<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD with MathML3 v1.3 20210610//EN"  "JATS-archivearticle1-3-mathml3.dtd"><article xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.3"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic" pub-type="epub">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">92643</article-id><article-id pub-id-type="doi">10.7554/eLife.92643</article-id><article-id pub-id-type="doi" specific-use="version">10.7554/eLife.92643.3</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research Article</subject></subj-group><subj-group subj-group-type="heading"><subject>Developmental Biology</subject></subj-group></article-categories><title-group><article-title>The embryonic role of juvenile hormone in the firebrat, <italic>Thermobia domestica,</italic> reveals its function before its involvement in metamorphosis</article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes" id="author-172134"><name><surname>Truman</surname><given-names>James W</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-9209-5435</contrib-id><email>jwt@uw.edu</email><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-171798"><name><surname>Riddiford</surname><given-names>Lynn M</given-names></name><contrib-id authenticated="true" contrib-id-type="orcid">https://orcid.org/0000-0002-3026-7430</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="fund1"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-335470"><name><surname>Konopova</surname><given-names>Barbora</given-names></name><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-335471"><name><surname>Nouzova</surname><given-names>Marcela</given-names></name><xref ref-type="aff" rid="aff5">5</xref><xref ref-type="other" rid="fund3"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-362598"><name><surname>Noriega</surname><given-names>Fernando G</given-names></name><xref ref-type="aff" rid="aff6">6</xref><xref ref-type="aff" rid="aff7">7</xref><xref ref-type="other" rid="fund2"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-335472"><name><surname>Herko</surname><given-names>Michelle</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/052w21a87</institution-id><institution>Friday Harbor Laboratories, University of Washington</institution></institution-wrap><addr-line><named-content content-type="city">Friday Harbor</named-content></addr-line><country>United States</country></aff><aff id="aff2"><label>2</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/00cvxb145</institution-id><institution>Department of Biology, University of Washington</institution></institution-wrap><addr-line><named-content content-type="city">Seattle</named-content></addr-line><country>United States</country></aff><aff id="aff3"><label>3</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/033n3pw66</institution-id><institution>Department of Zoology, Faculty of Science, University of South Bohemia</institution></institution-wrap><addr-line><named-content content-type="city">Ceske Budejovice</named-content></addr-line><country>Czech Republic</country></aff><aff id="aff4"><label>4</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/05pq4yn02</institution-id><institution>Institute of Entomology, Biology Centre of the Czech Academy of Sciences</institution></institution-wrap><addr-line><named-content content-type="city">Ceske Budejovice</named-content></addr-line><country>Czech Republic</country></aff><aff id="aff5"><label>5</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/05pq4yn02</institution-id><institution>Institute of Parasitology, Biology Centre of the Czech Academy of Sciences</institution></institution-wrap><addr-line><named-content content-type="city">Ceske Budejovice</named-content></addr-line><country>Czech Republic</country></aff><aff id="aff6"><label>6</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/02gz6gg07</institution-id><institution>Department of Biological Sciences and BSI, Florida International University</institution></institution-wrap><addr-line><named-content content-type="city">Miami</named-content></addr-line><country>United States</country></aff><aff id="aff7"><label>7</label><institution-wrap><institution-id institution-id-type="ror">https://ror.org/033n3pw66</institution-id><institution>Department of Parasitology, Faculty of Science, University of South Bohemia</institution></institution-wrap><addr-line><named-content content-type="city">Ceské Budejovice</named-content></addr-line><country>Czech Republic</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Chipman</surname><given-names>Ariel D</given-names></name><role>Reviewing Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/03qxff017</institution-id><institution>The