<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.3 20210610//EN"  "JATS-archivearticle1-3-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.3"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">92635</article-id><article-id pub-id-type="doi">10.7554/eLife.92635</article-id><article-id pub-id-type="doi" specific-use="version">10.7554/eLife.92635.3</article-id><article-version article-version-type="publication-state">version of record</article-version><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell Biology</subject></subj-group></article-categories><title-group><article-title>Progesterone induces meiosis through two obligate co-receptors with PLA2 activity</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Nader</surname><given-names>Nancy</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0003-1688-8174</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Assaf</surname><given-names>Lama</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Zarif</surname><given-names>Lubna</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Halama</surname><given-names>Anna</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Yadav</surname><given-names>Sharan</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Dib</surname><given-names>Maya</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Attarwala</surname><given-names>Nabeel</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Chen</surname><given-names>Qiuying</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-5909-3959</contrib-id><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="other" rid="fund3"/><xref ref-type="other" rid="fund4"/><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Suhre</surname><given-names>Karsten</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con9"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author"><name><surname>Gross</surname><given-names>Steven</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="fn" rid="con10"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes"><name><surname>Machaca</surname><given-names>Khaled</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0001-6215-2411</contrib-id><email>khm2002@qatar-med.cornell.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con11"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01cawbq05</institution-id><institution>Calcium Signaling Group, Research Department, Weill Cornell Medicine Qatar, Education City, Qatar Foundation</institution></institution-wrap><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02r109517</institution-id><institution>Department of Physiology and Biophysics, Weill Cornell Medicine</institution></institution-wrap><addr-line><named-content content-type="city">New York</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03eyq4y97</institution-id><institution>College of Health and Life Science, Hamad bin Khalifa University</institution></institution-wrap><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01cawbq05</institution-id><institution>Research Department, Weill Cornell Medicine Qatar, Education City, Qatar Foundation</institution></institution-wrap><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff><aff id="aff5"><label>5</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/01cawbq05</institution-id><institution>Medical program, Weill Cornell Medicine Qatar, Education City, Qatar Foundation</institution></institution-wrap><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff><aff id="aff6"><label>6</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02r109517</institution-id><institution>Department of Pharmacology, Weill Cornell Medicine</institution></institution-wrap><addr-line><named-content content-type="city">New York</named-content></addr-line><country>United States</country></aff><aff id="aff7"><label>7</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/024mw5h28</institution-id><institution>Biological Sciences division, University of Chicago</institution></institution-wrap><addr-line><named-content content-type="city">Chicago</named-content></addr-line><country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Russell</surname><given-names>Darryl L</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00892tw58</institution-id><institution>University of Adelaide</institution></institution-wrap><country>Australia</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Yan</surname><given-names>Wei</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/05dk0ce17</institution-id><institution>Washington State University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><pub-date publication-format="electronic" date-type="publication"><day>28</day><month>01</month><year>2025</year></pub-date><volume>13</volume><elocation-id>RP92635</elocation-id><history><date date-type="sent-for-review" iso-8601-date="2023-10-17"><day>17</day><month>10</month><year>2023</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint.</event-desc><date date-type="preprint" iso-8601-date="2023-10-18"><day>18</day><month>10</month><year>2023</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2023.09.09.556646"/></event><event><event-desc>This manuscript was published as a reviewed preprint.</event-desc><date date-type="reviewed-preprint" iso-8601-date="2024-01-18"><day>18</day><month>01</month><year>2024</year></date><self-uri content-type="reviewed-preprint" xlink:href="https://doi.org/10.7554/eLife.92635.1"/></event><event><event-desc>The reviewed preprint was revised.</event-desc><date date-type="reviewed-preprint" iso-8601-date="2024-12-13"><day>13</day><month>12</month><year>2024</year></date><self-uri content-type="reviewed-preprint" xlink:href="https://doi.org/10.7554/eLife.92635.2"/></event></pub-history><permissions><copyright-statement>© 2024, Nader et al</copyright-statement><copyright-year>2024</copyright-year><copyright-holder>Nader et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-92635-v1.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-92635-figures-v1.pdf"/><abstract><p>The steroid hormone progesterone (P4) regulates multiple aspects of reproductive and metabolic physiology. Classical P4 signaling operates through nuclear receptors that regulate transcription. In addition, P4 signals through membrane P4 receptors (mPRs) in a rapid nongenomic modality. Despite the established physiological importance of P4 nongenomic signaling, the details of its signal transduction cascade remain elusive. Here, using <italic>Xenopus</italic> oocyte maturation as a well-established physiological readout of nongenomic P4 signaling, we identify the lipid hydrolase ABHD2 (α/β hydrolase domain-containing protein 2) as an essential mPRβ co-receptor to trigger meiosis. We show using functional assays coupled to unbiased and targeted cell-based lipidomics that ABHD2 possesses a phospholipase A2 (PLA2) activity that requires mPRβ. This PLA2 activity bifurcates P4 signaling by inducing clathrin-dependent endocytosis of mPRβ, resulting in the production of lipid messengers that are G-protein coupled receptor agonists. Therefore, P4 drives meiosis by inducing an ABHD2 PLA2 activity that requires both mPRβ and ABHD2 as obligate co-receptors.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>progesterone</kwd><kwd>membrane progesterone receptor beta</kwd><kwd>ABHD2</kwd><kwd>nongenomic signaling</kwd><kwd>PLA2</kwd><kwd>lipid messengers</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>Xenopus</italic></kwd><kwd>Other</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100007458</institution-id><institution>Qatar Foundation</institution></institution-wrap></funding-source><award-id>BMRP</award-id><principal-award-recipient><name><surname>Machaca</surname><given-names>Khaled</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100008982</institution-id><institution>Qatar National Research Fund</institution></institution-wrap></funding-source><award-id>NPRP13S-0206-200274</award-id><principal-award-recipient><name><surname>Nader</surname><given-names>Nancy</given-names></name><name><surname>Machaca</surname><given-names>Khaled</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000052</institution-id><institution>NIH Office of the Director</institution></institution-wrap></funding-source><award-id>R01AR076029</award-id><principal-award-recipient><name><surname>Chen</surname><given-names>Qiuying</given-names></name></principal-award-recipient></award-group><award-group id="fund4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000135</institution-id><institution>NIH Blueprint for Neuroscience Research</institution></institution-wrap></funding-source><award-id>R21ES032347</award-id><principal-award-recipient><name><surname>Chen</surname><given-names>Qiuying</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Progesterone mediates nongenomic signaling in <italic>Xenopus</italic> oocyte meiosis by activating a PLA2 activity that requires two membrane receptors ABDH2 and mPRß.</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>publishing-route</meta-name><meta-value>prc</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>P4 signaling is critical for the regulation of female reproduction, sperm activation, neuronal function, and modulation of the immune system (<xref ref-type="bibr" rid="bib15">Garg et al., 2017</xref>; <xref ref-type="bibr" rid="bib57">Thomas, 2012</xref>; <xref ref-type="bibr" rid="bib8">Dressing et al., 2011</xref>). The classical mode of P4 signaling is through nuclear receptors (nPRs) that act as transcription factors and modulate gene expression, resulting in cellular responses on a relatively slow time scale (<xref ref-type="bibr" rid="bib49">Rekawiecki et al., 2011</xref>). In addition, P4 mediates rapid signal transduction that is independent of transcription and has thus been referred to as nongenomic. This signaling modality can be mediated by mPRs that are members of the progestin and AdipoQ receptors family (PAQR), and consist of 11 receptors with 5 being specific to P4: PAQR5 (mPRγ), PAQR6 (mPRδ), PAQR7 (mPRα), PAQR8 (mPRβ), and PAQR9 (mPRϵ) (<xref ref-type="bibr" rid="bib56">Tang et al., 2005</xref>). Several lines of evidence support the importance of nongenomic mPR-dependent signaling, including results from studies of nPR knockout mouse lines, the speed of the signal transmission following P4 treatments, and the observed activity of membrane impermeant BSA-coupled P4 (<xref ref-type="bibr" rid="bib8">Dressing et al., 2011</xref>; <xref ref-type="bibr" rid="bib59">Valadez-Cosmes et al., 2016</xref>; <xref ref-type="bibr" rid="bib13">Frye et al., 2006</xref>; <xref ref-type="bibr" rid="bib26">Lydon et al., 1995</xref>). Currently, mPR-mediated signaling is recognized as an important regulator of many biological functions in the nervous and cardiovascular systems, female and male reproductive tissues, intestine, immune and cancer cells, and glucose homeostasis (<xref ref-type="bibr" rid="bib8">Dressing et al., 2011</xref>; <xref ref-type="bibr" rid="bib59">Valadez-Cosmes et al., 2016</xref>; <xref ref-type="bibr" rid="bib36">Moussatche and Lyons, 2012</xref>; <xref ref-type="bibr" rid="bib7">Dosiou et al., 2008</xref>; <xref ref-type="bibr" rid="bib12">Flock et al., 2013</xref>). Thus, mPRs are emerging as potential clinical targets for hypertension, reproductive disorders, and neurological diseases (<xref ref-type="bibr" rid="bib60">Wendler and Wehling, 2022</xref>). However, their downstream signaling events are not well defined.</p><p>mPRs are integral membrane proteins with predicted 7-transmembrane domains, a cytoplasmic N-terminus, and an extracellular C-terminus, which were first identified in fish ovaries almost two decades ago (<xref ref-type="bibr" rid="bib56">Tang et al., 2005</xref>; <xref ref-type="bibr" rid="bib62">Zhu et al., 2003</xref>; <xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>). This topology is opposite to that of G-protein coupled receptors (GPCRs), yet there is an abundance of evidence for G protein activation downstream of mPRs, primarily Gα<sub>i</sub> and also Gβγ (<xref ref-type="bibr" rid="bib58">Thomas, 2022</xref>). However, there are conflicting reports as to whether mPRs signal through trimeric G-proteins or other modalities that remain to be defined (<xref ref-type="bibr" rid="bib36">Moussatche and Lyons, 2012</xref>; <xref ref-type="bibr" rid="bib54">Smith et al., 2008</xref>).</p><p>The anuran <italic>Xenopus laevis</italic> is a particularly suitable model to study P4 nongenomic signaling for two reasons: (1) the oocyte is transcriptionally silent, so signaling can only occur through the nongenomic arm; (2) P4 is known to trigger <italic>Xenopus</italic> oocyte maturation through the activation of mPRβ (PAQR8) (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>; <xref ref-type="bibr" rid="bib21">Josefsberg Ben-Yehoshua et al., 2007</xref>). Fully grown vertebrate oocytes arrest at prophase I of meiosis for prolonged periods before undergoing maturation in preparation for fertilization (<xref ref-type="bibr" rid="bib38">Nader et al., 2013</xref>). Importantly, P4 triggers re-entry into meiosis as well as a series of cytoplasmic differentiation steps that allow the egg to become fertilization-competent, able to activate in response to sperm entry, and to support early embryogenesis (<xref ref-type="bibr" rid="bib28">Machaca, 2007</xref>). Signaling downstream of mPRβ ultimately leads to activation of maturation promoting factor (MPF), composed of Cdk1 and cyclin B, that serves as the primary kinase which triggers oocyte entry into M-phase (<xref ref-type="bibr" rid="bib43">Nebreda and Ferby, 2000</xref>). MPF is activated non-reversibly through two signaling cascades, Plk-Cdc25C and the MAPK cascade (<xref ref-type="fig" rid="fig1">Figure 1A</xref>).</p><fig-group><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>α/β hydrolase domain-containing protein 2 (ABHD2) is required for P4-induced oocyte maturation.</title><p>(<bold>A</bold>) Signaling events downstream of mPRβ after progesterone (P4), leading to oocyte maturation. The role of GPR185 is also depicted. (<bold>B</bold>) mRNAs transcripts levels of mPRβ, ABHD2.S, ABHD2.LS, and <italic>Xenopus</italic> Ornithine decarboxylase (xODC) in oocytes using the Cycle threshold (Ct) generated from real-time PCR. (<bold>C</bold>) ABHD2 knockdown experiments. Oocytes were injected with specific ABHD2 antisense (AS) oligonucleotides and incubated at 18 °C for 24 hr. RNAs were prepared and analyzed by RT-PCR to determine the efficacy of ABHD2 knockdown as compared to naïve oocytes and mPRβ RNAs levels. Data are expressed as relative RNAs levels of ABHD2 and mPRβ mRNA after normalizing to xODC as a house keeping gene. (<bold>D</bold>) Representative WB of ABHD2 in naive and oocytes over-expressing ABHD2.L or ABHD2.S, following ABHD2 antisense (AS) oligonucleotide injection. Tubulin is shown as a loading control. (<bold>E</bold>) Oocyte maturation following injection of control antisense (Ctrl AS) or ABHD2 antisense (AS) with or without overexpression of ABHD2.S (AS +WT) and normalized to P4-treated naïve oocytes condition (Naive), (mean ± SEM; n=7 independent female frogs, ordinary one-way ANOVA). (<bold>F</bold>) Representative WB of MAPK, Plk1, and Cdc2 phosphorylation from untreated oocytes, eggs matured by overnight (O/N) treatment with P4, oocytes injected with control antisense (Ctrl AS) or ABHD2 antisense (AS) with or without overexpression of mPRβ. Tubulin is shown as a loading control. (<bold>G</bold>) Oocyte maturation in oocytes injected with control antisense (Ctrl AS) or ABHD2 antisense (AS) with or without overexpression of mPRβ and normalized to P4-treated naïve oocytes (mean ± SEM; n=3 independent female frogs, ordinary one-way ANOVA). (<bold>H</bold>) Schematic representation of <italic>Xenopus</italic> ABHD2.S and.L domains, including the acyltransferase and lipase motifs. (<bold>I, K</bold>) Oocyte maturation in oocytes injected with control antisense (Ctrl AS) or ABHD2 antisense (AS) with or without overexpression of ABHD2.S wild type (AS +WT) and the different ABHD2.S mutants as indicated, and normalized to P4-treated naïve oocytes (mean ± SEM; n=3 independent female frogs, ordinary one-way ANOVA). (<bold>J,L</bold>) Representative WB of MAPK, Plk1, and Cdc2 phosphorylation from untreated oocytes, eggs matured by overnight (O/N) with P4, oocytes injected with control antisense (Ctrl AS) or ABHD2 antisense (AS) with or without overexpression of the different ABHD2.S mutants as indicated on the panel. Tubulin is shown as a loading control.</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>Original files for western blot analysis displayed in <xref ref-type="fig" rid="fig1">Figure 1D,F,J,L</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig1-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig1sdata2"><label>Figure 1—source data 2.</label><caption><title>File containing labeled western blots for <xref ref-type="fig" rid="fig1">Figure 1D,F,J,L</xref>, indicating the relevant bands and treatments.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig1-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig1-v1.tif"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><label>Figure 1—figure supplement 1.</label><caption><title>Progesterone receptors in Xenopus oocytes.</title><p>(<bold>A</bold>) Table representing the number of transcripts per million (TPM) of the different progesterone receptors in <italic>Xenopus laevis</italic> oocytes (Ooc. S., and Ooc.(L).), eggs (Egg S., and Egg L.), and the ovary. Being tetraploid, <italic>Xenopus laevis</italic> expresses two different versions of each gene; S and L. the data are retrieved from Xenbase. (<bold>B</bold>) Alignment of <italic>Xenopus laevis</italic> α/β hydrolase domain-containing protein 2 (ABHD2).L and ABHD2.S amino acids sequences with human ABHD2. Residues implicated in the lipase activity of ABHD2 are highlighted in green, whereas the acetyltransferase domain is highlighted in purple. (<bold>C</bold>) Representative western blot (WB) of mPR-GFP proteins expression in naïve, control antisense (Ctrl AS), ABHD2 antisense (AS), and AS +mPR GFP injected oocytes. Tubulin is shown as a loading control. (<bold>D</bold>) Representative WB of ABHD2.S protein expression levels in naïve oocytes and in oocytes injected with mRNA to overexpress ABHD2 wildtype (WT), ABHD2.S S207A, ABHD2.S S207A/D345A/H376A (S/D/H). Tubulin is shown as a loading control.</p><p><supplementary-material id="fig1s1sdata1"><label>Figure 1—figure supplement 1—source data 1.</label><caption><title>Original files for western blot analysis are displayed in <xref ref-type="fig" rid="fig1">Figure 1C,D</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig1-figsupp1-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig1s1sdata2"><label>Figure 1—figure supplement 1—source data 2.</label><caption><title>File containing labeled western blots for <xref ref-type="fig" rid="fig1">Figure 1C,D</xref>, indicating the relevant bands and treatments.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig1-figsupp1-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig1-figsupp1-v1.tif"/></fig></fig-group><p>In addition, oocyte meiotic arrest is maintained by high levels of cAMP-PKA through the action of a constitutively active GPCR, GPR185 (<xref ref-type="bibr" rid="bib50">Ríos-Cardona et al., 2008</xref>; <xref ref-type="bibr" rid="bib39">Nader et al., 2014</xref>). PKA blocks maturation by inhibiting both arms of the pathway: translation and Cdc25C (<xref ref-type="fig" rid="fig1">Figure 1A</xref>; <xref ref-type="bibr" rid="bib9">Duckworth et al., 2002</xref>; <xref ref-type="bibr" rid="bib32">Matten et al., 1994</xref>). Interestingly, GPR185 is internalized in response to P4, which inhibits its ability to activate adenylate cyclase and thus renders the oocyte more permissive for maturation (<xref ref-type="bibr" rid="bib39">Nader et al., 2014</xref>). Several studies have detected a drop in cAMP levels in response to P4 using ELISA (<xref ref-type="bibr" rid="bib39">Nader et al., 2014</xref>; <xref ref-type="bibr" rid="bib52">Schorderet-Slatkine et al., 1982</xref>; <xref ref-type="bibr" rid="bib29">Maller et al., 1979</xref>; <xref ref-type="bibr" rid="bib51">Sadler and Maller, 1981</xref>; <xref ref-type="bibr" rid="bib40">Nader et al., 2016</xref>), but these findings could not be replicated using various reporters for cAMP and PKA at the single-cell level in real-time (<xref ref-type="bibr" rid="bib40">Nader et al., 2016</xref>). Furthermore, the different sensors did not detect a global drop in cAMP in response to P4, and P4-dependent maturation proceeds even when cAMP is high (<xref ref-type="bibr" rid="bib40">Nader et al., 2016</xref>). This argues that P4 signals through parallel pathways that can overwhelm the cAMP-PKA-dependent inhibition.</p><p>We have previously shown that mPRβ signals through APPL1 and AKT2 to activate Plk and MPF by forming a complex of activators within signaling endosomes (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>). Importantly, enrichment of mPRβ within endosomes is sufficient to induce maturation in the absence of P4, arguing that a primary function of P4 is to induce clathrin-dependent endocytosis of mPRβ (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>).</p><p>The lipase α/β hydrolase domain-containing protein 2 (ABHD2), an integral plasma membrane protein belonging to the ABHD family, was identified as a membrane progesterone receptor in human sperm (<xref ref-type="bibr" rid="bib60">Wendler and Wehling, 2022</xref>; <xref ref-type="bibr" rid="bib33">Miller et al., 2016</xref>) ABHD2 acts a monoacyl glycerol lipase (MAGL) that hydrolyses 2-arachidonoylglycerol (2-AG) forming arachidonic acid (AA) and glycerol and leads to sperm activation (<xref ref-type="bibr" rid="bib33">Miller et al., 2016</xref>). ABHD2 has also been implicated in follicular maturation in mammals (<xref ref-type="bibr" rid="bib3">Björkgren et al., 2021</xref>), vascular smooth muscle migration, and in pulmonary emphysema (<xref ref-type="bibr" rid="bib20">Jin et al., 2009</xref>; <xref ref-type="bibr" rid="bib34">Miyata et al., 2005</xref>). In addition, ABHD2 was proposed to function as a triacylglycerol (TAG) lipase (<xref ref-type="bibr" rid="bib42">Naresh Kumar et al., 2016</xref>), and was shown to localize to the ER where it regulates Ca<sup>2+</sup> release (<xref ref-type="bibr" rid="bib61">Yun et al., 2017</xref>).</p><p>Here, we show that ABHD2 is required for the P4-induced release of oocyte meiotic arrest. Using untargeted lipidomic analyses, we detect broad downregulation of glycerophospholipid (GPL) and sphingolipid lipid metabolites in association with the enrichment of a key bioactive lipid messengers that include prostaglandins (PGs), lysophosphatidic acid (LPA), and potentially sphingosine-1-phosphate (S1P). Importantly, we show that ABHD2 acts as a PLA2 that requires mPRβ to generate the aforementioned lipid messengers. The ABHD2 evoked PLA2 activity also triggers mPRβ endocytosis, which as we have previously shown is sufficient to initiate oocyte maturation (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>). To our knowledge, this is the first example of an α/β hydrolase that requires a heterologous co-receptor for activation.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>ABHD2 is required for P4-induced oocyte maturation</title><p>While reviewing the expression levels of various progesterone receptors in the <italic>Xenopus</italic> ovary, we noticed high levels of expression of ABHD2 in the oocyte and egg (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>). <italic>Xenopus laevis</italic> is tetraploid so it expresses two different versions of each gene, called S and L. There is significant sequence conservation between xABDH2.S and xABDH2.L with the human isoform, expect that xABHD2.L is truncated at position 309 (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>). Using primers specific to xABDH2.S and ones that amplify both the S and L isoforms, we confirmed that ABHD2 RNA is expressed in the oocyte at levels similar to those of mPRβ RNA (<xref ref-type="fig" rid="fig1">Figure 1B</xref>).</p><p>To test whether ABHD2 plays a role in oocyte maturation, we downregulated its expression by injecting anti-ABHD2 (L/S) oligos, which resulted in a significant reduction of ABHD2 RNA levels without affecting the levels of mPRβ RNA (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). We could not detect endogenous oocyte ABHD2 using Western blots (WB) most likely due to low expression levels, as we could readily detect overexpressed ABHD2 (<xref ref-type="fig" rid="fig1">Figure 1D</xref>). We thus tested the efficacy of the antisense (AS) approach on overexpressed ABHD2 (either L or S). <xref ref-type="fig" rid="fig1">Figure 1D</xref> shows the effective reduction of both isoforms (<xref ref-type="fig" rid="fig1">Figure 1D</xref>) within 24 hr after antisense injection, arguing for a short ABHD2 half-life on the order of hours. Interestingly, knocking down ABHD2 expression inhibited oocyte maturation in response to P4 (<xref ref-type="fig" rid="fig1">Figure 1E</xref>), and was coupled to blocking Plk1, MAPK, and MPF activation (<xref ref-type="fig" rid="fig1">Figure 1F</xref>). This inhibition was significantly reversed by overexpression of ABHD2 (<xref ref-type="fig" rid="fig1">Figure 1E</xref>), confirming that the specific knockdown of ABHD2 – and not off-target effects – mediated AS action. Overexpression of mPRβ in ABHD2 antisense treated oocytes (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1C</xref>) was less effective at rescuing oocyte maturation although it did have a significant effect (<xref ref-type="fig" rid="fig1">Figure 1G</xref>), and partially rescued Plk1 and MAPK activation but not MPF (<xref ref-type="fig" rid="fig1">Figure 1F</xref>). These data argue that both mPRβ and ABHD2 are required to sufficiently activate the kinase cascades downstream of P4 to induce oocyte maturation.</p></sec><sec id="s2-2"><title>ABHD2 lipase domain is required for P4-induced oocyte maturation</title><p>ABHD2 is a serine hydrolase that belongs to the α/β hydrolase family with a conserved lipid hydrolase domain GxSxG with residues D345 and H376 being important for lipase activity based on sequence homology (<xref ref-type="fig" rid="fig1">Figure 1H</xref>). In addition, as with other members of the α/β hydrolase family, <italic>Xenopus</italic> ABHD2 has an acyltransferase domain that is close to the human HxxxD consensus but with Asn replacing the Asp residue (<xref ref-type="fig" rid="fig1">Figure 1H</xref>). As ABHD2 has been shown to function as a P4-dependent hydrolase that is important for sperm activation (<xref ref-type="bibr" rid="bib33">Miller et al., 2016</xref>), we wondered whether ABHD2 lipase activity is similarly important for oocyte maturation.</p><p>To evaluate this possibility, we replaced the conserved functionally relevant residues in the HxxxD acyltransferase domain motif (i.e. H120 and N125) with Ala and tested the mutants’ ability to induce oocyte maturation in response to P4. Both the H120A and N125A mutants induced oocyte maturation to similar levels as those observed with WT ABHD2 in oocytes injected with ABHD2-AS (<xref ref-type="fig" rid="fig1">Figure 1I</xref>), and this rescue was associated with effective expression of both mutants and activation of Plk1, MAPK, and MPF in eggs (<xref ref-type="fig" rid="fig1">Figure 1J</xref>). These findings demonstrate that the ABHD2 acyltransferase motif is not required for maturation.