects of SST cIN maturation. In addition, prior work from the Darnell lab has demonstrated a role for Nova2 in both migration and axonal pathfinding within the cortex, spinal cord, and brain stem (<xref ref-type="bibr" rid="bib51">Saito et al., 2016</xref>; <xref ref-type="bibr" rid="bib69">Yano et al., 2010</xref>). Taken together clearly much remains to be understood concerning the role Nova proteins play during development in specific brain regions, circuits, and cell types. Indeed, given the broad expression of Nova proteins and the strong phenotypes associated with both conditional and global <italic>Nova</italic> loss of function, studies of this RNABP will no doubt provide further insights into their contribution to normal and disease brain function.</p><sec id="s3-1"><title>Contact for reagent and resource sharing</title><p>Please contact GF or LAI for reagents and resources generated in this study.</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><table-wrap id="keyresource" position="anchor"><label>Key resources table</label><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="middle">Reagent type (species) or resource</th><th align="left" valign="middle">Designation</th><th align="left" valign="middle">Source or reference</th><th align="left" valign="middle">Identifiers</th><th align="left" valign="middle">Additional information</th></tr></thead><tbody><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">SST-Cre</td><td align="left" valign="middle">Jackson Laboratories</td><td align="left" valign="middle">13044</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">RCE-GFP</td><td align="left" valign="middle">Jackson Laboratories</td><td align="left" valign="middle">032037-JAX</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">tgLhx6;eGFP</td><td align="left" valign="middle">MMRC</td><td align="left" valign="middle">000246-MU</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">Nova1LoxP/LoxP</td><td align="left" valign="middle"><ext-link ext-link-type="uri" xlink:href="https://elifesciences.org/articles/00178">https://elifesciences.org/articles/00178</ext-link></td><td align="left" valign="middle">Gift from Darnell Lab</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">Nova2 LoxP/LoxP</td><td align="left" valign="middle"><ext-link ext-link-type="uri" xlink:href="https://elifesciences.org/articles/00178">https://elifesciences.org/articles/00178</ext-link></td><td align="left" valign="middle">Gift from Darnell Lab</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">TRE-Bi-SypGFP-tdTomato</td><td align="left" valign="middle">Jackson Laboratories</td><td align="left" valign="middle">12345</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">Rosa-tTA LoxP/LoxP</td><td align="left" valign="middle">Jackson Laboratories</td><td align="left" valign="middle">8600</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">Ai9 LoxP/LoxP</td><td align="left" valign="middle">Jackson Laboratories</td><td align="left" valign="middle">7909</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Strain, strain background (<italic>Mus musculus</italic>)</td><td align="left" valign="middle">Ai32 LoxP/LoxP</td><td align="left" valign="middle">Jackson Laboratories</td><td align="left" valign="middle">24109</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="bottom">Anti-GFP, Chicken Polyclonal IgY</td><td align="left" valign="middle">Abcam</td><td align="left" valign="middle">Ab13970</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Anti-RFP (5 F8), Rat monoclonal</td><td align="left" valign="middle">ChromoTek</td><td align="left" valign="middle">5 f8-100</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Anti-mCherry, Goat polyclonal</td><td align="left" valign="middle">Origene</td><td align="left" valign="middle">AB0040-200</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Anti-Somatostatin (YC7), Rat monoclonal</td><td align="left" valign="middle">EMD Millipore</td><td align="left" valign="middle">MAB354</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Somatostatin 14, Rabbit</td><td align="left" valign="middle">Peninsula Labs</td><td align="left" valign="middle">T-4103.0050</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Homer 1 c, Rabbit polyclonal</td><td align="left" valign="middle">Synaptic systems</td><td align="left" valign="middle">160 023</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Vglut 1, Guinea pig polyclonal</td><td align="left" valign="middle">Sigma</td><td align="left" valign="middle">ab5905</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Gephyrin, Mouse IgG monoclonal</td><td align="left" valign="middle">Synaptic systems</td><td align="left" valign="middle">147 011</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">VGAT, Rabbit polyclonal</td><td align="left" valign="middle">Synaptic systems</td><td align="left" valign="middle">131 003</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Nova1/2, Human polyclonal</td><td align="left" valign="middle">pan-Nova (anti-Nova paraneoplastic human serum)</td><td align="left" valign="middle">Gift from Darnell Lab</td><td align="left" valign="middle"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">tagBFP, Rabbit polyclonal</td><td align="left" valign="middle">Evrogen</td><td align="left" valign="middle">AB233</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Antibody</td><td align="left" valign="middle">Anti-cFOS (4), Rabbit polyclonal</td><td align="left" valign="middle">Santa Cruz Biotechnology</td><td align="left" valign="middle">SC-52</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Viral Vector</td><td align="left" valign="middle">AAV-Syn-DIO-NachBac-P2A-mCherry</td><td align="left" valign="middle">NYUAD</td><td align="left" valign="middle">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Viral Vector</td><td align="left" valign="middle">AAV-Syn-Kir2.1-P2A-mCherry</td><td align="left" valign="middle">NYUAD</td><td align="left" valign="middle">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Viral Vector</td><td align="left" valign="middle">AAV-Syn-DIO-Nova2-<break/>tagBFP</td><td align="left" valign="middle">NYUAD</td><td align="left" valign="middle">This paper</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Viral Vector</td><td align="left" valign="middle">VTKS2 Backbone</td><td align="left" valign="middle">NYUAD</td><td align="left" valign="middle">Addgene_170853</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle">BEDTools</td><td align="left" valign="middle">Quinlan Lab</td><td align="left" valign="middle">v2.17.0</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle">Picard tools</td><td align="left" valign="middle">Broad Institute</td><td align="left" valign="middle"><ext-link ext-link-type="uri" xlink:href="http://broadinstitute.github.io/picard/">http://broadinstitute.github.io/picard/</ext-link></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle">DESeq2</td><td align="left" valign="middle">Bioconductor</td><td align="left" valign="middle">R studio package</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle">rMATS</td><td align="left" valign="middle">Xing Lab</td><td align="left" valign="middle">v3.0.9</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle">Rstudio</td><td align="left" valign="middle">Rstudio.com</td><td align="left" valign="middle">Version 1.1.456</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle">Custom code</td><td align="left" valign="middle">This paper</td><td align="left" valign="middle"><ext-link ext-link-type="uri" xlink:href="https://github.com/IbrahimLab-23/Nova-proteins-and-synaptic-integration-of-Sst-interneurons">https://github.com/IbrahimLab-23/Nova-proteins-and-synaptic-integration-of-Sst-interneurons</ext-link>; <xref ref-type="bibr" rid="bib30">Laboratory of Neural Circuits, 2023</xref></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle">ImageJ 2.0.0 Java 1.8.0_66</td><td align="left" valign="middle">National Institute of Health</td><td align="left" valign="middle"><ext-link ext-link-type="uri" xlink:href="https://imagej.net/">https://imagej.net/</ext-link>; RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:SCR_003070">SCR_003070</ext-link></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle" rowspan="3">Clampfit 10.7 (pClamp)</td><td align="left" valign="middle" rowspan="3">Molecular Devices</td><td align="left" valign="middle"/><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle"><ext-link ext-link-type="uri" xlink:href="https://www.moleculardevices.com/products/software/pclamp.html">https://www.moleculardevices.com/products/software/pclamp.html</ext-link>; RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:SCR_011323">SCR_011323</ext-link></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle"/><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle" rowspan="2">Prism 9.1.2</td><td align="left" valign="middle" rowspan="2">Graphpad Software</td><td align="left" valign="middle" rowspan="2"><ext-link ext-link-type="uri" xlink:href="https://www.graphpad.com/">https://www.graphpad.com/</ext-link>; RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:SCR_002798">SCR_002798</ext-link></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle" rowspan="3">Zen Blue</td><td align="left" valign="middle" rowspan="3">Zeiss</td><td align="left" valign="middle"/><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle"><ext-link ext-link-type="uri" xlink:href="https://www.zeiss.com/microscopy/en_us/products/microscope-software/zen.html">https://www.zeiss.com/microscopy/en_us/products/microscope-software/zen.html</ext-link>; RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:SCR_013672">SCR_013672</ext-link></td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="middle">Software, algorithm</td><td align="left" valign="middle"/><td align="left" valign="bottom"/></tr></tbody></table></table-wrap><sec id="s4-1"><title>Mouse maintenance and mouse strains</title><p>All experimental procedures were conducted in accordance with the National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of the NYU School of Medicine and Harvard Medical School. Generation and genotyping of <italic>Sst<sup>Cre</sup></italic> (JAX Stock No. 013044, <xref ref-type="bibr" rid="bib55">Taniguchi et al., 2011</xref>), RCE<sup>eGFP</sup>(JAX Stock No. 032037, <xref ref-type="bibr" rid="bib54">Sousa et al., 2009</xref>), Lhx6 BAC transgenic (referred to as TgLhx6;eGFP) (MMRC Stock No. 000246-MU, <xref ref-type="bibr" rid="bib20">Gong et al., 2003</xref>), <italic>Nova1<sup>LoxP/LoxP</sup></italic> (<xref ref-type="bibr" rid="bib71">Yuan et al., 2018</xref>), <italic>Nova2<sup>LoxP/Lox</sup></italic>(<xref ref-type="bibr" rid="bib52">Saito et al., 2019</xref>), TRE-Bi-SypGFP-TdTomato (JAX Stock No. 012345, <xref ref-type="bibr" rid="bib34">Li et al., 2010</xref>), and Ai9 <italic>Rosa26<sup>LSL-tdTomato</sup></italic> (JAX Stock No. 007909), Ai32 <italic>Rosa26<sup>LSL-ChR2</sup></italic> (JAX Stock No. 024109), <italic>Rosa26<sup>LSL-tTa</sup></italic> (JAX Stock No. 008600). All mouse strains were maintained on a mixed background (Swiss Webster and C57/Bl6). The day of birth is considered P0. Information about the mouse strains including genotyping protocols can be found at <ext-link ext-link-type="uri" xlink:href="http://www.jax.org/">http://www.jax.org/</ext-link> and elsewhere (see above references).</p></sec><sec id="s4-2"><title>Immunochemistry and imaging</title><p>Embryos, neonate, juvenile, and adult mice were perfused inter cardiac with ice cold 4% PFA after being anesthetized on ice (neonates) or using sodium pentobarbital anesthesia in adults. Brains that were processed for immunofluorescence on slides were post-fixed and cryopreserved in 30% sucrose. Sixteen µm coronal sections were obtained using Cryostat (Leica Biosystems) and collected on super-frost coated slides, then allowed to dry and stored at –20 °C until use. For immunofluorescence, cryosections were thawed and allowed to dry for 5–10 min and rinsed in 1 x PBS. They were incubated at room temperature in a blocking solution of PBST (PBS-0.1%Tx-100) and 10% normal donkey serum (NDS) for 1 hr, followed by incubation with primary antibodies in PBS-T and 1% NDS at 4 °C overnight or 2 days. Samples were then washed 4 times with PBS-T and incubated with fluorescence-conjugated secondary Alexa antibodies (Life Technologies) in PBS-T with 1% NDS at room temperature for 1 hr. Slides were incubated for 5 min with DAPI, washed three times with PBS-T. Then slides were mounted with Fluoromount G (Southern Biotech) and imaged.</p><p>Brains that were processed for free-floating immunofluorescence were first post-fixed in 4% PFA overnight at 4 °C. Fifty-µm-thickness brain slices were taken on a Leica vibratome and stored in a cryoprotecting solution (40% PBS, 30% glycerol and 30% ethylene glycol) at –20 °C. For immunofluorescence, floating sections were blocked for 1 hr at RT in normal donkey or goat serum blocking buffer and incubated for 2–3 days at 4 °C with primary antibodies in blocking buffer. Sections were washed 4x30 min at RT in PBST, incubated overnight at 4 °C with secondary antibodies and DAPI in blocking buffer, washed 4x30 min at RT in PBST before being mounted on super-frost plus glass slides. Primary antibodies are listed in Key Resource Table.</p></sec><sec id="s4-3"><title>Nova1/2 localization</title><p>To quantify the Nova localization in SST cINs, mCherry+/SST cIN, KIR2.1+/SST cINs or NaChBac+/SST cIN (n=27 cells from 3 mice each); control/SST cIN or ECS+/SST cINs (n=27 cells from 3 mice each); Nova2OE/SST cIN or Nova2OE +KIR2.1/SST cINs (n=20 cells from 3 mice) were binned into two categories based on the cell compartment Nova1/2 protein was localized to: Cytoplasmic restricted or Nuclear-expressing (comprised of nuclear restricted or whole soma localization). The number of Nuclear-expressing cells was then divided by the number of cytoplasmic restricted cells to obtain a ratio for Nova localization from either mCherry+/SST cIN or KIR2.1+/SST cINs. This was collected from at least three tissue sections from at least three animals.</p></sec><sec id="s4-4"><title>Electroconvulsive Shock</title><p>Electroconvulsive stimulation (ECS) was administered to animals with pulses consisting of 1.0 s, 50 Hz, 75 mA stimulus of 0.7ms delivered using the Ugo Basile ECT unit Model 57800, as previously described (<xref ref-type="bibr" rid="bib21">Guo et al., 2011</xref>; <xref ref-type="bibr" rid="bib39">Ma et al., 2009</xref>). Control/sham animals were similarly handled using the exact same procedure but without the current administration.</p></sec><sec id="s4-5"><title>Confocal imaging and synaptic puncta analysis</title><p>Animals were perfused as described above. Post-fixation incubation prior to cryopreservation was skipped. Cryostat sections (16 μm) were subjected to IHC as described above. Images were taken within the S1 cortex of at least three different sections from at least three different animals per genotype with a Zeiss LSM 800 laser scanning confocal microscope. Scans were performed to obtain four optical Z-sections of 0.33 μm each (totaling ~1.2 μm max projection) with a 63 x/1.4 Oil DIC objective. The same scanning parameters (pinhole diameter, laser power/offset, speed/averaging) were used for all images. Maximum projections of four consecutive 0.33 μm stacks were analyzed with ImageJ (NIH) puncta analyzer plugin (<xref ref-type="bibr" rid="bib26">Ippolito and Eroglu, 2010</xref>) to count the number of individual puncta consisting of pre-synaptic and post-synaptic markers that are close enough together to be considered a putative synaptic puncta. Synaptic puncta density per image was calculated by normalization to total puncta acquired for each individual channel accounted in each image for each condition. Puncta Analyzer plugin for ImageJ is written by Barry Wark and is available for download (<ext-link ext-link-type="uri" xlink:href="https://github.com/carina-block/Puncta-analyzer/tree/v1.0">https://github.com/carina-block/Puncta-analyzer/tree/v1.0</ext-link>; <xref ref-type="bibr" rid="bib63">Wark et al., 2023</xref>). Nova protein intensity was performed as: Cryostat sections of 20 µm were immunostained with goat anti-mCherry and human anti-pan Nova (from Darnell Lab). Images were analyzed using Fiji/ImageJ and Nova1/2 protein intensity levels were assessed normalized against area of the cells expressing the AAV.</p></sec><sec id="s4-6"><title>Electrophysiological recordings</title><sec id="s4-6-1"><title>Slice preparation</title><p>Acute brain slices (300 μm thick) were prepared from P18-P22 mice. Mice were deeply anesthetized with isofluorane. The brain was removed and placed in ice-cold modified artificial cerebrospinal fluid (ACSF) of the following composition (in mM): 87 NaCl, 26 NaHCO<sub>3</sub>, 2.5 KCl, 1.25 NaH2PO4, 0.5 CaCl, 4 MgCl2, 10 glucose, 75 sucrose saturated with 95% O2, 5% CO<sub>2</sub> at pH = 7.4. Coronal sections were cut using a vibratome (Leica, VT 1200 S). Slices were then incubated at 34 C for 30 minutes and then stored at room temperature until use.</p></sec><sec id="s4-6-2"><title>Recordings</title><p>Slices were transferred to the recording chamber of an up-right microscope (Zeiss Axioskop) equipped with IR DIC. Cells were visualized using a 40 X IR water immersion objective. Slices were perfused with ACSF of the following composition (in mM): 125 NaCl, 25 NaHCO3, 2.5 KCl, 1.25 NaH<sub>2</sub>PO<sub>4</sub>, 2 CaCl<sub>2</sub>, 1 MgCl<sub>2</sub>, 20 glucose, saturated with 95% O<sub>2</sub>, 5% CO<sub>2</sub> at pH = 7.4 and maintained at a constant temperature (31 °C) using a heating chamber. Whole-cell recordings were made from randomly selected tdTomato-positive SST interneurons or tdTomato negative pyramidal cells from layer II-III or layer V of the somatosensory cortex. Miniature synaptic currents were recorded in the presence of 1 uM TTX in ACSF. Recording pipettes were pulled from borosilicate glass capillaries (Harvard Apparatus) and had a resistance of 3–5 MΩ when filled with the appropriate internal solution, as reported below. Recordings were performed using a Multiclamp 700B amplifier (Molecular Devices). The current clamp signals were filtered at 10 KHz and digitized at 40 kHz using a Digidata 1550 A and the Clampex 10 program suite (Molecular Devices). Miniature synaptic currents were filtered at 3 kHz and recorded with a sampling rate of 10 kHz. Voltage-clamp recordings were performed at a holding potential of 0 mV. Current-clamp recordings were performed at a holding potential of –70 mV. Cells were only accepted for analysis if the initial series resistance was less than 40 MΩ and did not change by more than 20% throughout the recording period. The series resistance was compensated online by at least ~60% in voltage-clamp mode. No correction was made for the junction potential between the pipette and the ACSF.