Orsay virus spreads horizontally through the fecal-oral route and transmission can spread from a single animal to a population of animals on a plate (Yuan et al., 2018). We sought to assess the impact of bacteria on Orsay virus transmission rates and utilized a collection of bacteria isolated from the environment with wild C. elegans to assemble a panel of Gram-negative bacteria for comparison with the standard laboratory bacterial food, E. coli OP50 (Dirksen et al., 2016; Samuel et al., 2016; Dirksen, 2020; Brenner, 1974; Troemel et al., 2008). All animals were raised to young adulthood on lawns of E. coli OP50 to eliminate differences in developmental rates caused by different bacteria (Dirksen, 2020). We set up a transmission assay by placing infected animals (‘spreaders’) together with uninfected animals on a monoaxenic lawn of each test bacterium. We quantified the incidence proportion, defined as the number of new infections produced after 24 hr as determined by detection of induction of the pals-5p::GFP reporter, which is induced by infection with Orsay virus (Figure 1A–C; Bakowski et al., 2014). We observed a wide range in the measured incidence proportion (Figure 1B and C). Exposure to many of the naturally associated bacterial strains resulted in transmission that was comparable to the incidence proportion observed with E. coli OP50 with some prominent exceptions (Figure 1B and C). Two Ochrobactrum species promoted virus infection in nearly all individuals in the transmission assay and increased the incidence proportion 2.7-fold and 2.9-fold compared to E. coli OP50 (Figure 1B and C). We confirmed that transmission from the initial spreader animals in the assay, and not multiple rounds of infection, was responsible for the increased incidence proportion observed in the presence of Ochrobactrum vermis MYb71 (Figure 1—figure supplement 1). On the other hand, the presence of Pseudomonas lurida MYb11 reduced the incidence proportion 4.1-fold compared to E. coli OP50 and 11-fold compared to O. vermis MYb71 (Figure 1B and C). These results present a striking divergence in the effects of individual bacterial constituents of the C. elegans microbiota on the level of transmission of Orsay virus from infected animals.

We reasoned that increased transmission of Orsay virus could be due to bacterial modulation of host susceptibility to viral infection. To quantify the degree of host susceptibility to Orsay virus we added Orsay virus in doses that ranged across four orders of magnitude and then measured the fraction of individuals that became pals-5p::GFP positive after 24 hr (Figure 1A and D, Figure 1—figure supplements 2 and 3). We also specifically calculated the ID₅₀, or the dose of Orsay virus required to infect 50% of the population after 24 hr of exposure (Figure 1D and E and Figure 1—figure supplement 2). On average, 3.6 μL of Orsay virus stock prepared as indicated in the Materials and methods was required to infect 50% of a population of ZD2611 animals in the presence of E. coli OP50 after 24 hr (Figure 1—figure supplement 2). We observed variability in the measured ID₅₀ even when using the same batch of Orsay virus (e.g. Figure 1D vs Figure 1—figure supplement 3A vs. Figure 1—figure supplement 3B). We therefore chose to control all our experiments internally rather than attempt to normalize between Orsay virus batches and we report doses used in arbitrary units (a.u.), however 1 a.u. corresponds to 1 μL of Orsay virus filtrate (Materials and methods).

To determine quantitatively how different bacterial species modulate host susceptibility to viral infection independently of the potential differential effects of bacteria on host shedding of viruses, we added fixed doses of Orsay virus to plates of each bacterial species and monitored infection using the pals-5p::GFP reporter. At lower doses of Orsay virus, the presence of O. vermis MYb71 resulted in a higher fraction of infected animals than those observed in the presence of E. coli OP50 or P. lurida MYb11 (Figure 1D, Figure 1—figure supplement 3). At higher doses of Orsay virus, the presence of P. lurida MYb11 resulted in a reduced fraction of infected animals compared to O. vermis MYb71 and E. coli OP50 (Figure 1D, Figure 1—figure supplement 3). We further quantified the ID₅₀ in the presence of each bacterium and on average we observed that the ID₅₀ in the presence of E. coli OP50 was 14-fold higher than the ID₅₀ in the presence of O. vermis MYb71 (Figure 1D and E, and Figure 1—figure supplement 3). The ID₅₀ observed in the presence of P. lurida was 120-fold and 1800-fold higher than the ID₅₀ in the presence of E. coli OP50 or O. vermis MYb71, respectively (Figure 1D and E, and Figure 1—figure supplement 3).

We corroborated our observations from the pals-5p::GFP reporter by scoring the same samples using fluorescence in situ hybridization to detect the RNA1 segment of the Orsay virus genome in the intestinal cells of infected animals (Figure 1F). As expected, we observed that at lower doses the presence of O. vermis MYb71 resulted in a greater fraction of infected animals compared to E. coli OP50 or P. lurida MYb11, while at higher doses the presence of P. lurida MYb11 resulted in a reduced fraction of infected animals (Figure 1F). Together these data establish that individual members of the C. elegans microbiota can modulate host susceptibility to Orsay virus over three orders of magnitude with dramatic consequences for the transmissibility of Orsay virus.

We also assessed whether bacteria altered host feeding behavior as this may influence the transmission and infection rate of Orsay virus. We quantified the number of pharyngeal pumps per minute (ppm), a metric of C. elegans feeding, in the presence of each bacterium. After 6 hr of exposure to E. coli OP50, P. lurida MYb11, or O. vermis MYb71, there were no differences in pharyngeal pumping rates (Figure 1—figure supplement 4A). At 24 hr pumping rates were decreased in the presence of O. vermis MYb71 to an average of 242 ppm compared to 261 ppm in the presence of P. lurida MYb11 suggesting that changes to feeding behavior are unlikely to be responsible for observed effects on host susceptibility to Orsay virus (Figure 1—figure supplement 4B).