</p><p>To test for the role of ABHD2 lipid hydrolase activity in oocyte maturation, we mutated all three catalytically relevant residues: S207 within the GxSxG motif, D345, and H376 to Ala (S/D/H mutant) or just S207 to Ala. Effective expression of either the S/D/H or S207A mutants (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>), did not induce maturation in oocytes where endogenous ABHD2 was knocked down (<xref ref-type="fig" rid="fig1">Figure 1K</xref>). Neither mutant activated Plk1 or MPF, but expression of S207A led to low-level MAPK activation (<xref ref-type="fig" rid="fig1">Figure 1L</xref>) that was not associated with maturation (<xref ref-type="fig" rid="fig1">Figure 1K</xref>). We further tested whether the shorter ABHD2.L (309 residues) is functional as it is missing the C-terminal end of the α/β hydrolase domain including both D345 and H376. Notably, ABHD2.L did not induce oocyte maturation in response to P4 (<xref ref-type="fig" rid="fig1">Figure 1K</xref>) nor did it activate Plk1, MAPK, or MPF (<xref ref-type="fig" rid="fig1">Figure 1L</xref>). These data show that all three residues involved in lipase activity (S207, D345, H376) are critical for ABHD2 P4-mediated oocyte maturation.</p></sec><sec id="s2-3"><title>Lipidomics during oocyte maturation</title><p>The requirement for the lipase domain within ABHD2 for P4-dependent oocyte maturation suggests a potential role for lipid messengers downstream of P4 to release oocyte meiotic arrest. There is support for this idea in the literature from several early studies implicating lipid messengers in oocyte maturation, although there has been little consensus regarding specific pathways, lipases, or lipid mediators (<xref ref-type="bibr" rid="bib35">Mostafa et al., 2022</xref>). To globally assess oocyte lipid profiles in response to P4, we performed unbiased mass-spectrometry-based lipidomics and metabolomics (using the Metabolon CLP and HD4 platforms) at two-time points after P4: 5 min to assess rapid changes in lipid abundances, and 30 min, a ‘point of no return’ where the majority of oocytes in the population commit to maturation (<xref ref-type="bibr" rid="bib39">Nader et al., 2014</xref>). Furthermore, to be able to differentiate between pathways that are activated specifically through mPRβ or ABHD2, we performed the profiling on oocytes following mPRβ or ABHD2 knockdown.</p><p>The role of lipid signaling in oocyte maturation remains poorly defined, partly due to technical limitations in early studies, but also as a result of the complexity and transient nature of lipid signals (<xref ref-type="bibr" rid="bib35">Mostafa et al., 2022</xref>). An additional confounding factor in oocyte lipidomics is that oocytes in the population mature in an asynchronous fashion in response to P4. This asynchrony makes the identification of transient lipid messengers challenging. Finally, metabolomic profiles depend on environmental factors, basal metabolic rates, diet, and physical activity and are as such quite variable. We observe this variability as metabotypes that are specific to individual frog donors in the principal component analysis in data from both the HD4 and CLP platforms (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1A</xref>).</p><p>To minimize these technical and biological confounding factors, we performed the metabolomics analysis on groups of 10 oocytes at each time point and looked for relative changes in specific metabolites over time for each donor (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). That is the metabolic profile at T0 served as the baseline for each frog and we looked for changes in each metabolite at the 5- and 30 min time points after P4 addition. Furthermore, we averaged data from specific metabolites at the sub-pathway level to identify changes that are consistent among the three donor frogs tested. Data at the specific metabolite levels for both the CLP and HD4 platforms are presented in <xref ref-type="supplementary-material" rid="sdata3">Source data 3</xref>.</p><fig-group><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Metabolomics and lipidomics.</title><p>(<bold>A</bold>) Summary of the experimental setup. Naïve oocytes (Con) and oocytes injected with either mPR (mPR-KD) or α/β hydrolase domain-containing protein 2 (ABHD2) antisense (ABHD2-KD) were treated for 5 or 30 min with progesterone (P4). For each condition and time point, five replicates of 10 pooled oocytes each were collected. The experiment was repeated using three donor females. (<bold>B</bold>) Heatmap of fold changes for metabolites that were changed significantly (p&lt;0.05) at either the 5 min (T5) or 30 min (T30) time points in response to P4 as compared to untreated oocytes (T5/T0 and T30/T0) for naive (Con), mPR-KD, and ABHD2-KD oocytes. Metabolites are clustered at the levels of glycerophospholipids and sphingolipids and then at the pathway level as follows: PE (Phosphatidylethanolamines), LPE (Lysophosphatidylethanolamines), PC (Phosphatidylcholines), LPC (Lysophosphatidylcholine), PI (Phosphatidylinositols), DAG (Diacylglycerols), MAG (Monoacylglycerols), CER (Ceramides), HCER (Hexosylceramides), LCER (Lactosylceramides), and SM (Sphingomyelins). <xref ref-type="supplementary-material" rid="sdata3">Source data 3</xref> Tables 1–6 show the means and p-value for each ratio fold change. (<bold>C</bold>) Distribution of metabolites that are reduced (blue) or increased (red) significantly in single naïve oocytes 30 min after P4. Fold change and p-values were calculated from 10 individual oocytes at each time point. The raw data is listed in <xref ref-type="supplementary-material" rid="sdata3">Source data 3</xref> Table 7. (<bold>D</bold>) Summary of the changes in sphingolipids and glycerophospholipids after progesterone treatment. Increase (upward green arrow) or decrease (downward red arrow) in metabolite levels is noted. Tested chemical inhibitors are also shown. Strong inhibitors are indicated in red, weak inhibitors in pink, and drugs that do not inhibit oocyte maturation in gray. Generated using Biorender. (<bold>E</bold>) Levels of EETs and HETEs before and after P4 treatment in single oocytes. Naïve oocytes were incubated with either ethanol or P4 10<sup>–5</sup>M for 30 min. 20 single oocytes per condition were collected and used for analysis. 5-oxoETE and 8 (9)-EET were detected in 1 or 2 samples, respectively, so they were not included in the statistical analyses although both were lower following P4 treatment. (<bold>F</bold>) Levels of prostaglandins before (0 min) and after P4 treatment at 5 min and 30 min time points in naïve oocytes. Per each condition, 10 replicates were collected containing 10 pooled oocytes each. The following eicosanoids were not detected in either group: 6kPGF1α, PGF2α, PGE2, TXB2, PGD2, PGA2, PGJ2, 15-deoxyPGJ2, 12-HHTrE, 11-dehydro TXB2, LTB4, LTC4, LTD4, LTE4, 20-hydroxy LTB4, 20-carboxy LTB4, 5 (6)-DiHETEs, LXA4, LXB4, 5 (6)-EET, 5 (6)-DiHET, 8 (9)-DiHET, 11 (<xref ref-type="bibr" rid="bib60">Wendler and Wehling, 2022</xref>)-DiHET, 14 (<xref ref-type="bibr" rid="bib58">Thomas, 2022</xref>)-DHET, 20-HETE. Similar results were obtained from individual oocyte samples (see <xref ref-type="supplementary-material" rid="sdata3">Source data 3</xref> Table 7). Data are normalized to the PG levels at time zero. Example of the raw abundance of individual PG species is shown in <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1C</xref>.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig2-v1.tif"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><label>Figure 2—figure supplement 1.</label><caption><title>Metablomics profiles during oocyte maturation.</title><p>(<bold>A</bold>) Frog-driven metabotype as shown from the HD4 (<italic>left panel</italic>) and CLP platforms (<italic>right panel</italic>). (<bold>B</bold>) Data generated from the HD4 platform illustrated by the heatmap data of fold changes for individual metabolites that were changed significantly (p&lt;0.05) at either the 5 min (T5) or 30 min (T30) time points in response to P4 as compared to untreated oocytes (T5/T0 and T30/T0) for naive (Con), mPR-KD, and ABHD2-KD oocytes. Metabolites are clustered at the levels of fatty acids (FA), long-chain fatty acids (LCFA), polyunsaturated fatty acids (PUFA), and sterols. (<bold>C</bold>) The raw abundance of individual prostaglandin species in pooled oocytes before treatment from a representative frog (#3) to illustrate relative abundance among the different PG species. (<bold>D</bold>) S1P measurements in pooled oocytes before treatment, and at 5 and 30 min after progesterone addition. The data are shown as relative intensity normalized to the average of before-treatment levels.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig2-figsupp1-v1.tif"/></fig></fig-group><table-wrap id="table1" position="float"><label>Table 1.</label><caption><title>Pharmacological inhibitors potency.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Inhibitor</th><th align="left" valign="bottom">Target</th><th align="left" valign="bottom">IC<sub>50</sub> ± SEM Oocyte maturation (M)</th><th align="left" valign="bottom">IC<sub>50</sub> (M) Representative study</th><th align="left" valign="bottom">Ratio (Ooc/Lit)</th></tr></thead><tbody><tr><td style="background-color: #E6E6E6;">ACA</td><td style="background-color: #E6E6E6;">PLA2</td><td style="background-color: #E6E6E6;">3.8E-6±5.8E-7</td><td style="background-color: #E6E6E6;">5E-6 <xref ref-type="bibr" rid="bib24">Liu, 1999</xref></td><td style="background-color: #E6E6E6;">0.76</td></tr><tr><td style="background-color: #E6E6E6;">BEL</td><td style="background-color: #E6E6E6;">PLA2</td><td style="background-color: #E6E6E6;">3.9E-5±8E-6</td><td style="background-color: #E6E6E6;">8E-6 <xref ref-type="bibr" rid="bib2">Balsinde and Dennis, 1996</xref></td><td style="background-color: #E6E6E6;">4.9</td></tr><tr><td align="left" valign="bottom">MP-A08</td><td align="left" valign="bottom">Sphingosine Kinase 1</td><td align="left" valign="bottom">4.3E-5±1E-5</td><td align="left" valign="bottom">2.7E-5 <xref ref-type="bibr" rid="bib48">Pitman et al., 2015</xref></td><td align="left" valign="bottom">1.6</td></tr><tr><td style="background-color: #E6E6E6;">HA130</td><td style="background-color: #E6E6E6;">Autotaxin</td><td style="background-color: #E6E6E6;">4.2E-5±4.8E-5</td><td style="background-color: #E6E6E6;">2.8E-8 <xref ref-type="bibr" rid="bib1">Albers et al., 2010</xref></td><td style="background-color: #E6E6E6;">1,522</td></tr><tr><td align="left" valign="bottom">Ibuprofen</td><td align="left" valign="bottom">Cox-2</td><td align="left" valign="bottom">2.7E-4±6E-5</td><td align="left" valign="bottom">3.7E-4 <xref ref-type="bibr" rid="bib45">Noreen et al., 1998</xref></td><td align="left" valign="bottom">0.73</td></tr><tr><td align="left" valign="bottom">NS398</td><td align="left" valign="bottom">Cox-2</td><td align="left" valign="bottom">1E-4±5E-5</td><td align="left" valign="bottom">3.8E-6 <xref ref-type="bibr" rid="bib14">Futaki et al., 1994</xref></td><td align="left" valign="bottom">26.3</td></tr><tr><td style="background-color: #E6E6E6;">NF-449</td><td style="background-color: #E6E6E6;">GαS</td><td style="background-color: #E6E6E6;">5.2E-5±3E-5</td><td style="background-color: #E6E6E6;">7.9E-6 <xref ref-type="bibr" rid="bib17">Hohenegger et al., 1998</xref></td><td style="background-color: #E6E6E6;">6.5</td></tr></tbody></table></table-wrap><p>Lipidomics analyses on the CLP platform show downregulation in response to P4 of multiple sphingolipid species, including ceramide, hexosylceramide, lactosylceramide, and sphingomyelin at both the 5 min and 30 min time points (<xref ref-type="fig" rid="fig2">Figure 2B</xref> and <xref ref-type="supplementary-material" rid="sdata3">Source data 3</xref> Tables 1–6). A similar decrease in multiple glycerophospholipid species, including phosphatidylethanolamine (PE), phosphatidylcholine (PC), lysoPE, lysoPC, as well as glycerides including monoacylglycerol (MAG), and diacylglycerol (DAG) is observed (<xref ref-type="fig" rid="fig2">Figure 2B</xref> and <xref ref-type="supplementary-material" rid="sdata3">Source data 3</xref> Tables 1–6). The HD4 platform analysis supports and extends these findings although at a lower level of granularity in terms of specific lipid species showing downregulation of multiple fatty acid species including AA (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1B</xref>). Note that most of these changes at the specific biochemical levels are relatively small (20–25% decrease) yet they gain relevance through their combined trend through multiple experiments at the levels of multiple metabolites within the same pathway (<xref ref-type="supplementary-material" rid="sdata3">Source data 3</xref> Tables 1–6).</p><p>Importantly, knockdown of either ABHD2 or mPRβ eliminated the downregulation of sphingolipids and glycerophospholipids in response to P4 at both the 5- and 30 min time points (<xref ref-type="fig" rid="fig2">Figure 2B</xref> and <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1B</xref>). As oocytes with mPRβ or ABHD2 knockdown do not mature in response to P4, the lipidomics data argue that the changes observed in the lipid metabolites are important for oocyte maturation; and that both mPRβ and ABHD2 are required to initiate the lipase activities underlying these changes. The fact that many of those changes are observed early on after P4 addition (5 min) argues that they represent the initial signaling step downstream of P4 to commit the oocyte to meiosis.</p><p>We were initially puzzled by the global lipidomics profiles as they showed mostly downregulation of both GPL and sphingolipid species. If the cells are indeed in broad lipid catabolism mode, one would expect enrichment in some lipid end products. However, because oocyte maturation is asynchronous, changes in individual lipid species may be masked when several oocytes are pooled as in our lipidomics analyses. To get better insights into changes at the single oocyte level, we developed approaches (see Methods) to extract and analyze metabolites at the single oocyte level at the 30 min post-P4 time point. Single oocyte data showed a threefold increase in LPA and replicated the downregulation of GPL and sphingolipid species observed in the pooled analysis (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). The lipidomics changes observed in response to P4 are summarized in <xref ref-type="fig" rid="fig2">Figure 2D</xref> along both the GPL and sphingolipid pathways by an arrow up (red) or down (green) next to each detected lipid species.</p><p>Some end products of GPL and SL metabolism such as eicosanoids and sphingosine 1 phosphate (S1P) are not well suited to the standard extraction protocols used for our global metabolomics studies. Therefore, to enrich for these end products we performed targeted extraction and MS analyses against validated standards for eicosanoids and S1P, which would be the most likely end metabolites enriched based on the downregulation profile of other metabolites throughout the GPL and SL pathways (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). AA is a precursor for eicosanoids, which are produced through three main enzymatic pathways: (1) cyclooxygenases (cox1/cox2) action results in the formation of prostaglandins; (2) lipoxygenases produce leukotrienes; and (3) cytochrome P450 enzymes, ω-hydrolases and epoxygenases, yield hydroxyeicosatetraenoic acids (HETEs) and epoxyeicosatrienoic acids (EETs), respectively (<xref ref-type="fig" rid="fig2">Figure 2D</xref>).</p><p>We could not detect any leukotrienes in the oocyte samples despite testing for multiple species (LTB4, LTC4, LTD4, LTE4, 20-hydroxy LTB4, 20-carboxy LTB4) but could observe a downregulation in their precursor hydroxy-eicosatetraenoic acids (HETE) (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). We did, however, detect a decrease in LTB4 derivatives in the single oocyte MS analyses (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). We also observed decreases in two epoxyeicosatrienoids (EET) from single oocyte samples (20 oocytes at 30 min post-P4) (<xref ref-type="fig" rid="fig2">Figure 2E</xref>). In contrast to leukotrienes and lipoxins, the trend in prostaglandins (PG) was the opposite with increases observed in multiple species, including PGI2, PGF1a, PGE2/PGD2, and PGF2a (<xref ref-type="fig" rid="fig2">Figure 2F</xref>). <xref ref-type="fig" rid="fig2">Figure 2E</xref> shows the relative changes of PG species from different donor females. To illustrate the basal abundance of the different PGs species relative to each other, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1C</xref> shows the raw abundance of the different PGs relative to each other. Collectively these targeted metabolomics profiles show that AA is preferentially metabolized by cyclooxygenases at the expense of lipoxygenases/epoxygenases to produce PGs in response to P4 (<xref ref-type="fig" rid="fig2">Figure 2D</xref>).</p><p>From the metabolomics analyses of the SL pathway, sphingosine-1-phosphate (S1P) is predicted to increase in response to P4, as all other SL metabolites decrease in response to P4 (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). We, therefore, directly tested S1P levels in the oocyte in response to P4 at 5 and 30 min but did not detect any significant change (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1D</xref>). This implies that either S1P does not change in response to P4, or alternatively that the S1P produced in response to P4 diffuses out of the oocyte. This is possible as S1P is membrane-permeant and acts on cell surface receptors from the extracellular side (<xref ref-type="bibr" rid="bib4">Brindley and Pilquil, 2009</xref>). We tested this possibility directly below by assessing the role of S1P receptors in oocyte maturation.</p></sec><sec id="s2-4"><title>Pharmacological validation of the metabolomics findings</title><p>The metabolomics findings from extensive analyses using multiple platforms and extraction procedures to enrich and detect specific lipid species argue for an important role for lipid messengers in inducing oocyte maturation. This is further supported by the fact that when either mPRβ or ABHD2 are knocked down the lipid changes disappear. However, these metabolomics studies are correlative and do not address cause-effect relationships. To test whether activation of specific lipases is required for oocyte maturation, we used pharmacological tools to inhibit specific enzymes predicted to be important for maturation based on our metabolomic analyses (<xref ref-type="fig" rid="fig2">Figure 2D</xref>).</p><p>Along the GPL metabolic arm, the lipidomics data show the downregulation of upstream metabolites with the enrichment of LPA and prostaglandins (PGs) (<xref ref-type="fig" rid="fig2">Figure 2</xref>). This argues for a central role in PLA2 activity as it would produce AA as a precursor for PGs and LPC/LPE as precursors for LPA. To test for a role for PLA2 in maturation, we used a broad-spectrum inhibitor, ACA, as PLA2s represent a large family of enzymes (up to 16 groups) with disparate activation modes, Ca<sup>2+</sup>-dependency, and subcellular localization (secreted or cytosolic) (<xref ref-type="bibr" rid="bib6">Dennis et al., 2011</xref>; <xref ref-type="bibr" rid="bib23">Leslie, 2015</xref>). ACA completely inhibited maturation with an IC<sub>50</sub> of 3.8×10<sup>–6</sup> M (<xref ref-type="fig" rid="fig3">Figure 3A</xref>) in line with its reported PLA2 IC<sub>50</sub> value (5×10<sup>–6</sup> M, see <xref ref-type="table" rid="table1">Table 1</xref>). ACA treatment blocked Plk1, MAPK, and MPF activation explaining the maturation inhibition (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). Given the robust inhibition with ACA, we tested other PLA2 inhibitors, including AACOF3, bromoenol lactone (BEL), and pyrrophenone to get insights into the PLA2 isoform involved. BEL inhibited oocyte maturation with an IC<sub>50</sub> of 3.9×10<sup>–5</sup> M (<xref ref-type="fig" rid="fig3">Figure 3A</xref>), by mainly blocking the Plk1 pathway (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). The BEL IC<sub>50</sub> was about fivefold higher than its reported inhibitory potency of 8×10<sup>–6</sup> M (<xref ref-type="table" rid="table1">Table 1</xref>). The other two PLA2 inhibitors were ineffective (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). It is difficult to pinpoint a particular PLA2 isoform based on the isoform-specific profile of these inhibitor’s (see <ext-link ext-link-type="uri" xlink:href="https://www.sigmaaldrich.com/QA/en/technical-documents/technical-article/protein-biology/protein-expression/phospholipase-a2">https://www.sigmaaldrich.com/QA/en/technical-documents/technical-article/protein-biology/protein-expression/phospholipase-a2</ext-link>), arguing that the oocyte’s PLA2 activity required for maturation does not match known PLA2 isoforms. Nonetheless, the inhibitors data support a central role for PLA2 in inducing oocyte maturation downstream of P4. In line with this, pre-treatment of oocytes with mastoparan, a peptide toxin from wasp venom known to activate PLA2, enhanced oocyte maturation by ~50% in response to low P4 (<xref ref-type="fig" rid="fig3">Figure 3D</xref>).</p><fig-group><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>Pharmacological validation of the metabolomics findings.</title><p>(<bold>A, E, I</bold>) Dose-response of inhibition of oocyte maturation for the drugs tested. Oocytes were pre-treated for 2 hr with a vehicle or with increasing concentrations of the indicated drugs, followed by overnight treatment with progesterone (P4) at 10<sup>–5</sup> M. IC<sub>50</sub> was calculated using a nonlinear regression fit (mean ± SEM; n=3 independent female frogs). (<bold>D, F, H, J, K</bold>) Drug effect on oocyte maturation at low P4 concentration. Oocytes were pre-treated for 2 hr with the vehicle or with the highest drug concentration from the dose-response, followed by overnight treatment with P4 at 10<sup>–7</sup> M. Oocyte maturation was normalized to control oocytes (treated with vehicle) (mean ± SEM; n=3 independent female frogs for each chemical compound experiment, unpaired t-test). (<bold>B, C, G, L</bold>) Representative WB of MAPK, Plk1, and Cdc2 phosphorylation from untreated oocytes, oocytes pretreated with vehicle or the indicated drug for 2 hr then matured overnight (O/N) with P4 (eggs). Tubulin is shown as a loading control.</p><p><supplementary-material id="fig3sdata1"><label>Figure 3—source data 1.</label><caption><title>Original files for western blot analysis are displayed in <xref ref-type="fig" rid="fig3">Figure 3B,C,G,L</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig3-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig3sdata2"><label>Figure 3—source data 2.</label><caption><title>File containing labeled western blots for <xref ref-type="fig" rid="fig3">Figure 3B,C,G,L</xref>, indicating the relevant bands and treatments.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig3-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig3-v1.tif"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><label>Figure 3—figure supplement 1.</label><caption><title>Effects of various pharmacological inhibitors on oocyte maturation.</title><p>(<bold>A, B, E</bold>) Oocyte maturation inhibition dose-response.Oocytes were pre-treated for 2 hr with vehicle or with a increasing concentrations of specified inhibitor, followed by overnight treatment with progesterone (P4) at 10<sup>–5</sup>M. Oocyte maturation normalized to vehicle P4-treated oocytes. IC<sub>50</sub> of each chemical compound was calculated using a nonlinear regression fit (mean ± SEM; n=3 independent female frogs for each chemical compound experiment). (<bold>C, D, F</bold>) Effect of pristimerin (<bold>C</bold>), compound 183 (10<sup>–4</sup> M) (<bold>D</bold>), and MK591 (<bold>F</bold>) on oocyte maturation at the indicated P4 concentration. Oocytes were pre-treated for 2 hr with the vehicle or indicated inhibitor, followed by overnight treatment with P4. Oocyte maturation was normalized to the control oocyte condition (treated with vehicle) (mean ± SEM; n=3 independent female frogs for each chemical compound experiment, unpaired t-test).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig3-figsupp1-v1.tif"/></fig></fig-group><p>AA could still be produced through the action of fatty acid amide hydrolase (FAAH) independently of PLA2 activation, and PLD activation produces phosphatidic acid (PA) which is a precursor of LPA (<xref ref-type="fig" rid="fig2">Figure 2F</xref>). Inhibition of either FAAH or PLD had no effect on oocyte maturation (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A</xref>), arguing that the precursors for LPA and PGs are produced primarily through PLA2 activation in response to P4 in the oocyte.</p><p>Given the inhibitory effect of ABHD2 knockdown on oocyte maturation, we tested the effect of two plant triterpenoids known to inhibit ABHD2 and MAGLs, pristimerin and lupeol (<xref ref-type="bibr" rid="bib30">Mannowetz et al., 2017</xref>), as well as MAGL chemical inhibitors JZL184 and MJN110. None of these inhibitors had a significant inhibitory effect on oocyte maturation at high P4 (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1B</xref>). However, because pristimerin showed a trend toward inhibition at the highest concentration, we tested its effect at low P4 concentration where it inhibited oocyte maturation but required a concentration of 10<sup>–5</sup> M (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1C</xref>), which is two orders of magnitude higher than its documented IC<sub>50</sub> in other systems (<xref ref-type="bibr" rid="bib30">Mannowetz et al., 2017</xref>). These results argue against an important role for a monoacylglycerol enzymatic activity, whether ABHD2-dependent or not, in inducing oocyte maturation. We further tested a reported specific ABHD2 inhibitor, compound 183 (10<sup>–4</sup> M), which inhibited oocyte maturation at low and high P4 concentrations (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1D</xref>), arguing for a role for ABHD2 in oocyte maturation.</p><p>We next focused on enzymes that generate PGs and LPA as the enriched lipid metabolites in response to P4 (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). LPA can be produced through the action of PLA2 on phosphatidic acid (PA) or through autotaxin metabolism of LPE/LPC (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). Blocking autotaxin activity with HA130 repressed oocyte maturation with an IC<sub>50</sub> of 4.2×10<sup>–5</sup> M in the presence of high P4 (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). We, therefore, tested the effects of HA130 at low P4, where it significantly inhibited maturation by ~80% (<xref ref-type="fig" rid="fig3">Figure 3F</xref>). However, this inhibition of maturation required high concentrations of HA130 -at least three orders of magnitude higher than the reported HA130 IC<sub>50</sub>, arguing against a major role for the autotaxin pathway in generating LPA in response to P4, and rather supporting LPA production primarily through PLA2 activity.</p><p>We then tested the effect of inhibiting cyclooxygenases responsible for PGs production on oocyte maturation. Inhibition of Cox enzymes with ibuprofen effectively blocked maturation with an IC<sub>50</sub> of 2.7×10<sup>–4</sup> M consistent with its IC<sub>50</sub> against Cox2 (3.7×10<sup>–4</sup> M) (<xref ref-type="fig" rid="fig3">Figure 3E</xref>, <xref ref-type="table" rid="table1">Table 1</xref>). As expected from its effect on maturation, ibuprofen treatment blocked both Plk1 and MAPK activation (<xref ref-type="fig" rid="fig3">Figure 3G</xref>). Specific inhibition of Cox2 using NS398 blocked maturation with an IC<sub>50</sub> of 10<sup>–4</sup> M (<xref ref-type="fig" rid="fig3">Figure 3E</xref>), which is higher than its documented IC<sub>50</sub> against Cox2 (3.8×10<sup>–6</sup> M) (<xref ref-type="table" rid="table1">Table 1</xref>). Consistently, NS398 at high concentrations had a more pronounced inhibitory effect on oocyte maturation (~85%) at limiting P4 concentrations (<xref ref-type="fig" rid="fig3">Figure 3H</xref>). The Cox1-specific inhibitor SC-560 had no effect on oocyte maturation (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). Collectively these data argue for a role for Cox2 in supporting maturation but not for Cox1.