Hebrew University of Jerusalem</institution></institution-wrap><country>Israel</country></aff></contrib><contrib contrib-type="senior_editor"><name><surname>Desplan</surname><given-names>Claude</given-names></name><role>Senior Editor</role><aff><institution-wrap><institution-id institution-id-type="ror">https://ror.org/0190ak572</institution-id><institution>New York University</institution></institution-wrap><country>United States</country></aff></contrib></contrib-group><pub-date publication-format="electronic" date-type="publication"><day>03</day><month>04</month><year>2024</year></pub-date><volume>12</volume><elocation-id>RP92643</elocation-id><history><date date-type="sent-for-review" iso-8601-date="2023-09-26"><day>26</day><month>09</month><year>2023</year></date></history><pub-history><event><event-desc>This manuscript was published as a preprint.</event-desc><date date-type="preprint" iso-8601-date="2023-10-13"><day>13</day><month>10</month><year>2023</year></date><self-uri content-type="preprint" xlink:href="https://doi.org/10.1101/2023.10.06.561279"/></event><event><event-desc>This manuscript was published as a reviewed preprint.</event-desc><date date-type="reviewed-preprint" iso-8601-date="2023-11-21"><day>21</day><month>11</month><year>2023</year></date><self-uri content-type="reviewed-preprint" xlink:href="https://doi.org/10.7554/eLife.92643.1"/></event><event><event-desc>The reviewed preprint was revised.</event-desc><date date-type="reviewed-preprint" iso-8601-date="2024-02-22"><day>22</day><month>02</month><year>2024</year></date><self-uri content-type="reviewed-preprint" xlink:href="https://doi.org/10.7554/eLife.92643.2"/></event></pub-history><permissions><copyright-statement>© 2023, Truman et al</copyright-statement><copyright-year>2023</copyright-year><copyright-holder>Truman et al</copyright-holder><ali:free_to_read/><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><ali:license_ref>http://creativecommons.org/licenses/by/4.0/</ali:license_ref><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife-92643-v1.pdf"/><self-uri content-type="figures-pdf" xlink:href="elife-92643-figures-v1.pdf"/><abstract><p>To gain insights into how juvenile hormone (JH) came to regulate insect metamorphosis, we studied its function in the ametabolous firebrat, <italic>Thermobia domestica</italic>. Highest levels of JH occur during late embryogenesis, with only low levels thereafter. Loss-of-function and gain-of-function experiments show that JH acts on embryonic tissues to suppress morphogenesis and cell determination and to promote their terminal differentiation. Similar embryonic actions of JH on hemimetabolous insects with short germ band embryos indicate that JH’s embryonic role preceded its derived function as the postembryonic regulator of metamorphosis. The postembryonic expansion of JH function likely followed the evolution of flight. Archaic flying insects were considered to lack metamorphosis because tiny, movable wings were evident on the thoraces of young juveniles and their positive allometric growth eventually allowed them to support flight in late juveniles. Like in <italic>Thermobia</italic>, we assume that these juveniles lacked JH. However, a postembryonic reappearance of JH during wing morphogenesis in the young juvenile likely redirected wing development to make a wing pad rather than a wing. Maintenance of JH then allowed wing pad growth and its disappearance in the mature juvenile then allowed wing differentiation. Subsequent modification of JH action for hemi- and holometabolous lifestyles are discussed.</p></abstract><kwd-group kwd-group-type="author-keywords"><kwd>juvenile hormone</kwd><kwd>ecdysone</kwd><kwd>myoglianin</kwd><kwd>metamorphosis</kwd><kwd>differentiation</kwd><kwd>precocene</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Other</kwd><kwd>Thermobia domestica</kwd></kwd-group><funding-group><award-group id="fund1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000011</institution-id><institution>Howard Hughes Medical Institute</institution></institution-wrap></funding-source><award-id>Gift to UW</award-id><principal-award-recipient><name><surname>Truman</surname><given-names>James W</given-names></name><name><surname>Riddiford</surname><given-names>Lynn M</given-names></name></principal-award-recipient></award-group><award-group id="fund2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000002</institution-id><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>R21 AI167849</award-id><principal-award-recipient><name><surname>Noriega</surname><given-names>Fernando G</given-names></name></principal-award-recipient></award-group><award-group id="fund3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001824</institution-id><institution>Czech Science Foundation</institution></institution-wrap></funding-source><award-id>22-21244S</award-id><principal-award-recipient><name><surname>Nouzova</surname><given-names>Marcela</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>This sesquiterpene hormone likely acted as a morphogenesis-to-differentiation switch in archaic embryos before it evolved its postembryonic function as the <italic>status quo</italic> regulator of insect metamorphosis.