</p><p>Passive and active membrane properties were recorded in current clamp mode by applying a series of hyperpolarizing and depolarizing current steps and the analysis was done in Clampfit (Molecular Devices). The cell input resistance was calculated from the peak of the voltage response to a 50 pA hyperpolarizing 1 s long current step according to Ohm’s law. Analysis of the action potential properties was done on the first spike observed during a series of depolarizing steps. Threshold was defined as the voltage at the point when the slope first exceeds a value of 20 V.s-1. Rheobase was defined as the amplitude of the first depolarizing current step at which firing was observed. Analysis of miniature inhibitory events was done using Clampfit’s template search.</p></sec><sec id="s4-6-3"><title>Pipette solutions</title><p>Solution for voltage-clamp recordings from pyramidal cells (in mM): 125 Cs-gluconate, 2 CsCl, 10 HEPES, 1 EGTA, 4 MgATP, 0.3 Na-GTP, 8 Phosphocreatine-Tris, 1 QX-314-Cl and 0.4% biocytin, equilibrated with CsOH at pH = 7.3. Solution for current clamp recordings from SST cINs (in mM): 130 K-Gluconate, 10 KCl, 10 HEPES, 0.2 EGTA, 4 MgATP, 0.3 NaGTP, 5 Phosphocreatine and 0.4% biocytin, equilibrated with KOH CO2 to a pH = 7.3.</p></sec></sec><sec id="s4-7"><title><italic>Nova2</italic> OE/ <italic>Nova2</italic> OE +KIR2.1 experiment</title><p><italic>Sst<sup>Cre</sup></italic> mice crossed with Ai32 mice were injected at P0/1 with either AAV2/1-Syn-DIO-Nova2-tagBFP or together with AAV2/1-Syn-DIO-Kir2.1-mCherry at 1:1 ratio in the S1 cortex. Mice were perfused at P21, brains harvested, sucrose protected and sectioned on a freezing microtome (Leica) at 20 µm thickness as described above. Primary antibodies are listed in Key Resource Table.</p></sec><sec id="s4-8"><title>Optogenetic stimulation</title><p>Blue-light (470 nm) was transmitted to the slice from an LED placed under the condenser of an up-right microscope (Olympus BX50). IPSCs were elicited by applying single 1ms blue-light pulses of varying intensities (max. stimulation intensity ~0.33 mW/mm<sup>2</sup>) and directed to L2/3 or L5 of the slice in the recording chamber. Light pulses were delivered every 5 s. The LED output was driven by a TTL output from the Clampex software of the pCLAMP 9.0 program suite (Molecular Devices).</p></sec><sec id="s4-9"><title>Isolation of cortical interneurons from the developing mouse cerebral cortex</title><p>Cortical interneurons were dissociated from postnatal mouse cortices (P8) as described (<xref ref-type="bibr" rid="bib62">Wamsley et al., 2018</xref>). We collected at least 3–5 KO and 3–5 ctl brains and maintained overall balanced numbers of females and males within each condition, in order to avoid sex- related gene expression biases. Following dissociation, cortical neurons in suspension were filtered and GFP +or TdTomato + fate-mapped interneurons were sorted by fluorescence activated-cell sorting (FACS) on either a Beckman Coulter MoFlo (Cytomation), BD FACSAria II SORP or Sony SY3200. Sorted cINs were collected and lyzed in 200 µl TRIzol LS Reagent, then thoroughly mixed and stored at –80 °c until further total RNA extraction.</p></sec><sec id="s4-10"><title>Nucleic acid extraction, RNA amplification, cDNA library preparation, and RNA sequencing</title><p>Total RNAs from sorted SST cINs (P8 mouse S1 cortices for <xref ref-type="fig" rid="fig2">Figure 2</xref>, <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C</xref>, <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>, <xref ref-type="fig" rid="fig4s2">Figure 4—figure supplement 2</xref> and <xref ref-type="fig" rid="fig5">Figure 5</xref>) were extracted using TRIzol LS Reagent and PicoPure columns (if &lt;20 K cells were recovered) or PureLink RNA Mini Kit (if &gt;20 K cells were recovered), with PureLink DNase for on-column treatment, following the manufacturers’ guidelines. RNA quality and quantity were measured with a Picochip using an Agilent Bioanalyzer and only samples with high quality total RNA were used (RIN: 7–10). 20 ng of total RNA was used for cDNA synthesis and amplification, using NuGEN Ovation RNA-Seq System V2 kit (NuGEN part # 7102). A total of 100 ng of amplified cDNA were used to make a library using the Ovation Ultralow Library System (NuGEN part # 0330). The samples were mulitplexed and subjected to 50-nucleotide paired-end read rapid with the Illumina HiSeq 2500 sequencer (v4 chemistry), to generate &gt;50 million reads per sample. Library preparation, quantification, pooling, clustering and sequencing was carried out at the NYULMC Genome Technology Center. qRT-PCR (quantitative RT-PCR) was performed using SYBR select master mix (Thermo Fisher Scientific) on cDNA synthesized using SuperScript II reverse transcriptase and oligo(dT) primers.</p><p>List of RT- and qRT-PCR primers:</p><table-wrap id="inlinetable1" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="top">Primer name</th><th align="left" valign="top">Sequence</th></tr></thead><tbody><tr><td align="left" valign="top">Adam22-FAM-fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGGGAATAATTGCCGGCACCAT</named-content></td></tr><tr><td align="left" valign="top">Adam22-Rv</td><td align="left" valign="top"><named-content content-type="sequence">GCGAGGTCTCCCATTTTCAC</named-content></td></tr><tr><td align="left" valign="top">Anks1b-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGGCTCCCTAGACGTTCCTCAC</named-content></td></tr><tr><td align="left" valign="top">Anks1b-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">GGATGATGCTGCCAGTACTG</named-content></td></tr><tr><td align="left" valign="top">Sez6-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGCCACCATCCACTTCTCCTGT</named-content></td></tr><tr><td align="left" valign="top">Sez6-Rev</td><td align="left" valign="top"><named-content content-type="sequence">GCTCCCTAGACGTTCCTCAC</named-content></td></tr><tr><td align="left" valign="top">Dlg3-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGTTCCCTGGGTTAAGTGACGA</named-content></td></tr><tr><td align="left" valign="top">Dlg3-Rev</td><td align="left" valign="top"><named-content content-type="sequence">TCATCGTTGACTCGGTCCTT</named-content></td></tr><tr><td align="left" valign="top">Syngap1-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGAACATCCAAAGGCAGCCAAG</named-content></td></tr><tr><td align="left" valign="top">Syngap1-Rev</td><td align="left" valign="top"><named-content content-type="sequence">GCCGGCTCACATAGAAAAGG</named-content></td></tr><tr><td align="left" valign="top">Prkrir-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGGGGTTGAGAATTGTAGGAGAGC</named-content></td></tr><tr><td align="left" valign="top">Prkrir--Rev</td><td align="left" valign="top"><named-content content-type="sequence">CTGCTATGCGGGTTGTTCAA</named-content></td></tr><tr><td align="left" valign="top">Sorbs2-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGCGATCGGAGCCAAGGAGTAT</named-content></td></tr><tr><td align="left" valign="top">Sorbs2-Rev</td><td align="left" valign="top"><named-content content-type="sequence">AGGCTTCTGTCTATGGAGGAC</named-content></td></tr><tr><td align="left" valign="top">Nrxn1-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGACACCTGATGATGGGCGAC</named-content></td></tr><tr><td align="left" valign="top">Nrxn1-Rev</td><td align="left" valign="top"><named-content content-type="sequence">TGAAGCATCAGTCCGTTCCT</named-content></td></tr><tr><td align="left" valign="top">Ezh2-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGTGAGAAGGGACCGGTTTGTT</named-content></td></tr><tr><td align="left" valign="top">Ezh2-Rev</td><td align="left" valign="top"><named-content content-type="sequence">GCATTCAGGGTCTTTAACGGG</named-content></td></tr><tr><td align="left" valign="top">Triobp-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGACCCTAGCCAATGGACACAG</named-content></td></tr><tr><td align="left" valign="top">Triobp-Rev</td><td align="left" valign="top"><named-content content-type="sequence">CTTGAAGTTGAGCAGATCGGG</named-content></td></tr><tr><td align="left" valign="top">Itch-FAM-Fw</td><td align="left" valign="top"><named-content content-type="sequence">CGTCGCCGTCCAGCTCGACCAGTGCATTTCACAGTGGCCTTC</named-content></td></tr><tr><td align="left" valign="top">Itch-Rev</td><td align="left" valign="top"><named-content content-type="sequence">CCCATGGAATCAAGCTGTGG</named-content></td></tr></tbody></table></table-wrap></sec><sec id="s4-11"><title>Bioinformatics</title><p>Downstream computational analysis were performed at the NYULMC Genome Technology Center and at KAUST. All the reads were mapped to the mouse reference genome (mm10) using the STAR aligner (<xref ref-type="bibr" rid="bib11">Dobin et al., 2013</xref>). Quality control of RNAseq libraries (i.e. the mean read insert sizes and their standard deviations) was calculated using Picard tools (v.1.126, RRID:<ext-link ext-link-type="uri" xlink:href="https://identifiers.org/RRID/RRID:SCR_006525">SCR_006525</ext-link>) (<ext-link ext-link-type="uri" xlink:href="http://broadinstitute.github.io/picard/">http://broadinstitute.github.io/picard/</ext-link>). The Read Per Million (RPM) normalized BigWig files were generated using BEDTools (v2.17.0) (<xref ref-type="bibr" rid="bib47">Quinlan and Hall, 2010</xref>) and bedGraphToBigWig tool (v4). For the SST cIN P8 ECS, approx. 60E6-80E6 reads were aligned per sample; for P8 <italic>Sst-Nova1-</italic>cKO, <italic>Sst-Nova2-</italic>cKO, <italic>Sst-Nova1/2-</italic>dKO, approx. 60E6-70E6 reads were aligned per sample; for P8 SST-cIN wt ECS and <italic>Sst-Nova1/2-</italic>dKO+ECS, approx. 60E6-80E6 reads were aligned per sample. The samples processed for downstream analysis were as follows: nine samples for SST cIN +ECS versus SST cIN ctl at P8 (4/5 samples per condition), sixsamples for <italic>Sst-Nova1-</italic>cKO removal versus SST cIN ctl (three samples per genotype), six samples for <italic>Sst-Nova2-</italic>cKO removal versus SST cIN ctl (three samples per genotype), six samples for <italic>Sst-Nova1/2-</italic>dKO removal versus SST cIN ctl (three samples per genotype), and seven samples for <italic>Sst-Nova1/2-</italic>dKO removal ECS versus SST cIN ctl ECS (fourcontrol samples, three KO samples). We performed differential expression analysis using DESeq2 R package for calculating the expression level of transcripts between different conditions. Genes with an adjusted p-value &lt;0.05 and log fold change (FC)≥0.5 were considered differentially expressed.</p><p>We used rMATS (v3.0.9) to quantify the AS event types (i.e. Skipped exons (SE), alternative 3' splice sites (A3SS), alternative 5' splice sites (A5SS), mutually exclusive exons (MXE) and retained introns (RI)). rMATS uses a counts-based model, it detects AS events using splice junction and exon body counts and calculates an exon inclusion level value ψ for each event in each condition. It then determines the differential |∆ψ| value across conditions (cut-offs for significance were placed at FDR &lt;0.05 and |∆ψ|≥0.1). To compare the level of similarity among the samples and their replicates, we used two methods: classical multidimensional scaling or principal-component analysis and Euclidean distance-based sample clustering. The downstream statistical analyses and generating plots were performed in Rstudio (Version 1.1.456) (<ext-link ext-link-type="uri" xlink:href="http://www.r-project.org/">http://www.r-project.org/</ext-link>).</p><p>To assess the enrichment for the Nova-binding motif in the differentially regulated exons we utilized rMAPS (<xref ref-type="bibr" rid="bib43">Park et al., 2016</xref>). We utilized the raw output from rMATS analysis (6 RNAseq experiments of SST cINs +ECS vs SST cINs ctl) with significant splicing events cut off at FDR &gt;50%. rMAPS performs position weight analysis to assess the enrichment of RNA-binding protein binding motifs in the exonic and flanking intronic regions of up-regulated or down-regulated exons and plots the motif density along with a given pValue in comparison to unregulated exons.</p><p>We performed GO analysis using the DAVID online Bioinformatics Resources 6.8 at FDR &gt;0.05 (unless otherwise specified) (<xref ref-type="bibr" rid="bib23">Huang et al., 2009</xref>) and tested PPI networks by utilizing DAPPLE at 10,000 permutations (<xref ref-type="bibr" rid="bib49">Rossin et al., 2011</xref>). The GO categories were assigned to each group of genes, and after that, we used ClusterProfiler, the R function that helps with gene functional annotation and to perform GO enrichment analysis.</p></sec><sec id="s4-12"><title>Validation of SST-cINs AS activity-dependent exons by RT-PCR</title><p>Total RNAs from sorted cINs from wt/ctl SST cINs, ECS SST cINs, and ECS <italic>Sst-Nova1/2-</italic>dKO were extracted as described above and at least three independent biological replicates were used in each experiment. RT-PCR validation of regulated exons was performed as described before (<xref ref-type="bibr" rid="bib22">Han et al., 2014</xref>). After denaturation, samples were run on 10% Novex TBE-Urea Gels (Thermo Fisher). Gels were directly scanned by ChemiDoc Imaging System (Bio-Rad) and quantified by ImageStudio program (Licor).</p></sec><sec id="s4-13"><title>Quantification and statistical analysis</title><p>No statistical method was used to pre-determine sample sizes, but our sample sizes were similar to those reported in previous publications in the field. In all figures: *, p-value &lt;0.05; **, p-value &lt;0.01; ***, p-value &lt;0.001; ****, p-value &lt;0.0001. Statistical analyses for motif enrichment were performed by rMAPS and differential alternative splicing changes were performed using rMATS. Percentages were compared with repeated t-tests in <italic>GraphPad Prism</italic> or <italic>Rstudio</italic>, and means ± (standard deviation, SD) are represented. Some statistical analyses and generating plots were performed in R environment (v3.1.1) (<ext-link ext-link-type="uri" xlink:href="http://www.r-project.org/">http://www.r-project.org/</ext-link>).</p><p>All values presented in the manuscript are average ± standard error of the mean (SEM). The statistical values for the intrinsic physiology are obtained using one-way ANOVA with Bonferroni correction for multiple comparisons between the different genotypes: Controls, <italic>Nova1-</italic>cKO<italic>, Nova2-</italic>cKO and <italic>Nova1/2-</italic>dKO (*p≤0.05, **p≤0.01, **p≤0.005). For the Channelrhodopsin output, we first determined if the data is normally distributed using Lilliefors test. In case of normal distribution, we performed student’s t-test was used to compare Control vs <italic>Nova1-</italic>cKO, and Control vs <italic>Nova2-</italic>cKO (*p≤0.05, **p≤0.01, ***p≤0.005).</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn><fn fn-type="COI-statement" id="conf2"><p>Founder of Regal Therapeutics</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Formal analysis, Supervision, Investigation, Visualization, Writing – original draft, Project administration, Writing – review and editing</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Resources, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing</p></fn><fn fn-type="con" id="con3"><p>Formal analysis, Validation, Visualization, Writing – review and editing</p></fn><fn fn-type="con" id="con4"><p>Data curation, Formal analysis, Validation, Writing – review and editing</p></fn><fn fn-type="con" id="con5"><p>Data curation, Formal analysis, Writing – review and editing</p></fn><fn fn-type="con" id="con6"><p>Formal analysis</p></fn><fn fn-type="con" id="con7"><p>Data curation</p></fn><fn fn-type="con" id="con8"><p>Data curation</p></fn><fn fn-type="con" id="con9"><p>Resources</p></fn><fn fn-type="con" id="con10"><p>Resources</p></fn><fn fn-type="con" id="con11"><p>Formal analysis</p></fn><fn fn-type="con" id="con12"><p>Supervision</p></fn><fn fn-type="con" id="con13"><p>Resources</p></fn><fn fn-type="con" id="con14"><p>Methodology, Writing – original draft</p></fn><fn fn-type="con" id="con15"><p>Resources</p></fn><fn fn-type="con" id="con16"><p>Conceptualization, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>All experimental procedures were conducted in accordance with the National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of the NYU School of Medicine and Harvard Medical School (Protocol # IS00001269). All surgeries were performed under isoflurane anesthesia and every effort was made to minimize suffering.</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="mdar"><label>MDAR checklist</label><media xlink:href="elife-86842-mdarchecklist1-v2.pdf" mimetype="application" mime-subtype="pdf"/></supplementary-material><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>Intrinsic properties of SST-Nova1 SST-Nova2 and SST-Nova12-dKO.</title></caption><media xlink:href="elife-86842-supp1-v2.docx" mimetype="application" mime-subtype="docx"/></supplementary-material><supplementary-material id="supp2"><label>Supplementary file 2.</label><caption><title>Exon coverage of synaptic genes.</title></caption><media xlink:href="elife-86842-supp2-v2.docx" mimetype="application" mime-subtype="docx"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>Sequencing data has been deposited in GEO under accession code GSE143316. All processed RNA sequencing and splicing analysis data and sashimi plots can also be found at <ext-link ext-link-type="uri" xlink:href="https://github.com/IbrahimLab-23/Nova-proteins-and-synaptic-integration-of-Sst-interneurons">https://github.com/IbrahimLab-23/Nova-proteins-and-synaptic-integration-of-Sst-interneurons</ext-link> (copy archived at <xref ref-type="bibr" rid="bib30">Laboratory of Neural Circuits, 2023</xref>).</p><p>The following dataset was generated:</p><p><element-citation publication-type="data" specific-use="isSupplementedBy" id="dataset1"><person-group person-group-type="author"><name><surname>Wamsley</surname><given-names>B</given-names></name><name><surname>Khodadadi-Jamayran</surname><given-names>A</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2022">2022</year><data-title>Nova proteins direct synaptic integration of somatostatin interneurons through activity- dependent alternative splicing</data-title><source>NCBI Gene Expression Omnibus</source><pub-id pub-id-type="accession" xlink:href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE143316">GSE143316</pub-id></element-citation></p></sec><ack id="ack"><title>Acknowledgements</title><p>We would like to thank the NYULMC Division of Advanced Research Technologies and their personnel: Mouse Genotyping Core (Jiali Deng and Jisen Dai); Cytometry and Cell Sorting Core (Kamilah Ryan, Keith Kobylarz, Yulia Chupalova, and Michael Gregory); Genome Technology Center (Adriana Heguy); and Applied Bioinformatics Laboratory (Aristotelis Tsirigos), which is supported in part by grant UL1 TR00038 from the National Center for Advancing Translational Sciences (NCATS), NIH. CCSC and GTC are supported by the Cancer Center Support Grant, <ext-link ext-link-type="uri" xlink:href="https://www.sciencedirect.com/science/article/pii/S0896627318308286#gs3">P30CA016087</ext-link>, at the Laura and Isaac Perlmutter Cancer Center. We would also like to thank Yanjie Qiu and Marian Fernandez-Otero for helping with genotyping at Harvard Medical School. We would like to thank the extended Fishell Laboratory for critical reading of the manuscript. Work in the GF lab is supported by the following NIH grants: R01 NS081297, R01 MH071679, UG3 MH120096, P01 NS074972 and by the Simons Foundation SFARI.