In view of the effect of P. lurida MYb11 on attenuating Orsay virus infection of C. elegans, we examined the effect of the distantly related bacterium, Pseudomonas aeruginosa, an opportunistic pathogen of humans that has been characterized extensively (Tan et al., 1999a; Mahajan-Miklos et al., 1999). We observed that in the presence of either P. aeruginosa strains PA01 or PA14, transmission from spreader animals to uninfected individuals was nearly completely blocked and the incidence proportion was 11-fold and 32-fold lower than that observed in the presence of E. coli OP50, respectively (Figure 2A). The attenuating effect of P. aeruginosa PA01 and PA14 on virus transmission was further reduced 3.1-fold and 9.5-fold, respectively, compared to the incidence proportion observed in the presence of P. lurida MYb11 (Figure 2A).

We confirmed that host susceptibility to Orsay virus was reduced in the presence of P. aeruginosa by performing susceptibility assays at two doses of exogenous Orsay virus (Figure 2B, Figure 2—figure supplement 1). At each dose, fewer animals were infected following exposure to equivalent doses of Orsay virus in the presence of P. aeruginosa PA01, PA14, or P. lurida MYb11 as compared to the fraction of animals infected in the presence of E. coli OP50 (Figure 2B, Figure 2—figure supplement 1). At the highest dose of virus used, we still observed robust attenuation of infection in the presence of P. aeruginosa PA14 as 0.5% of the animals were infected as compared to 54%, 70%, and 97% in the presence of P. aeruginosa PA01, P. lurida MYb11, or E. coli OP50, respectively (Figure 2B). We confirmed that no individuals were detectably infected with Orsay virus while in the presence of P. aeruginosa PA14 using FISH staining (Figure 2C). FISH additionally confirmed that the presence of P. aeruginosa PA01 and P. lurida MYb11 attenuated average infection to 24% and 60% of the population respectively compared to E. coli OP50 which supported infection of 86% of the population. Further, P. aeruginosa PA01, P. lurida MYb11, and E. coli OP50 all supported higher levels of infection than P. aeruginosa PA14 (Figure 2C). Together these results demonstrate a striking capacity of P. lurida MYb11 and P. aeruginosa strains to sharply reduce, and even effectively block, host susceptibility to infection with Orsay virus.

We again assessed whether bacterial modulation of host feeding behavior may be responsible for the observed effects on host susceptibility to Orsay virus. There were no differences observed in pharyngeal pumping rate after 6 hr of exposure to each bacterium (Figure 1—figure supplement 4A). After 24 hr pharyngeal pumping rate increased in the presence of P. aeruginosa PA14 to an average of 264 ppm compared to 248 ppm in the presence of E. coli OP50 which suggests that changes to feeding behavior are unlikely to account for the attenuation of infection observed in P. aeruginosa (Figure 1—figure supplement 4B).

P. aeruginosa is a pathogen of C. elegans and numerous other organisms (Tan et al., 1999a; Rahme et al., 1995; Tan et al., 1999b). Moreover, while both PA01 and PA14 are pathogenic, PA14 is more virulent toward C. elegans (Tan et al., 1999a). P. lurida MYb11 promotes developmental rate and fitness, although does so at a minor cost to overall lifespan (Dirksen, 2020; Kissoyan et al., 2022). The effect of O. vermis MYb71 on lifespan has not been assessed. We assessed host lifespan under our assay conditions to examine links between bacterial pathogenicity and host susceptibility to Orsay virus. Under our assay conditions, including a full lawn of bacteria, which prevent C. elegans from avoiding undesirable bacteria, and a temperature of 20°C, which is below the optimal virulence temperature of P. aeruginosa, substantial mortality is not observed until 72 hr after exposure (Figure 2—figure supplement 2). All bacteria enhanced mortality in comparison to E. coli OP50 (Figure 2—figure supplement 2). Interestingly, O. vermis MYb71 exposure led to similarly enhanced mortality when compared to P. aeruginosa PA14, and both bacteria enhanced mortality in comparison to P. lurida MYb11 or P. aeruginosa PA01 (Figure 2—figure supplement 2). P. lurida MYb11 also enhanced mortality compared to P. aeruginosa PA01 under these conditions (Figure 2—figure supplement 2). The similar lifespans of animals exposed to P. aeruginosa PA14 and O. vermis MYb71 stand in contrast to their divergent effects on host susceptibility to Orsay virus. This suggests that general pathogenicity is unlikely to be responsible for effects on host susceptibility, although pathogenic consequences specific to exposure to each bacterium may still contribute to the observed effects on host susceptibility to Orsay virus.

We considered the possibility that the attenuation of Orsay virus transmission in the presence of P. lurida and P. aeruginosa strains might be due to inhibitory effects of the bacteria on the replication of Orsay virus once transmitted to a susceptible animal host. To evaluate this possibility, we made use of a plasmid-based system in which viral RNA1 is expressed through a transgene introduced into C. elegans, so that replication of RNA1 can be assessed independent of the entry of exogenous virus into the host (Jiang et al., 2017). In this system, the Orsay virus RNA1 segment, which encodes the RNA-dependent RNA polymerase (RdRP), is expressed following heat-shock. The expressed RNA1 may then be translated to produce the RdRP which can then replicate RNA1 through a negative-strand intermediate. The expression of RNA1 via heat-shock bypasses any differences in viral entry or pre-replication steps, allowing for a direct test of RNA1 replication efficiency under different conditions (Jiang et al., 2017). A plasmid expressing a mutated RdRP (RNA1[D601A]) incapable of supporting further RNA1 replication after the initial heat-shock serves as a control for heat-shock efficiency (Jiang et al., 2017). Using this system, we observed that Orsay virus RNA1 replication efficiency was unaffected by the presence of Pseudomonas species relative to RNA1 replication observed in the presence of E. coli OP50 (Figure 3A). Additionally, there were no differences observed in heat-shock efficiency between the different bacteria (Figure 3A). These data suggest that bacteria-induced differences in RNA1 replication in the host do not explain the substantial attenuation of Orsay virus transmission and infection rates caused by P. aeruginosa PA01 or PA14 and P. lurida MYb11.