</p><p>Interestingly, inhibition of lipoxygenases using MK591 potentiated maturation by ~20% in the presence of high P4 (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1E</xref>), and by 100% at low P4 (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1F</xref>). Leukotrienes are decreased in response to P4 (<xref ref-type="fig" rid="fig2">Figure 2</xref>), so presumably inhibition of lipoxygenases diverts AA metabolism toward cyclooxygenase hydrolysis thus increasing PGs production, which would explain the observed effect on oocyte maturation.</p></sec><sec id="s2-5"><title>S1P signaling supports oocyte maturation</title><p>The lipidomics data show the downregulation of most metabolites along the sphingolipid arm of the metabolic pathway with a presumed enrichment of S1P (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). We were, however, unable to detect an increase of S1P in the oocyte in response to P4 even when using a targeted mass spectrometry-based assay for S1P (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1D</xref>). This may be because S1P is readily secreted and signals extracellularly. However, activation of ceramidases could be involved in the sphingolipid changes. mPRs share sequence and structural homology with adiponectin receptors, which have been shown to possess ceramidase activity that requires Zn in the active site that acts on the ceramide amide bond (<xref ref-type="bibr" rid="bib18">Holland et al., 2011</xref>). We have previously shown that an mPRβ mutant with all four zinc coordinating residues mutated to Ala to abrogate Zn binding (H129, D146, H281, H285A) is functional in inducing oocyte maturation (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>). This argues that mPRβ does not require ceramidase activity to release oocyte meiotic arrest. To confirm this finding, we mutated Ser125 in the conserved SxxxH motif in mPRβ, which matches the ceramidase domain in PAQR and AdipoQ receptors (<xref ref-type="bibr" rid="bib22">Kelder et al., 2022</xref>; <xref ref-type="bibr" rid="bib55">Tanabe et al., 2015</xref>). The mPRβ-S125A mutant expresses and traffics normally to the cell membrane to similar levels as WT mPRβ (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A</xref>). Furthermore, it signals effectively downstream of progesterone as its overexpression (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B</xref>) rescues mPRβ knockdown with similar efficiency as WT mPRβ (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1C</xref>), and activates Plk1, MAPK, and MPF to induce oocyte maturation (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1D</xref>). Collectively these results argue against a role for mPRβ-dependent ceramidase activity in inducing oocyte maturation. Hence, changes in sphingolipids might be a consequence of the alterations in other lipid metabolic pathways, especially that the metabolism of GPLs is linked to that of sphingolipids through the activity of SM synthase.</p><p>If indeed S1P is the end product of sphingolipid metabolism in response to P4, then one would predict the activation of sphingosine kinases and concurrently ceramidases to support the metabolic flux. We tested this hypothesis using broad-spectrum sphingosine kinase and ceramidase inhibitors. Inhibition of ceramidase activity using D-e-MAPP had little effect on oocyte maturation at high P4 (10<sup>–5</sup> M) (<xref ref-type="fig" rid="fig3">Figure 3I</xref>). In contrast, at limiting P4 (10<sup>–7</sup> M) MAPP inhibited oocyte maturation by ~55% compared to untreated oocytes (<xref ref-type="fig" rid="fig3">Figure 3J</xref>). Note that at low P4 (10<sup>–7</sup> M) oocyte maturation is not complete as only the most primed oocytes respond, and this response varies from frog to frog (10–50% of the maturation observed with high P4). Inhibition of sphingosine kinases using MP-A08 inhibited oocyte maturation with an IC<sub>50</sub> of 4.3×10<sup>–5</sup> Mat high P4 (<xref ref-type="fig" rid="fig3">Figure 3I</xref> and <xref ref-type="table" rid="table1">Table 1</xref>). At low P4, MP-A08 blocked maturation by 87.5% (<xref ref-type="fig" rid="fig3">Figure 3K</xref>), supporting a role for S1P in oocyte maturation. MP-A08 treatment primarily blocks Plk1 activation and to a lesser extent MAPK (<xref ref-type="fig" rid="fig3">Figure 3L</xref>).</p><p>To assess the role of S1P signaling in releasing oocyte meiotic arrest, we targeted S1P receptor (S1PR) isoforms based on their expression in the ovary. Of the five S1PR isoforms, only S1PR2 and S1PR3 are expressed in the ovary with higher expression of S1PR3 (<xref ref-type="bibr" rid="bib31">Massé et al., 2010</xref>). We first confirmed the expression profile in oocytes using RT-PCR (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). S1PR3 expression levels were higher than S1PR2 (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). We confirmed the efficiency of the S1PR2 primers in the spleen where S1PR2 was shown to be highly expressed (<xref ref-type="bibr" rid="bib31">Massé et al., 2010</xref>). We then focused on S1PR3 as the primary S1PR in the oocyte and knocked down its expression using antisense oligos. We validated S1PR3 knockdown at the RNA (<xref ref-type="fig" rid="fig4">Figure 4B</xref>) and protein (<xref ref-type="fig" rid="fig4">Figure 4C</xref>) levels. S1PR3 knockdown blocked oocyte maturation induced by either P4 or the mPR-specific agonist OD-02 by ~50% (<xref ref-type="fig" rid="fig4">Figure 4D</xref>).</p><fig-group><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>S1P signaling and oocyte maturation.</title><p>(<bold>A</bold>) mRNAs levels of S1PR2, S1PR3, and the housekeeping gene Ornithine decarboxylase (ODC) in oocytes and spleen measured as the Cycle threshold (Ct) from real-time PCR. (<bold>B–C</bold>) S1PR3 knockdown. Oocytes were injected with control antisense (Ctrl AS) or specific S1PR3 antisense oligonucleotides and incubated at 18 °C for 24 hr. RNAs and protein extracts were prepared and analyzed by RT-PCR and western blot (WB) to determine the efficacy of S1PR3 knockdown as compared to control oocytes (Ctrl AS). B. Histogram showing the relative RNAs levels of S1PR3 mRNA to xODC. (<bold>C</bold>) Representative WB (left panel) and normalized quantification (right panel) comparing S1PR3 protein levels between naïve, Ctrl AS and S1PR3 AS injected oocytes. Tubulin is shown as a loading control (mean ± SEM; n=6 independent female frogs). (<bold>D</bold>) Oocyte maturation following injection of S1PR3 antisense, normalized to progesterone (P4) or Org OD 02–0 (OD)-treated oocytes injected with control antisense (Ctrl AS) (mean ± SEM; n=7 independent female frogs, ordinary one-way ANOVA). (E/F) Representative WBs of MAPK, Plk1, and Cdc2 (<bold>E</bold>), as well as CDC25C (<bold>F</bold>) phosphorylation from untreated oocytes, P4 or OD, matured eggs (O/N)D, oocytes injected with control antisense (Ctrl AS) or S1PR3 antisense (S1PR3 AS) and treated O/N with P4 or OD. Tubulin is shown as a loading control.(<bold>G</bold>) GVBD-time course after treatment with P4 at the indicated concentrations in oocytes injected with water (Con) or with S1PR3 antisense (S1PR3 AS) (mean ± SEM; n=2 independent female frogs).</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>Original files for western blot analysis are displayed in <xref ref-type="fig" rid="fig4">Figure 4C,E,F</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig4-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig4sdata2"><label>Figure 4—source data 2.</label><caption><title>File containing labeled western blots for <xref ref-type="fig" rid="fig4">Figure 4C,E,F</xref>, indicating the relevant bands and treatments.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig4-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig4-v1.tif"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><label>Figure 4—figure supplement 1.</label><caption><title>Role of GPCR signaling.</title><p>(<bold>A</bold>) mPR S125 plasma membrane localization. Oocytes were injected with mPR-GFP wild-type (WT) or the S125A mutant, along with TMEM-mCherry as a plasma membrane (PM) marker. <italic>Left panel,</italic> Representative confocal image of oocytes overexpression mPR-GFP WT or mPR-GFP S125A mutant along with TMEM-mCherry. <italic>Right panel,</italic> histogram showing the percentage of mPR-GFP WT or mPR-GFP S125A at the PM (mean ± SEM; n=10 oocytes per clone from two independent female frogs, unpaired t-test). (<bold>B</bold>) Representative WB of mPR-GFP protein expression in naïve, control antisense (Ctrl AS), mPRβ antisense (AS), and AS +mPR GFP WT or mPR-GFP S125A mutant injected oocytes. Tubulin is shown as a loading control. (<bold>C</bold>) Oocyte maturation in oocytes injected with control antisense (Ctrl AS) or mPRβ antisense (AS) with or without mPR-GFP WT or mPR-GFP S125A expression, and normalized to progesterone (P4)-treated naïve oocytes (Naive) (mean ± SEM; n=3 independent female frogs, ordinary one-way ANOVA). (<bold>D</bold>) Representative WB of MAPK, Plk1, and Cdc2 phosphorylation from untreated oocytes, P4 matured eggs, oocytes injected with control antisense (Ctrl AS) or mPRβ antisense (AS) with or without mPR-GFP WT or mPR-GFP S125A expression. Tubulin is shown as a loading control. (<bold>E</bold>) Inhibitor dose response. Oocytes were pre-treated for 2 hr with vehicle or with increasing concentrations of specified inhibitor, followed by overnight treatment with P4 at 10<sup>–5</sup> M. Oocyte maturation normalized to vehicle P4-treated oocytes. IC<sub>50</sub> was calculated using a nonlinear regression fit (mean ± SEM; n=3 independent female frogs for each chemical compound experiment). (<bold>F</bold>) Representative WB of MAPK, Plk1, and Cdc2 phosphorylation from untreated oocytes, oocytes pretreated with a vehicle for 2 hr then matured overnight (O/N) by P4 at 10<sup>–7</sup> M (eggs), and oocytes pretreated for 2 hr with NF449 then treated O/N with P4 10<sup>–7</sup> M. Tubulin is shown as a loading control. (<bold>G</bold>) Drug effect on oocyte maturation at low P4 concentration. Oocytes were pre-treated for 2 hr with vehicle or the specified inhibitor followed by overnight treatment with P4 at 10<sup>–7</sup> M. Oocyte maturation was normalized to the control oocytes condition (treated with vehicle) (mean ± SEM; n=3 independent female frogs for each chemical compound experiment, unpaired t-test).</p><p><supplementary-material id="fig4s1sdata1"><label>Figure 4—figure supplement 1—source data 1.</label><caption><title>Original files for western blot analysis are displayed in <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B,D,F</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig4-figsupp1-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig4s1sdata2"><label>Figure 4—figure supplement 1—source data 2.</label><caption><title>File containing labeled western blots for <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B,D,F</xref>, indicating the relevant bands and treatments.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig4-figsupp1-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig4-figsupp1-v1.tif"/></fig></fig-group><p>Interestingly, S1PR3 knockdown did not affect P4-mediated activation of MAPK and Plk1 (<xref ref-type="fig" rid="fig4">Figure 4E</xref>), yet P4 was unable to dephosphorylate and activate MPF (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). Plk1 induces maturation by activating the dual-specificity phosphatase Cdc25C, which dephosphorylates Cdc2 to activate MPF and is considered a rate-limiting step in MPF activation (<xref ref-type="bibr" rid="bib47">Perdiguero and Nebreda, 2004</xref>). We, therefore, tested the effects of S1PR3 knockdown on Cdc25C activation and showed that despite the induction of both Plk1 and MAPK, Cdc25C was not activated in response to P4 in S1PR3 knockdown cells (<xref ref-type="fig" rid="fig4">Figure 4F</xref>). We followed Cdc25C activation by assessing its dephosphorylation at Ser287 (Ser216 in humans), which is required for its activation (<xref ref-type="fig" rid="fig4">Figure 4F</xref>; <xref ref-type="bibr" rid="bib47">Perdiguero and Nebreda, 2004</xref>). The partial oocyte maturation block in S1PR3 KD oocytes argues for a modulatory role for S1P signaling. We tested this hypothesis by assessing the requirement for S1PR3 at increasing P4 dosages that would incrementally induce the multiple arms of the maturation signaling pathways. S1P3R knockdown oocytes matured with significantly less efficiency and with a slower time course at low P4 (10<sup>–7</sup> M) (<xref ref-type="fig" rid="fig4">Figure 4G</xref>), but interestingly this effect was gradually lost with increased P4 concentrations (10<sup>–5</sup> and 10<sup>–4</sup> M) (<xref ref-type="fig" rid="fig4">Figure 4G</xref>). These data argue that the S1P/S1PR3 pathway modulates oocyte maturation, but that by itself it is not essential for maturation as it can be bypassed when other pathways are hyper activated at high P4 concentrations. This is consistent with the production of multiple lipid messengers to induce maturation through several GPCR pathways.</p></sec><sec id="s2-6"><title>Role of G-protein coupled receptors (GPCRs) in mediating lipid messenger action</title><p>All the enriched lipid metabolites detected from our lipidomics analyses - PGs, LPA, and possibly S1P - act through GPCRs. This raises the intriguing possibility that P4 expands its signaling through the production of lipid messengers that act on several GPCRs to mediate the multiple cellular changes that need to occur concurrently during oocyte maturation. This is an attractive possibility as GPCRs have been implicated in <italic>Xenopus</italic> oocyte maturation for decades without conclusive evidence for their involvement, and they have been shown to mediate mPR nongenomic signaling. Therefore, we tested the effects of broad inhibitors of trimeric G-proteins. Blocking Gα<sub>s</sub> using NF-449 partially inhibited maturation (IC<sub>50</sub> 5×10<sup>–5</sup> M) (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1E</xref>), whereas blocking either Gβγ or Gα<sub>q/11</sub> with gallein and YM-254890, respectively was inefficient at blocking oocyte maturation (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1E</xref>). Interestingly, inhibiting Gα<sub>s</sub> with NF449 primarily blocked Plk1 activation to inhibit MPF and oocyte maturation, and to a lesser extent the MAPK pathway (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1F</xref>). At low P4 concentration, the inhibitory effect of NF-449 was still observed as well as inhibition by gallein but not YM-254890 (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1G</xref>). This argues for a supporting role for Gβγ signaling as well in oocyte maturation. These results support a role for Gα<sub>s</sub> signaling and potentially Gβγ downstream of P4 through lipid intermediates that require PLA2, Cox2, and SphK activities.</p></sec><sec id="s2-7"><title>ABHD2 is a PLA2 that requires mPRβ as a co-receptor</title><p>Both the metabolomics and pharmacological data strongly implicate PLA2 activation downstream of P4 to induce maturation. In addition, several lines of evidence argue that this PLA2 activity requires ABHD2: (1) Induction of the signaling cascades downstream of P4 requires both ABHD2 and PLA2; (2) the lipidomics changes downstream of P4 are dependent on both activities; (3) mutations in the ABHD2 lipase domain abolish its ability to induce maturation; (4) ABHD2 has been characterized as a lipase acting on either MAG or TAG (<xref ref-type="bibr" rid="bib33">Miller et al., 2016</xref>; <xref ref-type="bibr" rid="bib42">Naresh Kumar et al., 2016</xref>); and (5) an ABHD2 specific inhibitor (compound 183) inhibits maturation. Collectively, these findings suggest that ABHD2 is associated with a PLA2 activity that is induced in response to P4 to release oocyte meiotic arrest.</p><p>To test this hypothesis, we translated ABHD2 and mPRβ in vitro in rabbit reticulocyte lysates and assessed whether they possess PLA2 activity. Expression of ABHD2 or mPRβ alone was not associated with any increase in PLA2 activity whether in the presence or absence of P4 (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). Interestingly though, co-expression of both mPRβ and ABHD2 produced a PLA2 activity, but only in the presence of P4 (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). This is despite our inability to detect either mPR or ABHD2 expression by Western blots from the reticulocyte lysates reactions. These results argue that both mPRβ and ABHD2 are required for the P4-dependent PLA2 activity, but they do not address which receptor is the catalytic subunit. However, our functional experiment with the ABHD2 hydrolase domain mutants (S/D/H and S207) strongly argues that ABHD2 is the PLA2 catalytic subunit.</p><fig-group><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>Phospholipase A2 (PLA2) activity of the membrane progesterone receptor β (mPRβ)-α/β hydrolase domain-containing protein 2 (ABHD2) co-receptor complex.</title><p>(<bold>A</bold>) Time-dependent PLA2 activity from reticulocyte lysates expressing mPR, ABHD2.S, or ABHD2.S+mPR in the presence of ethanol as vehicle or P4 10<sup>–5</sup> M (mean ± SEM; n=3). (<bold>B</bold>) Time course of progesterone (P4)-dependent PLA2 activity in reticulocyte lysates expressing mPRβ with either wild-type ABHD2 (ABHD2) or the ABHD2 S207A/D345A/H376A mutant (S/D/H). P4-dependent PLA2 is plotted as the difference in activity in the presence and absence of P4 (Mean ± SEM; n=3). (<bold>C</bold>) Example western blot (WB) probed with anti-His antibody from tobacco lysates (ALiCE) alone (Con) and lysates expressing mPRβ or ABHD2 alone or both proteins in duplicated as indicated. (<bold>D</bold>) Time-dependent PLA2 activity from ALiCE lysates overexpressing mPR, ABHD2.S, or ABHD2.S+mPR in the presence of the vehicle ethanol or P4 10<sup>–5</sup> M (mean ± SEM; n=3). Data are plotted as the rate of production of the lysothiophospholipid product from the beginning of the experiment (0 min) with the rate of the lysates alone subtracted. (<bold>E</bold>) Representative immunoprecipitation (IP) WB and quantification of mPR-GFP from oocyte lysates from un-injected oocytes (Naive) or oocytes over-expressing mPR-GFP and ABHD2.S treated for 40 min with Ethanol (EtOH) or P4. <italic>Left panel,</italic> the representative WB membrane is probed for ABHD2 and GFP (mean ± SEM; n=3 independent female frogs, unpaired t-test).</p><p><supplementary-material id="fig5sdata1"><label>Figure 5—source data 1.</label><caption><title>Original files for western blot analysis are displayed in <xref ref-type="fig" rid="fig5">Figure 5C,E</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig5-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig5sdata2"><label>Figure 5—source data 2.</label><caption><title>File containing labeled western blots for <xref ref-type="fig" rid="fig5">Figure 5C,E</xref>, indicating the relevant bands and treatments.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig5-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig5-v1.tif"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><label>Figure 5—figure supplement 1.</label><caption><title>ABHD2 mutants interaction with mPRβ.</title><p>(<bold>A</bold>) Representative western blot (WB) of the immunoprecipitation (IP) of mPR-GFP using lysates from oocytes over-expressing mPR-GFP with α/β hydrolase domain-containing protein 2 (ABHD2). L, mCherry tagged ABHD2.S at its C-terminal (mCh-C) or N-terminal (mCh-N), and ABHD2.S S/D/H. The input represents expression levels of the different clones before the IP. Tubulin is shown as a loading control. The red arrows point to ABHD2.S different clones. (<bold>B</bold>) Oocyte maturation measured in oocytes injected with control antisense (Ctrl AS) or ABHD2 antisense (AS) with or without ABHD2.S wild type (AS +WT) or the mCherry tagged ABHD2.S clones and normalized to progesterone (P4)-treated naïve oocytes (Naive) (mean ± SEM; n=3–5 independent female frogs, ordinary one-way ANOVA).</p><p><supplementary-material id="fig5s1sdata1"><label>Figure 5—figure supplement 1—source data 1.</label><caption><title>Original files for western blot analysis are displayed in <xref ref-type="fig" rid="fig5">Figure 5A</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig5-figsupp1-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig5s1sdata2"><label>Figure 5—figure supplement 1—source data 2.</label><caption><title>File containing labeled western blots for <xref ref-type="fig" rid="fig5">Figure 5A</xref>, indicating the relevant bands and treatments.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig5-figsupp1-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig5-figsupp1-v1.tif"/></fig></fig-group><p>To directly confirm this prediction, we co-expressed mPRβ with either ABHD2 WT or the S/D/H mutant in reticulocyte lysates and tested their PLA2 activity. Mutating the ABHD2 lipid hydrolase domain (S/D/H mutant) resulted in a loss of PLA2 activity when the protein was expressed with mPRβ in the presence of P4 (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). Taken together, these results argue that ABHD2 has PLA2 catalytic activity but only in the presence of mPRβ.</p><p>To cross-validate our findings from the reticulocyte experiments, we tested in vitro and cell-based expression systems to increase protein yield. We settled on the coupled in vitro transcription/translation tobacco lysates system (ALiCE) that produces high protein yields and targets expressed proteins to microsomes directly using a melittin signal peptide. This is an advantage for our proteins of interest as they are both integral membrane proteins. The tobacco lysates expression system produced significantly higher yields of both mPR and ABHD2 expression where both proteins were readily detected on Western blots (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). Similar to the reticulocyte system, tobacco lysates expressing ABHD2 or mPRβ alone were not associated with increased PLA2 activity whether in the presence or absence of P4 (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Of note tobacco lysates have endogenous PLA2 activity, which was inhibited by expression of mPRβ alone (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). The PLA2 activity data from tobacco lysates are reported as the rate of increase over time (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Co-expression of mPRβ and ABHD2 in the tobacco lysates produced significant PLA2 activity that was not only higher than that detected from the reticulocyte lysates but also stable over extended periods of time allowing recordings for over 2 hr (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Interestingly in this case, however, the PLA2 activity of the co-receptor complex was independent of P4 (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Both the reticulocyte and tobacco expression system show that mPRβ is a necessary partner for ABHD2 to mediate its PLA2 activities. However, the reticulocyte co-expression results argue that mPRβ and ABHD2 need P4 to assemble and form a complex to be able to mediate the ABHD2 PLA2 activity. In contrast, when the two proteins are expressed at high levels and more importantly targeted specifically to the same microsomal compartment their PLA2 activity becomes P4 independent. We were thus interested in testing whether the two receptors interact in vivo. We expressed mPRβ-GFP in oocytes and tested whether it forms a complex with ABHD2. Immunoprecipitation of mPRβ-GFP pulls down ABHD2 at rest (<xref ref-type="fig" rid="fig5">Figure 5E</xref>), and importantly this interaction is significantly enhanced (1.9±0.2 fold, p=0.002) following P4 treatment (<xref ref-type="fig" rid="fig5">Figure 5E</xref>). This argues that P4 enhances the assembly of the co-receptor complex. Furthermore, co-expression and pull-down experiments show that the non-functional ABHD2 mutants: S/D/H and ABHD2.L interact with mPRβ (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A</xref>), indicating that the interaction between ABHD2 and mPRβ does not require a functional lipase domain.</p></sec><sec id="s2-8"><title>ABHD2 and PLA2 activity are required for mPRβ endocytosis and signaling</title><p>We have previously shown that mPRβ induces oocyte maturation at the level of the signaling endosome following its clathrin-dependent endocytosis (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>). Importantly, mPRβ endocytosis is sufficient to induce maturation in the absence of P4. Since changes in plasma membrane lipid composition are known to modulate endocytosis and membrane component activities, we suspected a role for ABHD2/PLA2 in mPRβ endocytosis in response to P4. Therefore, we quantified mPRβ endocytosis following ABHD2 knockdown. P4 leads to the enrichment of mPRβ positive intracellular vesicles, and this enrichment requires ABHD2 as it was lost in ABHD2 knockdown oocytes (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). PLA2 activity was also critical for P4-induced mPRβ endocytosis, which was completely blocked in ACA-treated oocytes (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). Interestingly, ACA also inhibited basal endocytosis of mPRβ in the absence of P4, which is apparent as lower vesicular mPRβ in oocytes treated with ACA (<xref ref-type="fig" rid="fig6">Figure 6B</xref>, no P4). This argues that both ABHD2 and PLA2 are required for mPRβ endocytosis and by extension its signaling in response to P4.</p><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>α/β hydrolase domain-containing protein 2 (ABHD2) and phospholipase A2 (PLA2) activity are required for membrane progesterone receptor β (mPRβ) endocytosis and signaling.</title><p>(<bold>A</bold>) Effect of ABHD2 knockdown on mPR-P4 mediated endocytosis. Oocytes were injected with mPR-GFP RNA (Naïve) and 48 hr later either left untreated or injected with ABHD2 antisense (ABHD2 AS). The following day oocytes were imaged, before and 45 min after progesterone (P4) treatment. <italic>Left panel,</italic> representative confocal image of mPR-GFP positive vesicles in naïve and ABHD2 AS oocytes, before and after P4. <italic>Right panel,</italic> histogram of mPR-GFP positive vesicle count before and after P4 (mean ± SEM; n=20–21 oocytes per condition, from three independent female frogs, ordinary one-way ANOVA). (<bold>B</bold>) PLA2 inhibition blocks P4-mediated endocytosis. Vesicle count from oocytes expressing mPR-GFP for 72 hr was pretreated with vehicle (naïve) or ACA for 2 hr, followed by imaging, before and 45 min after P4 treatment (mean ± SEM; n=16–18 oocytes per condition, from two independent female frogs, ordinary one-way ANOVA). (<bold>C</bold>) Cartoon depicting the role of SNAP25Δ20 in blocking exocytosis. (<bold>D</bold>) SNAP25Δ20-induced oocyte maturation requires clathrin-dependent endocytosis. Naïve oocytes were pretreated with vehicle or Pitstop (10<sup>–5</sup> M), followed by overnight treatment with P4 or SNAP25Δ20-mRNA injection. Oocyte maturation in P4 or SNAP25Δ20 injected oocytes normalized to the vehicle condition (mean ± SEM; n=4 independent female frogs, ordinary one-way ANOVA). (<bold>E</bold>) SNAP25Δ20-induced maturation requires ABHD2. Oocytes were injected with mPR antisense (mPR AS) or ABHD2 antisense (AS) with or without mPRβ mRNA (AS +mPR). 