</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Adler</surname><given-names>A</given-names></name><name><surname>Zhao</surname><given-names>R</given-names></name><name><surname>Shin</surname><given-names>ME</given-names></name><name><surname>Yasuda</surname><given-names>R</given-names></name><name><surname>Gan</surname><given-names>WB</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Somatostatin-expressing interneurons enable and maintain learning-dependent sequential activation of pyramidal neurons</article-title><source>Neuron</source><volume>102</volume><fpage>202</fpage><lpage>216</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2019.01.036</pub-id><pub-id pub-id-type="pmid">30792151</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Allène</surname><given-names>C</given-names></name><name><surname>Cattani</surname><given-names>A</given-names></name><name><surname>Ackman</surname><given-names>JB</given-names></name><name><surname>Bonifazi</surname><given-names>P</given-names></name><name><surname>Aniksztejn</surname><given-names>L</given-names></name><name><surname>Ben-Ari</surname><given-names>Y</given-names></name><name><surname>Cossart</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Sequential generation of two distinct Synapse-driven network patterns in developing neocortex</article-title><source>The Journal of Neuroscience</source><volume>28</volume><fpage>12851</fpage><lpage>12863</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.3733-08.2008</pub-id><pub-id pub-id-type="pmid">19036979</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Allene</surname><given-names>C</given-names></name><name><surname>Cossart</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Early NMDA receptor-driven waves of activity in the developing neocortex: physiological or pathological network Oscillations</article-title><source>The Journal of Physiology</source><volume>588</volume><fpage>83</fpage><lpage>91</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2009.178798</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ascoli</surname><given-names>GA</given-names></name><name><surname>Alonso-Nanclares</surname><given-names>L</given-names></name><name><surname>Anderson</surname><given-names>SA</given-names></name><name><surname>Barrionuevo</surname><given-names>G</given-names></name><name><surname>Benavides-Piccione</surname><given-names>R</given-names></name><name><surname>Burkhalter</surname><given-names>A</given-names></name><name><surname>Buzsáki</surname><given-names>G</given-names></name><name><surname>Cauli</surname><given-names>B</given-names></name><name><surname>Defelipe</surname><given-names>J</given-names></name><name><surname>Fairén</surname><given-names>A</given-names></name><name><surname>Feldmeyer</surname><given-names>D</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name><name><surname>Fregnac</surname><given-names>Y</given-names></name><name><surname>Freund</surname><given-names>TF</given-names></name><name><surname>Gardner</surname><given-names>D</given-names></name><name><surname>Gardner</surname><given-names>EP</given-names></name><name><surname>Goldberg</surname><given-names>JH</given-names></name><name><surname>Helmstaedter</surname><given-names>M</given-names></name><name><surname>Hestrin</surname><given-names>S</given-names></name><name><surname>Karube</surname><given-names>F</given-names></name><name><surname>Kisvárday</surname><given-names>ZF</given-names></name><name><surname>Lambolez</surname><given-names>B</given-names></name><name><surname>Lewis</surname><given-names>DA</given-names></name><name><surname>Marin</surname><given-names>O</given-names></name><name><surname>Markram</surname><given-names>H</given-names></name><name><surname>Muñoz</surname><given-names>A</given-names></name><name><surname>Packer</surname><given-names>A</given-names></name><name><surname>Petersen</surname><given-names>CCH</given-names></name><name><surname>Rockland</surname><given-names>KS</given-names></name><name><surname>Rossier</surname><given-names>J</given-names></name><name><surname>Rudy</surname><given-names>B</given-names></name><name><surname>Somogyi</surname><given-names>P</given-names></name><name><surname>Staiger</surname><given-names>JF</given-names></name><name><surname>Tamas</surname><given-names>G</given-names></name><name><surname>Thomson</surname><given-names>AM</given-names></name><name><surname>Toledo-Rodriguez</surname><given-names>M</given-names></name><name><surname>Wang</surname><given-names>Y</given-names></name><name><surname>West</surname><given-names>DC</given-names></name><name><surname>Yuste</surname><given-names>R</given-names></name><collab>Petilla Interneuron Nomenclature Group</collab></person-group><year iso-8601-date="2008">2008</year><article-title>Petilla terminology: nomenclature of features of GABAergic interneurons of the cerebral cortex</article-title><source>Nature Reviews. Neuroscience</source><volume>9</volume><fpage>557</fpage><lpage>568</lpage><pub-id pub-id-type="doi">10.1038/nrn2402</pub-id><pub-id pub-id-type="pmid">18568015</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Basaldella</surname><given-names>E</given-names></name><name><surname>Takeoka</surname><given-names>A</given-names></name><name><surname>Sigrist</surname><given-names>M</given-names></name><name><surname>Arber</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Multisensory signaling shapes vestibulo-motor circuit specificity</article-title><source>Cell</source><volume>163</volume><fpage>301</fpage><lpage>312</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2015.09.023</pub-id><pub-id pub-id-type="pmid">26451482</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bernard</surname><given-names>C</given-names></name><name><surname>Exposito-Alonso</surname><given-names>D</given-names></name><name><surname>Selten</surname><given-names>M</given-names></name><name><surname>Sanalidou</surname><given-names>S</given-names></name><name><surname>Hanusz-Godoy</surname><given-names>A</given-names></name><name><surname>Aguilera</surname><given-names>A</given-names></name><name><surname>Hamid</surname><given-names>F</given-names></name><name><surname>Oozeer</surname><given-names>F</given-names></name><name><surname>Maeso</surname><given-names>P</given-names></name><name><surname>Allison</surname><given-names>L</given-names></name><name><surname>Russell</surname><given-names>M</given-names></name><name><surname>Fleck</surname><given-names>RA</given-names></name><name><surname>Rico</surname><given-names>B</given-names></name><name><surname>Marín</surname><given-names>O</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Cortical wiring by Synapse type-specific control of local protein synthesis</article-title><source>Science</source><volume>378</volume><elocation-id>eabm7466</elocation-id><pub-id pub-id-type="doi">10.1126/science.abm7466</pub-id><pub-id pub-id-type="pmid">36423280</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bortone</surname><given-names>D</given-names></name><name><surname>Polleux</surname><given-names>F</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Kcc2 expression promotes the termination of cortical Interneuron migration in a voltage-sensitive calcium-dependent manner</article-title><source>Neuron</source><volume>62</volume><fpage>53</fpage><lpage>71</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2009.01.034</pub-id><pub-id pub-id-type="pmid">19376067</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cossart</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The maturation of cortical Interneuron diversity: how multiple developmental journeys shape the emergence of proper network function</article-title><source>Current Opinion in Neurobiology</source><volume>21</volume><fpage>160</fpage><lpage>168</lpage><pub-id pub-id-type="doi">10.1016/j.conb.2010.10.003</pub-id><pub-id pub-id-type="pmid">21074988</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>De Marco García</surname><given-names>NV</given-names></name><name><surname>Karayannis</surname><given-names>T</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Neuronal activity is required for the development of specific cortical Interneuron subtypes</article-title><source>Nature</source><volume>472</volume><fpage>351</fpage><lpage>355</lpage><pub-id pub-id-type="doi">10.1038/nature09865</pub-id><pub-id pub-id-type="pmid">21460837</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Denaxa</surname><given-names>M</given-names></name><name><surname>Neves</surname><given-names>G</given-names></name><name><surname>Rabinowitz</surname><given-names>A</given-names></name><name><surname>Kemlo</surname><given-names>S</given-names></name><name><surname>Liodis</surname><given-names>P</given-names></name><name><surname>Burrone</surname><given-names>J</given-names></name><name><surname>Pachnis</surname><given-names>V</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Modulation of apoptosis controls inhibitory Interneuron number in the cortex</article-title><source>Cell Reports</source><volume>22</volume><fpage>1710</fpage><lpage>1721</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2018.01.064</pub-id><pub-id pub-id-type="pmid">29444425</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dobin</surname><given-names>A</given-names></name><name><surname>Davis</surname><given-names>CA</given-names></name><name><surname>Schlesinger</surname><given-names>F</given-names></name><name><surname>Drenkow</surname><given-names>J</given-names></name><name><surname>Zaleski</surname><given-names>C</given-names></name><name><surname>Jha</surname><given-names>S</given-names></name><name><surname>Batut</surname><given-names>P</given-names></name><name><surname>Chaisson</surname><given-names>M</given-names></name><name><surname>Gingeras</surname><given-names>TR</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>STAR: Ultrafast universal RNA-seq aligner</article-title><source>Bioinformatics</source><volume>29</volume><fpage>15</fpage><lpage>21</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/bts635</pub-id><pub-id pub-id-type="pmid">23104886</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dredge</surname><given-names>BK</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Nova regulates GABA(A) receptor Gamma2 alternative splicing via a distal downstream UCAU-rich Intronic splicing enhancer</article-title><source>Molecular and Cellular Biology</source><volume>23</volume><fpage>4687</fpage><lpage>4700</lpage><pub-id pub-id-type="doi">10.1128/MCB.23.13.4687-4700.2003</pub-id><pub-id pub-id-type="pmid">12808107</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Eom</surname><given-names>T</given-names></name><name><surname>Zhang</surname><given-names>C</given-names></name><name><surname>Wang</surname><given-names>H</given-names></name><name><surname>Lay</surname><given-names>K</given-names></name><name><surname>Fak</surname><given-names>J</given-names></name><name><surname>Noebels</surname><given-names>JL</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>NOVA-dependent regulation of cryptic NMD Exons controls synaptic protein levels after seizure</article-title><source>eLife</source><volume>2</volume><elocation-id>e00178</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.00178</pub-id><pub-id pub-id-type="pmid">23359859</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Favuzzi</surname><given-names>E</given-names></name><name><surname>Deogracias</surname><given-names>R</given-names></name><name><surname>Marques-Smith</surname><given-names>A</given-names></name><name><surname>Maeso</surname><given-names>P</given-names></name><name><surname>Jezequel</surname><given-names>J</given-names></name><name><surname>Exposito-Alonso</surname><given-names>D</given-names></name><name><surname>Balia</surname><given-names>M</given-names></name><name><surname>Kroon</surname><given-names>T</given-names></name><name><surname>Hinojosa</surname><given-names>AJ</given-names></name><name><surname>F Maraver</surname><given-names>E</given-names></name><name><surname>Rico</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Distinct molecular programs regulate Synapse specificity in cortical inhibitory circuits</article-title><source>Science</source><volume>363</volume><fpage>413</fpage><lpage>417</lpage><pub-id pub-id-type="doi">10.1126/science.aau8977</pub-id><pub-id pub-id-type="pmid">30679375</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fishell</surname><given-names>G</given-names></name><name><surname>Rudy</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Mechanisms of inhibition within the Telencephalon: &quot;where the wild things are</article-title><source>Annual Review of Neuroscience</source><volume>34</volume><fpage>535</fpage><lpage>567</lpage><pub-id pub-id-type="doi">10.1146/annurev-neuro-061010-113717</pub-id><pub-id pub-id-type="pmid">21469958</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fuccillo</surname><given-names>MV</given-names></name><name><surname>Földy</surname><given-names>C</given-names></name><name><surname>Gökce</surname><given-names>Ö</given-names></name><name><surname>Rothwell</surname><given-names>PE</given-names></name><name><surname>Sun</surname><given-names>GL</given-names></name><name><surname>Malenka</surname><given-names>RC</given-names></name><name><surname>Südhof</surname><given-names>TC</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Single-cell mRNA profiling reveals cell-type-specific expression of Neurexin Isoforms</article-title><source>Neuron</source><volume>87</volume><fpage>326</fpage><lpage>340</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2015.06.028</pub-id><pub-id pub-id-type="pmid">26182417</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Furlanis</surname><given-names>E</given-names></name><name><surname>Scheiffele</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Regulation of neuronal differentiation, function, and plasticity by alternative splicing</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>34</volume><fpage>451</fpage><lpage>469</lpage><pub-id pub-id-type="doi">10.1146/annurev-cellbio-100617-062826</pub-id><pub-id pub-id-type="pmid">30028642</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Furlanis</surname><given-names>E</given-names></name><name><surname>Traunmüller</surname><given-names>L</given-names></name><name><surname>Fucile</surname><given-names>G</given-names></name><name><surname>Scheiffele</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Landscape of Ribosome-engaged transcript Isoforms reveals extensive neuronal-cell-Class- specific alternative splicing programs</article-title><source>Nature Neuroscience</source><volume>22</volume><fpage>1709</fpage><lpage>1717</lpage><pub-id pub-id-type="doi">10.1038/s41593-019-0465-5</pub-id><pub-id pub-id-type="pmid">31451803</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Garaschuk</surname><given-names>O</given-names></name><name><surname>Linn</surname><given-names>J</given-names></name><name><surname>Eilers</surname><given-names>J</given-names></name><name><surname>Konnerth</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Large-scale oscillatory calcium waves in the immature cortex</article-title><source>Nature Neuroscience</source><volume>3</volume><fpage>452</fpage><lpage>459</lpage><pub-id pub-id-type="doi">10.1038/74823</pub-id><pub-id pub-id-type="pmid">10769384</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gong</surname><given-names>S</given-names></name><name><surname>Zheng</surname><given-names>C</given-names></name><name><surname>Doughty</surname><given-names>ML</given-names></name><name><surname>Losos</surname><given-names>K</given-names></name><name><surname>Didkovsky</surname><given-names>N</given-names></name><name><surname>Schambra</surname><given-names>UB</given-names></name><name><surname>Nowak</surname><given-names>NJ</given-names></name><name><surname>Joyner</surname><given-names>A</given-names></name><name><surname>Leblanc</surname><given-names>G</given-names></name><name><surname>Hatten</surname><given-names>ME</given-names></name><name><surname>Heintz</surname><given-names>N</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>A gene expression Atlas of the central nervous system based on bacterial artificial Chromosomes</article-title><source>Nature</source><volume>425</volume><fpage>917</fpage><lpage>925</lpage><pub-id pub-id-type="doi">10.1038/nature02033</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guo</surname><given-names>JU</given-names></name><name><surname>Ma</surname><given-names>DK</given-names></name><name><surname>Mo</surname><given-names>H</given-names></name><name><surname>Ball</surname><given-names>MP</given-names></name><name><surname>Jang</surname><given-names>M-H</given-names></name><name><surname>Bonaguidi</surname><given-names>MA</given-names></name><name><surname>Balazer</surname><given-names>JA</given-names></name><name><surname>Eaves</surname><given-names>HL</given-names></name><name><surname>Xie</surname><given-names>B</given-names></name><name><surname>Ford</surname><given-names>E</given-names></name><name><surname>Zhang</surname><given-names>K</given-names></name><name><surname>Ming</surname><given-names>G</given-names></name><name><surname>Gao</surname><given-names>Y</given-names></name><name><surname>Song</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Neuronal activity modifies the DNA methylation landscape in the adult brain</article-title><source>Nature Neuroscience</source><volume>14</volume><fpage>1345</fpage><lpage>1351</lpage><pub-id pub-id-type="doi">10.1038/nn.2900</pub-id><pub-id pub-id-type="pmid">21874013</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Han</surname><given-names>A</given-names></name><name><surname>Stoilov</surname><given-names>P</given-names></name><name><surname>Linares</surname><given-names>AJ</given-names></name><name><surname>Zhou</surname><given-names>Y</given-names></name><name><surname>Fu</surname><given-names>XD</given-names></name><name><surname>Black</surname><given-names>DL</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>De Novo prediction of Ptbp1 binding and splicing targets reveals unexpected features of its RNA recognition and function</article-title><source>PLOS