We sought to confirm the successful replication of the plasmid expressed RNA1 of Orsay virus by assessing whether we could detect the replication of Orsay virus RNA1 in each Pseudomonas species. We exposed young adult wild-type (N2) or RNAi defective animals (rde-1(ne219)) to exogenous Orsay virus and quantified the amount of virus present at 2 hr and 24 hr post exposure, with the difference in RNA levels at these points reflecting viral genome replication. Animals of the RNAi defective rde-1(ne219) background have a defective antiviral response leading to higher viral loads than wild-type animals (Félix et al., 2011). The rde-1(ne219) mutant therefore provides a more sensitive genetic background in which to detect viral replication following rare infection events within a population as is expected in the presence of P. aeruginosa PA14. In rde-1(ne219) animals viral RNA1 levels increased at 24 hr relative to 2 hr post exposure regardless of the bacteria present (Figure 3B and C). On the other hand, in the wild-type background replication was not observed in animals exposed to P. aeruginosa PA14 and was attenuated in animals exposed to P. aeruginosa PA01 compared to animals exposed to E. coli OP50 or P. lurida MYb11 (Figure 3B and C). In a wild-type background individuals exposed to P. aeruginosa PA01 and P. aeruginosa PA14 are less likely to become infected from exogenous Orsay virus (Figure 2B, Figure 2—figure supplement 1). It is therefore likely that the viral load we observed in the wild-type populations is due to a smaller proportion of the population being infected, rather than hampered replication (Félix et al., 2011).

We also assessed whether P. lurida MYb11, P. aeruginosa PA01, or P. aeruginosa PA14 was capable of rapidly degrading Orsay virus or preventing viral shedding, either of which might account for attenuation of Orsay virus transmission. We did not observe a substantial decrease in viral stability in the presence of any bacterium suggesting Orsay virus is not rapidly degraded (Figure 3D and E). We did observe an approximately twofold decrease in viral levels between E. coli OP50 and P. lurida MYb11, however, this difference already existed within 30 min of exposure to each bacterium and did not grow further over the course of 24 hr suggesting we are measuring differences in recovery of Orsay virus from each bacterial lawn, rather than enhanced degradation in the presence of P. lurida MYb11 (Figure 3D and E). We measured rates of Orsay virus shedding during a transmission assay. We did not observe a substantial decrease in viral shedding in the presence of any bacterium (Figure 3F). We observed approximately fourfold lower levels of Orsay virus shed in the presence of P. lurida MYb11 vs E. coli OP50, but as suggested by our virus stability data, we believe these differences at least partly reflect differences in Orsay virus recovery from each bacterial lawn rather than actual differences in viral shedding (Figure 3F).

Extensive studies on Pseudomonas species have demonstrated the importance of quorum sensing for regulating many community-level behaviors in response to growing population density (Lee and Zhang, 2015). P. aeruginosa relies upon three quorum sensing systems: las, rhl, and pqs. These systems are arranged hierarchically, however crosstalk between them is extensive (Figure 4A; Lee and Zhang, 2015). In P. aeruginosa, an additional layer of regulation stems from two-component regulatory systems such as gacA/gacS which regulates numerous genes that together influence quorum sensing, virulence, and biofilm development (Figure 4A; Reimmann et al., 1997; Parkins et al., 2001; Brencic et al., 2009). P. aeruginosa possesses three exopolysaccharide biosynthetic clusters that each contribute to biofilm formation: pel, psl, and alg. However, P. aeruginosa PA01 preferentially produces Psl while P. aeruginosa PA14 is unable to synthesize Psl and produce Pel (Friedman and Kolter, 2004a; Friedman and Kolter, 2004b; Franklin et al., 2011; Jackson et al., 2004; Matsukawa and Greenberg, 2004). We hypothesized that quorum sensing might mediate the effect of Pseudomonas strains to attenuate virus transmission, while differences in exopolysaccharide production might mediate the enhanced attenuation of virus transmission observed in the presence of P. aeruginosa PA14 compared with what was observed in the presence of P. aeruginosa PA01. Therefore, we tested a panel of P. aeruginosa PA01 and P. aeruginosa PA14 quorum sensing and biofilm mutants to determine whether quorum sensing or biofilm formation was involved in the attenuation of Orsay virus infection mediated by P. aeruginosa.

Mutations of any the regulators of the las, rhl, or pqs quorum sensing systems suppressed the attenuation of Orsay virus infection caused by the presence of wild-type P. aeruginosa PA01 (Figure 4B, Figure 4—figure supplement 1). Knockout of gacA in P. aeruginosa PA01 also suppressed the attenuation of Orsay virus infection (Figure 4B, Figure 4—figure supplement 1). On the other hand, mutation of any of the three exopolysaccharide production pathways had no potent effect on the attenuation of infection (Figure 4B, Figure 4—figure supplement 1). These data support a role for quorum sensing regulated processes in reducing Orsay virus infection rates but do not implicate a role for individual exopolysaccharides.