48 hr later, oocytes were injected with mRNA to overexpress SNAP25Δ20. The following day, oocyte maturation was measured in mPR AS, ABHD2 AS, and ABHD2 AS +mPR oocytes normalized to naive oocytes injected with SNAP25Δ20 (mean ± SEM; n=3 independent female frogs, ordinary one-way ANOVA). (<bold>F</bold>) Representative WB of mPR and SNAP25Δ20 proteins expression in naïve, ABHD2 AS and ABHD2 AS +mPR oocytes. Tubulin is shown as a loading control. (<bold>G</bold>) Representative WB of MAPK, Plk1, and Cdc2 phosphorylation from untreated oocytes, P4 matured eggs, or SNAP25Δ20 mRNA injection, and oocytes injected with mPR (mPR AS) or ABHD2 antisense (ABHD2 AS) and treated O/N with P4 or SNAP25Δ20 mRNA injection. Tubulin is shown as a loading control. (<bold>H</bold>) Quantification of p-Plk as the ratio of p-PLK/Tubulin and p-MAPK as the ratio of p-MAPK/Tubulin normalized to the ratios in naive eggs (mean ± SEM; n=4 independent female frogs, ordinary one-way ANOVA). (<bold>I</bold>) Oocyte maturation in oocytes pretreated for 2 hr with ACA, NS398, and MP-A08 followed by SNAP25Δ20-mRNA injection and normalized to GVBD in oocytes pre-treated with vehicle followed by SNAP25Δ20-mRNA injection (Veh.) (mean ± SEM; n=3 independent female frogs, ordinary one-way ANOVA). (<bold>J</bold>) Model of the signaling cascade triggered in response to P4 (generated using Biorender).</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>Original files for western blot analysis are displayed in <xref ref-type="fig" rid="fig6">Figure 6F,G</xref>.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig6-data1-v1.zip"/></supplementary-material></p><p><supplementary-material id="fig6sdata2"><label>Figure 6—source data 2.</label><caption><title>File containing labeled western blots for <xref ref-type="fig" rid="fig6">Figure 6F,G</xref>, indicating the relevant bands and treatments.</title></caption><media mimetype="application" mime-subtype="zip" xlink:href="elife-92635-fig6-data2-v1.zip"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-fig6-v1.tif"/></fig><p>We were, therefore, interested in assessing the subcellular distribution of ABHD2 during oocyte maturation to determine whether it is also internalized. We thus tagged it at the N- or C-terminus with mCherry. Unfortunately, both mCh-tagged ABHD2s were not functional as they did not rescue ABHD2 knockdown (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1B</xref>), despite efficient expression and binding to mPR (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A</xref>). This prevented us from imaging the trafficking and distribution of ABHD2 during oocyte maturation.</p><p>The requirement for ABHD2 to mediate P4-dependent mPRβ endocytosis (<xref ref-type="fig" rid="fig6">Figure 6A</xref>) suggests that this may be the primary function of ABHD2 in response to P4. Under that scenario, P4 activates ABHD2 enzymatic activity which induces mPRβ endocytosis leading to oocyte maturation. To test this hypothesis, we were interested in inducing mPRβ endocytosis in the absence of P4. We have previously shown that a dominant negative SNAP25 mutant missing the last 20 residues (SNAP25Δ20), effectively blocks exocytosis in the oocyte (<xref ref-type="fig" rid="fig6">Figure 6C</xref>); leading to mPRβ enrichment intracellularly and inducing maturation in the absence of P4 (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>; <xref ref-type="bibr" rid="bib10">El-Jouni et al., 2007</xref>). Similar to P4, SNAP25Δ20-induced oocyte maturation requires clathrin-dependent endocytosis as it was blocked by a clathrin blocker pitstop (<xref ref-type="fig" rid="fig6">Figure 6D</xref>). As expected, SNAP25Δ20-induced oocyte maturation requires mPRβ as it was inhibited in oocytes where mPRβ was knocked down (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). Surprisingly, SNAP25Δ20-induced maturation also requires ABHD2, since oocytes where ABHD2 is knocked down were unable to mature in response to SNAP25Δ20 (<xref ref-type="fig" rid="fig6">Figure 6E</xref>), despite high expression of SNAP25Δ20 (<xref ref-type="fig" rid="fig6">Figure 6F</xref>). We further tested whether mPRβ overexpression allows ABHD2 KD oocytes to mature in response to SNAP25Δ20, but this was not the case (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). This argues that even in the presence of excess mPRβ, its forced internalization using SNAP25Δ20 (<xref ref-type="fig" rid="fig6">Figure 6C</xref>) in the absence of ABHD2 is not sufficient to induce maturation. Therefore, ABHD2 activity is not only required for mPRβ internalization but it is also required at the level of the signaling endosome following mPRβ endocytosis to induce maturation.</p><p>Like P4, SNAP25Δ20 activates Plk1, MAPK, and MPF (<xref ref-type="fig" rid="fig6">Figure 6G</xref>) and this induction was significantly inhibited following the knockdown of either ABHD2 or mPRβ (<xref ref-type="fig" rid="fig6">Figure 6G and H</xref>), showing that both proteins signal through the canonical kinase cascades to induce maturation following internalization even in the absence of P4. Furthermore, in addition to the PLA2 inhibitor ACA, inhibition of Cox2, or sphingosine kinase partially blocked SNAP25Δ20 induced maturation with ACA being the most effective (<xref ref-type="fig" rid="fig6">Figure 6I</xref>), similar to what we observe with P4. ACA blocks basal mPRβ recycling (<xref ref-type="fig" rid="fig6">Figure 6B</xref>), and as such would inhibit its internalization in response to SNAP25Δ20 expression. However, the Cox2 (NS398) and the SphK (MPA08) inhibitors should not interfere with mPRβ internalization in response to SNAP25Δ20, although experimentally it is difficult to ascertain this. Collectively these results argue that PLA2 activity is required for mPRβ internalization and that furthermore, both Cox2 and SphK activities are important to modulate oocyte maturation following mPRβ internalization.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>mPR-dependent nongenomic signaling is an important regulator of many physiological processes in female and male reproduction, cardiovascular, neuroendocrine, neurological, and immune function (<xref ref-type="bibr" rid="bib8">Dressing et al., 2011</xref>; <xref ref-type="bibr" rid="bib59">Valadez-Cosmes et al., 2016</xref>; <xref ref-type="bibr" rid="bib36">Moussatche and Lyons, 2012</xref>; <xref ref-type="bibr" rid="bib60">Wendler and Wehling, 2022</xref>). This raises interest in mPRs as potential therapeutic targets for hypertension and other cardiovascular diseases, reproductive disorders, neurological diseases, and cancer (<xref ref-type="bibr" rid="bib60">Wendler and Wehling, 2022</xref>). Therefore, understanding mPR signaling is important to assess their physiological and pathological contributions. In this study, we used oocyte maturation in the frog as a well-established model for P4 nongenomic signaling.</p><p>Oocyte maturation prepares the egg for fertilization and endows it with the ability to activate and initiate embryonic development (<xref ref-type="bibr" rid="bib28">Machaca, 2007</xref>). As such it represents the initial step in multicellular organismal development that precedes fertilization. It is, therefore, not surprising that oocyte maturation involves multiple signaling cascades to mediate both the completion of meiosis -the so-called nuclear maturation- to generate a haploid gamete, and the extensive cellular differentiation of the oocyte that is needed to support development, and includes protein synthesis, membrane remodeling, and Ca<sup>2+</sup> signaling differentiation that supports the block of polyspermy and resumption of meiosis at fertilization (<xref ref-type="bibr" rid="bib28">Machaca, 2007</xref>).</p><p>In <italic>Xenopus</italic> oocytes, the release of the long-term meiotic arrest can be triggered by P4. In fact, <italic>Xenopus</italic> oocyte maturation is one of the most studied examples of nongenomic P4 signaling and represents a well characterized system to define the signaling cascade downstream of P4. It is well-established that P4 in the oocyte activates two parallel and interdependent kinase cascades that ultimately culminate in MPF activation (<xref ref-type="bibr" rid="bib43">Nebreda and Ferby, 2000</xref>). Despite many studies over the past decades, the earliest signaling steps downstream of mPR have remained elusive. An interesting recent development shows that clathrin-dependent endocytosis of mPRβ is necessary and sufficient for its signaling and the induction of oocyte maturation even in the absence of P4 (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>). It, therefore, appears that the signaling endosome acts as a hub to activate the multiple pathways required to release meiotic arrest, resume meiosis, and prepare the egg for fertilization.</p><p>An untested assumption is that P4 induces oocyte maturation primarily through mPRβ since its knockdown or anti-mPRβ antibodies block maturation (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref>; <xref ref-type="bibr" rid="bib21">Josefsberg Ben-Yehoshua et al., 2007</xref>). However, the oocyte expresses other P4 receptors including ABHD2 that may contribute to P4 signaling. Here, we show that knockdown of ABHD2 blocks oocyte maturation and that this is rescued effectively by ABHD2 overexpression but not by mPRβ overexpression. ABHD2 contains a lipase and an acyltransferase motif. The lipase domain is required for oocyte maturation but not the acyltransferase domain. Based on this finding, we undertook an unbiased lipidomics approach to better define metabolic alterations driven by ABHD2 lipase activity. P4 resulted in a broad decrease in glycerophospholipid and sphingolipid species, with the enrichment of a few lipid messenger end products, namely prostaglandins, LPA, and S1P (<xref ref-type="fig" rid="fig6">Figure 6J</xref>). This is intriguing as all these lipid messengers act through GPCRs. We in fact validate S1P action through the S1P receptor, which is a GPCR, to support oocyte maturation. These findings argue that P4 activates ABHD2 lipase activity to generate lipid messengers that in turn stimulate various GPCRs that regulate the multiple aspects of oocyte maturation. This would nicely explain the standing controversy in the field as to whether mPRs are GPCRs or not. Should the findings from the oocyte hold in other systems, it would be argued that P4 activates lipid catabolism to generate lipid messenger that then acts through GPCRs. Thus, nongenomic P4 signaling would involve both non-GPCR and GPCR signaling modalities in series.</p><p>An intriguing finding of the current study is that the PLA2 activity of ABHD2 is activated through its interaction with mPRβ (<xref ref-type="fig" rid="fig6">Figure 6J</xref>). Although ABHD2 and mPRβ interact at rest, this interaction is enhanced following P4 treatment. This is the first report showing that ABHD2 possesses PLA2 activity and that this PLA2 activity requires interaction with mPRβ. The PLA2 family is large and complex with over 50 members that have been classified based on enzymatic activity, co-factor dependence, subcellular distribution, and structure (<xref ref-type="bibr" rid="bib6">Dennis et al., 2011</xref>; <xref ref-type="bibr" rid="bib37">Murakami et al., 2020</xref>); and include the secreted, cytosolic, Ca<sup>2+</sup>-independent, lysosomal, platelet-activating factor acyl hydrolase, and some members of the α/β hydrolase domain (ABHD) family (<xref ref-type="bibr" rid="bib25">Lord et al., 2013</xref>).</p><p>ABHD2 has been shown to act as a 2-AG lipase to activate sperm (<xref ref-type="bibr" rid="bib33">Miller et al., 2016</xref>; <xref ref-type="bibr" rid="bib30">Mannowetz et al., 2017</xref>). Interestingly, we find no evidence for such an activity in response to P4 based on our lipidomics analyses in the oocyte. This raises the interesting possibility that ABHD2 lipase specificity may be regulated by protein-protein interactions in a cell-specific fashion, but this remains to be tested.</p><p>In addition to the generation of lipid messengers that branch out P4 signaling at its onset into multiple signaling cascades through GPCRs, the ABHD2 PLA2 activity hydrolyzes phospholipids to generate AA that is then metabolized to PGs through the activity of Cox2. The hydrolysis of membrane phospholipids generates lysophospholipids with a single acyl chain that tends to have a conical shape. Such conical phospholipids are prone to inducing membrane curvature (<xref ref-type="bibr" rid="bib16">Harayama and Riezman, 2018</xref>) as the latter is determined by the size of the lipid headgroups and hydrophobic tails (<xref ref-type="bibr" rid="bib11">Ernst et al., 2016</xref>). Conical lipids have been shown to play important roles in membrane fusion events both in vitro and in vivo (<xref ref-type="bibr" rid="bib63">Zick et al., 2014</xref>; <xref ref-type="bibr" rid="bib46">Pagliuso et al., 2016</xref>; <xref ref-type="bibr" rid="bib19">Irie et al., 2017</xref>). It is, therefore, tempting to postulate that enrichment in lysophospholipids following ABHD2-PLA2 activation generates spontaneous membrane curvature, which can be sensed by the clathrin endocytic machinery to induce mPRβ endocytosis and initiate signaling and maturation (<xref ref-type="fig" rid="fig6">Figure 6J</xref>).</p><p>Collectively our findings define the earliest steps in nongenomic P4 signaling to release the oocyte meiotic arrest and prepare the egg for fertilization (<xref ref-type="fig" rid="fig6">Figure 6J</xref>). Furthermore, they show for the first time that two heterologous receptors previously implicated in nongenomic signaling, mPRβ and ABHD2, function as coreceptors to induce PLA2 activity that is required for both endocytosis and further downstream signaling. Nongenomic P4 signaling is widespread and mediates reproductive, neurological, and other functions. Therefore, these findings are likely to have broad implications throughout biology.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Reagents and primers</title><p>A list of the antibodies, siRNA, chemicals, and other reagents used is provided in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1a</xref>. Primers and sense/antisense oligos used are listed in <xref ref-type="supplementary-material" rid="supp1">Supplementary file 1b</xref>.</p></sec><sec id="s4-2"><title><italic>Xenopus laevis</italic> oocytes</title><p>All animal procedures and protocols were performed in accordance with the University of Weill Cornell Medicine-Qatar Institutional Animal Care and Use Committee. <italic>Xenopus laevis</italic> female frogs were obtained from <italic>Xenopus</italic> I (adult females Lab bred). Stage VI oocytes were obtained as previously described (<xref ref-type="bibr" rid="bib27">Machaca and Haun, 2002</xref>). Oocytes were maintained in L-15 medium solution (Sigma-Aldrich Cat# L4386) supplemented with HEPES (Sigma-Aldrich Cat# H4034), 0.1% (v/v) of penicillin/streptomycin stock solution (Thermo Fisher Scientific Cat# 15140–122) and 0.1% (v/v) of gentamycin (EMD Millipore Cat# 345814–1 GM) at pH 7.6. The oocytes were used 24–72 hr after harvesting and injected with RNAs or sense/antisense oligos and kept at 18 °C for 1–2 d to allow for protein expression or knockdown. After treatment with progesterone at 10<sup>–7</sup> M, 10<sup>–5</sup> M, or 10<sup>–4</sup> M (as indicated), GVBD was detected visually by the appearance of a white spot at the animal pole. For the inhibitor studies, oocytes were preincubated for 2 hr with different concentrations of the inhibitors, followed by overnight incubation with P4 at 10<sup>–7</sup> M or 10<sup>–5</sup> M concentration. Co-immunoprecipitation, Western blot, and oocyte imaging are described in supplemental data.</p></sec><sec id="s4-3"><title>Molecular biology</title><p>Generation of pSGEM-mPRβ-GFP, pSGEM-TMEM-mCherry, and pSGEM-SNAP25Δ20 were previously described (<xref ref-type="bibr" rid="bib41">Nader et al., 2020</xref> and El jouni et al.2007). To introduce the serine to alanine mutation at amino acid 125 (S125A) within the zinc-binding domains in pSGEM-mPR-GFP, the XL QuikChange mutagenesis kit (Agilent Technologies) was used. Coding sequences for ABHD2.L (XB-GENE-6489069) and ABHD2.S (XB-GENE-17345096) encoding the <italic>Xenopus</italic> ABHD2.L and S, respectively were synthetized tagged or not with mCherry and cloned in pSGEM by Gene universal. Mutants mPR S125A, ABHD2 H120A, and N125A were generated using the XL QuikChange mutagenesis kit. The rest of the ABHD2 mutants were generated by Gene universal. All constructs were verified by DNA sequencing and by analytical endonuclease restriction enzyme digestion. mRNAs for all the pSGEM clones were produced by in vitro transcription after linearizing the vectors with <italic>Nhe</italic>I, using the mMessage mMachine (Ambion). Relative expression of mPR, ABHD2 LS, ABHD2.S, S1PR2, and S1PR3 were assessed by quantitative real-time PCR (Affymetrix), with <italic>Xenopus</italic> Ornithine decarboxylase (xODC) as the internal control to normalize mRNA transcript levels (<xref ref-type="bibr" rid="bib53">Sindelka et al., 2006</xref>), after total RNA extraction using the RNeasy mini Kit (Qiagen).</p></sec><sec id="s4-4"><title>Co-immunoprecipitation</title><p>Around 70 Oocytes overexpressing GFP-tagged proteins were lysed in IP solution (30 mM HEPES, 100 mM NaCl, pH 7.5) containing protease and phosphatase inhibitors (5 µl/ oocyte). Lysates were cleared of yolk by centrifugation at 1000×g three times for 10 min each at 4 °C. Supernatants were then solubilized with 4% NP40 for 1 hr followed by 15 min centrifugation at 18,188 ×g at 4 °C before immunoprecipitation using anti-GFP microbeads (1 μl/oocyte) per the manufacturer’s instructions.</p></sec><sec id="s4-5"><title>Western blotting</title><p>Generally, cells were lysed in MPF lysis buffer 0.08 M β-glycerophosphate, 20 mM Hepes (pH 7.5), 15 mM MgCl<sub>2</sub>, 20 mM EGTA, 1 mM Na-Vanadate, 50 mM NaF, 1 mM DTT, in the presence of protease and phosphatase inhibitors, followed by centrifugation 3 x at 1000 ×g for 10 min at 4 °C to remove yolk granules. For the treatment with the Calf intestinal phosphatase (CIP), oocytes were lysed in IP solution (30 mM HEPES, 100 mM NaCl, pH 7.5) (5 µl/ oocyte) containing protease and phosphatase inhibitors, and centrifuged twice at 1000×g for 10 min each at 4 °C. Lysates were separated on 10% SDS-PAGE gels, transferred to polyvinylidene difluoride (PVDF) membranes (Millipore), blocked for 1 hr at room temperature with 5% Milk in TBS-T buffer (150 mM NaCl and 20 mM Tris; pH 7.6, 0.1% Tween) and then incubated overnight at 4 °C in 3% BSA in TBS-T with the primary antibody. Blots were then washed three times with TBS-T and probed for 1 hr with horseradish peroxidase (HRP)-conjugated secondary antibody 1/10,000 (for ABHD2, SNAP25, GFP, His, p-plk1, p-cdc25, and p-cdc2), or with infrared fluorescence, IRDye 800 and 680 secondary antibodies (1/10,000) (for GFP, S1PR3, p-MAPK and Tubulin). The blots were visualized using ECL-based detection of horseradish peroxidase (HRP) followed by Image J analysis or using the LI-COR Odyssey Clx Infrared Imaging system and analyzed using LI-COR image Studio Lite v.4.0. The primary antibodies used are anti-GFP (1/1000), anti-SNAP25 (1/1000), anti-Tubulin (1/10,000), anti-p-plk1 (1/1000), anti-phospho-MAPK (1/4000), anti-phospho-Cdc2 (1/1000), anti-phospho Cdc25 (1/1000), anti-His (1/1000), and anti-S1PR3 (1/1000).</p></sec><sec id="s4-6"><title>Oocytes imaging</title><p>Oocytes were imaged on a LSM880 confocal (Zeiss, Germany) fitted with a Plan Apo 63 x/1.4 oil immersion objective, with Z-stacks taking in 0.5 µm sections using a 1 Airy unit pinhole aperture. Images were analyzed using the ImageJ software. To measure the distribution of mPR at the cell membrane, TMEM was used as membrane marker. For each oocyte, the percentage (%) of membrane mPR was calculated by analyzing the intensity of fluorescence distribution through a z-stack of images, where we conservatively used two z stacks below the peak of WGA fluorescence, as a reference to mark the end of the plasma membrane compartment. For mPR-positive vesicle count, z-stacks of images from oocytes overexpressing mPR-GFP were collected before and after P4 in the presence or absence of ABHD2 antisense, or after 2 hr pretreatment with ACA. ImageJ software was used to quantify mPR vesicles using the 3D objects counter application.</p></sec><sec id="s4-7"><title>Metabolomic analyses</title><p>Untargeted metabolomics was performed on single oocytes or a group of 10 oocytes per condition. For measurements of metabolites in a group of 10 oocytes, three experiments using three independent female frogs were performed. Each experiment was conducted in 5 sample replicates per condition per frog. Metabolites were analyzed on both the Metabolon HD4 and CLP platforms. Tandem LC MSMS was used to measure prostaglandins and S1P from 10 oocytes using 10 replicates per condition. Levels of Eicosanoids, EETs, and HETEs before and 30 min after P4 treatment were measured in 20 single oocytes per condition by Cayman chemicals A detailed description of the techniques used is reported below.</p></sec><sec id="s4-8"><title>Sample preparation for metabolomics analysis</title><p>The untargeted metabolomic study was done on a single oocyte or a group of 10 oocytes per condition. For the single oocyte approach, individual oocyte was kept in 96 wells plate in 50 µl Ringer Buffer (96 mM NaCl, 2.5 mM KCl, 1.8 mM CaCl2, 2 mM MgCl2, 10 Mm Hepes, pH 7.4) (with or without 10<sup>–5</sup> M Progesterone treatment). Oocytes from each condition (10 per condition) were collected individually in a 1.5 ml tube. Each oocyte was washed in 50 µl metabolite grade water three times, following aspiration after each wash to remove as much water as possible, without sucking up the oocyte. Washed oocytes were then flash-frozen on dry ice. The samples were kept at –80 °C until shipment for metabolite measurements.</p><p>Single oocyte was extracted in 80% MeOH (LC-MS grade methanol, Fisher Scientific) by bead-beating for 45 s using a Tissuelyser cell disrupter (Qiagen). Extracts were centrifuged for 5 min at 5000 rpm to pellet insoluble protein and supernatants were transferred to clean tubes. The extraction procedure was repeated two additional times, and all three supernatants were pooled, dried in a Vacufuge (Eppendorf), and stored at –80 °C until analysis. The methanol-insoluble protein pellet was solubilized in 0.2 M NaOH at 95 °C for 20 min and protein was quantified using a BioRad DC assay. On the day of metabolite analysis, dried cell extracts were reconstituted in 70% acetonitrile at a relative protein concentration of 4 µg/ml, and 4 µl of this reconstituted extract was injected for LC/MS-based untargeted metabolite profiling. LC/MS metabolomics platform for untargeted metabolite profiling.</p><p>Metabolite extract from a single oocyte was analyzed by LC/MS as described previously (<xref ref-type="bibr" rid="bib5">Chen et al., 2018</xref>), using a platform comprised of an Agilent Model 1290 Infinity II liquid chromatography system coupled to an Agilent 6550 iFunnel time-of-flight MS analyzer. Chromatography of metabolites utilized aqueous normal phase (ANP) chromatography on a Diamond Hydride column (Microsolv). Mobile phases consisted of: (A) 50% isopropanol, containing 0.025% acetic acid, and (B) 90% acetonitrile containing 5 mM ammonium acetate. To eliminate the interference of metal ions on chromatographic peak integrity and electrospray ionization, EDTA was added to the mobile phase at a final concentration of 5 µM. The following gradient was applied: 0–1.0 min, 99% B; 1.0–15.0 min, to 20% B; 15.0–29.0, 0% B; 29.1–37 min, 99% B. Raw data were analyzed using MassHunter Profinder 8.0 and MassProfiler Professional (MPP) 15.1 software (Agilent technologies).</p><p>For measurements of metabolites in a group of 10 oocytes, three experiments using three independent female frogs were performed. Each experiment was conducted in five sample replicates per condition per frog; each sample consist of 10 pooled oocytes.</p></sec><sec id="s4-9"><title>Processing of samples for untargeted metabolomics at Metabolon (HD4 platform)</title><p>The samples were processed according to Metabolon’s standard protocols at Metabolon Inc (Durham, NC, USA). The processes were conducted in an automated manner using the MicroLab STAR system from Hamilton. The samples were ultrasonicated in deionized water and a small portion of the homogenate was used to quantify the protein content with Bradford. The protein content was used for metabolomics data normalization.</p><p>The metabolite extraction process was conducted with recovery standards, which were added to the samples for the QC purposes. The samples were extracted with a series of organic and aqueous solvents under vigorous shaking for 2 min (Glen Mills GenoGrinder 2000). The samples were centrifuged, and the metabolite extract was divided into 4 aliquots, each dedicated for a different measurement strategy. The organic solvent was removed from the 4 sample aliquots using TurboVap (Zymark), and the samples were kept overnight under nitrogen flow.</p></sec><sec id="s4-10"><title>Untargeted metabolic measurements at Metabolon (HD4 platform)</title><p>To ensure the comprehensive metabolite coverage each of the four dried sample aliquots was reconstituted in solvents compatible with the given measurement method. The reconstitution solvents added to each sample contained a series of standards at fixed concentrations to ensure injection and chromatographic consistency. The reconstituted samples were analyzed in the following conditions: (1) Acidic positive ion (optimized for hydrophilic compounds). The extract was gradient eluted from a C18 column (Waters UPLC BEH C18–2.1×100  mm, 1.7  μm) with water and methanol containing 0.05% perfluoropentanoic acid and 0.1% formic acid; (2) Acidic positive ion (optimized for hydrophobic compounds). The extract was gradient eluted from C18 (Waters UPLC BEH C18–2.1×100  mm, 1.7  μm) with methanol, acetonitrile, water, 0.05% perfluoropentanoic acid, and 0.01% formic acid; (3) Basic negative ion. The extract was gradient eluted from a separate dedicated C18 column using methanol and water containing 6.5  mM ammonium bicarbonate at pH 8; and (4) Negative ionization. The extract was gradient eluted from a HILIC column (Waters UPLC BEH Amide 2.1×150  mm, 1.7  μm) using water and acetonitrile with 10  mM ammonium formate at pH 10.8.</p><p>For each of the methods the MS scan range varied, but covered 70–1000 m/z.</p><p>The untargeted metabolic profiling was conducted using Waters ACQUITY ultra-performance liquid chromatography (UPLC) and a Thermo Scientific Q-Exactive high resolution/accurate mass spectrometer interfaced with a heated electrospray ionization (HESI-II) source and Orbitrap mass analyzer, as previously described (PMID: 19624122).</p><p>The obtained raw data was extracted using Metabolon’s hardware and software. The compounds were identified by comparison of peaks to library entries of purified standards using retention index, accurate mass match to the library ±10  ppm, and MS/MS forward and reverse scores between the experimental data and authentic standards as references. Manual assessment of library matches for each compound and each sample was conducted. The metabolic data was normalized to correct variations resulting from inter-day tuning differences in the instrument. Each compound was corrected in a run-day and normalized on protein content determined with Bradford.