Computational Biology</source><volume>10</volume><elocation-id>e1003442</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pcbi.1003442</pub-id><pub-id pub-id-type="pmid">24499931</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Huang</surname><given-names>DW</given-names></name><name><surname>Sherman</surname><given-names>BT</given-names></name><name><surname>Lempicki</surname><given-names>RA</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Systematic and integrative analysis of large Gene lists using DAVID Bioinformatics resources</article-title><source>Nature Protocols</source><volume>4</volume><fpage>44</fpage><lpage>57</lpage><pub-id pub-id-type="doi">10.1038/nprot.2008.211</pub-id><pub-id pub-id-type="pmid">19131956</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ibrahim</surname><given-names>LA</given-names></name><name><surname>Huang</surname><given-names>S</given-names></name><name><surname>Fernandez-Otero</surname><given-names>M</given-names></name><name><surname>Sherer</surname><given-names>M</given-names></name><name><surname>Qiu</surname><given-names>Y</given-names></name><name><surname>Vemuri</surname><given-names>S</given-names></name><name><surname>Xu</surname><given-names>Q</given-names></name><name><surname>Machold</surname><given-names>R</given-names></name><name><surname>Pouchelon</surname><given-names>G</given-names></name><name><surname>Rudy</surname><given-names>B</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Bottom-up inputs are required for establishment of top-down Connectivity onto cortical layer 1 Neurogliaform cells</article-title><source>Neuron</source><volume>109</volume><fpage>3473</fpage><lpage>3485</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2021.08.004</pub-id><pub-id pub-id-type="pmid">34478630</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Iijima</surname><given-names>T</given-names></name><name><surname>Wu</surname><given-names>K</given-names></name><name><surname>Witte</surname><given-names>H</given-names></name><name><surname>Hanno-Iijima</surname><given-names>Y</given-names></name><name><surname>Glatter</surname><given-names>T</given-names></name><name><surname>Richard</surname><given-names>S</given-names></name><name><surname>Scheiffele</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Sam68 regulates neuronal activity-dependent alternative splicing of Neurexin-1</article-title><source>Cell</source><volume>147</volume><fpage>1601</fpage><lpage>1614</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2011.11.028</pub-id><pub-id pub-id-type="pmid">22196734</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ippolito</surname><given-names>DM</given-names></name><name><surname>Eroglu</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Quantifying synapses: an Immunocytochemistry-based assay to quantify Synapse number</article-title><source>Journal of Visualized Experiments</source><elocation-id>2270</elocation-id><pub-id pub-id-type="doi">10.3791/2270</pub-id><pub-id pub-id-type="pmid">21113117</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kapfer</surname><given-names>C</given-names></name><name><surname>Glickfeld</surname><given-names>LL</given-names></name><name><surname>Atallah</surname><given-names>BV</given-names></name><name><surname>Scanziani</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Supralinear increase of recurrent inhibition during sparse activity in the Somatosensory cortex</article-title><source>Nature Neuroscience</source><volume>10</volume><fpage>743</fpage><lpage>753</lpage><pub-id pub-id-type="doi">10.1038/nn1909</pub-id><pub-id pub-id-type="pmid">17515899</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Karayannis</surname><given-names>T</given-names></name><name><surname>De Marco García</surname><given-names>NV</given-names></name><name><surname>Fishell</surname><given-names>GJ</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Functional adaptation of cortical interneurons to attenuated activity is subtype-specific</article-title><source>Frontiers in Neural Circuits</source><volume>6</volume><elocation-id>66</elocation-id><pub-id pub-id-type="doi">10.3389/fncir.2012.00066</pub-id><pub-id pub-id-type="pmid">23015781</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kepecs</surname><given-names>A</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Interneuron cell types are fit to function</article-title><source>Nature</source><volume>505</volume><fpage>318</fpage><lpage>326</lpage><pub-id pub-id-type="doi">10.1038/nature12983</pub-id><pub-id pub-id-type="pmid">24429630</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="software"><person-group person-group-type="author"><collab>Laboratory of Neural Circuits</collab></person-group><year iso-8601-date="2023">2023</year><data-title>Nova proteins direct synaptic integration of Somatostatin interneurons through activity-dependent alternative splicing</data-title><version designator="swh:1:rev:14f0623c0cf82a27e040ca7a8261da347810a99b">swh:1:rev:14f0623c0cf82a27e040ca7a8261da347810a99b</version><source>Software Heritage</source><ext-link ext-link-type="uri" xlink:href="https://archive.softwareheritage.org/swh:1:dir:a04d919c68e34ba38af869122b1105d79ae445f6;origin=https://github.com/IbrahimLab-23/Nova-Proteins-and-Synaptic-Integration-of-Sst-Interneurons;visit=swh:1:snp:46dc1d9ff6c7c39bbd7239d4aa368b117b63e231;anchor=swh:1:rev:14f0623c0cf82a27e040ca7a8261da347810a99b">https://archive.softwareheritage.org/swh:1:dir:a04d919c68e34ba38af869122b1105d79ae445f6;origin=https://github.com/IbrahimLab-23/Nova-Proteins-and-Synaptic-Integration-of-Sst-Interneurons;visit=swh:1:snp:46dc1d9ff6c7c39bbd7239d4aa368b117b63e231;anchor=swh:1:rev:14f0623c0cf82a27e040ca7a8261da347810a99b</ext-link></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Le Magueresse</surname><given-names>C</given-names></name><name><surname>Monyer</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Gabaergic interneurons shape the functional maturation of the cortex</article-title><source>Neuron</source><volume>77</volume><fpage>388</fpage><lpage>405</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2013.01.011</pub-id><pub-id pub-id-type="pmid">23395369</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname><given-names>JA</given-names></name><name><surname>Xing</surname><given-names>Y</given-names></name><name><surname>Nguyen</surname><given-names>D</given-names></name><name><surname>Xie</surname><given-names>J</given-names></name><name><surname>Lee</surname><given-names>CJ</given-names></name><name><surname>Black</surname><given-names>DL</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Depolarization and Cam kinase IV modulate NMDA receptor splicing through two essential RNA elements</article-title><source>PLOS Biology</source><volume>5</volume><elocation-id>e40</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pbio.0050040</pub-id><pub-id pub-id-type="pmid">17298178</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname><given-names>J-A</given-names></name><name><surname>Tang</surname><given-names>Z-Z</given-names></name><name><surname>Black</surname><given-names>DL</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>An inducible change in Fox-1/A2Bp1 splicing modulates the alternative splicing of downstream neuronal target Exons</article-title><source>Genes &amp; Development</source><volume>23</volume><fpage>2284</fpage><lpage>2293</lpage><pub-id pub-id-type="doi">10.1101/gad.1837009</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname><given-names>L</given-names></name><name><surname>Tasic</surname><given-names>B</given-names></name><name><surname>Micheva</surname><given-names>KD</given-names></name><name><surname>Ivanov</surname><given-names>VM</given-names></name><name><surname>Spletter</surname><given-names>ML</given-names></name><name><surname>Smith</surname><given-names>SJ</given-names></name><name><surname>Luo</surname><given-names>L</given-names></name><name><surname>McCabe</surname><given-names>BD</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Visualizing the distribution of synapses from individual neurons in the mouse brain</article-title><source>PLOS ONE</source><volume>5</volume><elocation-id>e11503</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0011503</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Licatalosi</surname><given-names>DD</given-names></name><name><surname>Mele</surname><given-names>A</given-names></name><name><surname>Fak</surname><given-names>JJ</given-names></name><name><surname>Ule</surname><given-names>J</given-names></name><name><surname>Kayikci</surname><given-names>M</given-names></name><name><surname>Chi</surname><given-names>SW</given-names></name><name><surname>Clark</surname><given-names>TA</given-names></name><name><surname>Schweitzer</surname><given-names>AC</given-names></name><name><surname>Blume</surname><given-names>JE</given-names></name><name><surname>Wang</surname><given-names>X</given-names></name><name><surname>Darnell</surname><given-names>JC</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>HITS-CLIP yields genome-wide insights into brain alternative RNA processing</article-title><source>Nature</source><volume>456</volume><fpage>464</fpage><lpage>469</lpage><pub-id pub-id-type="doi">10.1038/nature07488</pub-id><pub-id pub-id-type="pmid">18978773</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lim</surname><given-names>L</given-names></name><name><surname>Mi</surname><given-names>D</given-names></name><name><surname>Llorca</surname><given-names>A</given-names></name><name><surname>Marín</surname><given-names>O</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Development and functional diversification of cortical interneurons</article-title><source>Neuron</source><volume>100</volume><fpage>294</fpage><lpage>313</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2018.10.009</pub-id><pub-id pub-id-type="pmid">30359598</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lin</surname><given-names>CW</given-names></name><name><surname>Sim</surname><given-names>S</given-names></name><name><surname>Ainsworth</surname><given-names>A</given-names></name><name><surname>Okada</surname><given-names>M</given-names></name><name><surname>Kelsch</surname><given-names>W</given-names></name><name><surname>Lois</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Genetically increased cell-intrinsic excitability enhances neuronal integration into adult brain circuits</article-title><source>Neuron</source><volume>65</volume><fpage>32</fpage><lpage>39</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2009.12.001</pub-id><pub-id pub-id-type="pmid">20152111</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>Z</given-names></name><name><surname>Wang</surname><given-names>L</given-names></name><name><surname>Welch</surname><given-names>JD</given-names></name><name><surname>Ma</surname><given-names>H</given-names></name><name><surname>Zhou</surname><given-names>Y</given-names></name><name><surname>Vaseghi</surname><given-names>HR</given-names></name><name><surname>Yu</surname><given-names>S</given-names></name><name><surname>Wall</surname><given-names>JB</given-names></name><name><surname>Alimohamadi</surname><given-names>S</given-names></name><name><surname>Zheng</surname><given-names>M</given-names></name><name><surname>Yin</surname><given-names>C</given-names></name><name><surname>Shen</surname><given-names>W</given-names></name><name><surname>Prins</surname><given-names>JF</given-names></name><name><surname>Liu</surname><given-names>J</given-names></name><name><surname>Qian</surname><given-names>L</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Single-cell Transcriptomics reconstructs fate conversion from fibroblast to cardiomyocyte</article-title><source>Nature</source><volume>551</volume><fpage>100</fpage><lpage>104</lpage><pub-id pub-id-type="doi">10.1038/nature24454</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname><given-names>DK</given-names></name><name><surname>Jang</surname><given-names>MH</given-names></name><name><surname>Guo</surname><given-names>JU</given-names></name><name><surname>Kitabatake</surname><given-names>Y</given-names></name><name><surname>Chang</surname><given-names>ML</given-names></name><name><surname>Pow-Anpongkul</surname><given-names>N</given-names></name><name><surname>Flavell</surname><given-names>RA</given-names></name><name><surname>Lu</surname><given-names>B</given-names></name><name><surname>Ming</surname><given-names>GL</given-names></name><name><surname>Song</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Neuronal activity-induced Gadd45B promotes epigenetic DNA Demethylation and adult Neurogenesis</article-title><source>Science</source><volume>323</volume><fpage>1074</fpage><lpage>1077</lpage><pub-id pub-id-type="doi">10.1126/science.1166859</pub-id><pub-id pub-id-type="pmid">19119186</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mauger</surname><given-names>O</given-names></name><name><surname>Lemoine</surname><given-names>F</given-names></name><name><surname>Scheiffele</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Targeted Intron retention and Excision for rapid Gene regulation in response to neuronal activity</article-title><source>Neuron</source><volume>92</volume><fpage>1266</fpage><lpage>1278</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2016.11.032</pub-id><pub-id pub-id-type="pmid">28009274</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Minlebaev</surname><given-names>M</given-names></name><name><surname>Colonnese</surname><given-names>M</given-names></name><name><surname>Tsintsadze</surname><given-names>T</given-names></name><name><surname>Sirota</surname><given-names>A</given-names></name><name><surname>Khazipov</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Early Γ Oscillations synchronize developing thalamus and cortex</article-title><source>Science</source><volume>334</volume><fpage>226</fpage><lpage>229</lpage><pub-id pub-id-type="doi">10.1126/science.1210574</pub-id><pub-id pub-id-type="pmid">21998388</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nigro</surname><given-names>MJ</given-names></name><name><surname>Hashikawa-Yamasaki</surname><given-names>Y</given-names></name><name><surname>Rudy</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Diversity and connectivity of layer 5 Somatostatin-expressing interneurons in the mouse barrel cortex</article-title><source>The Journal of Neuroscience</source><volume>38</volume><fpage>1622</fpage><lpage>1633</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.2415-17.2017</pub-id><pub-id pub-id-type="pmid">29326172</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Park</surname><given-names>JW</given-names></name><name><surname>Jung</surname><given-names>S</given-names></name><name><surname>Rouchka</surname><given-names>EC</given-names></name><name><surname>Tseng</surname><given-names>YT</given-names></name><name><surname>Xing</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>rMAPS: RNA map analysis and plotting server for alternative Exon regulation</article-title><source>Nucleic Acids Research</source><volume>44</volume><fpage>W333</fpage><lpage>W338</lpage><pub-id pub-id-type="doi">10.1093/nar/gkw410</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pouchelon</surname><given-names>G</given-names></name><name><surname>Dwivedi</surname><given-names>D</given-names></name><name><surname>Bollmann</surname><given-names>Y</given-names></name><name><surname>Agba</surname><given-names>CK</given-names></name><name><surname>Xu</surname><given-names>Q</given-names></name><name><surname>Mirow</surname><given-names>AMC</given-names></name><name><surname>Kim</surname><given-names>S</given-names></name><name><surname>Qiu</surname><given-names>Y</given-names></name><name><surname>Sevier</surname><given-names>E</given-names></name><name><surname>Ritola</surname><given-names>KD</given-names></name><name><surname>Cossart</surname><given-names>R</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>The organization and development of cortical Interneuron Presynaptic circuits are area specific</article-title><source>Cell Reports</source><volume>37</volume><elocation-id>109993</elocation-id><pub-id pub-id-type="doi">10.1016/j.celrep.2021.109993</pub-id><pub-id pub-id-type="pmid">34758329</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Priya</surname><given-names>R</given-names></name><name><surname>Paredes</surname><given-names>MF</given-names></name><name><surname>Karayannis</surname><given-names>T</given-names></name><name><surname>Yusuf</surname><given-names>N</given-names></name><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Jaglin</surname><given-names>X</given-names></name><name><surname>Graef</surname><given-names>I</given-names></name><name><surname>Alvarez-Buylla</surname><given-names>A</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Activity regulates cell death within cortical interneurons through a calcineurin-dependent mechanism</article-title><source>Cell Reports</source><volume>22</volume><fpage>1695</fpage><lpage>1709</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2018.01.007</pub-id><pub-id pub-id-type="pmid">29444424</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Quesnel-Vallières</surname><given-names>M</given-names></name><name><surname>Dargaei</surname><given-names>Z</given-names></name><name><surname>Irimia</surname><given-names>M</given-names></name><name><surname>Gonatopoulos-Pournatzis</surname><given-names>T</given-names></name><name><surname>Ip</surname><given-names>JY</given-names></name><name><surname>Wu</surname><given-names>M</given-names></name><name><surname>Sterne-Weiler</surname><given-names>T</given-names></name><name><surname>Nakagawa</surname><given-names>S</given-names></name><name><surname>Woodin</surname><given-names>MA</given-names></name><name><surname>Blencowe</surname><given-names>BJ</given-names></name><name><surname>Cordes</surname><given-names>SP</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Misregulation of an activity-dependent splicing network as a common mechanism underlying autism spectrum disorders</article-title><source>Molecular Cell</source><volume>64</volume><fpage>1023</fpage><lpage>1034</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2016.11.033</pub-id><pub-id pub-id-type="pmid">27984743</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Quinlan</surname><given-names>AR</given-names></name><name><surname>Hall</surname><given-names>IM</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Bedtools: a flexible suite of utilities for comparing Genomic features</article-title><source>Bioinformatics</source><volume>26</volume><fpage>841</fpage><lpage>842</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btq033</pub-id><pub-id