</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>publishing-route</meta-name><meta-value>prc</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Insects first appeared about 400 mya as a group of direct developing arthropods whose hatchlings were miniature versions of the adult except that they lacked the sexual specializations needed for reproduction. Starting from this ametabolous life history, insects underwent series of developmental innovations that resulted in their becoming the dominant meso-sized group of animals in most terrestrial and freshwater environments. The first life history change followed the evolution of wings and powered flight (<xref ref-type="bibr" rid="bib57">Kukalova-Peck, 1978</xref>; <xref ref-type="bibr" rid="bib10">Belles, 2019</xref>). In this hemimetabolous pattern, the hatchling lacked wings as well as genitalia, and these developed as immobile pads during juvenile growth and transformed into functional structures during the molt to the adult. The subsequent step from this ‘incomplete metamorphosis’ to complete metamorphosis involved a redirection of embryogenesis to produce a modified larval form that was adapted to feeding and growth. The transition to the adult form then occurred through a transitional stage, the pupa, thereby establishing the three-part life history diagnostic of the ‘complete metamorphosis’ exhibited by holometabolous insects (reviews: <xref ref-type="bibr" rid="bib12">Belles, 2020b</xref>; <xref ref-type="bibr" rid="bib49">Jindra, 2019</xref>; <xref ref-type="bibr" rid="bib98">Truman and Riddiford, 2002</xref>; <xref ref-type="bibr" rid="bib100">Truman and Riddiford, 2019</xref>). Classically, juvenile hemimetabolous stages were called nymphs and juvenile holometabolous stages were called larvae. Although this terminology is somewhat controversial, we will use it throughout this paper.</p><p>The sesquiterpene hormone, juvenile hormone (JH), is the ‘gate-keeper’ for metamorphosis. Both nymphs and larvae depend on it to maintain their respective forms (<xref ref-type="bibr" rid="bib47">Jindra et al., 2013</xref>; <xref ref-type="bibr" rid="bib48">Jindra et al., 2015</xref>). JH has two essential functions: it is required at the start of an ecdysteroid-induced molt to maintain the insect in its current stage (<xref ref-type="bibr" rid="bib85">Riddiford, 1976</xref>), and its presence during intermolt periods ensures that imaginal discs and primordia remain dormant and do not begin premature morphogenesis to the adult stage (<xref ref-type="bibr" rid="bib99">Truman et al., 2006</xref>). Besides its function of suppressing metamorphosis, JH is also involved in shaping polymorphisms such as those seen in the castes of social insects (<xref ref-type="bibr" rid="bib73">Nijhout and Wheeler, 1982</xref>).</p><p>The role of JH in the two ametabolous orders, the Archaeognatha (jumping bristletails) and the Zygentoma (silverfish), is poorly understood. In the latter order, JH is involved in egg production in the adult firebrat <italic>Thermobia domestica</italic> (<xref ref-type="bibr" rid="bib15">Bitsch et al., 1985</xref>), but the only JH-related action seen in the juvenile is the suppression of scale appearance by JH application during the molt from the third to the fourth juvenile stage (<xref ref-type="bibr" rid="bib107">Watson, 1967</xref>). In crustaceans, the immediate precursor to JH, methyl farnesoate (MF), regulates ovarian maturation (<xref ref-type="bibr" rid="bib60">Laufer et al., 1998</xref>). Since insects and other Hexapoda (i.e. Collembola, Protura and Diplura) evolved from crustaceans (<xref ref-type="bibr" rid="bib83">Regier et al., 2005</xref>; <xref ref-type="bibr" rid="bib106">von Reumont et al., 2012</xref>), it has been thought that MF and JH may have originally functioned in regulating reproduction and only later became involved in development as insect life histories became more complex (<xref ref-type="bibr" rid="bib35">Goodman and Granger, 2005</xref>).