For P. aeruginosa PA14, mutation of gacA or rhlR suppressed the attenuation of Orsay virus infection observed in the presence of wild-type P. aeruginosa PA14 (Figure 4C, Figure 4—figure supplement 2). Loss of the rhlR regulators rhlI or pqsE alone had no effect on the attenuation of Orsay virus infection, but simultaneous mutation of both rhlI and pqsE did suppress the attenuation of Orsay virus infection observed in the presence of wild-type P. aeruginosa PA14, similar to that observed for the rhlR mutant, suggesting rhlI and pqsE function redundantly to regulate rhlR in this context (Figure 4C, Figure 4—figure supplement 2; Mukherjee et al., 2018). Mutation of lasI or lasR suppressed the attenuation of Orsay virus infection to a lesser extent (Figure 4C, Figure 4—figure supplement 2). Independent mutation of two genes responsible for pel or alg exopolysaccharide production had no effect on infection rates (Figure 4C, Figure 4—figure supplement 2). We further confirmed that mutation of rhlR and gacA in P. aeruginosa PA01 or P. aeruginosa PA14 suppressed the attenuation of Orsay virus infection via FISH (Figure 4D and E). These data suggest a role for quorum sensing in mediating P. aeruginosa PA14 suppression of Orsay virus infection, as we observed for P. aeruginosa PA01. However, our results obtained in the presence of P. aeruginosa PA14 suggest that there may be some differential regulation of the bacterial effectors responsible in comparison to P. aeruginosa PA01, or additional non-quorum sensing-related factors that also mediate suppression.

As P. aeruginosa mutants could suppress the attenuation of infection observed by wild-type P. aeruginosa in the presence of exogenous virus, we next confirmed that these P. aeruginosa mutants similarly affected transmission from infected spreader animals. All P. aeruginosa PA01 quorum sensing mutants suppressed the attenuation of transmission by increasing the incidence proportion >6-fold compared to the wild-type P. aeruginosa PA01 (Figure 4F). P. aeruginosa PA14 rhlR and gacA mutants suppressed the attenuation of transmission by increasing the incidence proportion 19-fold and 17-fold respectively compared to wild-type P. aeruginosa PA14, but a lasI mutant had minimal effect consistent with the pattern we observed in the susceptibility assay using exogenous Orsay virus (Figure 4F). Likewise, the magnitude of suppression of the attenuation of Orsay virus transmission observed in the P. aeruginosa rhlR or gacA mutants was greater in the P. aeruginosa PA01 background compared to the P. aeruginosa PA14 background, potentially suggesting the existence of additional strain specific factors that act in P. aeruginosa PA14 to attenuate Orsay virus transmission.

Our findings suggest the possibility that quorum sensing molecules could act directly to attenuate infection. To explore this hypothesis, we prepared liquid E. coli OP50, O. vermis MYb71, P. lurida MYb11, P. aeruginosa PA01, and P. aeruginosa PA14 cultures and added culture supernatant to plates containing E. coli OP50 and Orsay virus. We did not observe any potent effect on host susceptibility to infection by Orsay virus from any supernatant (Figure 4—figure supplement 3), although it is difficult to rule out the possibility that the compounds may act at concentrations that are locally higher than the concentrations at which the compounds are present in our experiments.

We designed a candidate-based screen using a non-redundant transposon insertion library to gain further insight into the genetic regulation of P. aeruginosa mediated reduction of Orsay virus transmission and infection (Figure 5A; Liberati et al., 2006). We identified candidate genes to include in our screen from three sources: gacA-regulated genes, rhlR-regulated genes (but rhlI- or pqsE-independent), and the set of genes required for full virulence in C. elegans previously identified by Feinbaum et al. (Figure 5A; Brencic et al., 2009; Simanek et al., 2022; Feinbaum et al., 2012). Of the 211 genes tested, 18 putative hits, including lasI, rhlR, and gacA, were identified with the corresponding P. aeruginosa PA14 mutants exhibiting suppression of the attenuation of Orsay virus infection by wild-type P. aeruginosa PA14 (Figure 5A, Supplementary file 1c). Using the 15 novel candidate genes, we performed an additional set of susceptibility assays which confirmed six of the hits (Figure 5B, Figure 5—figure supplement 1, Supplementary file 1c). The identified hits grouped into two clusters based on the strength of their suppression. Transposon insertion in the genes ptsP, prpC, and kinB led to marked suppression of the attenuation of Orsay virus leading to infection of 97%, 89%, and 82% of the population respectively compared to infection in only 4.2% of the population in the presence of wild-type P. aeruginosa PA14 (Figure 5B, Figure 5—figure supplement 1). Transposon insertion in three additional genes, clpA, glnK, and fabF1, resulted in weaker, but robust suppression of the attenuation of Orsay virus leading to infection of 34%, 28%, and 17% of the population respectively (Figure 5B, Figure 5—figure supplement 1). We additionally tested whether transposon insertion into these genes suppressed attenuation of Orsay virus transmission. While we observed a trend toward mutations affecting susceptibility also affecting virus transmission, we observed a high degree of variation in the transmission assay, such that only mutation of ptsP led to statistically significant suppression of Orsay virus attenuation (Figure 5C).

We noted that all six of the hits originated from the set of genes required for full P. aeruginosa PA14 virulence in C. elegans (Feinbaum et al., 2012). These hits represented only 6 out of the 41 tested genes that are known to influence virulence, indicative of some degree of specificity in the consequences of these mutations beyond their general effect on P. aeruginosa PA14 virulence (Feinbaum et al., 2012).