</p></sec><sec id="s4-11"><title>Processing of samples for lipidomics at Metabolon (CLP platform)</title><p>The samples for lipidomics measurements were also conducted at Metabolon Inc using Metabolon’s standard protocols, performed in an automated manner by deploying the MicroLab STAR system from Hamilton. The samples were ultrasonicated in deionized water and a small portion of the homogenate was used to quantify the protein content with Bradford, for data normalization. Further sample processing was conducted in accordance with to modified Bligh-Dyer extraction (PMID: 13671378) using methanol/water/dichloromethane. The lipid extraction was conducted in the presence of internal standards. The organic extracts were dried under nitrogen flow using TurboVap (Zymark). The samples where reconstituted in dichloromethane: methanol (50:50) containing 10 mM ammonium acetate.</p></sec><sec id="s4-12"><title>Measurements of samples for lipidomics at Metabolon (CLP platform)</title><p>The reconstituted sample extracts were directly infused by deploying Shimadzu liquid chromatography (LC) with nano PEEK tubing as previously described (PMID: 29363076 and PMID: 22645248). The measurements were conducted in both positive and negative electrospray ionization modes using Sciex SelexIon-5500 QTRAP. The molecules were detected in multiple reaction monitoring (MRM) mode with a total of more than 1100 MRMs. The individual lipid species were quantified. It was achieved by calculation of the ratio of the signal intensity of each measured compound to the one of its assigned internal standards, followed by the multiplication of the concentration of internal standard added to the sample. The concentrations of the lipid class were calculated from the sum of all molecular species within a class. The fatty acid compositions were determined by calculating the proportion of each class comprised of individual fatty acids. The obtained data were normalized on protein content.</p></sec><sec id="s4-13"><title>Tandem LC MSMS for measurements of prostaglandins and S1P</title><p>For the measurements of prostaglandins and S1P, 10 x ‘10 oocytes’ per condition were used; vehicle (30 min in 50 μl Ringer 1 X without P4), 5 min P4 (25 min in 50 μl Ringer 1 X without P4, then P4 was added for 5 min), and 30 min P4 (30 min in 50 μl Ringer 1 X containing P4 at 10<sup>–5</sup> M). After the end of each treatment, oocytes were quickly washed with water and then flash-frozen. Three rounds of experiments from three different female frogs were performed and used for tandem LC-MS/MS measurement of arachidonic acid, S1P, and prostaglandins.</p><p>Eicosanoids were extracted as previously described (<xref ref-type="bibr" rid="bib44">Nithipatikom et al., 2003</xref>). Briefly, pooled oocytes were vortexed in 1 ml solution containing 0.1% BHT, 800 µl ddH2O, 175 μl ethanol, and 25 μl acetic acid, followed by centrifugation at 1500 rpm for 3 min. The supernatant was loaded onto an ethanol:ddH2O (1:3) pre-conditioned C18 Bond Elut SPE column, washed with 20 ml ddH2O, then eluted with 5 ml ethyl acetate and collected in a glass tube. After the ethyl acetate layer was removed from the water layer from the bottom of the glass tubes, the water layer was extracted twice with ethyl acetate. All ethyl acetate portion was pooled, vacuum dried down and stored at –80 °C freezer. On the day of measurement, dried samples were reconstituted in 25 µl 35%Acetonitrile, 65% H<sub>2</sub>O, and 0.1% acetic acid solution for LC/MS/MS data acquisition. For S1P measurement, pooled frog oocytes were extracted by 80% MeOH, supernatant from 80% MeOH extracts were dried down and reconstituted in 25 µl 35%Acetonitrile, 65% H<sub>2</sub>O, and 0.1% acetic acid solution for LC/MS/MS data acquisition.</p><p>The tandem LC/MS/MS platform for prostaglandin and S1P measurement comprised of an Agilent Model 1290 Infinity II liquid chromatography system coupled to an Agilent 6460 Triple Quadrupole MS analyzer. An Agilent Zorbax SB-AQ reversed phase column (2.1×100 mm, 1.8 µm particle size), was used for the separation. Mobile phases consist of (A) 0.1% formic acid and 1 mM ammonium formate in 99% water 1% acetonitrile and (B) 0.1% formic acid and 1 mM ammonium formate in 99% acetonitrile H2O. Column temperature was set at 60 °C and autosampler temperature was at 4 °C. The flow rate was 0.4 mL/min. The following was applied: 0–2, 30% B; 2–12 min, to 65% B; 12–12.5 min, to 95%, 12.5–14.5 min, 95% B; 14.5–15 min, to 30% B; 15–20 min, 30% B. MRM transitions for qualitative and quantitative ions were acquired for PGA1, A2, B1, B2, D2/E2, I2. F1α, F2α. Note that PGD2 and PGE2 were not separatable by this method.</p><p>For the measurements of the eicosanoids, EETs, and HETEs – we used the services of Cayman chemicals. Single oocytes were incubated with either ethanol or P4 10<sup>–5</sup>M in Ringer 1 x. 20 oocytes per condition were used. 30 min later, each oocyte was lysed within the tube by pipetting up and down, followed by spinning 3 x for 1000 g 10 min at 4 C. Supernatants were collected, flash-frozen and kept at –80 C prior to shipment/analysis.</p></sec><sec id="s4-14"><title>PLA2 assay</title><p>RNAs for mPR and ABHD2.S wt or ABHD2.S S/D/H mutants were used to generate recombinant proteins of mPR, ABHD2.S, and mPR/ABHD2.S, using the rabbit reticulocytes lysates Nuclease-treated kit and the transcend tRNA from Promega, as per the manufacturer’s instruction. These different reactions were used to measure phospholipase A2 (PLA2) activity following the manufacturer’s procedures (Abcam, Cambridge, UK), in the presence of ethanol or P4 (10<sup>–5</sup> M). No RNA control without substrate was used as background. PLA2 activity was corrected on reticulocytes without any RNA.</p><p>We used a coupled in vitro transcription/translation kit (ALiCECell-Free Protein Synthesis System, Sigma Aldrich) that allows the expression of difficult-to-produce proteins, such as membrane proteins, in microsomes using the pAlice02.His vector, which adds a melittin signal peptide to translocate the proteins into microsomes. To subclone mPRβ into the pALICE02 vector, pSGEM-mPR was PCR amplified using the following primers: 5’ <named-content content-type="sequence">CTACCATGGCAATGACTACCGCAATCCTTGA</named-content>-3’ (Forward) 5’-<named-content content-type="sequence">CTAGGTACCTCAGTGATGGTGATGGTGATGAAGTTCTTTTCTGGCCAACT</named-content>-3’ (Reverse). The resulting PCR product was cut with NcoI and KpnI, gel purified, and ligated into NcoI/KpnI of pALICE02. To subclone ABHD2 in pALICE02, pSGEM-ABHD2 was PCR amplified using the following primers: 5’-<named-content content-type="sequence">ACTGATATCATGGATGCGATAGTGGAAACCC</named-content>-3’(Forward) and 5’-<named-content content-type="sequence">CTAGGTACCTCAGTGATGGTGATGGTGATGTTTATGGTCAGACTCAGCAGCC</named-content>-3’(Reverse). The resulting PCR product was cut with EcoRV and KpnI, gel purified, and ligated into pALICE02 cut with NcoI and Klenow treated to produce a blunt end then cut with KpnI. All constructs were verified by DNA sequencing and by analytical endonuclease restriction enzyme digestion. The pAlice02 vector allows for the expression of C-terminally His-tagged mPRβ and ABHD2. Briefly, DNA was added to the pALiCE lysates, followed by incubation at 25 °C for 48 hr with constant shaking at 700 rpm. The expression of ABHD2 and mPRβ were confirmed by western blot, before proceeding to the PLA2 assay.</p></sec><sec id="s4-15"><title>Statistics</title><p>Data are presented as mean ± SEM. Each set of experiments was at least repeated three times. Groups were compared using the Prism 9 software (GraphPad) using the statistical tests indicated in the figure legend. Statistical significance is indicated by p-values (ns, not significant; ***p≤0.001; **p≤0.01; *p≤0.05).</p></sec><sec id="s4-16"><title>Materials availability statement</title><p>All clones or reagents generated in the course of this study are readily available to colleagues in the scientific community without any restrictions. If interested please contact the corresponding author, Khaled Machaca at khm2002@qatar-med.cornell.edu.</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review and editing</p></fn><fn fn-type="con" id="con2"><p>Investigation, Methodology</p></fn><fn fn-type="con" id="con3"><p>Investigation, Methodology</p></fn><fn fn-type="con" id="con4"><p>Formal analysis, Investigation</p></fn><fn fn-type="con" id="con5"><p>Investigation, Methodology</p></fn><fn fn-type="con" id="con6"><p>Investigation, Methodology</p></fn><fn fn-type="con" id="con7"><p>Investigation</p></fn><fn fn-type="con" id="con8"><p>Formal analysis, Investigation, Methodology</p></fn><fn fn-type="con" id="con9"><p>Formal analysis</p></fn><fn fn-type="con" id="con10"><p>Formal analysis</p></fn><fn fn-type="con" id="con11"><p>Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>This study was performed in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols (#2011-0035) of the Weill Cornell Medicine Qatar. The protocol was approved by the IACUC committee of Weill Cornell Medicine Qatar.</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="supp1"><label>Supplementary file 1.</label><caption><title>List of reagents.</title><p>(<bold>a</bold>) List of antibodies, chemicals, and reagents. (<bold>b</bold>) List of antisense oligonucleotides and primers.</p></caption><media xlink:href="elife-92635-supp1-v1.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material><supplementary-material id="mdar"><label>MDAR checklist</label><media xlink:href="elife-92635-mdarchecklist1-v1.docx" mimetype="application" mime-subtype="docx"/></supplementary-material><supplementary-material id="sdata1"><label>Source data 1.</label><caption><title>Full Western blots.</title></caption><media xlink:href="elife-92635-data1-v1.zip" mimetype="application" mime-subtype="zip"/></supplementary-material><supplementary-material id="sdata2"><label>Source data 2.</label><caption><title>Labelled full Western Blots.</title></caption><media xlink:href="elife-92635-data2-v1.zip" mimetype="application" mime-subtype="zip"/></supplementary-material><supplementary-material id="sdata3"><label>Source data 3.</label><caption><title>Means and p-values for ratio fold changes for lipids analyzed on the CLP platform at 5 min time point after treatment with progesterone (P4).</title><p>Means and p-values for ratio fold changes for lipids analyzed on the CLP platform at 30 min time point after treatment with P4. Means and p-values for ratio fold changes for lipids analyzed on the HD4 platform at 5 min time point after treatment with P4. Means and p-values for ratio fold changes for other metabolites analyzed on the HD4 platform at 5 min time point after treatment with P4. Means and p-values for ratio fold changes for lipids analyzed on the HD4 platform at 30 min time point after treatment with P4. Means and p-values for ratio fold changes for other metabolites analyzed on the HD4 platform at 30 min time point after treatment with P4. Means and p-values for ratio fold changes for different compounds at 30 min time point after treatment with P4 in single oocyte metabolomics.</p></caption><media xlink:href="elife-92635-data3-v1.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>All data generated or analysed during this study are included in the manuscript and associated source data files. The metabolomics datasets in the source data tables include the metabolomics and lipidomics platforms used as explained in details in the methods section.</p></sec><ack id="ack"><title>Acknowledgements</title><p>We are grateful to the Bioinformatics and Virtual Metabolomics Core at Weill Cornell Medicine Qatar for their support in the metabolomics and lipidomic studies. We also thank the Vivarium and Microscopy Cores at WCMQ for their support in multiple experiments. This work as well as the Cores are supported by the Biomedical Research Program at Weill Cornell Medical College in Qatar (BMRP), a program funded by the Qatar Foundation. Additional funding was provided by NPRP-Standard (NPRP-S) 13th Cycle grant 13 S-0206-200274 from the Qatar National Research Fund (a member of Qatar Foundation). The findings herein reflect the work and are solely the responsibility of the authors. This work was also supported by NIH R01AR076029 and NIH R21ES032347 to QC.</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Albers</surname><given-names>HMHG</given-names></name><name><surname>Dong</surname><given-names>A</given-names></name><name><surname>van Meeteren</surname><given-names>LA</given-names></name><name><surname>Egan</surname><given-names>DA</given-names></name><name><surname>Sunkara</surname><given-names>M</given-names></name><name><surname>van Tilburg</surname><given-names>EW</given-names></name><name><surname>Schuurman</surname><given-names>K</given-names></name><name><surname>van Tellingen</surname><given-names>O</given-names></name><name><surname>Morris</surname><given-names>AJ</given-names></name><name><surname>Smyth</surname><given-names>SS</given-names></name><name><surname>Moolenaar</surname><given-names>WH</given-names></name><name><surname>Ovaa</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Boronic acid-based inhibitor of autotaxin reveals rapid turnover of LPA in the circulation</article-title><source>PNAS</source><volume>107</volume><fpage>7257</fpage><lpage>7262</lpage><pub-id pub-id-type="doi">10.1073/pnas.1001529107</pub-id><pub-id pub-id-type="pmid">20360563</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Balsinde</surname><given-names>J</given-names></name><name><surname>Dennis</surname><given-names>EA</given-names></name></person-group><year iso-8601-date="1996">1996</year><article-title>Bromoenol lactone inhibits magnesium-dependent phosphatidate phosphohydrolase and blocks triacylglycerol biosynthesis in mouse P388D1 macrophages</article-title><source>The Journal of Biological Chemistry</source><volume>271</volume><fpage>31937</fpage><lpage>31941</lpage><pub-id pub-id-type="doi">10.1074/jbc.271.50.31937</pub-id><pub-id pub-id-type="pmid">8943239</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Björkgren</surname><given-names>I</given-names></name><name><surname>Chung</surname><given-names>DH</given-names></name><name><surname>Mendoza</surname><given-names>S</given-names></name><name><surname>Gabelev-Khasin</surname><given-names>L</given-names></name><name><surname>Petersen</surname><given-names>NT</given-names></name><name><surname>Modzelewski</surname><given-names>A</given-names></name><name><surname>He</surname><given-names>L</given-names></name><name><surname>Lishko</surname><given-names>PV</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Alpha/beta hydrolase domain-containing protein 2 regulates the rhythm of follicular maturation and estrous stages of the female reproductive cycle</article-title><source>Frontiers in Cell and Developmental Biology</source><volume>9</volume><elocation-id>710864</elocation-id><pub-id pub-id-type="doi">10.3389/fcell.2021.710864</pub-id><pub-id pub-id-type="pmid">34568325</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brindley</surname><given-names>DN</given-names></name><name><surname>Pilquil</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Lipid phosphate phosphatases and signaling</article-title><source>Journal of Lipid Research</source><volume>50</volume><fpage>S225</fpage><lpage>S230</lpage><pub-id pub-id-type="doi">10.1194/jlr.R800055-JLR200</pub-id><pub-id pub-id-type="pmid">19066402</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname><given-names>Q</given-names></name><name><surname>Kirk</surname><given-names>K</given-names></name><name><surname>Shurubor</surname><given-names>YI</given-names></name><name><surname>Zhao</surname><given-names>D</given-names></name><name><surname>Arreguin</surname><given-names>AJ</given-names></name><name><surname>Shahi</surname><given-names>I</given-names></name><name><surname>Valsecchi</surname><given-names>F</given-names></name><name><surname>Primiano</surname><given-names>G</given-names></name><name><surname>Calder</surname><given-names>EL</given-names></name><name><surname>Carelli</surname><given-names>V</given-names></name><name><surname>Denton</surname><given-names>TT</given-names></name><name><surname>Beal</surname><given-names>MF</given-names></name><name><surname>Gross</surname><given-names>SS</given-names></name><name><surname>Manfredi</surname><given-names>G</given-names></name><name><surname>D’Aurelio</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Rewiring of Glutamine Metabolism Is a Bioenergetic Adaptation of Human Cells with Mitochondrial DNA Mutations</article-title><source>Cell Metabolism</source><volume>27</volume><fpage>1007</fpage><lpage>1025</lpage><pub-id pub-id-type="doi">10.1016/j.cmet.2018.03.002</pub-id><pub-id pub-id-type="pmid">29657030</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dennis</surname><given-names>EA</given-names></name><name><surname>Cao</surname><given-names>J</given-names></name><name><surname>Hsu</surname><given-names>YH</given-names></name><name><surname>Magrioti</surname><given-names>V</given-names></name><name><surname>Kokotos</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Phospholipase A2 enzymes: physical structure, biological function, disease implication, chemical inhibition, and therapeutic intervention</article-title><source>Chemical Reviews</source><volume>111</volume><fpage>6130</fpage><lpage>6185</lpage><pub-id pub-id-type="doi">10.1021/cr200085w</pub-id><pub-id pub-id-type="pmid">21910409</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dosiou</surname><given-names>C</given-names></name><name><surname>Hamilton</surname><given-names>AE</given-names></name><name><surname>Pang</surname><given-names>Y</given-names></name><name><surname>Overgaard</surname><given-names>MT</given-names></name><name><surname>Tulac</surname><given-names>S</given-names></name><name><surname>Dong</surname><given-names>J</given-names></name><name><surname>Thomas</surname><given-names>P</given-names></name><name><surname>Giudice</surname><given-names>LC</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Expression of membrane progesterone receptors on human T lymphocytes and Jurkat cells and activation of G-proteins by progesterone</article-title><source>The Journal of Endocrinology</source><volume>196</volume><fpage>67</fpage><lpage>77</lpage><pub-id pub-id-type="doi">10.1677/JOE-07-0317</pub-id><pub-id pub-id-type="pmid">18180318</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dressing</surname><given-names>GE</given-names></name><name><surname>Goldberg</surname><given-names>JE</given-names></name><name><surname>Charles</surname><given-names>NJ</given-names></name><name><surname>Schwertfeger</surname><given-names>KL</given-names></name><name><surname>Lange</surname><given-names>CA</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Membrane progesterone receptor expression in mammalian tissues: a review of regulation and physiological implications</article-title><source>Steroids</source><volume>76</volume><fpage>11</fpage><lpage>17</lpage><pub-id pub-id-type="doi">10.1016/j.steroids.2010.09.006</pub-id><pub-id pub-id-type="pmid">20869977</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Duckworth</surname><given-names>BC</given-names></name><name><surname>Weaver</surname><given-names>JS</given-names></name><name><surname>Ruderman</surname><given-names>JV</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>G2 arrest in <italic>Xenopus</italic> oocytes depends on phosphorylation of cdc25 by protein kinase A</article-title><source>PNAS</source><volume>99</volume><fpage>16794</fpage><lpage>16799</lpage><pub-id pub-id-type="doi">10.1073/pnas.222661299</pub-id><pub-id pub-id-type="pmid">12477927</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>El-Jouni</surname><given-names>W</given-names></name><name><surname>Haun</surname><given-names>S</given-names></name><name><surname>Hodeify</surname><given-names>R</given-names></name><name><surname>Hosein Walker</surname><given-names>A</given-names></name><name><surname>Machaca</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Vesicular traffic at the cell membrane regulates oocyte meiotic arrest</article-title><source>Development</source><volume>134</volume><fpage>3307</fpage><lpage>3315</lpage><pub-id pub-id-type="doi">10.1242/dev.005454</pub-id><pub-id pub-id-type="pmid">17699605</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ernst</surname><given-names>R</given-names></name><name><surname>Ejsing</surname><given-names>CS</given-names></name><name><surname>Antonny</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Homeoviscous adaptation and the regulation of membrane lipids</article-title><source>Journal of Molecular Biology</source><volume>428</volume><fpage>4776</fpage><lpage>4791</lpage><pub-id pub-id-type="doi">10.1016/j.jmb.2016.08.013</pub-id><pub-id pub-id-type="pmid">27534816</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Flock</surname><given-names>GB</given-names></name><name><surname>Cao</surname><given-names>X</given-names></name><name><surname>Maziarz</surname><given-names>M</given-names></name><name><surname>Drucker</surname><given-names>DJ</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Activation of enteroendocrine membrane progesterone receptors promotes incretin secretion and improves glucose tolerance in mice</article-title><source>Diabetes</source><volume>62</volume><fpage>283</fpage><lpage>290</lpage><pub-id pub-id-type="doi">10.2337/db12-0601</pub-id><pub-id pub-id-type="pmid">22933106</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Frye</surname><given-names>CA</given-names></name><name><surname>Sumida</surname><given-names>K</given-names></name><name><surname>Lydon</surname><given-names>JP</given-names></name><name><surname>O’Malley</surname><given-names>BW</given-names></name><name><surname>Pfaff</surname><given-names>DW</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Mid-aged and aged wild-type and progestin receptor knockout (PRKO) mice demonstrate rapid progesterone and 3alpha,5alpha-THP-facilitated lordosis</article-title><source>Psychopharmacology</source><volume>185</volume><fpage>423</fpage><lpage>432</lpage><pub-id pub-id-type="doi">10.1007/s00213-005-0300-4</pub-id><pub-id pub-id-type="pmid">16544163</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Futaki</surname><given-names>N</given-names></name><name><surname>Takahashi</surname><given-names>S</given-names></name><name><surname>Yokoyama</surname><given-names>M</given-names></name><name><surname>Arai</surname><given-names>I</given-names></name><name><surname>Higuchi</surname><given-names>S</given-names></name><name><surname>Otomo</surname><given-names>S</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>NS-398, a new anti-inflammatory agent, selectively inhibits prostaglandin G/H synthase/cyclooxygenase (COX-2) activity in vitro</article-title><source>Prostaglandins</source><volume>47</volume><fpage>55</fpage><lpage>59</lpage><pub-id pub-id-type="doi">10.1016/0090-6980(94)90074-4</pub-id><pub-id pub-id-type="pmid">8140262</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Garg</surname><given-names>D</given-names></name><name><surname>Ng</surname><given-names>SSM</given-names></name><name><surname>Baig</surname><given-names>KM</given-names></name><name><surname>Driggers</surname><given-names>P</given-names></name><name><surname>Segars</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Progesterone-mediated non-classical signaling</article-title><source>Trends in Endocrinology and Metabolism</source><volume>28</volume><fpage>656</fpage><lpage>668</lpage><pub-id pub-id-type="doi">10.1016/j.tem.2017.05.006</pub-id><pub-id pub-id-type="pmid">28651856</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Harayama</surname><given-names>T</given-names></name><name><surname>Riezman</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Understanding the diversity of membrane lipid composition</article-title><source>Nature Reviews. Molecular Cell Biology</source><volume>19</volume><fpage>281</fpage><lpage>296</lpage><pub-id pub-id-type="doi">10.1038/nrm.2017.138</pub-id><pub-id pub-id-type="pmid">29410529</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hohenegger</surname><given-names>M</given-names></name><name><surname>Waldhoer</surname><given-names>M</given-names></name><name><surname>Beindl</surname><given-names>W</given-names></name><name><surname>Böing</surname><given-names>B</given-names></name><name><surname>Kreimeyer</surname><given-names>A</given-names></name><name><surname>Nickel</surname><given-names>P</given-names></name><name><surname>Nanoff</surname><given-names>C</given-names></name><name><surname>Freissmuth</surname><given-names>M</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Gsalpha-selective G protein antagonists</article-title><source>PNAS</source><volume>95</volume><fpage>346</fpage><lpage>351</lpage><pub-id pub-id-type="doi">10.1073/pnas.95.1.346</pub-id><pub-id pub-id-type="pmid">9419378</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Holland</surname><given-names>WL</given-names></name><name><surname>Miller</surname><given-names>RA</given-names></name><name><surname>Wang</surname><given-names>ZV</given-names></name><name><surname>Sun</surname><given-names>K</given-names></name><name><surname>Barth</surname><given-names>BM</given-names></name><name><surname>Bui</surname><given-names>HH</given-names></name><name><surname>Davis</surname><given-names>KE</given-names></name><name><surname>Bikman</surname><given-names>BT</given-names></name><name><surname>Halberg</surname><given-names>N</given-names></name><name><surname>Rutkowski</surname><given-names>JM</given-names></name><name><surname>Wade</surname><given-names>MR</given-names></name><name><surname>Tenorio</surname><given-names>VM</given-names></name><name><surname>Kuo</surname><given-names>M-S</given-names></name><name><surname>Brozinick</surname><given-names>JT</given-names></name><name><surname>Zhang</surname><given-names>BB</given-names></name><name><surname>Birnbaum</surname><given-names>MJ</given-names></name><name><surname>Summers</surname><given-names>SA</given-names></name><name><surname>Scherer</surname><given-names>PE</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Receptor-mediated activation of ceramidase activity initiates the pleiotropic actions of adiponectin</article-title><source>Nature Medicine</source><volume>17</volume><fpage>55</fpage><lpage>63</lpage><pub-id pub-id-type="doi">10.1038/nm.2277</pub-id><pub-id pub-id-type="pmid">21186369</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Irie</surname><given-names>A</given-names></name><name><surname>Yamamoto</surname><given-names>K</given-names></name><name><surname>Miki</surname><given-names>Y</given-names></name><name><surname>Murakami</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Phosphatidylethanolamine dynamics are required for osteoclast fusion</article-title><source>Scientific Reports</source><volume>7</volume><elocation-id>46715</elocation-id><pub-id pub-id-type="doi">10.1038/srep46715</pub-id><pub-id pub-id-type="pmid">28436434</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jin</surname><given-names>S</given-names></name><name><surname>Zhao</surname><given-names>G</given-names></name><name><surname>Li</surname><given-names>Z</given-names></name><name><surname>Nishimoto</surname><given-names>Y</given-names></name><name><surname>Isohama</surname><given-names>Y</given-names></name><name><surname>Shen</surname><given-names>J</given-names></name><name><surname>Ito</surname><given-names>T</given-names></name><name><surname>Takeya</surname><given-names>M</given-names></name><name><surname>Araki</surname><given-names>K</given-names></name><name><surname>He</surname><given-names>P</given-names></name><name><surname>Yamamura</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2009">2009</year><article-title>Age-related pulmonary emphysema in mice lacking alpha/beta hydrolase domain containing 2 gene</article-title><source>Biochemical and Biophysical Research Communications</source><volume>380</volume><fpage>419</fpage><lpage>424</lpage><pub-id