pub-id-type="pmid">20110278</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Racca</surname><given-names>C</given-names></name><name><surname>Gardiol</surname><given-names>A</given-names></name><name><surname>Eom</surname><given-names>T</given-names></name><name><surname>Ule</surname><given-names>J</given-names></name><name><surname>Triller</surname><given-names>A</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>The neuronal splicing factor Nova Co-Localizes with target Rnas in the Dendrite</article-title><source>Frontiers in Neural Circuits</source><volume>4</volume><elocation-id>5</elocation-id><pub-id pub-id-type="doi">10.3389/neuro.04.005.2010</pub-id><pub-id pub-id-type="pmid">20407637</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rossin</surname><given-names>EJ</given-names></name><name><surname>Lage</surname><given-names>K</given-names></name><name><surname>Raychaudhuri</surname><given-names>S</given-names></name><name><surname>Xavier</surname><given-names>RJ</given-names></name><name><surname>Tatar</surname><given-names>D</given-names></name><name><surname>Benita</surname><given-names>Y</given-names></name><name><surname>Cotsapas</surname><given-names>C</given-names></name><name><surname>Daly</surname><given-names>MJ</given-names></name><name><surname>Gojobori</surname><given-names>T</given-names></name><collab>International Inflammatory Bowel Disease Genetics Constortium</collab></person-group><year iso-8601-date="2011">2011</year><article-title>Proteins encoded in Genomic regions associated with immune-mediated disease physically interact and suggest underlying biology</article-title><source>PLOS Genetics</source><volume>7</volume><elocation-id>e1001273</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.1001273</pub-id><pub-id pub-id-type="pmid">21249183</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rudy</surname><given-names>B</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name><name><surname>Lee</surname><given-names>S</given-names></name><name><surname>Hjerling-Leffler</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Three groups of interneurons account for nearly 100% of neocortical GABAergic neurons</article-title><source>Developmental Neurobiology</source><volume>71</volume><fpage>45</fpage><lpage>61</lpage><pub-id pub-id-type="doi">10.1002/dneu.20853</pub-id><pub-id pub-id-type="pmid">21154909</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Saito</surname><given-names>Y</given-names></name><name><surname>Miranda-Rottmann</surname><given-names>S</given-names></name><name><surname>Ruggiu</surname><given-names>M</given-names></name><name><surname>Park</surname><given-names>CY</given-names></name><name><surname>Fak</surname><given-names>JJ</given-names></name><name><surname>Zhong</surname><given-names>R</given-names></name><name><surname>Duncan</surname><given-names>JS</given-names></name><name><surname>Fabella</surname><given-names>BA</given-names></name><name><surname>Junge</surname><given-names>HJ</given-names></name><name><surname>Chen</surname><given-names>Z</given-names></name><name><surname>Araya</surname><given-names>R</given-names></name><name><surname>Fritzsch</surname><given-names>B</given-names></name><name><surname>Hudspeth</surname><given-names>AJ</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Nova2-mediated RNA regulation is required for axonal Pathfinding during development</article-title><source>eLife</source><volume>5</volume><elocation-id>e14371</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.14371</pub-id><pub-id pub-id-type="pmid">27223325</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Saito</surname><given-names>Y</given-names></name><name><surname>Yuan</surname><given-names>Y</given-names></name><name><surname>Zucker-Scharff</surname><given-names>I</given-names></name><name><surname>Fak</surname><given-names>JJ</given-names></name><name><surname>Jereb</surname><given-names>S</given-names></name><name><surname>Tajima</surname><given-names>Y</given-names></name><name><surname>Licatalosi</surname><given-names>DD</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Differential Nova2-mediated splicing in excitatory and inhibitory neurons regulates cortical development and cerebellar function</article-title><source>Neuron</source><volume>101</volume><fpage>707</fpage><lpage>720</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2018.12.019</pub-id><pub-id pub-id-type="pmid">30638744</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Silberberg</surname><given-names>G</given-names></name><name><surname>Markram</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Disynaptic inhibition between neocortical pyramidal cells mediated by Martinotti cells</article-title><source>Neuron</source><volume>53</volume><fpage>735</fpage><lpage>746</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2007.02.012</pub-id><pub-id pub-id-type="pmid">17329212</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sousa</surname><given-names>VH</given-names></name><name><surname>Miyoshi</surname><given-names>G</given-names></name><name><surname>Hjerling-Leffler</surname><given-names>J</given-names></name><name><surname>Karayannis</surname><given-names>T</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Characterization of Nkx6-2-derived neocortical Interneuron lineages</article-title><source>Cerebral Cortex</source><volume>19 Suppl 1</volume><fpage>i1</fpage><lpage>i10</lpage><pub-id pub-id-type="doi">10.1093/cercor/bhp038</pub-id><pub-id pub-id-type="pmid">19363146</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Taniguchi</surname><given-names>H</given-names></name><name><surname>He</surname><given-names>M</given-names></name><name><surname>Wu</surname><given-names>P</given-names></name><name><surname>Kim</surname><given-names>S</given-names></name><name><surname>Paik</surname><given-names>R</given-names></name><name><surname>Sugino</surname><given-names>K</given-names></name><name><surname>Kvitsiani</surname><given-names>D</given-names></name><name><surname>Fu</surname><given-names>Y</given-names></name><name><surname>Lu</surname><given-names>J</given-names></name><name><surname>Lin</surname><given-names>Y</given-names></name><name><surname>Miyoshi</surname><given-names>G</given-names></name><name><surname>Shima</surname><given-names>Y</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name><name><surname>Nelson</surname><given-names>SB</given-names></name><name><surname>Huang</surname><given-names>ZJ</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>A resource of CRE driver lines for genetic targeting of GABAergic neurons in cerebral cortex</article-title><source>Neuron</source><volume>71</volume><fpage>995</fpage><lpage>1013</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2011.07.026</pub-id><pub-id pub-id-type="pmid">21943598</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tremblay</surname><given-names>R</given-names></name><name><surname>Lee</surname><given-names>S</given-names></name><name><surname>Rudy</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Gabaergic interneurons in the neocortex: from cellular properties to circuits</article-title><source>Neuron</source><volume>91</volume><fpage>260</fpage><lpage>292</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2016.06.033</pub-id><pub-id pub-id-type="pmid">27477017</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ule</surname><given-names>J</given-names></name><name><surname>Jensen</surname><given-names>K</given-names></name><name><surname>Mele</surname><given-names>A</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>CLIP: A method for identifying protein–RNA interaction sites in living cells</article-title><source>Methods</source><volume>37</volume><fpage>376</fpage><lpage>386</lpage><pub-id pub-id-type="doi">10.1016/j.ymeth.2005.07.018</pub-id><pub-id pub-id-type="pmid">16314267</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ule</surname><given-names>J</given-names></name><name><surname>Stefani</surname><given-names>G</given-names></name><name><surname>Mele</surname><given-names>A</given-names></name><name><surname>Ruggiu</surname><given-names>M</given-names></name><name><surname>Wang</surname><given-names>X</given-names></name><name><surname>Taneri</surname><given-names>B</given-names></name><name><surname>Gaasterland</surname><given-names>T</given-names></name><name><surname>Blencowe</surname><given-names>BJ</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>An RNA map predicting Nova-dependent splicing regulation</article-title><source>Nature</source><volume>444</volume><fpage>580</fpage><lpage>586</lpage><pub-id pub-id-type="doi">10.1038/nature05304</pub-id><pub-id pub-id-type="pmid">17065982</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vuong</surname><given-names>CK</given-names></name><name><surname>Black</surname><given-names>DL</given-names></name><name><surname>Zheng</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>The Neurogenetics of alternative splicing</article-title><source>Nature Reviews. Neuroscience</source><volume>17</volume><fpage>265</fpage><lpage>281</lpage><pub-id pub-id-type="doi">10.1038/nrn.2016.27</pub-id><pub-id pub-id-type="pmid">27094079</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vuong</surname><given-names>CK</given-names></name><name><surname>Wei</surname><given-names>W</given-names></name><name><surname>Lee</surname><given-names>JA</given-names></name><name><surname>Lin</surname><given-names>CH</given-names></name><name><surname>Damianov</surname><given-names>A</given-names></name><name><surname>de la Torre-Ubieta</surname><given-names>L</given-names></name><name><surname>Halabi</surname><given-names>R</given-names></name><name><surname>Otis</surname><given-names>KO</given-names></name><name><surname>Martin</surname><given-names>KC</given-names></name><name><surname>O’Dell</surname><given-names>TJ</given-names></name><name><surname>Black</surname><given-names>DL</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Rbfox1 regulates synaptic transmission through the inhibitory neuron-specific vSNARE Vamp1</article-title><source>Neuron</source><volume>98</volume><fpage>127</fpage><lpage>141</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2018.03.008</pub-id><pub-id pub-id-type="pmid">29621484</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wamsley</surname><given-names>B</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Genetic and activity-dependent mechanisms underlying Interneuron diversity</article-title><source>Nature Reviews Neuroscience</source><volume>18</volume><fpage>299</fpage><lpage>309</lpage><pub-id pub-id-type="doi">10.1038/nrn.2017.30</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wamsley</surname><given-names>B</given-names></name><name><surname>Jaglin</surname><given-names>XH</given-names></name><name><surname>Favuzzi</surname><given-names>E</given-names></name><name><surname>Quattrocolo</surname><given-names>G</given-names></name><name><surname>Nigro</surname><given-names>MJ</given-names></name><name><surname>Yusuf</surname><given-names>N</given-names></name><name><surname>Khodadadi-Jamayran</surname><given-names>A</given-names></name><name><surname>Rudy</surname><given-names>B</given-names></name><name><surname>Fishell</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Rbfox1 mediates cell-type-specific splicing in cortical interneurons</article-title><source>Neuron</source><volume>100</volume><fpage>846</fpage><lpage>859</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2018.09.026</pub-id><pub-id pub-id-type="pmid">30318414</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="software"><person-group person-group-type="author"><name><surname>Wark</surname><given-names>B</given-names></name><name><surname>Schindelin</surname><given-names>J</given-names></name><name><surname>Stavish</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2023">2023</year><data-title>Puncta-Analyzer V2.0</data-title><version designator="c7431c8">c7431c8</version><source>GitHub</source><ext-link ext-link-type="uri" xlink:href="https://github.com/carina-block/Puncta-analyzer/tree/v1.0">https://github.com/carina-block/Puncta-analyzer/tree/v1.0</ext-link></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wong</surname><given-names>FK</given-names></name><name><surname>Bercsenyi</surname><given-names>K</given-names></name><name><surname>Sreenivasan</surname><given-names>V</given-names></name><name><surname>Portalés</surname><given-names>A</given-names></name><name><surname>Fernández-Otero</surname><given-names>M</given-names></name><name><surname>Marín</surname><given-names>O</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Pyramidal cell regulation of Interneuron survival Sculpts cortical networks</article-title><source>Nature</source><volume>557</volume><fpage>668</fpage><lpage>673</lpage><pub-id pub-id-type="doi">10.1038/s41586-018-0139-6</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xie</surname><given-names>J</given-names></name><name><surname>Black</surname><given-names>DL</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>A Camk IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels</article-title><source>Nature</source><volume>410</volume><fpage>936</fpage><lpage>939</lpage><pub-id pub-id-type="doi">10.1038/35073593</pub-id><pub-id pub-id-type="pmid">11309619</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname><given-names>JW</given-names></name><name><surname>Hanganu-Opatz</surname><given-names>IL</given-names></name><name><surname>Sun</surname><given-names>JJ</given-names></name><name><surname>Luhmann</surname><given-names>HJ</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Three patterns of oscillatory activity Differentially synchronize developing neocortical networks in vivo</article-title><source>The Journal of Neuroscience</source><volume>29</volume><fpage>9011</fpage><lpage>9025</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.5646-08.2009</pub-id><pub-id pub-id-type="pmid">19605639</pub-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname><given-names>JW</given-names></name><name><surname>An</surname><given-names>S</given-names></name><name><surname>Sun</surname><given-names>JJ</given-names></name><name><surname>Reyes-Puerta</surname><given-names>V</given-names></name><name><surname>Kindler</surname><given-names>J</given-names></name><name><surname>Berger</surname><given-names>T</given-names></name><name><surname>Kilb</surname><given-names>W</given-names></name><name><surname>Luhmann</surname><given-names>HJ</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Thalamic network Oscillations synchronize Ontogenetic columns in the newborn rat barrel cortex</article-title><source>Cerebral Cortex</source><volume>23</volume><fpage>1299</fpage><lpage>1316</lpage><pub-id pub-id-type="doi">10.1093/cercor/bhs103</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname><given-names>Y</given-names></name><name><surname>Park</surname><given-names>JW</given-names></name><name><surname>Bebee</surname><given-names>TW</given-names></name><name><surname>Warzecha</surname><given-names>CC</given-names></name><name><surname>Guo</surname><given-names>Y</given-names></name><name><surname>Shang</surname><given-names>X</given-names></name><name><surname>Xing</surname><given-names>Y</given-names></name><name><surname>Carstens</surname><given-names>RP</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Determination of a comprehensive alternative splicing regulatory network and Combinatorial regulation by key factors during the epithelial-to-Mesenchymal transition</article-title><source>Molecular and Cellular Biology</source><volume>36</volume><fpage>1704</fpage><lpage>1719</lpage><pub-id pub-id-type="doi">10.1128/MCB.00019-16</pub-id><pub-id pub-id-type="pmid">27044866</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yano</surname><given-names>M</given-names></name><name><surname>Hayakawa-Yano</surname><given-names>Y</given-names></name><name><surname>Mele</surname><given-names>A</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Nova2 regulates neuronal migration through an RNA switch in Disabled-1 signaling</article-title><source>Neuron</source><volume>66</volume><fpage>848</fpage><lpage>858</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2010.05.007</pub-id><pub-id pub-id-type="pmid">20620871</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yu</surname><given-names>CR</given-names></name><name><surname>Power</surname><given-names>J</given-names></name><name><surname>Barnea</surname><given-names>G</given-names></name><name><surname>O’Donnell</surname><given-names>S</given-names></name><name><surname>Brown</surname><given-names>HEV</given-names></name><name><surname>Osborne</surname><given-names>J</given-names></name><name><surname>Axel</surname><given-names>R</given-names></name><name><surname>Gogos</surname><given-names>JA</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Spontaneous neural activity is required for the establishment and maintenance of the olfactory sensory map</article-title><source>Neuron</source><volume>42</volume><fpage>553</fpage><lpage>566</lpage><pub-id pub-id-type="doi">10.1016/s0896-6273(04)00224-7</pub-id><pub-id pub-id-type="pmid">15157418</pub-id></element-citation></ref><ref id="bib71"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yuan</surname><given-names>Y</given-names></name><name><surname>Xie</surname><given-names>S</given-names></name><name><surname>Darnell</surname><given-names>JC</given-names></name><name><surname>Darnell</surname><given-names>AJ</given-names></name><name><surname>Saito</surname><given-names>Y</given-names></name><name><surname>Phatnani</surname><given-names>H</given-names></name><name><surname>Murphy</surname><given-names>EA</given-names></name><name><surname>Zhang</surname><given-names>C</given-names></name><name><surname>Maniatis</surname><given-names>T</given-names></name><name><surname>Darnell</surname><given-names>RB</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Cell type-specific CLIP reveals that NOVA regulates cytoskeleton interactions in motoneurons 1–19</article-title><source>Genome Biology</source><volume>19</volume><elocation-id>117</elocation-id><pub-id pub-id-type="doi">10.1186/s13059-018-1493-2</pub-id><pub-id pub-id-type="pmid">30111345</pub-id></element-citation></ref></ref-list></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.86842.sa0</article-id><title-group><article-title>Editor's evaluation</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Nelson</surname><given-names>Sacha B</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/05abbep66</institution-id><institution>Brandeis University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group></front-stub><body><p>This is an important study that explores the roles of a set of RNA binding proteins on the connectivity and development of a prominent class of neocortical interneurons. The authors provide convincing evidence that these proteins regulate alternative splicing of key effector genes in these neurons and regulate neuronal inputs and outputs in an activity-dependent manner.