We next sought to determine whether our findings from the interaction of C. elegans and Orsay virus in the presence of P. aeruginosa could inform us further regarding the mechanisms underlying the attenuation of Orsay virus transmission in the presence of P. lurida MYb11. In particular, we identified gacA, ptsP, prpC, and kinB orthologs using Orthovenn2 and generated a putative knockout allele of each gene by removing the coding potential for all but 10 amino acids from the N and C termini (Figure 6A; Xu et al., 2019). Following exposure to exogenous Orsay virus, knockout of gacA in P. lurida MYb11 led to infection of 77% of the population compared to infection of 43% of the population in the presence of wild-type P. lurida MYb11 from exogenous Orsay virus (Figure 6B, Figure 6—figure supplement 1). These observations were confirmed via FISH, as the gacA mutant supported infection of 62% of the population versus 37% infection in the presence of wild-type P. lurida MYb11 (Figure 6C). The gacA mutation also suppressed the attenuation of Orsay virus transmission, increasing the incidence proportion 2.9-fold compared to wild-type P. lurida MYb11 (Figure 6D). These data suggest that gacA has a conserved role between P. aeruginosa and P. lurida MYb11 in the attenuation of Orsay virus transmission and infection of C. elegans. On the other hand, knockout of the P. lurida MYb11 orthologs of ptsP, prpC, or kinB failed to suppress the attenuation of Orsay virus infection or transmission by P. lurida MYb11 (Figure 6E,F, Figure 6—figure supplement 1C, D; Feinbaum et al., 2012; Sun et al., 2023). One explanation of these results is that these genes play different roles within P. lurida MYb11 and P. aeruginosa and therefore their mutation did not have the same consequences for Orsay virus attenuation. Alternatively, these results might suggest that ptsP, prpC, and kinB act to attenuate Orsay virus infection via some specific effect on P. aeruginosa PA14 virulence but do not influence the interaction of P. lurida MYb11 with C. elegans.

P. lurida MYb11 and O. vermis MYb71 can both be isolated from C. elegans natural environment (Dirksen et al., 2016; Dirksen, 2020). We were therefore curious how exposure to both bacteria simultaneously would impact Orsay virus infection rates. When cultures of O. vermis MYb71 and P. lurida MYb11 were concentrated to 25 mg/mL and then mixed, we observed that a 50% mixture of each bacterium (vol:vol) attenuated infection to the same degree as pure P. lurida MYb11 (Figure 7A, Figure 7—figure supplement 1A and B). Moreover, we also noted that mixing O. vermis MYb71 with E. coli OP50 also lead to infection rates similar to pure E. coli OP50 (Figure 7A, Figure 7—figure supplement 1A and B). Previous studies have identified that Ochrobactrum is found in large numbers in the C. elegans intestine following exposure (Dirksen et al., 2016; Dirksen, 2020). We investigated how the levels of Ochrobactrum in the intestine changed following exposure to pure or mixed lawns of bacteria. When alone, GFP expressing Ochrobactrum BH3 was readily observed within the intestine at 4 hr or 24 hr of exposure. Interestingly, exposure to a mixed lawn of Ochrobactrum BH3 and P. lurida MYb11 reduced intestinal accumulation of Ochrobactrum BH3 compared to the pure Ochrobactrum BH3 treatment (Figure 7B and C, and Figure 7—figure supplement 1C–F). On the other hand, exposure to a mixed lawn of Ochrobactrum BH3 and E. coli OP50 reduced accumulation of Ochrobactrum BH3 at 4 hr compared to a pure Ochrobactrum BH3 treatment, but this difference was minimal by 24 hr (Figure 7B and C, and Figure 7—figure supplement 1C–F).

These data suggested that the presence of Ochrobactrum in the intestine may be important for its ability to promote Orsay virus infection. We therefore fixed C. elegans exposed to O. vermis MYb71 or E. coli OP50 for examination via electron microscopy and imaged cross sections of the intestine. As expected from our fluorescence experiments, O. vermis MYb71 was readily observed in the intestinal lumen at 4 hr or 24 hr of exposure (Figure 7D and E). The glycocalyx is the mucus-like layer covering C. elegans intestinal cells and that recent work has suggested may play a role in defense against Orsay virus (McGhee, 2007; Zhou et al., 2024). The glycocalyx of animals exposed to O. vermis MYb71 was observed with regions of variable thickness and potential instances of O. vermis MYb71 deforming the microvilli brush border as opposed to animals exposed to E. coli OP50 where the glycocalyx appeared uniform and undisturbed (Figure 7D and E). A recent report observed that S. marcescens promoted infection of the mosquito A. aegypti by Dengue, Zika, and Sindbis viruses by secreting a protein, enhancin, that degrades the mucus layer covering epithelial cells (Wu et al., 2019). These observations lead us to speculate that O. vermis MYb71 mediated disruption of the brush border and glycocalyx promotes Orsay virus infection although this hypothesis has yet to be tested.

C. elegans were maintained on NGM agar plates (17 g agar, 2.5 g peptone, 3 g NaCl per 1 L water) containing E. coli OP50 (Brenner, 1974). Strains bearing the glp-4(bn2) temperature-sensitive mutation were maintained at 16°C, while all other were maintained at 20°C. All assays were performed on SKA assay plates at 20°C (17 g agar, 3.5 g peptone, 3 g NaCl per 1 L water) (Tan et al., 1999a). A full list of C. elegans strains used in this study is contained within the Supplemental Information (Supplementary file 1a). For all assays relying upon pals-5p::GFP, induction was manually assessed using a Nikon SMZ18 stereofluorescent microscope.

All bacteria were grown in Luria broth (10 g tryptone, 5 g yeast, 10 g NaCl per 1 L water). E. coli OP50 and P. aeruginosa strains were grown at 37°C with shaking, while all other strains were grown at 27°C with shaking. A full list of bacterial strains used in this study is contained within the Supplemental Information (Supplementary file 1b).