</p><p>Although JH treatment only mildly effects postembryonic development in <italic>Thermobia</italic> (<xref ref-type="bibr" rid="bib107">Watson, 1967</xref>)<italic>,</italic> it can severely derange embryonic development (<xref ref-type="bibr" rid="bib88">Rohdendorf and Sehnal, 1973</xref>). These severe embryonic effects in an ametabolous insect suggest that the JH may initially had been an embryonic hormone and later moved into the postembryonic realm to support more complex life histories.</p><p>Our study of the JH titer in <italic>Thermobia</italic> shows that the highest concentrations of the hormone occur during late embryogenesis. By a detailed examination of the effects of chemicals that mimic the natural JH or block its production, respectively, we find that JH is necessary for the terminal differentiation and maturation of embryonic tissues. Associated with promoting differentiation, JH also is a potent suppressor of morphogenesis. A comparison of these embryonic functions in <italic>Thermobia</italic> with corresponding functions in embryos from basal hemimetabolous orders indicates that the ability of JH to switch embryonic tissues from morphogenesis to terminal differentiation was in place before the appearance of flight and of metamorphosis. The development of wings and of complex insect life histories involved the reappearance of morphogenesis during postembryonic growth. In hemimetabolous insects postembryonic morphogenesis was principally related to wing development, but in the Holometabola it involved the deferred building of the adult body plan. We think that JH reappeared in the postembryonic domain of these juveniles as a counterforce to morphogenesis so that the latter was suppressed during most of juvenile growth. The disappearance of JH then allowed morphogenesis and the subsequent formation of the adult after growth was completed.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>The time-course of embryogenesis in <italic>Thermobia</italic></title><p>The embryogenesis of <italic>Thermobia domestica</italic> is summarized in <xref ref-type="fig" rid="fig1">Figure 1</xref>. At 37 °C, the time from egg deposition to hatching is about 11.5 days. A developmental timetable was constructed using 12 hr egg collections and determining the distribution of developmental stages at half day intervals from the midpoint of each collection window (see Methods). Ages are given in days after egg laying (# d AEL). As with insects from the other ametabolous order (the Archaeognatha), <italic>Thermobia</italic> embryos undergo short germ band development (<xref ref-type="bibr" rid="bib50">Jura, 1972</xref>). An embryonic rudiment forms at the posterior pole of the egg and consists of head and thoracic segments with a terminal growth zone. As abdominal segments are progressively specified, the ventral midline invaginates into the yolk causing the abdomen to fold onto itself, thereby opposing the ventral surfaces of the anterior and posterior segments (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). By about 1.5 d AEL, the embryo is evident as a cleared area at the posterior pole of the egg, and by a half day later abdomen formation is finished, and appendage buds are appearing. The dorsal surface of the embryo is open to the yolk and the embryo has an overall S-shape (<xref ref-type="fig" rid="fig1">Figure 1A</xref>).</p><fig id="fig1" position="float"><label>Figure 1.</label><caption><title>Timeline of <italic>Thermobia domestica</italic> embryogenesis at 37 °C.</title><p>(<bold>A</bold>) Diagrammatic representations of important events in embryogenesis. In the segmenting germ band, the arrow indicates the invagination of the mid-abdominal region into the yolk. By the onset of katatrepsis (<xref ref-type="bibr" rid="bib78">Panfilio, 2008</xref>), dorsal closure along the abdomen (red arrow) has moved the abdomen ventrally (solid black arrow) and the contraction of the serosa pulls the sides of the embryo towards the anterior pole (dashed black arrows). After katatrepsis the expanding lateral edges of the embryo displace cells of the amnion, gradually zipping up the dorsal thoracic midline (red arrow) until definitive dorsal closure is accomplished. (<bold>B</bold>) Summary of the progression of embryonic development at various times after egg deposition. The interception of each stage with the 50% line (dashed) is the basis for the embryonic timeline in (<bold>C</bold>). EEF: extraembryonic fluid. (<bold>C</bold>) Timeline of embryonic development based on (<bold>B</bold>). Micrographs show the appearance of embryos at the indicated times; first and last embryos are covered by the egg chorion. White triangle: progression of dorsal closure; red triangle: eye pigmentation; blue triangle: expanded cerci after shedding of the E1 cuticle. Times of cuticle deposition based on <xref ref-type="bibr" rid="bib55">Konopová and Zrzavý, 2005</xref>.