</p></body></sub-article><sub-article article-type="decision-letter" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.86842.sa1</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Nelson</surname><given-names>Sacha B</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/05abbep66</institution-id><institution>Brandeis University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><contrib-group><contrib contrib-type="reviewer"><name><surname>Nelson</surname><given-names>Sacha B</given-names></name><role>Reviewer</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/05abbep66</institution-id><institution>Brandeis University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text id="sa2-box1"><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></boxed-text><p><bold>Decision letter after peer review:</bold></p><p>[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]</p><p>Thank you for submitting your work entitled &quot;Nova proteins direct synaptic integration of somatostatin interneurons through activity- dependent alternative splicing&quot; for consideration by <italic>eLife</italic>. Your article has been reviewed by 3 peer reviewers, including Sacha B Nelson as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by a Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Kevin Beier (Reviewer #2).</p><p>Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in <italic>eLife</italic>.</p><p>Summary</p><p>As you can see from the comments below, each of the reviewers found the topic important and thought that a number of the features of the study were well carried out and that there were some interesting results. Although each of the reviewers also raised concerns, there was some initial disagreement about how easily these could be addressed. After further discussion between the editors and reviewers, there was broad agreement that there are issues that make interpretation problematic and preclude publication without a significant amount of new work. Given the number of experiments that would be required to address the key concerns, and the <italic>eLife</italic> policy that revisions should entail only work that can be completed relatively quickly, we cannot recommend revision.</p><p>The core concerns (in part outlined below) are:</p><p>1) The necessity of Nova proteins for the effects of activity are not convincingly established;</p><p>2) Possible changes in gene expression levels are not adequately disentangled from changes in splicing;</p><p>3) The effect of activity on Nova protein stability/levels/activity are not adequately documented.</p><p><italic>Reviewer #1:</italic></p><p>This is a thorough and interesting study of the role of Nova1 and 2 RNA binding proteins (RBPs) in the activity-dependent development of Martinotti-type SST interneurons in the mouse cerebral cortex. The paper is likely to interest both those with a focused interest in neuronal splicing as well as those with more general interests in cortical circuit development. The paper will impact these fields both by revealing the importance of these specific RBPs as well as by providing a resource of activity-dependent splice variants which can be followed in these cells to understand either the mechanisms of activity-dependent control of these processes, or the downstream effects on synaptogenesis and circuit function. The major limitations of the present manuscript are that some findings are difficult to interpret, given the available data, and some of the presentation is hard to follow, perhaps reflecting incomplete editing of a prior revision.</p><p>1) The scientific point made in Figure 3B is unclear: If at P2, excitatory neurons have not yet turned on Nova1, does this really matter, does it really indicate any specificity? At P8 (more relevant to manipulation performed) is the difference between exc and inh. neurons significant? If significance is hard to assess, maybe this point (together with 3A, C should be left out).</p><p>2) p. 13: &quot;Interestingly, SST-dKO mutants exhibited less altered splicing events than the single SST-Nova2mutant, suggesting that some inclusion and exclusion AS events are antagonistically directed by Nova1 and Nova2.&quot; This is indeed interesting, but it is difficult for the reader to assess the sensitivity and reproducibility of these measurements. Some estimate of the sensitivity and noise in the measurements that can then be used to predict the degree of overlap between the 3 KO conditions tested expected by chance is required if one is to conclude anything about these overlaps (including both the overlaps shown in Figure S4C-E and the reduced overlap in the number of events between Nova2 and the double KO). This is especially true since phenotypically, the Nova2 and double KO seem so similar (Figure 4).</p><p>3) The interpretation of Figure 6 depends upon knowing the relative level of overexpression of Nova2. Is the effect of KIR2.1 simply to reduce Nova2 levels back to control levels or is there a separate activity dependent regulation of Nova2 localization or activity which is at work here? Although ideally these experiments should have been designed in a way that permits this comparison, if they were not it would probably be sufficient to discuss this point and make clear to the reader that this is still unknown. The discussion does note: &quot;In the presence of KIR2.1, the levels of Nova protein appear to be dramatically reduced, even when Nova2 is over-expressed&quot; but it is not clear which data are being referred to. Figure 6 shows nuclear/cyto ratios but not overall protein levels.</p><p><italic>Reviewer #2:</italic></p><p>In the manuscript by Wamsley et al., the authors report that neuronal activity drives expression of Nova proteins in somatostatin interneurons in the cortex, and that Nova proteins direct both the development of inputs and outputs of these neurons through mediating alternative splicing of various transcripts. Though it is not explicitly shown that alternative splicing is the mechanism by which Nova proteins act, this is a reasonable hypothesis given the previously shown functions of Nova proteins. The investigators use a variety of methods to test their hypotheses and show how activity patterns can mediate the development of these cortical interneurons. The manuscript is both interesting and well-written. However, I have a few technical concerns about the work, and there are areas that I believe require further clarification.</p><p>The fact that mCherry is directly fused to Kir2.1 or NaChBac (or at least it appears so – information on these viral vectors is missing from the methods) may be problematic. Kir2.1 expression levels in neurons tend to be low, perhaps because the cell can only tolerate so much. I am not sure about NaChBac. This creates a problem when assessing axonal density in this manuscript e.g., Figures 1C and 1E. mCherry expression is dependent on both expression levels of the ion channel to which it is fused, as well as trafficking/localization. For the control experiment, cytoplasmic mCherry is used, which would have very different targeting/trafficking properties than membrane-localized protein. Therefore there are quite a few perhaps unintended variables in Figure 1 that the investigators should discuss.</p><p>I also thought that the data from these experiments should be normalized, for example to the numbers of infected cells, or expression levels per cell. Both metrics in Figure 1 (and all anatomical experiments throughout the manuscript) are dependent on how many cells are infected by the AAVs used, or how robustly the markers are expressed. Without this normalization, it is unclear how these results may be affected by technical artifacts.</p><p>It is confusing to me why synaptic physiology results from the double cKO animals are not presented in Figure 4. The authors note that these mice were physiologically abnormal and exhibit early lethality. Yet they were able to perform quality recordings from these animals (Figure S5). In that case I am curious what the puncta results would be from these double cKO animals (analogous to panels 4A-B and 4E-F).</p><p>For Figure 4, differences in IPSC amplitude could be driven by different numbers of infected cells, or more robust ChR2 expression in the control vs Nova1 or Nova2 cKO conditions. It would help to either normalize the expression of ChR2 (e.g., anatomical quantification). Also, the strength of individual synapses could be assessed by replacing extracellular ca<sup>2+</sup> with Sr2+ to evoke quantal release from SST cINs.</p><p>The switching between a single cKO and double cKO animals was very confusing to me. If these mice were sufficiently problematic that the data should be presented in the supplemental and not main figures, I do not understand why Figure 5 was performed with the double cKO and not single cKO animals. This should be clarified.</p><p>The investigators make a note about AS events (relating to figure S4) that I feel is slightly misleading. They make the statement that &quot;We found that the number of alterations in the SST-Nova2 AS events that overlap with SST-dKO is almost three times higher than that observed when comparing the overlap between SST-dKO and SST-Nova1.&quot; This is misleading as it was already noted that Nova2 loss results in about 3x more AS events than Nova1 loss. Thus it would be expected that, simply by this numeric difference, there would be 3x more overlap with the dKO condition. Indeed, for Nova1 25 overlap/124 total altered = 20%, and Nova2 62 overlap/339 total = 20%, or Nova1/Nova2 overlap 25/62 vs Nova1/Nova2 total 124/339 = 40%. Indeed this doesn't seem like a major point to emphasize, unless I am misunderstanding the intention of the authors.</p><p>Figure 5 seems highly focused though the results should have been broad given the nature of the assays being performed. The GO analysis in Figure S6 seems much more interesting than validating one gene via qPCR. Perhaps these data could be added to the main figure.</p><p>I was fairly satisfied with this manuscript until Figure 6, where I got confused.</p><p>Nova OE = more axons and synapses, Figure 6 (no information about inputs)</p><p>Nova cKO = fewer axons/synapses (Figure 4)</p><p>Kir2.1 = fewer axons/synapses (Figure 6)</p><p>Question: What would happen with activation (via ECS or NaChBac) in the Nova cKO mice?</p><p>Question: What is the effect of Nova cKO on basal cellular activity of cells normally expressing Nova?</p><p>It seems that Kir2.1, assuming the only effect is to hyperpolarize cells, is the dominant driver of function. However this is confusing to me. If the expression of Nova proteins is activity-dependent, it makes sense Kir2.1 would be epistatic to Nova protein expression. But it also appears to be the case that Kir2.1 functions downstream of Nova expression, as Kir2.1 can prevent the function of Nova OE. The only explanation I can think of is that reducing cellular activity (e.g., via Kir2.1) is the master regulator of this pathway – increased activity drives Nova protein expression, but reduced activity actively inhibits Nova expression and function. If this is the case, reducing activity thus is dominant over downstream pathways that typically signal axon/synapse growth (e.g., via Nova protein function).</p><p>However, how that would work in the context of the experiments performed is confusing.</p><p>NovaOE + Kir2.1 = blocks Nova function (presumably by reducing Nova protein levels), Figure 6. This makes sense if activity is necessary for transcription or translation of Nova proteins. But it is rather more confusing when considering that OE is though TRE-driven expression. Thus, one would have to argue either there are enhancer elements within the Nova protein that are activity-dependent, or rather, that Nova transcription is blocked without activity (though presumably Nova in the AAV context contains no introns, though this is not described in the methods). That, or somehow Nova protein is actively degraded on a rapid timescale in the absence of basal levels of activity. If this is the case, this should be explored, or explained. In general, the mode of activity as a master regulator, and Nova's potential role, should be more clearly explained or demonstrated.</p><p><italic>Reviewer #3:</italic></p><p>In their manuscript, Wamsley et al. present an interesting and novel set of claims which if true would be of appropriate impact for publication in <italic>eLife</italic>. They conclude that (1) during development, axonal and inhibitory synaptic density in SST-INs is mediated by activity, and (2) these axonal and synaptic changes are mediated in turn by expression and nuclear localization of splicing regulators Nova1 and Nova2 and (3) Nova1/2-mediated changes in mRNA splicing. While this is an appealing set of conclusions, some lines of evidence require further vetting and some inconsistencies required resolution before this should be considered for publication.</p><p>1. In Figure 1, the authors show phenotypic changes, axon and synapse reorganization, after activity manipulations using Kir2.1 and NaChBac. In order to truly show that Nova mediates Kir2.1 or NaChBac activity-induced changes in axon and synapse density – and to fully back the message claimed in the title – the authors should at least show that in the Nova KOs, NaChBac does not elicit the axon and synapse density increase shown in Figure 1. This question is somewhat investigated in Figure 6, but this experiment does not establish if the axon/synapse density decrease in KIR2.1 co-expressing animals is due to Nova down-regulation, or Nova down-regulation appears as one consequence of activity dampening, but has nothing to do with axon/synapse elimination. Alternatively, the authors might show in the Nova KOs that ECS-induced activity does not change axon synapse density. However, the current manuscript has not yet shown that ECS would eventually lead to phenotypic changes similar to those in Figure 1, nor if presumed splicing changes in the Kir2.1 and NaChBac experiments would be similar to those in ECS (see next point). Unless this can be thoroughly established, only the experiment involving Nova KOs and NaChBac-mediated activity would really establish the proposed pathway.</p><p>2. The manuscript focuses heavily on SST-INs and seems to imply a cell-autonomous effect, e.g. in Figures 1 and 3 the SST-Cre restricted manipulation of activity using Kir2.1 and NaChBac expression results in axonal and synaptic changes and Nova1/2 translocation. However, the use of broad ECS manipulations in other key figures leaves open the possibility that some observed changes are mediated by activity in excitatory or other IN types. Indeed, the authors acknowledge that Nova1 and 2 are both highly expressed in PV cINs as well as SST INs. Namely, in Figure 2, splicing changes in SST INs may be mediated by non-cell autonomous changes in activity distinct from the cell-autonomous effects in axonal and synaptic density or in Nova1/2 translocation. Before the authors can make any suggestion about SST-IN specific synaptic or axonal changes being mediated by changes in splicing, they at least should show SST-IN specific splicing changes using RNAseq in SST-Cre;AAV-flex-KIR2.1/NaChBac activity-manipulated animals, otherwise the SST-IN focus of the manuscript is somewhat unwarranted. The same applies for changes in expression of Nova1/2 (understandably here, potentially subtler cell-autonomous effects may not be easily detected with a WB) (Figure 3A-F). It would also be interesting to know the degree of overlap in up/down regulated genes between the experiments in Figure 2 and Figure 5, which was in contrast to Figure 2 performed with SST-Cre restricted KO of Nova1/2 (though, still with ECS).</p><p>3. Following onto this previous comment, overall throughout the manuscript a more detailed and quantitative treatment of the alternative splicing results would be informative and lend greater credibility to the results presented here. While the authors provide a GO analysis, a coarse summary of alternative splicing &quot;event types&quot;, and anecdotally mention a few example genes by name, fuller documentation of the exact genes that have been alternatively spliced would allow better vetting of the results. Furthermore, annotation of Nrxn1 is not correct: exon numbering oddly seems to go against strand direction and the coordinates appear to point at exon 6 (or splice site 2) rather than 10. Previously this exon has been shown to be uniformly excised in SST cells, which is the opposite of what this study finds. This should be clarified. Finally, although the authors have data to show this, there is no mention of how gene expression level changes after each manipulation (ECS, KOs…). It would be greatly reassuring if the authors clearly present which genes experienced the largest splicing changes and whether their expression level has changed significantly. Currently, it is impossible to tell, for example, if we are looking at splicing changes in genes, which expression has majorly gone down. While splicing changes occurred, gene expression may reveal more immediate insights into the phenotypic outcomes, axon and synaptic reorganization. This would be especially important in the case of ECS experiments, but also interesting when Nova is overexpressed.</p><p>4. In Figure 4, authors should quantify SST-IN axonal density in Nova 1 and Nova 2 cKOs in addition to the synaptic changes, as changes in axonal density were also observed in the activity manipulations of Figure 1. It would be also interesting to know if the cell changes in excitatory input onto SST-INs observed in Figure 5 with SST-restricted Nova1 or 2 KO are observed with activity manipulation as well. Although a lack of Nova2 KO impact on cell survival is casually mentioned in Discussion, this should be quantified and documented for each KO condition.</p><p>5. Figure 2E is referenced in text, but not shown in figure.</p><p>6. Without further clarification, I find the presentation of Nova1/2 localization unconvincing. Figure 3G shows that Nova1/2 is either cytoplasmic or nuclear or both. However, for quantification, apparently only the nuclear/cytoplasmic ratio was used. It should be clearly stated if &quot;both&quot; cells were counted as &quot;nuclear&quot; or not, because outcomes can be very different. Furthermore, it should be clarified if any quantitative measure or cutoff was used to determine cytoplasmic versus nuclear localization. Were these blinded experiments?</p><p>[Editors’ note: further revisions were suggested prior to acceptance, as described below.]