pub-id-type="doi">10.1016/j.bbrc.2009.01.098</pub-id><pub-id pub-id-type="pmid">19250629</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Josefsberg Ben-Yehoshua</surname><given-names>L</given-names></name><name><surname>Lewellyn</surname><given-names>AL</given-names></name><name><surname>Thomas</surname><given-names>P</given-names></name><name><surname>Maller</surname><given-names>JL</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>The role of <italic>Xenopus</italic> membrane progesterone receptor beta in mediating the effect of progesterone on oocyte maturation</article-title><source>Molecular Endocrinology</source><volume>21</volume><fpage>664</fpage><lpage>673</lpage><pub-id pub-id-type="doi">10.1210/me.2006-0256</pub-id><pub-id pub-id-type="pmid">17185392</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kelder</surname><given-names>J</given-names></name><name><surname>Pang</surname><given-names>Y</given-names></name><name><surname>Dong</surname><given-names>J</given-names></name><name><surname>Schaftenaar</surname><given-names>G</given-names></name><name><surname>Thomas</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Molecular modeling, mutational analysis and steroid specificity of the ligand binding pocket of mPRα (PAQR7): shared ligand binding with AdipoR1 and its structural basis</article-title><source>The Journal of Steroid Biochemistry and Molecular Biology</source><volume>219</volume><elocation-id>106082</elocation-id><pub-id pub-id-type="doi">10.1016/j.jsbmb.2022.106082</pub-id><pub-id pub-id-type="pmid">35189329</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Leslie</surname><given-names>CC</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Cytosolic phospholipase A₂: physiological function and role in disease</article-title><source>Journal of Lipid Research</source><volume>56</volume><fpage>1386</fpage><lpage>1402</lpage><pub-id pub-id-type="doi">10.1194/jlr.R057588</pub-id><pub-id pub-id-type="pmid">25838312</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>L</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>Regulation of lung surfactant secretion by phospholipase A2</article-title><source>Journal of Cellular Biochemistry</source><volume>72</volume><fpage>103</fpage><lpage>110</lpage><pub-id pub-id-type="pmid">10025671</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lord</surname><given-names>CC</given-names></name><name><surname>Thomas</surname><given-names>G</given-names></name><name><surname>Brown</surname><given-names>JM</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Mammalian alpha beta hydrolase domain (ABHD) proteins: lipid metabolizing enzymes at the interface of cell signaling and energy metabolism</article-title><source>Biochimica et Biophysica Acta</source><volume>1831</volume><fpage>792</fpage><lpage>802</lpage><pub-id pub-id-type="doi">10.1016/j.bbalip.2013.01.002</pub-id><pub-id pub-id-type="pmid">23328280</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lydon</surname><given-names>JP</given-names></name><name><surname>DeMayo</surname><given-names>FJ</given-names></name><name><surname>Funk</surname><given-names>CR</given-names></name><name><surname>Mani</surname><given-names>SK</given-names></name><name><surname>Hughes</surname><given-names>AR</given-names></name><name><surname>Montgomery</surname><given-names>CA</given-names><suffix>Jr</suffix></name><name><surname>Shyamala</surname><given-names>G</given-names></name><name><surname>Conneely</surname><given-names>OM</given-names></name><name><surname>O’Malley</surname><given-names>BW</given-names></name></person-group><year iso-8601-date="1995">1995</year><article-title>Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities</article-title><source>Genes &amp; Development</source><volume>9</volume><fpage>2266</fpage><lpage>2278</lpage><pub-id pub-id-type="doi">10.1101/gad.9.18.2266</pub-id><pub-id pub-id-type="pmid">7557380</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Machaca</surname><given-names>K</given-names></name><name><surname>Haun</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Induction of maturation-promoting factor during <italic>Xenopus</italic> oocyte maturation uncouples Ca(2+) store depletion from store-operated Ca(2+) entry</article-title><source>The Journal of Cell Biology</source><volume>156</volume><fpage>75</fpage><lpage>85</lpage><pub-id pub-id-type="doi">10.1083/jcb.200110059</pub-id><pub-id pub-id-type="pmid">11781335</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Machaca</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Ca2+ signaling differentiation during oocyte maturation</article-title><source>Journal of Cellular Physiology</source><volume>213</volume><fpage>331</fpage><lpage>340</lpage><pub-id pub-id-type="doi">10.1002/jcp.21194</pub-id><pub-id pub-id-type="pmid">17620315</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maller</surname><given-names>JL</given-names></name><name><surname>Butcher</surname><given-names>FR</given-names></name><name><surname>Krebs</surname><given-names>EG</given-names></name></person-group><year iso-8601-date="1979">1979</year><article-title>Early effect of progesterone on levels of cyclic adenosine 3’:5’-monophosphate in <italic>Xenopus</italic> oocytes</article-title><source>The Journal of Biological Chemistry</source><volume>254</volume><fpage>579</fpage><lpage>582</lpage><pub-id pub-id-type="pmid">216678</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mannowetz</surname><given-names>N</given-names></name><name><surname>Miller</surname><given-names>MR</given-names></name><name><surname>Lishko</surname><given-names>PV</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Regulation of the sperm calcium channel CatSper by endogenous steroids and plant triterpenoids</article-title><source>PNAS</source><volume>114</volume><fpage>5743</fpage><lpage>5748</lpage><pub-id pub-id-type="doi">10.1073/pnas.1700367114</pub-id><pub-id pub-id-type="pmid">28507119</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Massé</surname><given-names>K</given-names></name><name><surname>Kyuno</surname><given-names>J</given-names></name><name><surname>Bhamra</surname><given-names>S</given-names></name><name><surname>Jones</surname><given-names>EA</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>The lysophosphatidic acid (LPA) and sphingosine-1-phosphate (S1P) receptor gene families: cloning and comparative expression analysis in <italic>Xenopus laevis</italic></article-title><source>The International Journal of Developmental Biology</source><volume>54</volume><fpage>1361</fpage><lpage>1374</lpage><pub-id pub-id-type="doi">10.1387/ijdb.103068km</pub-id><pub-id pub-id-type="pmid">20712001</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Matten</surname><given-names>W</given-names></name><name><surname>Daar</surname><given-names>I</given-names></name><name><surname>Vande Woude</surname><given-names>GF</given-names></name></person-group><year iso-8601-date="1994">1994</year><article-title>Protein kinase A acts at multiple points to inhibit <italic>Xenopus</italic> oocyte maturation</article-title><source>Molecular and Cellular Biology</source><volume>14</volume><fpage>4419</fpage><lpage>4426</lpage><pub-id pub-id-type="doi">10.1128/mcb.14.7.4419-4426.1994</pub-id><pub-id pub-id-type="pmid">8007949</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miller</surname><given-names>MR</given-names></name><name><surname>Mannowetz</surname><given-names>N</given-names></name><name><surname>Iavarone</surname><given-names>AT</given-names></name><name><surname>Safavi</surname><given-names>R</given-names></name><name><surname>Gracheva</surname><given-names>EO</given-names></name><name><surname>Smith</surname><given-names>JF</given-names></name><name><surname>Hill</surname><given-names>RZ</given-names></name><name><surname>Bautista</surname><given-names>DM</given-names></name><name><surname>Kirichok</surname><given-names>Y</given-names></name><name><surname>Lishko</surname><given-names>PV</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Unconventional endocannabinoid signaling governs sperm activation via the sex hormone progesterone</article-title><source>Science</source><volume>352</volume><fpage>555</fpage><lpage>559</lpage><pub-id pub-id-type="doi">10.1126/science.aad6887</pub-id><pub-id pub-id-type="pmid">26989199</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miyata</surname><given-names>K</given-names></name><name><surname>Oike</surname><given-names>Y</given-names></name><name><surname>Hoshii</surname><given-names>T</given-names></name><name><surname>Maekawa</surname><given-names>H</given-names></name><name><surname>Ogawa</surname><given-names>H</given-names></name><name><surname>Suda</surname><given-names>T</given-names></name><name><surname>Araki</surname><given-names>K</given-names></name><name><surname>Yamamura</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Increase of smooth muscle cell migration and of intimal hyperplasia in mice lacking the alpha/beta hydrolase domain containing 2 gene</article-title><source>Biochemical and Biophysical Research Communications</source><volume>329</volume><fpage>296</fpage><lpage>304</lpage><pub-id pub-id-type="doi">10.1016/j.bbrc.2005.01.127</pub-id><pub-id pub-id-type="pmid">15721306</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mostafa</surname><given-names>S</given-names></name><name><surname>Nader</surname><given-names>N</given-names></name><name><surname>Machaca</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Lipid signaling during gamete maturation</article-title><source>Frontiers in Cell and Developmental Biology</source><volume>10</volume><elocation-id>814876</elocation-id><pub-id pub-id-type="doi">10.3389/fcell.2022.814876</pub-id><pub-id pub-id-type="pmid">36204680</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moussatche</surname><given-names>P</given-names></name><name><surname>Lyons</surname><given-names>TJ</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Non-genomic progesterone signalling and its non-canonical receptor</article-title><source>Biochemical Society Transactions</source><volume>40</volume><fpage>200</fpage><lpage>204</lpage><pub-id pub-id-type="doi">10.1042/BST20110638</pub-id><pub-id pub-id-type="pmid">22260690</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Murakami</surname><given-names>M</given-names></name><name><surname>Sato</surname><given-names>H</given-names></name><name><surname>Taketomi</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Updating phospholipase a2 biology</article-title><source>Biomolecules</source><volume>10</volume><elocation-id>1457</elocation-id><pub-id pub-id-type="doi">10.3390/biom10101457</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nader</surname><given-names>N</given-names></name><name><surname>Kulkarni</surname><given-names>RP</given-names></name><name><surname>Dib</surname><given-names>M</given-names></name><name><surname>Machaca</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>How to make a good egg!: the need for remodeling of oocyte Ca(2+) signaling to mediate the egg-to-embryo transition</article-title><source>Cell Calcium</source><volume>53</volume><fpage>41</fpage><lpage>54</lpage><pub-id pub-id-type="doi">10.1016/j.ceca.2012.11.015</pub-id><pub-id pub-id-type="pmid">23266324</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nader</surname><given-names>N</given-names></name><name><surname>Dib</surname><given-names>M</given-names></name><name><surname>Daalis</surname><given-names>A</given-names></name><name><surname>Kulkarni</surname><given-names>RP</given-names></name><name><surname>Machaca</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Role for endocytosis of a constitutively active GPCR (GPR185) in releasing vertebrate oocyte meiotic arrest</article-title><source>Developmental Biology</source><volume>395</volume><fpage>355</fpage><lpage>366</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2014.08.036</pub-id><pub-id pub-id-type="pmid">25220151</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nader</surname><given-names>N</given-names></name><name><surname>Courjaret</surname><given-names>R</given-names></name><name><surname>Dib</surname><given-names>M</given-names></name><name><surname>Kulkarni</surname><given-names>RP</given-names></name><name><surname>Machaca</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Release from <italic>Xenopus</italic> oocyte prophase I meiotic arrest is independent of a decrease in cAMP levels or PKA activity</article-title><source>Development</source><volume>143</volume><fpage>1926</fpage><lpage>1936</lpage><pub-id pub-id-type="doi">10.1242/dev.136168</pub-id><pub-id pub-id-type="pmid">27122173</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nader</surname><given-names>N</given-names></name><name><surname>Dib</surname><given-names>M</given-names></name><name><surname>Hodeify</surname><given-names>R</given-names></name><name><surname>Courjaret</surname><given-names>R</given-names></name><name><surname>Elmi</surname><given-names>A</given-names></name><name><surname>Hammad</surname><given-names>AS</given-names></name><name><surname>Dey</surname><given-names>R</given-names></name><name><surname>Huang</surname><given-names>X-Y</given-names></name><name><surname>Machaca</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Membrane progesterone receptor induces meiosis in <italic>Xenopus</italic> oocytes through endocytosis into signaling endosomes and interaction with APPL1 and Akt2</article-title><source>PLOS Biology</source><volume>18</volume><elocation-id>e3000901</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pbio.3000901</pub-id><pub-id pub-id-type="pmid">33137110</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Naresh Kumar</surname><given-names>M</given-names></name><name><surname>Thunuguntla</surname><given-names>VBSC</given-names></name><name><surname>Veeramachaneni</surname><given-names>GK</given-names></name><name><surname>Chandra Sekhar</surname><given-names>B</given-names></name><name><surname>Guntupalli</surname><given-names>S</given-names></name><name><surname>Bondili</surname><given-names>JS</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Molecular characterization of human ABHD2 as TAG lipase and ester hydrolase</article-title><source>Bioscience Reports</source><volume>36</volume><elocation-id>e00358</elocation-id><pub-id pub-id-type="doi">10.1042/BSR20160033</pub-id><pub-id pub-id-type="pmid">27247428</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nebreda</surname><given-names>AR</given-names></name><name><surname>Ferby</surname><given-names>I</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Regulation of the meiotic cell cycle in oocytes</article-title><source>Current Opinion in Cell Biology</source><volume>12</volume><fpage>666</fpage><lpage>675</lpage><pub-id pub-id-type="doi">10.1016/s0955-0674(00)00150-2</pub-id><pub-id pub-id-type="pmid">11063930</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nithipatikom</surname><given-names>K</given-names></name><name><surname>Laabs</surname><given-names>N</given-names></name><name><surname>Isbell</surname><given-names>M</given-names></name><name><surname>Campbell</surname><given-names>W</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Liquid chromatographic–mass spectrometric determination of cyclooxygenase metabolites of arachidonic acid in cultured cells</article-title><source>Journal of Chromatography B</source><volume>785</volume><fpage>135</fpage><lpage>145</lpage><pub-id pub-id-type="doi">10.1016/S1570-0232(02)00906-6</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Noreen</surname><given-names>Y</given-names></name><name><surname>Ringbom</surname><given-names>T</given-names></name><name><surname>Perera</surname><given-names>P</given-names></name><name><surname>Danielson</surname><given-names>H</given-names></name><name><surname>Bohlin</surname><given-names>L</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Development of a radiochemical cyclooxygenase-1 and -2 in vitro assay for identification of natural products as inhibitors of prostaglandin biosynthesis</article-title><source>Journal of Natural Products</source><volume>61</volume><fpage>2</fpage><lpage>7</lpage><pub-id pub-id-type="doi">10.1021/np970343j</pub-id><pub-id pub-id-type="pmid">9461646</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pagliuso</surname><given-names>A</given-names></name><name><surname>Valente</surname><given-names>C</given-names></name><name><surname>Giordano</surname><given-names>LL</given-names></name><name><surname>Filograna</surname><given-names>A</given-names></name><name><surname>Li</surname><given-names>G</given-names></name><name><surname>Circolo</surname><given-names>D</given-names></name><name><surname>Turacchio</surname><given-names>G</given-names></name><name><surname>Marzullo</surname><given-names>VM</given-names></name><name><surname>Mandrich</surname><given-names>L</given-names></name><name><surname>Zhukovsky</surname><given-names>MA</given-names></name><name><surname>Formiggini</surname><given-names>F</given-names></name><name><surname>Polishchuk</surname><given-names>RS</given-names></name><name><surname>Corda</surname><given-names>D</given-names></name><name><surname>Luini</surname><given-names>A</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Golgi membrane fission requires the CtBP1-S/BARS-induced activation of lysophosphatidic acid acyltransferase δ</article-title><source>Nature Communications</source><volume>7</volume><elocation-id>12148</elocation-id><pub-id pub-id-type="doi">10.1038/ncomms12148</pub-id><pub-id pub-id-type="pmid">27401954</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Perdiguero</surname><given-names>E</given-names></name><name><surname>Nebreda</surname><given-names>AR</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Regulation of Cdc25C activity during the meiotic G2/M transition</article-title><source>Cell Cycle</source><volume>3</volume><fpage>733</fpage><lpage>737</lpage><pub-id pub-id-type="pmid">15136768</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pitman</surname><given-names>MR</given-names></name><name><surname>Powell</surname><given-names>JA</given-names></name><name><surname>Coolen</surname><given-names>C</given-names></name><name><surname>Moretti</surname><given-names>PAB</given-names></name><name><surname>Zebol</surname><given-names>JR</given-names></name><name><surname>Pham</surname><given-names>DH</given-names></name><name><surname>Finnie</surname><given-names>JW</given-names></name><name><surname>Don</surname><given-names>AS</given-names></name><name><surname>Ebert</surname><given-names>LM</given-names></name><name><surname>Bonder</surname><given-names>CS</given-names></name><name><surname>Gliddon</surname><given-names>BL</given-names></name><name><surname>Pitson</surname><given-names>SM</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>A selective ATP-competitive sphingosine kinase inhibitor demonstrates anti-cancer properties</article-title><source>Oncotarget</source><volume>6</volume><fpage>7065</fpage><lpage>7083</lpage><pub-id pub-id-type="doi">10.18632/oncotarget.3178</pub-id><pub-id pub-id-type="pmid">25788259</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rekawiecki</surname><given-names>R</given-names></name><name><surname>Kowalik</surname><given-names>MK</given-names></name><name><surname>Kotwica</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Nuclear progesterone receptor isoforms and their functions in the female reproductive tract</article-title><source>Polish Journal of Veterinary Sciences</source><volume>14</volume><fpage>149</fpage><lpage>158</lpage><pub-id pub-id-type="doi">10.2478/v10181-011-0024-9</pub-id><pub-id pub-id-type="pmid">21528728</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ríos-Cardona</surname><given-names>D</given-names></name><name><surname>Ricardo-González</surname><given-names>RR</given-names></name><name><surname>Chawla</surname><given-names>A</given-names></name><name><surname>Ferrell</surname><given-names>JE</given-names><suffix>Jr</suffix></name></person-group><year iso-8601-date="2008">2008</year><article-title>A role for GPRx, A novel GPR3/6/12-related G-protein coupled receptor, in the maintenance of meiotic arrest in <italic>Xenopus laevis</italic> oocytes</article-title><source>Developmental Biology</source><volume>317</volume><fpage>380</fpage><lpage>388</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2008.02.047</pub-id><pub-id pub-id-type="pmid">18381211</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sadler</surname><given-names>SE</given-names></name><name><surname>Maller</surname><given-names>JL</given-names></name></person-group><year iso-8601-date="1981">1981</year><article-title>Progesterone inhibits adenylate cyclase in <italic>Xenopus</italic> oocytes: action on the guanine nucleotide regulatory protein</article-title><source>The Journal of Biological Chemistry</source><volume>256</volume><fpage>6368</fpage><lpage>6373</lpage><pub-id pub-id-type="pmid">7240211</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schorderet-Slatkine</surname><given-names>S</given-names></name><name><surname>Schorderet</surname><given-names>M</given-names></name><name><surname>Baulieu</surname><given-names>EE</given-names></name></person-group><year iso-8601-date="1982">1982</year><article-title>Cyclic AMP-mediated control of meiosis: effects of progesterone, cholera toxin, and membrane-active drugs in <italic>Xenopus laevis</italic> oocytes</article-title><source>PNAS</source><volume>79</volume><fpage>850</fpage><lpage>854</lpage><pub-id pub-id-type="doi">10.1073/pnas.79.3.850</pub-id><pub-id pub-id-type="pmid">6278498</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sindelka</surname><given-names>R</given-names></name><name><surname>Ferjentsik</surname><given-names>Z</given-names></name><name><surname>Jonák</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Developmental expression profiles of <italic>Xenopus laevis</italic> reference genes</article-title><source>Developmental Dynamics</source><volume>235</volume><fpage>754</fpage><lpage>758</lpage><pub-id pub-id-type="doi">10.1002/dvdy.20665</pub-id><pub-id pub-id-type="pmid">16397894</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname><given-names>JL</given-names></name><name><surname>Kupchak</surname><given-names>BR</given-names></name><name><surname>Garitaonandia</surname><given-names>I</given-names></name><name><surname>Hoang</surname><given-names>LK</given-names></name><name><surname>Maina</surname><given-names>AS</given-names></name><name><surname>Regalla</surname><given-names>LM</given-names></name><name><surname>Lyons</surname><given-names>TJ</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Heterologous expression of human mPRalpha, mPRbeta and mPRgamma in yeast confirms their ability to function as membrane progesterone receptors</article-title><source>Steroids</source><volume>73</volume><fpage>1160</fpage><lpage>1173</lpage><pub-id pub-id-type="doi">10.1016/j.steroids.2008.05.003</pub-id><pub-id pub-id-type="pmid">18603275</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tanabe</surname><given-names>H</given-names></name><name><surname>Fujii</surname><given-names>Y</given-names></name><name><surname>Okada-Iwabu</surname><given-names>M</given-names></name><name><surname>Iwabu</surname><given-names>M</given-names></name><name><surname>Nakamura</surname><given-names>Y</given-names></name><name><surname>Hosaka</surname><given-names>T</given-names></name><name><surname>Motoyama</surname><given-names>K</given-names></name><name><surname>Ikeda</surname><given-names>M</given-names></name><name><surname>Wakiyama</surname><given-names>M</given-names></name><name><surname>Terada</surname><given-names>T</given-names></name><name><surname>Ohsawa</surname><given-names>N</given-names></name><name><surname>Hato</surname><given-names>M</given-names></name><name><surname>Ogasawara</surname><given-names>S</given-names></name><name><surname>Hino</surname><given-names>T</given-names></name><name><surname>Murata</surname><given-names>T</given-names></name><name><surname>Iwata</surname><given-names>S</given-names></name><name><surname>Hirata</surname><given-names>K</given-names></name><name><surname>Kawano</surname><given-names>Y</given-names></name><name><surname>Yamamoto</surname><given-names>M</given-names></name><name><surname>Kimura-Someya</surname><given-names>T</given-names></name><name><surname>Shirouzu</surname><given-names>M</given-names></name><name><surname>Yamauchi</surname><given-names>T</given-names></name><name><surname>Kadowaki</surname><given-names>T</given-names></name><name><surname>Yokoyama</surname><given-names>S</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Crystal structures of the human adiponectin receptors</article-title><source>Nature</source><volume>520</volume><fpage>312</fpage><lpage>316</lpage><pub-id pub-id-type="doi">10.1038/nature14301</pub-id><pub-id pub-id-type="pmid">25855295</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tang</surname><given-names>YT</given-names></name><name><surname>Hu</surname><given-names>T</given-names></name><name><surname>Arterburn</surname><given-names>M</given-names></name><name><surname>Boyle</surname><given-names>B</given-names></name><name><surname>Bright</surname><given-names>JM</given-names></name><name><surname>Emtage</surname><given-names>PC</given-names></name><name><surname>Funk</surname><given-names>WD</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>PAQR proteins: a novel membrane receptor family defined by an ancient 7-transmembrane pass motif</article-title><source>Journal of Molecular Evolution</source><volume>61</volume><fpage>372</fpage><lpage>380</lpage><pub-id pub-id-type="doi">10.1007/s00239-004-0375-2</pub-id><pub-id pub-id-type="pmid">16044242</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thomas</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Rapid steroid hormone actions initiated at the cell surface and the receptors that mediate them with an emphasis on recent progress in fish models</article-title><source>General and Comparative Endocrinology</source><volume>175</volume><fpage>367</fpage><lpage>383</lpage><pub-id pub-id-type="doi">10.1016/j.ygcen.2011.11.032</pub-id><pub-id pub-id-type="pmid">22154643</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thomas</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Membrane progesterone receptors (mPRs, PAQRs): review of structural and signaling characteristics</article-title><source>Cells</source><volume>11</volume><elocation-id>1785</elocation-id><pub-id pub-id-type="doi">10.3390/cells11111785</pub-id><pub-id pub-id-type="pmid">35681480</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Valadez-Cosmes</surname><given-names>P</given-names></name><name><surname>Vázquez-Martínez</surname><given-names>ER</given-names></name><name><surname>Cerbón</surname><given-names>M</given-names></name><name><surname>Camacho-Arroyo</surname><given-names>I</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Membrane progesterone receptors in reproduction and cancer</article-title><source>Molecular and Cellular Endocrinology</source><volume>434</volume><fpage>166</fpage><lpage>175</lpage><pub-id pub-id-type="doi">10.1016/j.mce.2016.06.027</pub-id><pub-id pub-id-type="pmid">27368976</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wendler</surname><given-names>A</given-names></name><name><surname>Wehling</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Many or too many progesterone membrane receptors? clinical implications</article-title><source>Trends in Endocrinology and Metabolism</source><volume>33</volume><fpage>850</fpage><lpage>868</lpage><pub-id pub-id-type="doi">10.1016/j.tem.2022.10.001</pub-id><pub-id pub-id-type="pmid">36384863</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yun</surname><given-names>B</given-names></name><name><surname>Lee</surname><given-names>H</given-names></name><name><surname>Powell</surname><given-names>R</given-names></name><name><surname>Reisdorph</surname><given-names>N</given-names></name><name><surname>Ewing</surname><given-names>H</given-names></name><name><surname>Gelb</surname><given-names>MH</given-names></name><name><surname>Hsu</surname><given-names>K-L</given-names></name><name><surname>Cravatt</surname><given-names>BF</given-names></name><name><surname>Leslie</surname><given-names>CC</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Regulation of calcium release from the endoplasmic reticulum by the serine hydrolase ABHD2</article-title><source>Biochemical and Biophysical Research Communications</source><volume>490</volume><fpage>1226</fpage><lpage>1231</lpage><pub-id pub-id-type="doi">10.1016/j.bbrc.2017.06.195</pub-id><pub-id pub-id-type="pmid">28684316</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhu</surname><given-names>Y</given-names></name><name><surname>Rice</surname><given-names>CD</given-names></name><name><surname>Pang</surname><given-names>Y</given-names></name><name><surname>Pace</surname><given-names>M</given-names></name><name><surname>Thomas</surname><given-names>P</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes</article-title><source>PNAS</source><volume>100</volume><fpage>2231</fpage><lpage>2236</lpage><pub-id pub-id-type="doi">10.1073/pnas.0336132100</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zick</surname><given-names>M</given-names></name><name><surname>Stroupe</surname><given-names>C</given-names></name><name><surname>Orr</surname><given-names>A</given-names></name><name><surname>Douville</surname><given-names>D</given-names></name><name><surname>Wickner</surname><given-names>WT</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Membranes linked by trans-SNARE complexes require lipids prone to non-bilayer structure for progression to fusion</article-title><source>eLife</source><volume>3</volume><elocation-id>e01879</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.01879</pub-id><pub-id pub-id-type="pmid">24596153</pub-id></element-citation></ref></ref-list></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92635.3.sa0</article-id><title-group><article-title>eLife Assessment</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Russell</surname><given-names>Darryl L</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution>University of Adelaide</institution><country>Australia</country></aff></contrib></contrib-group><kwd-group kwd-group-type="claim-importance"><kwd>Important</kwd></kwd-group><kwd-group kwd-group-type="evidence-strength"><kwd>Solid</kwd></kwd-group></front-stub><body><p>This <bold>important</bold> study provides <bold>solid</bold> evidence for a non-genomic action of progesterone in <italic>Xenopus</italic> oocyte activation. The findings demonstrate that two non-genomic progesterone receptors, ABHD2 and mPRb, function as a novel progesterone-stimulated phospholipase A2. The findings will be of broad interest to reproductive endocrinologists and physiologists.