</p><p><supplementary-material id="fig1sdata1"><label>Figure 1—source data 1.</label><caption><title>The percent of embryos attaining a particular developmental ‘milestone’ as a function of the time after egg laying at 37 °C.</title><p>Age of each sample calculated from the midpoint of its 12 hr egg collection.</p></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-92643-fig1-data1-v1.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig1-v1.tif"/></fig><p>The embryo then begins ‘zipping up’ its dorsal midline starting at the end of the abdomen. The dorsal closure of the abdomen pushes the abdominal tip ventrally and forward as the embryo and its yolk assume a ‘comma’ shape. Growing appendage buds have reached about a third of their final length by this time. Extraembryonic membranes growing up from the lateral sides of the embryo envelop the yolk mass and then, during katatrepsis, they contract to pull the head of the embryo towards the anterior pole, and the embryo rotates to achieve a C-shape. The enclosure of the yolk by the extraembryonic membranes defines provisional dorsal closure. The embryo then begins rapid morphogenetic growth and cell determination. During this phase of organogenesis, the lateral margins of the embryonic thorax extend dorsally to completely enclose the yolk at definitive dorsal closure (about 7.5 d AEL). Having reached its full size, the embryo then undergoes terminal differentiation and maturation over the next 4 days.</p><p>Embryogenesis is accompanied by two bouts of cuticle production. The first embryonic (E1) cuticle is deposited after the formation of the segmented germ band. It contains little chitin (see below) and has a fibrous structure (<xref ref-type="bibr" rid="bib54">Klag, 1978</xref>; <xref ref-type="bibr" rid="bib55">Konopová and Zrzavý, 2005</xref>) which presumably allows it to stretch to accommodate subsequent embryonic growth. The second embryonic (E2) cuticle starts to be deposited around dorsal closure as the embryo reaches its full size. The E2 procuticle has the lamellar structure (<xref ref-type="bibr" rid="bib55">Konopová and Zrzavý, 2005</xref>) typical of most insect cuticles (<xref ref-type="bibr" rid="bib71">Neville, 1975</xref>) and serves as the cuticle of the first juvenile (J1) stage. This cuticle is shed a day after hatching with the start of the J2 stage. Feeding begins in the J3 stage.</p></sec><sec id="s2-2"><title>JH and ecdysteroid titers during embryogenesis of <italic>Thermobia domestica</italic></title><p>As in most insects, <italic>Thermobia</italic> produces JH III (<xref ref-type="bibr" rid="bib7">Baker et al., 1984</xref>). Using the liquid chromatography-mass spectrometric method of <xref ref-type="bibr" rid="bib82">Ramirez et al., 2020</xref>, we measured JH III levels during <italic>Thermobia</italic> embryogenesis at daily intervals starting at 5 d AEL and extending through hatching and the first 10 days of postembryonic life (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). Detectable levels of JH III were found at 6 d AEL, and the titer slowly ramped up until an abrupt peak on days 10 and 11. After hatching, JH III fell to low, but detectable, levels through the start of the J4 stage.</p><fig id="fig2" position="float"><label>Figure 2.</label><caption><title>Titers of hormones and hormone related gene transcripts during embryogenesis of <italic>Thermobia domestica.</italic></title><p>(<bold>A</bold>) Titer of juvenile hormone III (JH-III) during the last 60% of embryogenesis and the first eight days of juvenile life. The timing of various milestones of embryonic development are noted for this panel and those below. ecd: ecdysis; J#: start of second, third and fourth juvenile instars. (<bold>B</bold>) The ecdysteroid titer in 20-hydroxyecdysone (20E) equivalents during embryogenesis and the first six days of juvenile life. Dark bars indicate the approximate time of deposition of the first embryonic (EC1) epicuticle and procuticle, and the second (EC2) embryonic cuticle (based on <xref ref-type="bibr" rid="bib55">Konopová and Zrzavý, 2005</xref>). epi: epicuticle deposition, pro: procuticle deposition. (<bold>C</bold>) The relative levels of transcripts of the JH receptor, <italic>Methoprene-tolerant</italic> (<italic>Met</italic>), the JH response gene <italic>Krüppel homolog 1</italic> (<italic>Kr-h1</italic>), and the TGF-β family member <italic>Myoglianin</italic> (<italic>Myo</italic>) based on real-time PCR of timed embryos. Expression of each gene is related to the 12 hr timepoint which is given the value of 1. Each bar shows the mean (+/-S.D.) for three biological replicats.