</p><p>Thank you for resubmitting your work entitled &quot;Nova proteins direct synaptic integration of somatostatin interneurons through activity-dependent alternative splicing&quot; for further consideration by <italic>eLife</italic>. Your revised article has been evaluated by Gary Westbrook (Senior Editor) and Sacha Nelson, Reviewing Editor.</p><p>The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:</p><p>Please address each of the issues identified below. All of these changes should be able to be addressed with textual changes, and/or in one case a minor additional statistical analysis. The latter is concerned with Reviewer #2's point that results from 2/3 and 5 should be treated separately. In further consultation, the reviewers agreed that a simple test that the two are not different could be used to justify merging without further changes to figures or downstream analyses. It was also agreed that although a quantal measure from ChR2 experiments would be preferred because it affords better normalization, this issue could simply be acknowledged in the text.</p><p><italic>Reviewer #1 (Recommendations for the authors):</italic></p><p>The additional experiments go a large way toward addressing the key concerns raised by the reviewers. I have no further suggestions for improvement, other than two very minor clarifications.</p><p>102 RNABPs (i.e. PTBP1/2, FUS, ELAVL4, SRRM4, Rbfox1, FMR1, Nova1, Nova2) → 102 RNABPs (e.g. PTBP1/2, FUS, ELAVL4, SRRM4, Rbfox1, FMR1, Nova1, Nova2)</p><p>e.g. (as opposed to i.e.) makes it clear the listed RNABPs are examples.</p><p>&quot;Sleepaway&quot; should be replaced in the methods with a more generic description of the formulation or its components.</p><p><italic>Reviewer #2 (Recommendations for the authors):</italic></p><p>The authors performed a number of additional experiments to try to address the questions regarding the relationship between activity and Nova expression, which do improve the manuscript. It still is not crystal clear what the relationship is, but biology sometimes is not simple.</p><p>Several remaining issues:</p><p>The manuscript states that Nova proteins impact afferent and efferent connectivity through alternative splicing. I would say the manuscript falls a bit short of making that causal relationship. The data imply it, but no experiments were done specifically altering splice events individually or globally and assessing the impacts on connectivity.</p><p>Authors report measuring mPSCs, however, no TTX was included in recording preparations. Therefore these would be better described as spontaneous PSCs, not minis.</p><p>Why were results from L2/3 and L5 cells merged? They should also be assessed independently.</p><p>A quantal measure of elicited PSC amplitude would still be a superior measure to the non-normalized version presented, even if the number of cells expressing ChR2 should theoretically not change.</p><p>The authors make the statement &quot;we found a small decrease in the ratio of nucleus to cytoplasmic Nova protein within SST cINS injected with Kir2.1&quot;. It is unclear why this decrease is noted as small: the ratio (4.75 to.265) is approximately 20:1, similar to but larger than that for NaChBac (4.75 to 40.91, 1:10) listed as substantial. It is not clear why this wording was used.</p><p>Differences in significance for GO results correlate with the number of altered AS genes identified. This perhaps is not a function of the biological significance of those genes identified in this way, but just the number of genes used as inputs.</p><p>For S6F and S6H, it is unclear to me how a pval = 0.0001 could be obtained from these plots, at least with the values given in the text vs. the figure. Also, ** is noted, vs. *** which might be expected. I'm just confused by this. Is this also a difference in SEM vs. SD?</p></body></sub-article><sub-article article-type="reply" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.86842.sa2</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]</p><disp-quote content-type="editor-comment"><p>The core concerns (in part outlined below) are:</p><p>1) The necessity of Nova proteins for the effects of activity are not convincingly established;</p></disp-quote><p>In addition to better organizing how electroconvulsive shock regulates Nova levels and localization (figure 3), as well as a complete reorganization of the loss of function results (figure 4), we have added experiments in figure 5 on how the loss of Nova genes impacts synaptic function and the loss of Nova genes blunts the splicing changes normally induced by ECS (Figure 6). Finally, in entirely new data we explore in Figure 7 the epistatic interdependence of activity and Nova2 with regard to their ability to regulate synaptic formation and strength is explored.</p><disp-quote content-type="editor-comment"><p>2) Possible changes in gene expression levels are not adequately disentangled from changes in splicing;</p></disp-quote><p>Given the substantial changes seen in both Nova cKOs, truly disentangling the changes mediated by Nova in gene expression versus alternatively splicing is a massively daunting undertaking that goes beyond the reasonable scope of any single paper. That said we have done a good faith effort to catalog these changes in both Nova knockouts (Figure 5) and by comparing gene expression changes after ECS in wild type versus Nova cKOs. As the reviewers can appreciate, gene expression can by itself be affected by alterative splicing either by directly changing the stability of the RNA transcript or by Nova stabilization of RNAs themselves. While describing these changes is possible and has now been done in the revised manuscript, accounting for what aspects of Nova function is attributable to GE versus AS is task that will take years of experimentation to sort out. We acknowledge this in the revised discussion and point out specifically how one might undertake experiments aimed at fully addressing these important issues.</p><disp-quote content-type="editor-comment"><p>3) The effect of activity on Nova protein stability/levels/activity are not adequately documented.</p></disp-quote><p>These issues are now addressed in revised figures 4-7 as discussed above and below. In short, we have gone to an extraordinary length to explore these questions in single and double KOs. Moreover, we have examined the interdependence between Nova2 and activity through reciprocal epistatic experiments in Figure 7 (NaChBacmediated SST cIN cell autonomous increase in activity in Nova2 cKOs versus Nova2 OE in the context of cell autonomous Kir2.1 activity suppression). Specially, while the question of Nova2 protein levels dependence on activity is demonstrated to be independent of transcription, and the two-way relationship between activity and Nova2 is explored, we did not undertake the logistically complex experiments to examine Nova1 and Nova1/2 OE and LOF experiments in the context of activity modulation. Our decision not to undertake these further experiments was both due to the magnitude of the task, as well as because our LOF analysis indicates that Nova1 has a lesser function in SST cINs, which based on the double KO analysis is partly antagonistic to Nova2.</p><disp-quote content-type="editor-comment"><p>Reviewer #1:</p><p>This is a thorough and interesting study of the role of Nova1 and 2 RNA binding proteins (RBPs) in the activity-dependent development of Martinotti-type SST interneurons in the mouse cerebral cortex. The paper is likely to interest both those with a focused interest in neuronal splicing as well as those with more general interests in cortical circuit development. The paper will impact these fields both by revealing the importance of these specific RBPs as well as by providing a resource of activity-dependent splice variants which can be followed in these cells to understand either the mechanisms of activity-dependent control of these processes, or the downstream effects on synaptogenesis and circuit function. The major limitations of the present manuscript are that some findings are difficult to interpret, given the available data, and some of the presentation is hard to follow, perhaps reflecting incomplete editing of a prior revision.</p></disp-quote><p>We hope that in the extensive revision we have done in streamlining and thoroughly editing our manuscript has clarified the data and our narrative.</p><disp-quote content-type="editor-comment"><p>1) The scientific point made in Figure 3B is unclear: If at P2, excitatory neurons have not yet turned on Nova1, does this really matter, does it really indicate any specificity? At P8 (more relevant to manipulation performed) is the difference between exc and inh. neurons significant? If significance is hard to assess, maybe this point (together with 3A, C should be left out).</p></disp-quote><p>We agree with the reviewer that the enrichment in inhibitory versus excitatory cells is of only secondary importance to this study and have now relegated this data to Supplemental Figure 3C. Although Nova proteins are only slightly enriched in cINs vs excitatory neurons during the relevant time period, this serves at least to provide an indication of their relative abundance.</p><disp-quote content-type="editor-comment"><p>2) p. 13: &quot;Interestingly, SST-dKO mutants exhibited less altered splicing events than the single SST-Nova2mutant, suggesting that some inclusion and exclusion AS events are antagonistically directed by Nova1 and Nova2.&quot; This is indeed interesting, but it is difficult for the reader to assess the sensitivity and reproducibility of these measurements. Some estimate of the sensitivity and noise in the measurements that can then be used to predict the degree of overlap between the 3 KO conditions tested expected by chance is required if one is to conclude anything about these overlaps (including both the overlaps shown in Figure S4C-E and the reduced overlap in the number of events between Nova2 and the double KO). This is especially true since phenotypically, the Nova2 and double KO seem so similar (Figure 4).</p></disp-quote><p>In the analytical splicing framework of this paper, we selected rMATS specifically for its superior performance compared to other methods (i.e. DEXseq, MISO, Leafcutter) to be sensitive enough to detect robust splicing events shared among the replicates of mutants compared to controls. rMATs is also shown to reduce random sampling noise that might introduce false positive or skew the inclusion and exclusion events (even three years later, rMATs remains the tool of choice in the field). We think this is exemplified not only in the obvious biological overlaps between mutant splicing profiles mentioned here but also in our success in verifying rMATA splicing predictions.</p><disp-quote content-type="editor-comment"><p>3) The interpretation of Figure 6 depends upon knowing the relative level of overexpression of Nova2. Is the effect of KIR2.1 simply to reduce Nova2 levels back to control levels or is there a separate activity dependent regulation of Nova2 localization or activity which is at work here? Although ideally these experiments should have been designed in a way that permits this comparison, if they were not it would probably be sufficient to discuss this point and make clear to the reader that this is still unknown. The discussion does note: &quot;In the presence of KIR2.1, the levels of Nova protein appear to be dramatically reduced, even when Nova2 is over-expressed&quot; but it is not clear which data are being referred to. Figure 6 shows nuclear/cyto ratios but not overall protein levels.</p></disp-quote><p>Our impression both in terms of the protein level (based on immunocytochemistry), as well as synapse formation/function, is that the Kir2.1 reduces it below normal physiological levels. Whether this is through reduced translation or localization is impossible to know. However, the ability to suppress supernumerary synapse formation in NOVA2 OE through Kir2.1 expression indicates it could act entirely through its influence on translation and localization. We have now made these points in the revised text.</p><disp-quote content-type="editor-comment"><p>Reviewer #2:</p><p>In the manuscript by Wamsley et al., the authors report that neuronal activity drives expression of Nova proteins in somatostatin interneurons in the cortex, and that Nova proteins direct both the development of inputs and outputs of these neurons through mediating alternative splicing of various transcripts. Though it is not explicitly shown that alternative splicing is the mechanism by which Nova proteins act, this is a reasonable hypothesis given the previously shown functions of Nova proteins. The investigators use a variety of methods to test their hypotheses and show how activity patterns can mediate the development of these cortical interneurons. The manuscript is both interesting and well-written. However, I have a few technical concerns about the work, and there are areas that I believe require further clarification.</p><p>The fact that mCherry is directly fused to Kir2.1 or NaChBac (or at least it appears so – information on these viral vectors is missing from the methods) may be problematic. Kir2.1 expression levels in neurons tend to be low, perhaps because the cell can only tolerate so much. I am not sure about NaChBac. This creates a problem when assessing axonal density in this manuscript e.g., Figures 1C and 1E. mCherry expression is dependent on both expression levels of the ion channel to which it is fused, as well as trafficking/localization. For the control experiment, cytoplasmic mCherry is used, which would have very different targeting/trafficking properties than membrane-localized protein. Therefore there are quite a few perhaps unintended variables in Figure 1 that the investigators should discuss.</p></disp-quote><p>Kir2.1 and NachBac are separated by a 2A sequence, and we have now clarified this.</p><disp-quote content-type="editor-comment"><p>I also thought that the data from these experiments should be normalized, for example to the numbers of infected cells, or expression levels per cell. Both metrics in Figure 1 (and all anatomical experiments throughout the manuscript) are dependent on how many cells are infected by the AAVs used, or how robustly the markers are expressed. Without this normalization, it is unclear how these results may be affected by technical artifacts.</p></disp-quote><p>Now corrected. We analyzed about 30 cells per image per three images per replicate. When we did normalize to number of cells infected it did not change the significant results, which is now included in the manuscript, thus the density of infected cells did not change the cell–specific changes in Nova localization and expression.</p><disp-quote content-type="editor-comment"><p>It is confusing to me why synaptic physiology results from the double cKO animals are not presented in Figure 4. The authors note that these mice were physiologically abnormal and exhibit early lethality. Yet they were able to perform quality recordings from these animals (Figure S5). In that case I am curious what the puncta results would be from these double cKO animals (analogous to panels 4A-B and 4E-F).</p></disp-quote><p>This physiology data for the Nova1/2-dKO has now been included.</p><disp-quote content-type="editor-comment"><p>For Figure 4, differences in IPSC amplitude could be driven by different numbers of infected cells, or more robust ChR2 expression in the control vs Nova1 or Nova2 cKO conditions. It would help to either normalize the expression of ChR2 (e.g., anatomical quantification). Also, the strength of individual synapses could be assessed by replacing extracellular ca<sup>2+</sup> with Sr2+ to evoke quantal release from SST cINs.</p></disp-quote><p>ChR2 was expressed using the Ai32 reporter mouse line and hence the expression was uniform in terms of number of cells in all conditions.</p><disp-quote content-type="editor-comment"><p>The switching between a single cKO and double cKO animals was very confusing to me. If these mice were sufficiently problematic that the data should be presented in the supplemental and not main figures, I do not understand why Figure 5 was performed with the double cKO and not single cKO animals. This should be clarified.</p></disp-quote><p>We were concerned whether Nova1 and Nova2 compensated for each other. It seems that Nova2 is the central Nova required in SST cINs and based on the double KO these two may function somewhat antagonistically. We think that while all of this is of interest to the reader, it thoroughly justifies using Nova2 OE and cKO as the focus of the paper and by proxy figure 7.</p><disp-quote content-type="editor-comment"><p>The investigators make a note about AS events (relating to figure S4) that I feel is slightly misleading. They make the statement that &quot;We found that the number of alterations in the SST-Nova2 AS events that overlap with SST-dKO is almost three times higher than that observed when comparing the overlap between SST-dKO and SST-Nova1.&quot; This is misleading as it was already noted that Nova2 loss results in about 3x more AS events than Nova1 loss. Thus it would be expected that, simply by this numeric difference, there would be 3x more overlap with the dKO condition. Indeed, for Nova1 25 overlap/124 total altered = 20%, and Nova2 62 overlap/339 total = 20%, or Nova1/Nova2 overlap 25/62 vs Nova1/Nova2 total 124/339 = 40%. Indeed this doesn't seem like a major point to emphasize, unless I am misunderstanding the intention of the authors.</p></disp-quote><p>We agree with the reviewer’s point that the overlap could simply be due to increased number of splicing events and a statistic correlation would be informative in the overlap. However, It should also be noted that this finding is more of an independent biological replication and confirmation of what has been seen in similar bulk and excitatory neuronal analysis – however in this current manuscript version as noted above we have thus focused our analysis on the role of Nova2, with the discussion and data from Nova1 and the double KO being included for completeness.</p><disp-quote content-type="editor-comment"><p>Figure 5 seems highly focused though the results should have been broad given the nature of the assays being performed. The GO analysis in Figure S6 seems much more interesting than validating one gene via qPCR. Perhaps these data could be added to the main figure.</p></disp-quote><p>The central focus of this paper is on the joint role of activity and Nova genes in synaptogenesis in SST cINs. We have now included the GO analysis both for GE and AS in the main text and supplementary figures.</p><disp-quote content-type="editor-comment"><p>I was fairly satisfied with this manuscript until Figure 6, where I got confused.</p><p>Nova OE = more axons and synapses, Figure 6 (no information about inputs)</p><p>Nova cKO = fewer axons/synapses (Figure 4)</p><p>Kir2.1 = fewer axons/synapses (Figure 6)</p><p>Question: What would happen with activation (via ECS or NaChBac) in the Nova cKO mice?