Orsay virus was isolated from infected WUM31(rde-1(ne219);jyIs9[pals-5p::gfp;myo-2p::mCherry]) individuals. Plates with gravid WUM31 were bleached to obtain eggs. Eggs were hatched overnight in M9 solution rotating at 20°C and the L1 larvae were arrested to synchronize the population. L1 larvae were combined with 100 μL of 6× concentrated E. coli OP50 liquid culture and 50 μL of Orsay virus filtrate, plated on SKA plates, and once dried, placed at 20°C for 48 hr. Four GFP-positive individuals were then transferred to a new 6 cm NGM plate with E. coli OP50 and maintained until just starved. Twenty such 6 cm plates were washed with 10 mL of M9 and the resulting suspension was Dounce homogenized. Alternatively, two 3.5 cm SKA plates containing infected WUM31 animals were allowed to starve and then equally chunked onto eight 10 cm NGM plates with E. coli OP50. Once these plates were just starved, the plates were washed with 10 mL of M9 and homogenized as above. The homogenized suspension was then centrifuged at 13,200×g for 5 min. The supernatant was passed through a 0.22 μm filter and aliquoted. Each batch of virus was tested for potency and an ID₅₀ calculated for ZD2611 populations in the presence of E. coli OP50 (Figure 1—figure supplement 2). On average, 3.6 μL of Orsay virus stock prepared as indicated in the Materials and methods was required to infect 50% of a population of ZD2611 animals in the presence of E. coli OP50 after 24 hr (Figure 1—figure supplement 2). We observed variability in the measured ID₅₀ even when using the same batch of Orsay virus (e.g. Figure 1D vs Figure 1—figure supplement 3 vs. Figure 1—figure supplement 3). We therefore chose to control all our experiments internally rather than attempt to normalize between Orsay virus batches and we report doses used in a.u., however 1 a.u. corresponds to 1 μL of Orsay virus filtrate.

Prior to all assays, plates with fecund ZD2611(glp-4(bn-2);jyIs8[pals-5p::gfp;myo-2p::mCherry]) were bleached to obtain eggs. Eggs were hatched overnight in M9 solution rotating at 20°C and the L1 larvae were arrested to synchronize the population. ZD2611 L1s were dropped onto plates containing E. coli OP50 and placed at 20°C for 64–72 hr. At this temperature reproduction is delayed, but not eliminated, and no L1s are observed during transmission or susceptibility assays. The resulting young adults were washed off the plates in M9 and centrifuged at 1000×g for 1 min. After removing the supernatant, the young adults were once again washed in M9, then centrifuged at 1000×g for 1 min. Young adults were directly dropped onto prepared plates described below.

Unless otherwise indicated, bacteria were cultured overnight and added to cover the assay plates. Plates containing E. coli OP50 or P. aeruginosa strains were placed at 37°C for 24 hr. Plates containing O. vermis MYb71 or P. lurida MYb11 strains were placed at 25°C for 24 hr. All plates were then moved to room temperature (RT) for an additional 24 hr before the addition of virus.

For the natural isolate transmission screen and early transmission assay cultures were grown to late stationary phase. Cultures were then spun down for 6 min at 4000×g and reconstituted to 25 mg/mL in their own supernatant. 150 μL of this suspension was combined with 50 μL of a mix of M9 for transmission assays or 50 μL of a combination of Orsay virus filtrate and M9 for the early transmission assay. This mixture was combined with young adult ZD2611 individuals and directly added to cover assay plates before drying.

To obtain infected spreader animals, fecund ZD2610 (glp-4(bn-20); rde-1(ne219); jyIs8[pals-5p::gfp;myo-2p::mCherry]) were bleached to obtain eggs. Eggs were hatched overnight in M9 solution rotating at 20°C and the L1 larvae were arrested to synchronize the population. Arrested ZD2610 L1s were dropped onto NGM plates containing E. coli OP50 and placed at 20°C for 48 hr. Animals were then washed off the plates in M9 and centrifuged at 1000×g for 1 min. After removing the supernatant, the young adults were washed with M9 again then centrifuged at 1000×g for 1 min. Supernatant was once again removed, and individuals were immediately mixed with 100 μL of 6× overnight E. coli OP50 culture and 50 μL of Orsay virus for a minimum of 18–20 hr. pals-5p::GFP-positive ZD2610 young adults were identified and picked onto transfer plates containing the appropriate bacteria prepared as indicated above for 4–6 hr. After this period, five spreaders were transferred to assay plates containing the same bacteria and approximately 100 uninfected ZD2611 individuals to start the assay. Transmission assays were scored 24 hr after adding spreader individuals.

For the natural isolate transmission screen, arrested ZD2610 L1s were combined with 100 μL of 6× concentrated E. coli OP50 and 50 μL of Orsay virus filtrate and once dried, placed at 20°C for 64–72 hr. On the day of the assay, pals-5p::GFP-positive ZD2610 young adults were identified and picked onto transfer plates containing the appropriate bacteria prepared as indicated above for 4–6 hr. After this period, five spreaders were transferred to assay plates containing the same bacteria and approximately 100 uninfected ZD2611 individuals to start the assay.

Incidence proportion was calculated by dividing the number of newly infected animals by the total non-spreader population per plate. Individual plates for which the total number of pals-5p::GFP-positive individuals after 24 hr was less than the initial number of spreaders placed on the plate were excluded to eliminate potential differences in incidence proportion caused by unequal numbers of infected spreader animals. For Figure 1C a single plate was censored from P. lurida MYb11, for Figure 2A six plates were censored from P. aeruginosa PA14, and for Figure 4E 12 plates were censored: seven from P. aeruginosa PA14, three from P. aeruginosa PA01, one from P. aeruginosa PA14ΔgacA, and one from P. aeruginosa PA14ΔlasI.