</p><p><supplementary-material id="fig2sdata1"><label>Figure 2—source data 1.</label><caption><title>Age of samples extracted for Juvenile Hormone III measurements.</title><p>Age of samples from midpoint of 12 hr egg collections. E: embryonic age; J: age of juvenile; n.d.: below range of detectability.</p></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-92643-fig2-data1-v1.docx"/></supplementary-material></p><p><supplementary-material id="fig2sdata2"><label>Figure 2—source data 2.</label><caption><title>Age of samples extracted for ecdysteroid measurements (given as 20 hydroxyecdysone equivalents).</title><p>Age of samples from midpoint of 12 hr egg collections. Hatching occurred at 11.5 days after egg laying (AEL).</p></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-92643-fig2-data2-v1.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig2-v1.tif"/></fig><p>Ecdysteroid titers through embryogenesis and the early juvenile instars were measured using the enzyme immunoassay method (<xref ref-type="bibr" rid="bib80">Porcheron et al., 1989</xref>). As seen in <xref ref-type="fig" rid="fig2">Figure 2B</xref>, there was a shallow, transient rise in ecdysteroid from 2.5 to 4 d AEL, associated with the time of deposition of the E1 cuticle (<xref ref-type="bibr" rid="bib55">Konopová and Zrzavý, 2005</xref>). A prominent peak of 20 hydroxyecdysone (20E) then occurred around the time of dorsal closure, coordinated with the production of the E2 cuticle, and another 20E peak occurred just before hatching. We assume that this late embryonic peak is responsible for producing the J2 cuticle. The subsequent ecdysis to the J3 stage is preceded by an increase in 20E 1–2 days earlier.</p><p><xref ref-type="fig" rid="fig2">Figure 2C</xref> summarizes the expression of some endocrine-related transcripts. Using real-time PCR (and the comparative Ct method; <xref ref-type="bibr" rid="bib90">Schmittgen and Livak, 2008</xref>), we measured transcript levels at half-day intervals through the first half of embryogenesis and then at daily intervals thereafter. Transcripts for the JH receptor, <italic>Methoprene-tolerant</italic> (<italic>Met</italic>), appeared around the time of segmented germ band formation and extended through dorsal closure. <italic>Met</italic> transcript levels declined when the JH III titer spiked. <italic>Krüppel homolog 1</italic> (<italic>Kr-h1</italic>) is a highly conserved gene that is induced by JH (<xref ref-type="bibr" rid="bib56">Konopova et al., 2011</xref>; <xref ref-type="bibr" rid="bib92">Smykal et al., 2014</xref>; <xref ref-type="bibr" rid="bib11">Belles, 2020a</xref>; <xref ref-type="bibr" rid="bib41">He and Zhang, 2022</xref>). Low levels of <italic>Kr-h1</italic> transcripts were present at 12 hr after egg deposition, but then were not detected until about 6 d AEL when JH-III first appeared. A spike in <italic>Kr-h1</italic> transcripts coincided with the JH III peak at the end of embryogenesis. Myoglianin (myo) is a member of the Transforming Growth Factor-β (TGF-β) family of morphogens (<xref ref-type="bibr" rid="bib102">Upadhyay et al., 2017</xref>). Its appearance in the last larval or nymphal instar suppresses JH production (<xref ref-type="bibr" rid="bib46">Ishimaru et al., 2016</xref>; <xref ref-type="bibr" rid="bib51">Kamsoi and Belles, 2019</xref>; <xref ref-type="bibr" rid="bib40">He et al., 2020</xref>) and is essential for the onset of metamorphosis. Myo also acts on some target tissues in the last larval instar to make them competent to initiate metamorphosis (<xref ref-type="bibr" rid="bib5">Awasaki et al., 2011</xref>). <italic>Myo</italic> transcripts appeared in <italic>Thermobia</italic> after formation of the segmented germ band. They peaked during the major phase of embryonic growth, and then were low after definitive dorsal closure.</p></sec><sec id="s2-3"><title>Effects of suppression of the late embryonic peak of JH</title><p>To examine the role of embryonic JH (<xref ref-type="fig" rid="fig2">Figure 2A</xref>), we treated embryos with 7-ethoxyprecocene (7EP), a drug that suppresses JH production (<xref ref-type="bibr" rid="bib17">Bowers and Martinez-Pardo, 1977</xref>; <xref ref-type="bibr" rid="bib1">Aboulafia-Baginsky et al., 1984</xref>). As seen in <xref ref-type="fig" rid="fig3">Figure 3A</xref>, treatment of young juvenile <italic>Thermobia</italic> with 7EP markedly suppressed their production of JH III. Also, application of 7EP to embryos at 6 d AEL, prior to the onset of JH secretion, prevented the appearance of <italic>Kr-h1</italic> transcripts, but the latter could then be induced by treatment with 1 ng of pyriproxyfen, a JH mimic (JHm) (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). Therefore, 7EP is effective in suppressing JH synthesis in <italic>Thermobia</italic>.