</p></body></sub-article><sub-article article-type="referee-report" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92635.3.sa1</article-id><title-group><article-title>Reviewer #1 (Public review):</article-title></title-group><contrib-group><contrib contrib-type="author"><anonymous/><role specific-use="referee">Reviewer</role></contrib></contrib-group></front-stub><body><p>Summary:</p><p>Numerous pathways have been proposed to elucidate the nongenomic actions of progesterone within both male and female reproductive tissues. The authors employed the <italic>Xenopus</italic> oocyte system to investigate the PLA2 activity of ABHD2 and the downstream lipid mediators in conjunction with mPRb and P4, on their significance in meiosis. The research has been conducted extensively and is presented clearly.</p><p>Strengths:</p><p>While the interaction between membranous PR and ABHD2 is not a novel concept, this present study exhibits several strengths:</p><p>(1) mPRbeta, a member of the PAQR family, has been elusive in terms of detailed signal transduction. Through mutation studies involving the Zn binding domain, the authors discovered that the hydrolase activity of mPRbeta is not essential for meiosis and oocyte maturation. Instead, they suggest that ABHD2, acting as a coreceptor of mPRbeta, demonstrates phospholipase activity, indicating that downstream lipid mediators may play a dominant role when stimulated by progesterone.</p><p>(2) Extensive exploration of downstream signaling pathways and the identification of several potential meiotic activity-related lipid mediators make this aspect of the study novel and potentially significant.</p><p>Weaknesses:</p><p>However, there are some weaknesses and areas that need further clarification:</p><p>(1) The mechanism governing the molecular assembly of mPRbeta and ABHD2 remains unclear. Are they constitutively associated or is their association ligand-dependent? Does P4 bind not only to mPRbeta but also to ABHD2, as indicated in Figure 6J? In the latter case, the reviewer suggests that the authors conduct a binding experiment using labeled P4 with ABHD2 to confirm this interaction and assess any potential positive or negative cooperativity with a partner receptor.</p><p>(2) The authors have diligently determined the metabolite profile using numerous egg cells. However, the interpretation of the results appears incomplete, and inconsistencies were noted between Figure 2F and Supplementary Figure 2C. Furthermore, PGE2 and D2 serve distinct roles and have different elution patterns by LC-MS/MS, thus requiring separate measurements. In addition, the extremely short half-life of PGI2 necessitates the measurement of its stable metabolite, 6-keto-PGF1a, instead. The authors also need to clarify why they measured PGF1a but not PGF2a. Unfortunately, even in the revision, authors did not adequately address the last issue (differential measurements of PGD2 and E2, 6-keto-PG!alpha be determined instead of PGI2).</p><p>(3) Although they propose PGs, LPA and S1P are important downstream mediators, the exact roles of the identified lipid mediators have not been clearly demonstrated, as receptor expression and activation were not demonstrated. While the authors showed S1PR3 expression and its importance by genetic manipulation, there was no observed change in S1P levels following P4 treatment (Supplementary Figure 2D). It is essential to identify which receptors (subtypes) are expressed and how downstream signaling pathways (PKA, Ca, MAPK, etc.) relate to oocyte phenotypes.</p><p>These clarifications and further experiments would enhance the overall impact and comprehensiveness of the study.</p><p>Comments on revisions:</p><p>Need correction and addition for differential analyses of PGD2 and PGE2, and measurement of 6-keto-PGF1alpha instead of PGI2 (Figure 2F). PGI2 is extremely unstable (T1/2, 1 min in neutral buffer) and rapidly converted nonenzymically to 6-keto-PGF1a.</p></body></sub-article><sub-article article-type="referee-report" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92635.3.sa2</article-id><title-group><article-title>Reviewer #2 (Public review):</article-title></title-group><contrib-group><contrib contrib-type="author"><anonymous/><role specific-use="referee">Reviewer</role></contrib></contrib-group></front-stub><body><p>Summary:</p><p>This interesting paper examines the earliest steps in progesterone-induced frog oocyte maturation, an example of non-genomic steroid hormone signaling that has been studied for decades but is still very incompletely understood. In fish and frog oocytes it seems clear that mPR proteins are involved, but exactly how they relay signals is less clear. In human sperm, the lipid hydrolase ABHD2 has been identified as a receptor for progesterone, and so the authors here examine whether ABHD2 might contribute to progesterone-induced oocyte maturation as well. The main results are:</p><p>(1) Knocking down ABHD2 makes oocytes less responsive to progesterone, and ectopically expressing ABHD2.S (but not the shorter ABHD2.L gene product) partially rescues responsiveness. The rescue depends upon the presence of critical residues in the protein's conserved lipid hydrolase domain, but not upon the presence of critical residues in its acyltransferase domain.</p><p>(2) Treatment of oocytes with progesterone causes a decrease in sphingolipid and glycerophospholipid content within 5 min. This is accompanied by an increase in LPA content and arachidonic acid metabolites. These species may contribute to signaling through GPCRs. Perhaps surprisingly, there was no detectable increase in sphingosine-1-phosphate, which might have been expected given the apparent substantial hydrolysis of sphingolipids. The authors speculate that S1P is formed and contributes to signaling but diffuses away.</p><p>(3) Pharmacological inhibitors of lipid-metabolizing enzymes support, for the most part, the inferences from the lipidomics studies, although there are some puzzling findings. The puzzling findings may be due to uncertainty about whether the inhbitors are working as advertised.</p><p>(4) Pharmacological inhibitors of G-protein signaling support a role for G-proteins and GPCRs in this signaling, although again there are some puzzling findings.</p><p>(5) Reticulocyte expression supports the idea that mPRβ and ABHD2 function together to generate a progesterone-regulated PLA2 activity.</p><p>(6) Knocking down or inhibiting ABHD2 inhibited progesterone-induced mPRβ internalization, and knocking down ABHD2 inhibited SNAP25∆20-induced maturation.</p><p>Strengths:</p><p>All in all, this could be a very interesting paper and a nice contribution. The data add a lot to our understanding of the process, and, given how ubiquitous mPR and AdipoQ receptor signaling appear to be, something like this may be happening in many other physiological contexts.</p><p>Weaknesses:</p><p>I have several suggestions for how to make the main points more convincing.</p><p>Main criticisms:</p><p>(1) The ABHD2 knockdown and rescue, presented in Fig 1, is one of the most important findings. It can and should be presented in more detail to allow the reader to understand the experiments better. E.g.: the antisense oligos hybridize to both ABHD2.S and ABHD2.L, and they knock down both (ectopically expressed) proteins. Do they hybridize to either or both of the rescue constructs? If so, wouldn't you expect that both rescue constructs would rescue the phenotype, since they both should sequester the AS oligo? Maybe I'm missing something here.</p><p>In addition, it is critical to know whether the partial rescue (Fig 1E, I, and K) is accomplished by expressing reasonable levels of the ABHD2 protein, or only by greatly overexpressing the protein. The author's antibodies do not appear to be sensitive enough to detect the endogenous levels of ABHD2.S or .L, but they do detect the overexpressed proteins (Fig 1D). The authors could thus start by microinjecting enough of the rescue mRNAs to get detectable protein levels, and then titer down, assessing how low one can go and still get rescue. And/or compare the mRNA levels achieved with the rescue construct to the endogenous mRNAs.</p><p>Finally, please make it clear what is meant by n = 7 or n = 3 for these experiments. Does n = 7 mean 7 independently lysed oocytes from the same frog? Or 7 groups of, say, 10 oocytes from the same frog? Or different frogs on different days? I could not tell from the figure legends, the methods, or the supplementary methods. Ideally one wants to be sure that the knockdown and rescue can be demonstrated in different batches of oocytes, and that the experimental variability is substantially smaller than the effect size.</p><p>(2) The lipidomics results should be presented more clearly. First, please drop the heat map presentations (Fig 2A-C) and instead show individual time course results, like those shown in Fig 2E, which make it easy to see the magnitude of the change and the experiment-to-experiment variability. As it stands, the lipidomics data really cannot be critically assessed.</p><p>[Even as heat map data go, panels A-C are hard to understand. The labels are too small, especially on the heat map on the right side of panel B. And the 25 rows in panel C are not defined (the legend makes me think the panel is data from 10 individual oocytes, so are the 25 rows 25 metabolites? If so, are the individual oocyte data being collapsed into an average? Doesn't that defeat the purpose of assessing individual oocytes?) And those readers with red-green colorblindness (8% of men) will not be able to tell an increase from a decrease. But please don't bother improving the heat maps; they should just be replaced with more-informative bar graphs or scatter plots.]</p><p>(3) The reticulocyte lysate co-expression data are quite important, and are both intriguing and puzzling. My impression had been that to express functional membrane proteins, one needed to add some membrane source, like microsomes, to the standard kits. Yet it seems like co-expression of mPR and ABHD2 proteins in a standard kit is sufficient to yield progesterone-regulated PLA2 activity. I could be wrong here-I'm not a protein expression expert-but I was surprised by this result, and I think it is critical that the authors make absolutely certain that it is correct. Do you get much greater activities if microsomes are added? Are the specific activities of the putative mPR-ABHD2 complexes reasonable?</p><p>Comments on revisions:</p><p>The authors have satisfied my concerns with their response letter and revisions.</p></body></sub-article><sub-article article-type="referee-report" id="sa3"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92635.3.sa3</article-id><title-group><article-title>Reviewer #3 (Public review):</article-title></title-group><contrib-group><contrib contrib-type="author"><anonymous/><role specific-use="referee">Reviewer</role></contrib></contrib-group></front-stub><body><p>Summary:</p><p>The authors report two P4 receptors, ABHD2 and mPRβ that function as co-receptors to induce PLA2 activity and thus drive meiosis. In their experimental studies, the authors knock down ABHD2 and demonstrated inhibition of oocyte maturation and inactivation of Plk1, MAPK, and MPF, which indicated that ABHD2 is required for P4-induced oocyte maturation. Next, they showed three residues (S207, D345, H376) in the lipase domain that are crucial for ABHD2 P4-mediated oocyte maturation in functional assays. They performed global lipidomics analysis on mPRβ or ABHD2 knockdown oocytes, among which the downregulation of GPL and sphingolipid species were observed and enrichment in LPA was also detected using their metabolomics method. Furthermore, they investigated pharmacological profiles of enzymes predicted to be important for maturation based on their metabolomic analyses and ascertained the central role for PLA2 in inducing oocyte maturation downstream of P4. They showed the modulation of S1P/S1PR3 pathway on oocyte maturation and potential role for or Gαs signaling and potentially Gβγ downstream of P4.</p><p>Strengths:</p><p>The authors make a very interesting finding that ABHD2 has PLA2 catalytic activity but only in the presence of mPRβ and P4. Finally, they provided supporting data for a relationship between ABHD2/PLA2 activity and mPRβ endocytosis and further downstream signaling. Collectively, this research report defines early steps in nongenomic P4 signaling, which is of broad physiological implications.</p><p>Weaknesses:</p><p>There were concerns with the pharmacological studies presented. Many of these inhibitors are used at high (double digit micromolar) concentrations that could result in non-specific pharmacological effects and the authors have provided very little data in support of target engagement and selectivity under the multiple experimental paradigms. In addition, the use of an available ABHD2 small molecule inhibitor was lacking in these studies.</p><p>Comments on revisions:</p><p>In the revised manuscript, the authors have addressed my major concerns.</p></body></sub-article><sub-article article-type="author-comment" id="sa4"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92635.3.sa4</article-id><title-group><article-title>Author response</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Nader</surname><given-names>Nancy</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine Qatar</institution><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff></contrib><contrib contrib-type="author"><name><surname>Assaf</surname><given-names>Lama</given-names></name><role specific-use="author">Author</role><aff><institution>Hamad bin Khalifa University</institution><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff></contrib><contrib contrib-type="author"><name><surname>Zarif</surname><given-names>Lubna</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine Qatar</institution><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff></contrib><contrib contrib-type="author"><name><surname>Halama</surname><given-names>Anna</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine Qatar</institution><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff></contrib><contrib contrib-type="author"><name><surname>Yadav</surname><given-names>Sharan</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine Qatar</institution><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff></contrib><contrib contrib-type="author"><name><surname>Dib</surname><given-names>Maya</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine Qatar</institution><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff></contrib><contrib contrib-type="author"><name><surname>Attarwala</surname><given-names>Nabeel</given-names></name><role specific-use="author">Author</role><aff><institution>University of Chicago</institution><addr-line><named-content content-type="city">Chicago</named-content></addr-line><country>United States</country></aff></contrib><contrib contrib-type="author"><name><surname>Chen</surname><given-names>Qiuying</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine</institution><addr-line><named-content content-type="city">New York</named-content></addr-line><country>United States</country></aff></contrib><contrib contrib-type="author"><name><surname>Suhre</surname><given-names>Karsten</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine Qatar</institution><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff></contrib><contrib contrib-type="author"><name><surname>Gross</surname><given-names>Steven</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine</institution><addr-line><named-content content-type="city">New York</named-content></addr-line><country>United States</country></aff></contrib><contrib contrib-type="author"><name><surname>Machaca</surname><given-names>Khaled</given-names></name><role specific-use="author">Author</role><aff><institution>Weill Cornell Medicine Qatar</institution><addr-line><named-content content-type="city">Doha</named-content></addr-line><country>Qatar</country></aff></contrib></contrib-group></front-stub><body><p>The following is the authors’ response to the original reviews.</p><disp-quote content-type="editor-comment"><p><bold>eLife Assessment:</bold></p><p>“…However, the findings are reliant on high concentrations of inhibitor drugs, and mechanistic details about the molecular interaction and respective functions of ABHD2 and mPRb are incomplete.”</p></disp-quote><p>As discussed below in the response to Reviewers the drug concentrations used span the full dose response of the active range of each drug. In cases where the drug concentrations required to block oocyte maturation where significantly higher than those reported in the literature, we considered those drugs ineffective. In terms of the molecular details of the mechanistic interaction between mPRb and ABHD2, we now provide additional data confirming their molecular interaction to produce PLA2 activity where each protein alone is insufficient. Although these new studies provide more mechanistic insights, there remains details of the ABHD2-mPR interactions that would need to be addressed in future studies which are beyond the scope of the current already extensive study.</p><disp-quote content-type="editor-comment"><p><bold>Public Reviews:</bold></p><p><bold>Reviewer 1</bold></p><p>(1) The mechanism governing the molecular assembly of mPRbeta and ABHD2 remains unclear. Are they constitutively associated or is their association ligand-dependent? Does P4 bind not only to mPRbeta but also to ABHD2, as indicated in Figure 6J? In the latter case, the reviewer suggests that the authors conduct a binding experiment using labeled P4 with ABHD2 to confirm this interaction and assess any potential positive or negative cooperativity with a partner receptor.</p></disp-quote><p>The co-IP experiments presented in Figure 5E argue that the two receptors are constitutively associated at rest before exposure to P4; but at low levels since addition of P4 increases the association between mPRβ and ABHD2 by ~2 folds. Importantly, we know from previous work (Nader et al., 2020) and from imaging experiments in this study that mPR recycles in immature oocytes between the PM and the endosomal compartment. It is not clear at this point within which subcellular compartment the basal association of mPR and ABHD2 occurs. We have tried to elucidate this point but have not been able to generate a functional tagged ABHD2. We generated GFP-tagged ABHD2 at both the N- and C-terminus but these constructs where not functional in terms of their ability to rescue ABHD2 knockdown. This prevented us from testing the association dynamics between ABHD2 and mPR.</p><p>Regarding whether ABHD2 in the oocyte directly binds P4 or not, we had in the initial submission no data directly supporting this rather we based the cartoon in Fig. 6J on the findings from Miller et al. (Science 2016) who showed that ABHD2 in sperm binds biotinylated P4. With the use of a new expression system to produce ABHD2 in vitro (please see below) we were able to try the experiment suggested by the Reviewer. In vitro expressed ABHD2 was incubated with biotinylated P4, and binding tested on a streptavidin column. Under these conditions we could not detect any specific binding of P4 to ABHD2, however, these experiments remain somewhat preliminary and would require validation using additional approaches to conclusively test whether <italic>Xenopus</italic> ABHD2 binds P4 or not. The discrepancy with the Miller et al. findings could be species specific as they tested mammalian ABHD2.</p><disp-quote content-type="editor-comment"><p>(2) The authors have diligently determined the metabolite profile using numerous egg cells. However, the interpretation of the results appears incomplete, and inconsistencies were noted between Figure 2B and Supplementary Figure 2C. Furthermore, PGE2 and D2 serve distinct roles and have different elution patterns by LC-MS/MS, thus requiring separate measurements. In addition, the extremely short half-life of PGI2 necessitates the measurement of its stable metabolite, 6-keto-PGF1a, instead. The authors also need to clarify why they measured PGF1a but not PGF2a.</p></disp-quote><p>We believe the Reviewer meant to indicate discrepancies between Fig. 2E (not 2B) and Supp. Fig. 2C. Indeed, the Reviewer is correct, and this is because Fig. 2E shows pooled normalized data on a per PG species and frog, whereas Supp. Fig. 2E shows and example of absolute raw levels from a single frog to illustrate the relative basal abundance of the different PG species. We had failed to clarify this in the Supp. Fig. 2E figure legend, which we have now added in the revised manuscript. So, the discrepancies are due to variation between different donor animals which is highlighted in Supp. Fig. 2A. Furthermore, to minimize confusion, in the revised manuscript we revised Supp. Fig. 2C to show only PG levels at rest, to illustrate basal levels of the different PG species relative to each other, which is the goal of this supplemental figure.</p><disp-quote content-type="editor-comment"><p>(3) Although they propose PGs, LPA, and S1P are important downstream mediators, the exact roles of the identified lipid mediators have not been clearly demonstrated, as receptor expression and activation were not demonstrated. While the authors showed S1PR3 expression and its importance by genetic manipulation, there was no observed change in S1P levels following P4 treatment (Supplementary Figure 2D). It is essential to identify which receptors (subtypes) are expressed and how downstream signaling pathways (PKA, Ca, MAPK, etc.) relate to oocyte phenotypes.</p></disp-quote><p>We agree conceptually with the Reviewer that identifying the details of the signaling of the different GPCRs involved in oocyte maturation would be interesting. However, our lipidomic data argue that the activation of a PLA2 early in the maturation process in response to P4 leads to the production of multiple lipid messengers that would activate GPCRs and branch out the signaling pathway to activate various pathways required for the proper and timely progression of oocyte maturation. Preparing the egg for fertilization is complex; so, it is not surprising that a variety of pathways are activated simultaneously to properly initiate both cytoplasmic and nuclear maturation to transition the egg from its meiotic arrest state to be ready to support the rapid growth during early embryogenesis. We focus on the S1P signaling pathway specifically because, as pointed out by the Reviewer, we could not detect an increase in S1P even though our metabolomic data collectively argued for an increase. Our results on the S1P pathway -as well as a plethora of other studies historically in the literature that we allude to in the manuscript- argue that these different GPCRs support and regulate oocyte maturation, but they are not essential for the early maturation signaling pathway. For example, for S1P, as shown in Figure 4, the delay/inhibition of oocyte maturation due to S1PR3 knockdown can be reversed at high levels of P4, which presumably leads to higher levels of other lipid mediators that would bypass the need for signaling through S1PR3. This is reminiscent of the kinase cascade driving oocyte maturation where there is significant redundancy and feedback regulation. Therefore, analyzing each receptor subtype that may regulate the different PG species, LPA, and S1P would be a tedious and time-consuming undertaking that goes beyond the scope of the current manuscript. More importantly based on the above arguments, we suggest that findings from such an analysis, similar to the conclusions from the S1PR3 studies (Fig. 4), would show a modulatory role on oocyte maturation rather than a core requirement for the maturation process as observed with mPR and ABHD2. Thus they would provide relatively little insights into the core signaling pathway driving P4-mediated oocyte maturation.</p><disp-quote content-type="editor-comment"><p><bold>Reviewer 2:</bold></p><p>(1) The ABHD2 knockdown and rescue, presented in Fig 1, is one of the most important findings. It can and should be presented in more detail to allow the reader to understand the experiments better. E.g.: the antisense oligos hybridize to both ABHD2.S and ABHD2.L, and they knock down both (ectopically expressed) proteins. Do they hybridize to either or both of the rescue constructs? If so, wouldn't you expect that both rescue constructs would rescue the phenotype since they both should sequester the AS oligo? Maybe I'm missing something here.