Unless otherwise indicated, Orsay virus filtrate at the indicated doses was diluted in filtered M9 solution. 200 μL total was applied to each assay plate and swirled to cover the entire bacterial lawn. Plates were then dried before the addition of approximately 100 uninfected ZD2611 individuals prepared as indicated above. Assays were scored 24 hr later using a Nikon SMZ18 stereo fluorescent microscope and the fraction of pals-5p::GFP-positive individuals was calculated.

For early transmission assay, young ZD2611 adults were exposed to 0 a.u. or 5 a.u. exogenous Orsay virus in the presence of O. vermis MYb71. 8 hr post infection five infected individuals from the 5 a.u. plate were transferred to the 0 a.u. plate to assess whether transmission from these individuals would occur. Both plates were scored 16 hr after the transfer.

Assay plates were prepared with E. coli OP50 for susceptibility assays as indicated above. Bacteria were inoculated into 6 mL of LB and allowed to grow for 48 hr. Cultures were then spun at 4000×g for 6 min and the spent media supernatant was passed through a 0.22 μm filter. 200 μL of the filtered supernatant was added to the E. coli OP50 assay plates just prior to the addition of Orsay virus and ZD2611 young adults.

Previously published probes were obtained to target the RNA1 segment of Orsay virus (Franz et al., 2014). Animals were infected according to the methods described above for susceptibility assays. Animals were processed according to the Stellaris RNA FISH Protocol for C. elegans (LGC Biosearch Technologies) with minor modifications. Briefly, young adults were washed off the plate and rinsed twice in M9. Animals were then fixed for 30 min rotating in a microcentrifuge tube at 20°C. After washing twice with 1 mL of phosphate buffered saline animals were permeabilized in 70% of ethanol and stored at 4°C for 1–7 days. Animals were washed with Wash Buffer A before addition of 100 μL of hybridization buffer containing 3 μL of RNA1 probe mix. Probe was hybridized overnight at 46°C. Animals were then washed with Wash Buffer A alone once, and then again with Wash Buffer A containing 5 ng/mL DAPI. Lastly 100 μL of Wash Buffer B was added before mounting animals on slides with 25 μL of Vectashield Mounting Medium. The fraction of individuals with RNA1 staining was then quantified using a Nikon SMZ18 stereofluorescent microscope or a Zeiss AxioImager Z1 compound fluorescent microscope.

Assay plates with each bacterium were prepared as described above. 50 a.u. Orsay virus was added to each plate as in a susceptibility assay, however no C. elegans were added. Plates were washed with 1 mL of ddH₂O after 30 min or 24 hr. A spike-in control was also included where 50 a.u. of Orsay virus was directly added to 1 ml H₂O and processed the same as all other samples. The resulting mixture was spun at 15,000 rpm (max speed) at 4°C for 10 min. 1 μL of the supernatant was used to make cDNA (Promega GoScript reverse transcriptase using random primers (A2801)). Orsay virus RNA1 level was quantified by qPCR using 1 μL of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system (RNA1 qPCR primers GW194 and GW195) (Félix et al., 2011).

Infected ZD2610 animals were prepared as indicated above with infection occurring at the L4 stage. 24 hr later as young adults, 20 pals-5p::GFP-positive animals were transferred to assay plates prepared with bacteria as indicated above for a transmission assay. These animals were allowed to shed virus onto the plate for 24 hr at 20°C. Spreaders were then removed and the assay plates were washed with 1 mL of M9. The resulting mixture was spun at 15,000 rpm (max speed) at 4°C for 10 min. 1 μL of the supernatant was used to make cDNA (Promega GoScript reverse transcriptase using random primers (A2801)). Orsay Virus RNA1 level was quantified by qPCR using 1 μL of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system (RNA1 qPCR primers GW194 and GW195) (Félix et al., 2011).

Animals were washed five times in M9 and collected in TRIzol reagent (Invitrogen) and stored at –80°C before extraction. RNA extraction was performed using Direct-zol RNA microprep kits (Zymo Research) following the manufacturer’s instructions.

cDNA was made using 1000 ng of RNA as template (Promega GoScript Reverse Transcriptase using Random Primers). cDNA was diluted at 1/80 and qPCR were performed using 1 μL of diluted cDNA (GoTaq Promega) and run on QuantStudio 3 Real Time PCR system. RNA1 levels were then quantified via qPCR using previously published primers (Félix et al., 2011). Orsay virus RNA levels were normalized to the internal control host gene snb-1 (primers GCTCAGGTTGATGAAGTCGTC and GGTGGCCGCAGATTTCTC).

Adult animals carrying a transgene containing the wild-type RNA1 or RNA1D601A Orsay virus genome segment under the control of a heat-inducible promoter were placed on the indicated bacteria for 4 hr before heat-shock at 33°C for 2 hr (Jiang et al., 2017). Animals then recovered at 20°C for 20 hr before harvesting for RNA extraction and qPCR as detailed above. RNA1 levels were normalized to the values obtained from animals bearing the wild-type RNA1 and exposed to E. coli OP50.

Adult ERT54 (jyIs8[pals-5p::gfp;myo-2p::mCherry]) or WUM31 (rde-1(ne219); jyIs8[pals-5p::gfp;myo-2p::mCherry)] were exposed to exogenous Orsay virus in the presence of P. lurida MYb11, P. aeruginosa PA01, or P. aeruginosa PA14 prepared as in a susceptibility assay. After 2 hr or 24 hr, animals were harvested for RNA extraction and qPCR as detailed above. RNA1 levels were quantified via qPCR. Within each genotype, the data for each experiment were normalized to the 2 hr timepoint.