</p><p>Question: What is the effect of Nova cKO on basal cellular activity of cells normally expressing Nova?</p></disp-quote><p>We have now included this experiment in Figure 7. We investigated whether activation using NachBac in the Nova2-KO will compensate for the lack of Nova2. Interestingly, we found that NachBac was unable to induce activity dependent changes in synaptic output without the presence of Nova2. On the other hand, reducing activity using Kir2.1 while overexpressing Nova2, brought the physiological output below baseline. This suggests that Nova is needed to mediate the activity dependent changes, as well as a basal level of activity is needed to translocate Nova to the nucleus which is needed for Nova to function.</p><disp-quote content-type="editor-comment"><p>It seems that Kir2.1, assuming the only effect is to hyperpolarize cells, is the dominant driver of function. However this is confusing to me. If the expression of Nova proteins is activity-dependent, it makes sense Kir2.1 would be epistatic to Nova protein expression. But it also appears to be the case that Kir2.1 functions downstream of Nova expression, as Kir2.1 can prevent the function of Nova OE. The only explanation I can think of is that reducing cellular activity (e.g., via Kir2.1) is the master regulator of this pathway – increased activity drives Nova protein expression, but reduced activity actively inhibits Nova expression and function. If this is the case, reducing activity thus is dominant over downstream pathways that typically signal axon/synapse growth (e.g., via Nova protein function).</p><p>However, how that would work in the context of the experiments performed is confusing.</p></disp-quote><p>As now shown in Figure 7, as well as discussed extensively in the text, neuronal activity and Nova work in unison to control synaptogenesis. Activity controls the levels and localization of Nova2, while Nova2 is required for activity to promote synaptogenesis. As such they are not epistatic to one another in the tradition sense but rather act to coordinate synapse formation through AS and GE.</p><disp-quote content-type="editor-comment"><p>NovaOE + Kir2.1 = blocks Nova function (presumably by reducing Nova protein levels), Figure 6. This makes sense if activity is necessary for transcription or translation of Nova proteins. But it is rather more confusing when considering that OE is though TRE-driven expression. Thus, one would have to argue either there are enhancer elements within the Nova protein that are activity-dependent, or rather, that Nova transcription is blocked without activity (though presumably Nova in the AAV context contains no introns, though this is not described in the methods). That, or somehow Nova protein is actively degraded on a rapid timescale in the absence of basal levels of activity. If this is the case, this should be explored, or explained. In general, the mode of activity as a master regulator, and Nova's potential role, should be more clearly explained or demonstrated.</p></disp-quote><p>There is no question that the interaction between activity and Nova are multifaceted.</p><p>Activity regulates the levels of Nova transcript, protein and localization. Nova in turn regulates AS and GE and synaptogenesis and likely other cellular functions in both SST and other neuronal types. We feel figure 7 provides a parsimonious explanation for how activity and Nova2 are coordinated but clearly with regard to both activity and Nova they influence SST cIN function more broadly.</p><p>Our data suggest that activity is needed for the localization of Nova to the nucleus which is suppressed using Kir2.1 (even if we overexpress Nova2). In this revised manuscript we constructed a new AAV, where TRE elements are not involved. We have spent three years expanding on this story and clarifying it and hope the reviewers are satisfied with what we consider to be a good faith effort to focus and refine our findings.</p><disp-quote content-type="editor-comment"><p>Reviewer #3:</p><p>In their manuscript, Wamsley et al. present an interesting and novel set of claims which if true would be of appropriate impact for publication in eLife. They conclude that (1) during development, axonal and inhibitory synaptic density in SST-INs is mediated by activity, and (2) these axonal and synaptic changes are mediated in turn by expression and nuclear localization of splicing regulators Nova1 and Nova2 and (3) Nova1/2-mediated changes in mRNA splicing. While this is an appealing set of conclusions, some lines of evidence require further vetting and some inconsistencies required resolution before this should be considered for publication.</p><p>1. In Figure 1, the authors show phenotypic changes, axon and synapse reorganization, after activity manipulations using Kir2.1 and NaChBac. In order to truly show that Nova mediates Kir2.1 or NaChBac activity-induced changes in axon and synapse density – and to fully back the message claimed in the title – the authors should at least show that in the Nova KOs, NaChBac does not elicit the axon and synapse density increase shown in Figure 1. This question is somewhat investigated in Figure 6, but this experiment does not establish if the axon/synapse density decrease in KIR2.1 co-expressing animals is due to Nova down-regulation, or Nova down-regulation appears as one consequence of activity dampening, but has nothing to do with axon/synapse elimination. Alternatively, the authors might show in the Nova KOs that ECS-induced activity does not change axon synapse density. However, the current manuscript has not yet shown that ECS would eventually lead to phenotypic changes similar to those in Figure 1, nor if presumed splicing changes in the Kir2.1 and NaChBac experiments would be similar to those in ECS (see next point). Unless this can be thoroughly established, only the experiment involving Nova KOs and NaChBac-mediated activity would really establish the proposed pathway.</p></disp-quote><p>In our revised paper, Figures 6 and 7 are aimed to address the precise questions raised by the reviewer. In short, the changes in AS and GE after ECS in wild type versus Nova1/2-dKO are compared in figure 6. In figure 7, the mutual dependence between activity increase in Nova2 cKO, as well as activity decrease in Nova2 OE are compare with regard to their complementary effects of synaptic structure/function.</p><disp-quote content-type="editor-comment"><p>2. The manuscript focuses heavily on SST-INs and seems to imply a cell-autonomous effect, e.g. in Figures 1 and 3 the SST-Cre restricted manipulation of activity using Kir2.1 and NaChBac expression results in axonal and synaptic changes and Nova1/2 translocation. However, the use of broad ECS manipulations in other key figures leaves open the possibility that some observed changes are mediated by activity in excitatory or other IN types. Indeed, the authors acknowledge that Nova1 and 2 are both highly expressed in PV cINs as well as SST INs. Namely, in Figure 2, splicing changes in SST INs may be mediated by non-cell autonomous changes in activity distinct from the cell-autonomous effects in axonal and synaptic density or in Nova1/2 translocation. Before the authors can make any suggestion about SST-IN specific synaptic or axonal changes being mediated by changes in splicing, they at least should show SST-IN specific splicing changes using RNAseq in SST-Cre;AAV-flex-KIR2.1/NaChBac activity-manipulated animals, otherwise the SST-IN focus of the manuscript is somewhat unwarranted. The same applies for changes in expression of Nova1/2 (understandably here, potentially subtler cell-autonomous effects may not be easily detected with a WB) (Figure 3A-F). It would also be interesting to know the degree of overlap in up/down regulated genes between the experiments in Figure 2 and Figure 5, which was in contrast to Figure 2 performed with SST-Cre restricted KO of Nova1/2 (though, still with ECS).</p></disp-quote><p>While the effects of Kir2.1, NaChBac and either cKO or OE of Nova are all clearly cell autonomous, the effects ECS are, by definition, not. While the alignment of the NaChBac findings with the ECS results inclines us to believe they influence SST cINs in a similar manner, parsing the line between what aspects in ECS are induced directly versus indirectly is subtle and somewhat nebulous. While the reviewer suggests many further interesting areas, the need to focus was clear from both this reviewer and the others and we hope this reviewer concurs with the reasons for our choices. The work already spans an enormous range of approaches and has been expanded significantly over the past three years since its last review.</p><disp-quote content-type="editor-comment"><p>3. Following onto this previous comment, overall throughout the manuscript a more detailed and quantitative treatment of the alternative splicing results would be informative and lend greater credibility to the results presented here. While the authors provide a GO analysis, a coarse summary of alternative splicing &quot;event types&quot;, and anecdotally mention a few example genes by name, fuller documentation of the exact genes that have been alternatively spliced would allow better vetting of the results. Furthermore, annotation of Nrxn1 is not correct: exon numbering oddly seems to go against strand direction and the coordinates appear to point at exon 6 (or splice site 2) rather than 10. Previously this exon has been shown to be uniformly excised in SST cells, which is the opposite of what this study finds. This should be clarified. Finally, although the authors have data to show this, there is no mention of how gene expression level changes after each manipulation (ECS, KOs…). It would be greatly reassuring if the authors clearly present which genes experienced the largest splicing changes and whether their expression level has changed significantly. Currently, it is impossible to tell, for example, if we are looking at splicing changes in genes, which expression has majorly gone down. While splicing changes occurred, gene expression may reveal more immediate insights into the phenotypic outcomes, axon and synaptic reorganization. This would be especially important in the case of ECS experiments, but also interesting when Nova is overexpressed.</p></disp-quote><p>We thank the reviewer for this suggestion. We have now included both GE and AS changes for all conditions tested. We find that although many synaptic genes have both GE and AS changes, the level of AS changes is larger than the changes in their GE. These data have now been included in both the main text and supplementary figures. Additionally, we have now included all the sashimi plots for the major synaptic genes involved in the github link which show that with ECS many genes are clearly AS, and those changes are largely abolished by knocking out Nova1/2. We analyzed the specific Nxrn1 exon that is differentially spiced in SST+ cINs in our data, we used the coordinates directly from the genome to label the exons and splice site.</p><disp-quote content-type="editor-comment"><p>4. In Figure 4, authors should quantify SST-IN axonal density in Nova 1 and Nova 2 cKOs in addition to the synaptic changes, as changes in axonal density were also observed in the activity manipulations of Figure 1. It would be also interesting to know if the cell changes in excitatory input onto SST-INs observed in Figure 5 with SST-restricted Nova1 or 2 KO are observed with activity manipulation as well. Although a lack of Nova2 KO impact on cell survival is casually mentioned in Discussion, this should be quantified and documented for each KO condition.</p></disp-quote><p>While we have examined excitatory input, our effort here was to narrow rather than broaden what was already a wide-reaching effort. We hope the reviewers concurs that by focusing on specifically efferent synaptic contacts of SST cINs, we are able to provide a more coherent story. Finally with regard to cell death, we explored this and note that this doesn’t appear to be affected and that the role of activity and synaptogenesis occurs during periods that are only weakly associated with the normal period of cell death.</p><disp-quote content-type="editor-comment"><p>5. Figure 2E is referenced in text, but not shown in figure.</p></disp-quote><p>This has now been corrected.</p><disp-quote content-type="editor-comment"><p>6. Without further clarification, I find the presentation of Nova1/2 localization unconvincing. Figure 3G shows that Nova1/2 is either cytoplasmic or nuclear or both. However, for quantification, apparently only the nuclear/cytoplasmic ratio was used. It should be clearly stated if &quot;both&quot; cells were counted as &quot;nuclear&quot; or not, because outcomes can be very different. Furthermore, it should be clarified if any quantitative measure or cutoff was used to determine cytoplasmic versus nuclear localization. Were these blinded experiments?</p></disp-quote><p>We used DAPI boundaries to locate the nucleus. We quantified the relative pixel intensity within the nuclear boundaries compared to outside to calculate the nuclear/cytoplasmic ratios.</p><p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p><disp-quote content-type="editor-comment"><p>The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:</p><p>Please address each of the issues identified below. All of these changes should be able to be addressed with textual changes, and/or in one case a minor additional statistical analysis. The latter is concerned with Reviewer #2's point that results from 2/3 and 5 should be treated separately. In further consultation, the reviewers agreed that a simple test that the two are not different could be used to justify merging without further changes to figures or downstream analyses. It was also agreed that although a quantal measure from ChR2 experiments would be preferred because it affords better normalization, this issue could simply be acknowledged in the text.</p><p>Reviewer #1 (Recommendations for the authors):</p><p>The additional experiments go a large way toward addressing the key concerns raised by the reviewers. I have no further suggestions for improvement, other than two very minor clarifications.</p><p>102 RNABPs (i.e. PTBP1/2, FUS, ELAVL4, SRRM4, Rbfox1, FMR1, Nova1, Nova2) → 102 RNABPs (e.g. PTBP1/2, FUS, ELAVL4, SRRM4, Rbfox1, FMR1, Nova1, Nova2)</p><p>e.g. (as opposed to i.e.) makes it clear the listed RNABPs are examples.</p><p>&quot;Sleepaway&quot; should be replaced in the methods with a more generic description of the formulation or its components.</p></disp-quote><p>We thank the reviewer for pointing out these details. These have now been modified in the text.</p><disp-quote content-type="editor-comment"><p>Reviewer #2 (Recommendations for the authors):</p><p>The authors performed a number of additional experiments to try to address the questions regarding the relationship between activity and Nova expression, which do improve the manuscript. It still is not crystal clear what the relationship is, but biology sometimes is not simple.</p><p>Several remaining issues:</p><p>The manuscript states that Nova proteins impact afferent and efferent connectivity through alternative splicing. I would say the manuscript falls a bit short of making that causal relationship. The data imply it, but no experiments were done specifically altering splice events individually or globally and assessing the impacts on connectivity.</p><p>Authors report measuring mPSCs, however, no TTX was included in recording preparations. Therefore these would be better described as spontaneous PSCs, not minis.</p></disp-quote><p>We thank the reviewer for raising this point. These recordings were in fact miniature currents in the presence of TTX. We have now added this clarification in the methods section.</p><disp-quote content-type="editor-comment"><p>Why were results from L2/3 and L5 cells merged? They should also be assessed independently.</p><p>A quantal measure of elicited PSC amplitude would still be a superior measure to the non-normalized version presented, even if the number of cells expressing ChR2 should theoretically not change.</p></disp-quote><p>As the reviewer suggested, we agree that a quantal measure would be superior, however the strontium experiments did not work well in our hands, and we were unable to elucidate quantal release. We believe using a transgenic Ai32 line can partially mitigate this issue.</p><disp-quote content-type="editor-comment"><p>The authors make the statement &quot;we found a small decrease in the ratio of nucleus to cytoplasmic Nova protein within SST cINS injected with Kir2.1&quot;. It is unclear why this decrease is noted as small: the ratio (4.75 to.265) is approximately 20:1, similar to but larger than that for NaChBac (4.75 to 40.91, 1:10) listed as substantial. It is not clear why this wording was used.</p></disp-quote><p>The reviewer makes a valid point on the word choice here. We agree with the reviewer and have amended the wording to state that both Kir and NachBac induced significant changes in the nucleus to cytoplasmic ratio of Nova protein expression.</p><disp-quote content-type="editor-comment"><p>Differences in significance for GO results correlate with the number of altered AS genes identified. This perhaps is not a function of the biological significance of those genes identified in this way, but just the number of genes used as inputs.</p></disp-quote><p>That is indeed the case, it is the p-value associated with the number of genes annotated to be in a specific GO term, hence it does not reflect the biological significance or level of alternative splicing differences. However, we have attempted to check the significance of alternative splicing levels of synaptic genes under different experimental conditions as shown in Figures 2F, 4D, and 6F.</p><disp-quote content-type="editor-comment"><p>For S6F and S6H, it is unclear to me how a pval = 0.0001 could be obtained from these plots, at least with the values given in the text vs. the figure. Also, ** is noted, vs. *** which might be expected. I'm just confused by this. Is this also a difference in SEM vs. SD?</p></disp-quote><p>In Figure 5—figure supplement 1F right panel, the p-Value=0.005 as denoted in the figure legend is for the comparison of the average amplitudes under the different mutant conditions. However, in Figure 5—figure supplement 1H, since the cumulative fraction considers each event, by sheer total number of events the pValue tends to become really low making it p=0.0001. However, we realize this might be misleading, and we have now changed the pValue in the text to reflect the difference in the average amplitude as opposed to the cumulative fraction.</p></body></sub-article></article>