</p></disp-quote><p>For the ABHD2 rescue experiment, the ABHD2 constructs (S or L) were expressed 48 hrs before the antisense was injected. The experiment was conducted in this way to avoid the potential confounding issue of both constructs sequestering the antisense. The assumption is that the injected RNA after protein expression would be degraded thus allowing the injected antisense to target endogenous ABHD2. The idea is to confirm that ABHD2.S expression alone is sufficient to rescue the antisense knockdown as confirmed experimentally.</p><p>However, to further confirm the rescue, we performed the experiment in a different chronological order, where we started with injecting the antisense to knock down endogenous ABHD2 and this was followed 24 hrs later by expressing wild type ABHD2.S. As shown in Author response image 1 this also rescues the knockdown.</p><fig id="sa4fig1" position="float"><label>Author response image 1.</label><caption><title>ABHD2 knockdown and rescue.</title><p>Oocytes were injected with control antisense (Ctrl AS) or specific ABHD2 antisense (AS) oligonucleotides and incubated at 18 oC for 24 hr. Oocytes were then injected with mRNA to overexpress ABHD.S for 48 hr and then treated with P4 overnight. The histogram shows % GVBD in naïve, oocytes injected with control or ABHD2 antisense with or without mRNA to overexpress ABHD2.S.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-sa4-fig1-v1.tif"/></fig><disp-quote content-type="editor-comment"><p>In addition, it is critical to know whether the partial rescue (Fig 1E, I, and K) is accomplished by expressing reasonable levels of the ABHD2 protein, or only by greatly overexpressing the protein. The author's antibodies do not appear to be sensitive enough to detect the endogenous levels of ABHD2.S or .L, but they do detect the overexpressed proteins (Fig 1D). The authors could thus start by microinjecting enough of the rescue mRNAs to get detectable protein levels, and then titer down, assessing how low one can go and still get rescue. And/or compare the mRNA levels achieved with the rescue construct to the endogenous mRNAs.</p></disp-quote><p>The dose response of ABHD2 protein expression in correlation with rescue of the ABHD2 knockdown is shown indirectly in Figure 1I and 1J. In experiments ABHD2 knockdown was rescued using either the WT protein or two mutants (H120A and N125A). All three constructs rescued ABHD2 KD with equal efficiency (Fig. 1I), eventhough their expression levels varied (Fig. 1J). The WT protein was expressed at significantly higher levels than both mutants, and N125A was expressed at higher levels than H120A (Fig. 1J), note the similar tubulin loading control. Crude estimation of the WBs argues for the WT protein expression being ~3x that of H120A and ~2x that of N125A, yet all three have similar rescue of the ABHD2 knockdown (Fig. 1I). This argues that low levels of ABHD2 expression is sufficient to rescue the knockdown, consistent with the catalytic enzymatic nature of the ABHD2 PLA2 activity.</p><disp-quote content-type="editor-comment"><p>Finally, please make it clear what is meant by n = 7 or n = 3 for these experiments. Does n = 7 mean 7 independently lysed oocytes from the same frog? Or 7 groups of, say, 10 oocytes from the same frog? Or different frogs on different days? I could not tell from the figure legends, the methods, or the supplementary methods. Ideally one wants to be sure that the knockdown and rescue can be demonstrated in different batches of oocytes, and that the experimental variability is substantially smaller than the effect size.</p></disp-quote><p>The n reflects the number of independent female frogs. We have added this information to the figure legends. For each donor frog at each time point 10-30 oocytes were used.</p><disp-quote content-type="editor-comment"><p>(2) The lipidomics results should be presented more clearly. First, please drop the heat map presentations (Fig 2A-C) and instead show individual time course results, like those shown in Fig 2E, which make it easy to see the magnitude of the change and the experiment-to-experiment variability. As it stands, the lipidomics data really cannot be critically assessed.</p><p>[Even as heat map data go, panels A-C are hard to understand. The labels are too small, especially on the heat map on the right side of panel B. The 25 rows in panel C are not defined (the legend makes me think the panel is data from 10 individual oocytes, so are the 25 rows 25 metabolites? If so, are the individual oocyte data being collapsed into an average? Doesn't that defeat the purpose of assessing individual oocytes?) And those readers with red-green colorblindness (8% of men) will not be able to tell an increase from a decrease. But please don't bother improving the heat maps; they should just be replaced with more informative bar graphs or scatter plots.]</p></disp-quote><p>We have revised the lipidomics data as requested by the Reviewer. The Reviewer asked that we show the data as a time course with each individual frog as in Fig. 2E. This turns out to be confusing and not a good way to present the data (please see Author response image 2).</p><fig id="sa4fig2" position="float"><label>Author response image 2.</label><caption><title>Metabolite levels from 5 replicates of 10 oocytes each at each time point were measured and averaged per frog and per time point.</title><p>Fold change was measured as the ratio at the 5- and 30-min time points relative to untreated oocytes (T0). FCs that are not statistically significant are shown as faded. Oocytes with mPR knockdown (KD) are boxed in green and ABHD2-KD in purple.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-sa4-fig2-v1.tif"/></fig><p>We therefore revised the metabolomics data as follow to improve clarity. The changes in the glycerophospholipids and sphingolipids determined on the Metabolon CLP platform (specific for lipids) are now shown as single metabolites clustered at the levels of species and pathways and arranged for the 5- and 30-min time points sequentially on the same heatmap as requested (Fig. 2B). This allows for a quick visual overview of the data that clearly shows the decrease in the lipid species following P4 treatment in the control oocytes and not in the mPR-KD or ABHD2-KD cells (Fig. 2B). The individual species are listed in Supplemental Tables 1 and 2. We also revised the Supplemental Tables to include the values for the non-significant changes, which were omitted from the previous submission.</p><p>We revised the metabolomics data from the HD4 platform in a similar fashion but because the lipid data were complimentary and less extensive than those from the CLP platform, we moved that heatmap to Supplemental Fig. 2B.</p><p>For the single oocyte metabolomics, we now show the data as the correlation between FC and p value, which clearly shows the upregulated (including LPA) and downregulated metabolites at T30 relative to T0 (Fig. 2C). The raw data is now shown in a new Supplemental Table 7.</p><disp-quote content-type="editor-comment"><p>(3) The reticulocyte lysate co-expression data are quite important and are both intriguing and puzzling. My impression had been that to express functional membrane proteins, one needed to add some membrane source, like microsomes, to the standard kits. Yet it seems like co-expression of mPR and ABHD2 proteins in a standard kit is sufficient to yield progesterone-regulated PLA2 activity. I could be wrong here - I'm not a protein expression expert - but I was surprised by this result, and I think it is critical that the authors make absolutely certain that it is correct. Do you get much greater activities if microsomes are added? Are the specific activities of the putative mPR-ABHD2 complexes reasonable?</p></disp-quote><p>We thank the Reviewer for this insightful comment. We agree that this is a critical result that would benefit from cross validation, especially given the low level of PLA2 activity detected in the reticulocyte lysate expression system. We have therefore expanded these studies using another in vitro expression system with microsomal membranes based on tobacco extracts (ALiCECell-Free Protein Synthesis System, Sigma Aldrich) to enhance production and stability of the expressed receptors as suggested by the Reviewer. We further prepared virus-like particles (VLPs) from cells expressing each receptor individually or both receptors together. We however could not detect any PLA2 activity from the VLPs. We thus focused on the coupled in vitro transcription/translation tobacco extracts that allow the expression of difficult-to-produce membrane proteins in microsomes. This kit targets membrane protein directly to microsomes using a microsome targeting melittin signal peptide. This system took significant time and effort to troubleshoot and adapt to mPR and ABHD2 expression. We were however ultimately able to produce significantly higher amounts of both ABHD2 and mPRb, which were readily detected by WBs (Supplemental Fig. 4I). In contrast, we could not reliably detect mPR or ABHD2 using WBs from reticulocyte lysates given the limited amounts produced.</p><p>Similarly to our previous findings with proteins produced in reticulocytes, expression of ABHD2 or mPRβ alone was not associated with an increase in PLA2 activity over a two-hour incubation period (Fig. 5C). It is worth noting here that the tobacco lysates had high endogenous PLA2 activity. However, co-expression of both mPRb and ABHD2 produced robust PLA2 activity that was significantly higher than that detected in reticulocyte lysate system (Fig. 5C). Surprisingly, however this PLA2 activity was P4 independent as it was observed when both receptors are co-expressed in the absence of P4.</p><p>These results validate our earlier conclusion that PLA2 activity requires both mPR and ABHD2, so their interaction in needed for enzymatic activity. It is interesting however that in the tobacco expression system this mPR-ABHD2 PLA2 activity becomes for the most part P4 independent. As the tobacco expression system forces both ABHD2 and mPR into microsomes using a signal sequence, the two receptors are enriched in the same vesicular compartment. As they can interact independently of P4 as shown in the co-IP experiments in immature oocytes (Fig. 5D), their forced co-expression in the same microsomal compartment could lead to their association and thus PLA2 activity. This is an attractive possibility that fits the current data, but would need independent validation.</p><disp-quote content-type="editor-comment"><p><bold>Reviewer 3:</bold></p><p><italic>There were concerns with the pharmacological studies presented. Many of these inhibitors are used at high (double-digit micromolar) concentrations that could result in non-specific pharmacological effects and the authors have provided very little data in support of target engagement and selectivity under the multiple experimental paradigms. In addition, the use of an available ABHD2 small molecule inhibitor was lacking in these studies.</italic></p></disp-quote><p>For the inhibitors used we performed a full dose response to define the active concentrations. So, inhibitors were not used at one high dose. We then compared the EC50 for each active inhibitor to the reported EC50 in the literature (Table 1). The inhibitors were deemed effective only if they inhibited oocyte maturation within the range reported in the literature. This despite the fact that frog oocytes are notorious in requiring higher concentrations of drug given their high lipophilic yolk content, which acts as a sponge for drugs. So our criteria for an effective inhibitor are rather stringent.</p><p>Based on these criteria, only 3 inhibitors were ‘effective’ in inhibiting oocyte maturation: Ibuprofen, ACA and MP-A08 with relative IC50s to those reported in the literature of 0.7, 1.1, and 1.6 respectively. Ibuprofen targets Cox enzymes, which produce prostaglandins. We independently confirmed an increase in PGs in response to P4 in oocytes thus validating the drug inhibitory effect. ACA blocks PLA2 and inhibits maturation, a role supported by the metabolomics analyses that shows decrease in the PE/PE/LPE/LPC species; and by the ABHD2-mPR PLA2 activity following in vitro expression. Finally, MP-A08 blocks sphingosine kinase activity, which role is supported by the metabolomics showing a decrease in sphingosine levels in response to P4; and our functional studies validating a role for the S1P receptor 3 in oocyte maturation.</p><p>As pointed out by the Reviewer, other inhibitors did block maturation at very high concentration, but we do not consider these as effective and have not implicated the blocked enzymes in the early steps of oocyte maturation. To clarify this point, we edited the summary panel (now Fig. 2D) to simplify it and highlight the inhibitors with an effect in the reported range in red and those that don’t inhibit based on the above criteria in grey. Those with intermediate effects are shown in pink. We hope these edits clarify the inhibitors studies.</p><disp-quote content-type="editor-comment"><p><bold>Recommendations For the Authors</bold></p><p><bold>Reviewer 2:</bold></p><p>(1) Introduction, para 1. Please change &quot;mPRs mediated&quot; to &quot;mPR-mediated&quot;.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(2) Introduction, para 2. Please change &quot;cyclin b&quot; to &quot;cyclin B&quot;.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(3) Introduction, para 2. Please change &quot;that serves&quot; to &quot;which serves&quot;.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(4) Introduction, para 4. I know that the authors have published evidence that &quot;a global decrease in cAMP levels is not detectable&quot; (2016), but old work from Maller and Krebs (JBC 1979) did see an early, transient decrease after P4 treatment, and subsequent work from Maller said that there was both a decrease in adenylyl cyclase activity and an increase in cAMP activity. Perhaps it would be better to say something like &quot;early work showed a transitory drop in cAMP activity within 1 min of P4 treatment (Maller), although later studies failed to detect this drop and showed that P4-dependent maturation proceeds even when cAMP is high (25)&quot;.</p></disp-quote><p>We agree and thank the Reviewer for this recommendation. The text was revised accordingly.</p><disp-quote content-type="editor-comment"><p>(5) Results, para 1. Based on the results in Fig 1B, one should probably not assert that ABHD2 is expressed &quot;at levels similar to those of mPRβ in the oocyte&quot;-with different mRNAs and different PCR primers, it's hard to say whether they are similar or not. The RNAseq data from Xenbase in Supp Fig 1 supports the idea that the ABHD2 and mPRβ mRNAs are expressed at similar levels at the message level, although of course mRNA levels and protein levels do not correlate well when different gene products are compared (Wuhr's 2014 Curr Biol paper reported correlation coefficients of about 0.3).</p></disp-quote><p>We agree and have changed the text as follow to specifically point out to RNA: “we confirmed that ABHD2 RNA is expressed in the oocyte at levels similar to those of mPRβ RNA (Fig. 1B).”</p><disp-quote content-type="editor-comment"><p>(6) Results, para 2. It would be worth pointing out that since an 18 h incubation with microinjected antisense oligos was sufficient to substantially knock down both the ABHD2 mRNAs (Fig 1C) and the ectopically-expressed proteins (Fig 1D), the mRNA and protein half-lives must be fairly short, on the order of a few hours or less.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(7) Figure 1. Please make the western blots (especially Fig 1D) and their labeling larger. These are key results and as it stands the labeling is virtually unreadable on printed copies of the figures. I'm not sure about eLife's policy, but many journals want the text in figures to be no smaller than 5-7 points at 100% size.</p><p>Likewise for many of the western blots in subsequent figures.</p></disp-quote><p>As requested by the Reviewer we have increased the font and size of all Western blots in the Figures.</p><disp-quote content-type="editor-comment"><p>(8) Figure 1E, G. I am not sure one should compare the effectiveness of the ABHD2 rescue (Fig 1E) and the mPRβ rescue (Fig 1G). Even if these were oocytes from the same frog, we do not know how the levels of the overexpressed ABHD2 and mPRβ proteins compare. E.g. maybe ABHD2 was highly overexpressed and mPRβ was overexpressed by a tiny amount.</p></disp-quote><p>Although this is a possibility, the expression levels of the proteins here is not of much concern because we previously showed that mPRβ expression effectively rescues mPRβ antisense knockdown which inhibits maturation (please see (Nader et al., 2020)). This argues that at the levels of mRNA injected mPR is functional to support maturation, yet it does not rescue ABHD2 knockdown to the same levels (Fig. 1G). With that it is fair to argue that mPRβ is not as effective at rescuing ABHD2 KD maturation.</p><disp-quote content-type="editor-comment"><p>(9) Inhibitor studies: There are two likely problems in comparing the observed potencies with legacy data - in vitro vs in vivo data and frog vs. mammalian data. Please make it clear what is being compared to what when you are comparing legacy data.</p></disp-quote><p>The legacy data are from the literature based on the early studies that defined the IC50 for inhibition primarily using in vivo models (cell line mostly) but not oocytes. Typically, frog oocytes require significantly higher concentrations of inhibitors to mediate their effect because of the high lipophilic yolk content which acts as a sponge for some drugs. So, the fact that the drugs that are effective in inhibiting oocyte maturation (ACA, MP-A08, and Ibuprofen) work in a similar or lower concentration range to the published IC&lt;sub50 gives us confidence as to the specificity of their effect. We have revised Table 1 to include the reference for each IC&lt;sub50 value from the literature to allow the reader to judge the exact model and context used.</p><disp-quote content-type="editor-comment"><p>(10) Isn't it surprising that Gas seems to promote maturation, given the Maller data (and data from others) that cAMP and PKA oppose maturation (see also the authors' own Fig 1A) and the authors' previous data sees no positive effect (minor point 7 above)?</p></disp-quote><p>We show that a specific Gas inhibitor NF-449 inhibits maturation (although at relatively high concentrations), which is consistent with a positive role for Gas in oocyte maturation. We argue based on the lipidomics data and the inhibitors data that GPCRs play a modulatory role and not a central early signaling role in terms of releasing oocyte meiotic arrest. They are likely to have effects on the full maturation of the egg in preparation for embryonic development. The actions of the multiple lipid messengers generated downstream of mPRβ activation are likely to act through GPCRs and could signal through Gas or other Ga or even through Gβγ. Minor point 7 refers to the size of Western blots.</p><disp-quote content-type="editor-comment"><p>(11) Page 9, bottom: &quot;...one would predict activation of sphingosine kinases....&quot; Couldn't it just be the activity of some constitutively active sphingosine kinase? Maybe replace &quot;activation&quot; with &quot;activity&quot;.</p></disp-quote><p>A constitutively sphingosine kinase activity would not make sense as it needs to be activated by P4.</p><disp-quote content-type="editor-comment"><p>(12) Sometimes the authors refer to concentrations in molar units plus a power of 10 (e.g. 10-5 M) and sometime in µM or nM, sometimes even within the same paragraph. This makes it unnecessarily difficult to compare. Please keep consistent.</p></disp-quote><p>We replaced all the concentrations through the text to M with scientific notation for consistency as requested by the Reviewer.</p><disp-quote content-type="editor-comment"><p>(13) Fig 3I: &quot;Sphingosine kinase&quot; is misspelled.</p></disp-quote><p>This has been corrected. We thank the Reviewer for catching it.</p><disp-quote content-type="editor-comment"><p>(14) Legend to Fig. 5: Please change &quot;after P4 treatment in reticulocytes&quot; to &quot;after P4 treatment in reticulocyte lysates&quot;.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(15) Fig 6J. Doesn't the MAPK cascade inhibit MYT1? I.e. shouldn't the arrow be -| rather than -&gt;?</p></disp-quote><p>Yes the Reviewer is correct. This has been changed. We thank the Reviewer for noticing this error.</p><disp-quote content-type="editor-comment"><p>(16) Materials and Methods, second paragraph. Please change &quot;inhibitor's studies&quot; to &quot;inhibitor studies&quot;.</p></disp-quote><p>Corrected thanks.</p><disp-quote content-type="editor-comment"><p>(17) Table 1: Please be consistent in how you write Cox-2.</p></disp-quote><p>Done.</p><disp-quote content-type="editor-comment"><p><bold>Reviewer #3:</bold></p><p>The findings are of potential broad interest, but I have some concerns with the pharmacological studies presented. Many of these inhibitors are used at high (double-digit micromolar) concentrations that could result in non-specific pharmacological effects and the authors have provided very little data in support of target engagement and selectivity under the multiple experimental paradigms. Importantly, several claims regarding lipid metabolism signaling in the context of oocyte maturation are made without critical validation that the intended target is inactivated with reasonable selectivity across the proteome. Several of the inhibitors used for pharmacology and metabolomics are known covalent inhibitors (JZL184 and MJN110) that can readily bind additional lipases depending on the treatment time and concentration.</p><p>I did not find any data using the reported ABHD2 inhibitor (compound 183; PMID: 31525885). Is there a reason not to include this compound to complement the knockdown studies? I believe this is an important control given that not all lipid effects were reversed with ABHD2 knockdown. The proper target engagement and selectivity studies should be performed with this ABHD2 inhibitor.</p></disp-quote><p>We obtained aliquots the reported ABHD2 inhibitor compound 183 from Dr. Van Der Stelt and tested its effect on oocyte maturation at 10<sup>-4</sup>M using both low (10<sup>-7</sup>M) or high (10<sup>-5</sup>M) P4 concentration. Compound 183 partially inhibited P4-mediated oocyte maturation. The new data was added to the manuscript as Supplemental Figure 3D.</p><disp-quote content-type="editor-comment"><p>Additional comments:</p><p>(1) Pristimerin was tested at low P4 concentration for effects on oocyte maturation. Authors should also test JZL184 and MJN110 under this experimental paradigm.</p></disp-quote><p>We have tested the effect of high concentration (2.10-<sup>-5</sup>M) of JZL184 or MJN110 on oocyte maturation at low P4 concentration (Author response image 3). MJN 110 did not have a prominent effect on oocyte maturation at low P4, whereas JZL184 inhibited maturation by 50%. However, this inhibition of maturation required concentrations of JZL 184 that are 10 times higher than those reported in rat and human cells (Cui et al., 2016; Smith et al., 2015), arguing against an important role for a monoacylglycerol enzymatic activity in inducing oocyte maturation.</p><fig id="sa4fig3" position="float"><label>Author response image 3.</label><caption><title>The effect of MJN110 and JZL184 compounds on oocyte maturation at low P4 concentration.</title><p>Oocytes were pre-treated for 2 hours with the vehicle or with the highest concentration of 2.10-<sup>-5</sup> M for both JZL184 or MJN110, followed by overnight treatment with P4 at 10-<sup>7</sup>M. Oocyte maturation was measured as % GVBD normalized to control oocytes (treated with vehicle) (mean + SEM; n = 2 independent female frogs for each compound).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92635-sa4-fig3-v1.tif"/></fig><disp-quote content-type="editor-comment"><p>1. Figure 4A showed different ct values of ODC between Oocytes and spleen, please explain them in the text. There is not any description regarding spleen information in Figure 4A, please make it clear in the text.</p></disp-quote><p>We thank the Reviewer for this recommendation. The text was revised accordingly.</p><disp-quote content-type="editor-comment"><p>(3) For Figures 3A, E, and I, there are different concentration settings for comparing the activity, is it possible to get the curves based on the same set of concentrations? The concentration gradient didn't include higher concentration points in these figures, thus the related values are incorrect. Please set more concentration points to improve the figures. And for the error bar, there are different display formats like Figure 4c and 4d, etc. Please uniform the format for all the figures. Additionally, for the ctrl. or veh., please add an error bar for all figures.</p></disp-quote><p>Some of the drugs tested were toxic to oocytes at high concentrations so the dose response was adjusted accordingly. The graphs were plotted to encompass the entire tested dose response. We could have plotted the data on the same x-axis range but that would make the figures uneven and awkward.</p><p>We are not clear what the Reviewer means by “The concentration gradient didn't include higher concentration points in these figures, thus the related values are incorrect.”</p><p>The error bars for all dose responses are consistent throughout all the Figures. They are different from those on bar graphs to improve clarity. If the Reviewer wishes to have the error bars on the bar graphs and dose response the same, we are happy to do so.</p><p>For the inhibitor studies the data were normalized on a per frog basis to control for variability in the maturation rate in response to P4, which varies from frog to frog. It is thus not possible to add error bars for the controls.</p><disp-quote content-type="editor-comment"><p>(4) Please check the sentence &quot;However, the concentration of HA130...... higher that......'; Change &quot;IC50&quot; to &quot;IC50&quot; in the text and tables. Table 1 lists IC50 values in the literature, but the references are not cited. Please include the references properly. For the IC50 value obtained in the research, please include the standard deviation in the table. For reference parts, Ref 1, 27, 32, 46, doublecheck the title format.</p></disp-quote><p>We edited the sentence as follows to be more clear: “However, this inhibition of maturation required high concentrations of HA130 -at least 3 orders of magnitude higher that the reported HA130 IC<sub>50</sub>-…”</p><p>We changed IC50 to subscript in Table 1.</p><p>We added the relevant references in Table 1 to provide context for the cited IC50 values for the different inhibitors used.</p><p>We added SEM to the IC<sub>50</sub> for inhibition of oocyte maturation values in Table 1.</p><p>We checked the titles on the mentioned references and cannot identify any problems.</p><p>References</p><p>Cui, Y., Prokin, I., Xu, H., Delord, B., Genet, S., Venance, L., and Berry, H. (2016). Endocannabinoid dynamics gate spike-timing dependent depression and potentiation. eLife <italic>5</italic>, e13185.</p><p>Nader, N., Dib, M., Hodeify, R., Courjaret, R., Elmi, A., Hammad, A.S., Dey, R., Huang, X.Y., and Machaca, K. (2020). Membrane progesterone receptor induces meiosis in <italic>Xenopus</italic> oocytes through endocytosis into signaling endosomes and interaction with APPL1 and Akt2. PLoS Biol <italic>18</italic>, e3000901.</p><p>Smith, M., Wilson, R., O'Brien, S., Tufarelli, C., Anderson, S.I., and O'Sullivan, S.E. (2015). The Effects of the Endocannabinoids Anandamide and 2-Arachidonoylglycerol on Human Osteoblast Proliferation and Differentiation. PloS one <italic>10</italic>, e0136546.</p></body></sub-article></article>