A protocol developed for allelic exchange in P. aeruginosa was modified for use in P. lurida MYb11 (Hmelo et al., 2015). Briefly, homology arms flanking the region to be deleted were obtained using polymerase chain reaction (PCR) and cloned into the pExG2-KanR suicide vector using Hi-Fi Assembly (New England Biolabs) (Rietsch et al., 2005). DH5α E. coli were transformed using a standard heat-shock protocol. Successful transformants were selected for LB+Kanamycin (50 μg/mL) plates and colony PCR was performed to check for proper insert size in the transformants. E. coli bearing the desired plasmid were grown overnight in LB+Kanamycin (50 μg/mL). Plasmids were then obtained using a QIAGEN MiniPrep Kit (QIAGEN). Plasmids were assessed for the desired sequence by Sanger sequencing and transformed into P. lurida MYb11 using the following electroporation procedure. P. lurida MYb11 was grown overnight then placed on ice for 30 min. The culture was spun down at 4°C and washed twice with ice-cold water. After reconstitution in 100 μL of ice-cold water the suspension was transferred to a pre-chilled cuvette and transformed at 630 kV using an Eporator (Eppendorf). 900 μL of LB was added, and the suspension was transferred to a microcentrifuge tube and incubated at 27°C for 2 hr with shaking. The suspension was then plated on LB+Kanamycin (50 μg/mL) plates and grown for 48 hr at 25°C. Colonies were picked and grown overnight in LB. Cultures were streaked onto sucrose plates (15 g agar, 10 g tryptone, 5 g yeast, 60 g sucrose per 1 L water) to perform sucrose-based counter selection (Hmelo et al., 2015). Colonies that survived were genotyped for the expected deletion.

Assay plates, bacteria, and ZD2611 animals were prepared as indicated above, however plates were prepared with the addition of 50 μg of 5-fluorodeoxyuridine to eliminate the need to transfer animals during the assay by preventing reproduction. 30 young adult ZD2611 animals were added to each assay plate and assessed for survival every 24 hr. Three replicate plates were prepared per experiment and three experiments were performed in total.

Assay plates, bacteria, and ZD2611 animals were prepared as indicated above. 20 young adult ZD2611 animals were transferred to each assay plate. At 6 hr and 24 hr, animals were recorded with slow-motion video capture (1/4×) while feeding. Cycles of pharyngeal pumping were counted and used to calculate the number of pharyngeal pumps per minute.

Bacteria were grown in LB for 48 hr before being spun down at 4000×g for 6 min. The resulting cell pellets were weighed and reconstituted to 25 mg/mL in their own culture supernatant. Concentrated bacteria were then combined with filtered M9 for colonization experiments or filtered M9 plus 1 μL of Orsay filtrate for mixing susceptibility assays. For mixing susceptibility assays young adult ZD2611 individuals prepared as above were added to the mixture before addition to plates such that the bacterial lawn covered the entire plate. For colonization assays N2 animals were prepared in the same manner to adulthood. Mixing susceptibility assays were scored as a susceptibility assay as indicated above. Colonization assays were scored at 4 hr or 24 hr. Briefly, animals were picked off of the plate and anesthetized in sodium azide before mounting on a microscope slide. Fluorescent images of the region of the intestinal lumen behind the pharynx were imaged using a Zeiss AxioImager Z.1 compound microscope. Images were then imported into FIJI for analysis (Schneider et al., 2012; Schindelin et al., 2012). An irregular polygon tracing the region behind the pharynx was drawn and the median fluorescence intensity measured.

Animals were prepared for electron microscopy as indicated above for susceptibility assays. Animals were washed off their plates in M9 and allowed to pellet by gravity. The supernatant was removed and animals were anesthetized with sodium azide. Animals were then pipetted into a type A 6 mm Cu/Au carrier (Leica) and frozen in a high-pressure freezer (EM ICE, Leica). This was followed by the following freeze substitution protocol: (EM AFS2, Leica).

All experiments were performed three times. For transmission, qPCR, FISH-based susceptibility assays, and lifespan assays data from each experiment are combined. For susceptibility assays and colonization assays a single representative experiment is shown and replicates are shown in the supplementary material. All qPCR-related data were analyzed in GraphPad Prism 10.2.3. All other data were analyzed in R Studio running R version 4.2.2 (R Development Core Team, 2022). When comparing all the means of more than two groups p-values were calculated using one-way ANOVA followed by the Tukey’s HSD (honest significant difference) test. When comparing multiple experimental groups to a control group p-values were calculated using one-way ANOVA followed by Dunnett’s test. p-Values for assays comparing only two groups were calculated using Student’s t-test or Welch’s t-test as indicated. E. coli OP50 is included in all experiments as a reference but was not included for statistical comparison unless explicitly noted. Susceptibility assay curves were modeled using the drc (Ritz et al., 2015) package in R. A two-parameter log-logistic function was used to model the curve and ID₅₀ values were calculated using the ED function. Kaplan-Meier survival curves were made using the survival (Therneau, 2023) package and curves were compared using the log-rank test within the survdiff function. Plots were made using the gdata (Warnes, 2022), scales (Wickham and scales, 2022), drc (Ritz et al., 2015), Rmisc (Hope, 2022), multcomp (Hothorn et al., 2008), survival (Therneau, 2023), ggplot2 (Wickham, 2016), ggsignif (Ahlmann-Eltze and Patil, 2021), and cowplot (Wilke, 2020) packages.

All reagents generated in this study (Supplementary file 1a and b) are available upon request. Primer sequence information is contained within Supplementary file 2.