</p><fig id="fig3" position="float"><label>Figure 3.</label><caption><title>The effects of suppression of JH production on the embryonic development of <italic>Thermobia</italic>.</title><p>(<bold>A</bold>) Compared with solvent alone (Control), treatment of stage 2 juveniles with 7-ethoxyprecocene (7EP) resulted in a &gt;75% reduction in JH-III levels as measured on the day after application. (<bold>B</bold>) The effect treating embryos at 6 d AEL with the cyclohexane solvent (blue) or 1 μg 7EP (orange) on their subsequent expression of <italic>Kr-</italic>h1, <italic>Met</italic>, and <italic>myo</italic> over the next 3 days as revealed by real-time PCR. Sub-groups of 7EP treated embryos were treated with 1 ng JHm at 7 d and measured over the next 2 days (green). Significant differences determined by t-test: *=p &lt; 0.05; **=p &lt; 0.01; ***=p &lt; 0.001. Numbers above columns indicate fold upregulation (upward arrow) or downregulation (downward arrow) of the two hormone treatments relative to cyclohexane control, or to the effect of JHm rescue to 7EP treated embryos. Each based on three biological replicates. (<bold>C</bold>) A group of 20 embryos were treated with cyclohexane (black) or 1 μg 7EP (red) and their subsequent development monitored until hatching. Both groups started eye pigmentation at the same time, but resorption of the extraembryonic fluid and hatching were suppressed in the 7EP group. The latter two events were restored by treating embryos with the 1 ng JHm at 8.5 d AEL (green). (<bold>D</bold>) Confocal sections of the dorsal view of embryos treated as in ‘C’ and examined at the time of hatching of the controls. 7EP treatment prevented extension of the foregut (fg) and crop (c) and the posterior displacement of the midgut (mg). Normal gut development was restored with JHm treatment at 8.5d. br: brain; muscle (green); propidium iodide staining (red). (<bold>E</bold>) Pseudo-transmitted light and confocal sections showing cuticle and nuclei of the eye region of 10 d embryos that had been treated with cyclohexane (control) or 7EP at 5 d AEL. A subset of the latter was then given JHm on day 7.5. Control and JHm-treated embryos show local apolysis of the eye cuticle and expansion of the depth of the eye due to growth of the rhabdoms; embryos treated with 7EP alone failed to show this growth. PI: propidium iodide stain,+trans: pseudo transmitted light. (<bold>F</bold>) The relationship of the final phenotypes of embryos to the time of their treatment with 1 μg of 7EP. Arrows indicate the normal timing of the event. EEF: extraembryonic fluid.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig3-v1.tif"/></fig><p>Initially, embryos were treated with 1 μg of 7EP at 3.5 d AEL and monitored daily to track features of development that could be viewed through the eggshell (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). Solvent control and 7EP-treated embryos acquired eye pigment and underwent dorsal closure (not shown) at the same time, but the 7EP group failed to resorb their extraembryonic fluid and did not hatch. Fluid resorption and hatching was rescued when these embryos were treated with JHm shortly after dorsal closure.</p><p>Dissection of the 7EP-treated embryos showed that they usually did not shed their E1 cuticle or expand their E2 cuticle. After dorsal closure, the foregut normally lengthens as the midgut is displaced posteriorly to the anterior abdomen, but these events did not occur after the 7EP treatment (<xref ref-type="fig" rid="fig3">Figure 3D</xref>). In the case of the developing eye, the various ommatidial cell types are present and recognizable by dorsal closure and assume their mature configuration by hatching. Also, by hatching the distal most cells in each ommatidium have detached from their overlying cuticle in preparation for making the cuticular lenses of the J2 stage. Ommatidial maturation and cuticle detachment did not occur after 7EP treatment (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). However, the normal maturation of both the eye and the midgut was seen after subsequent application of JHm (<xref ref-type="fig" rid="fig3">Figure 3D and E</xref>).</p><p>Sensitivity to the suppression of JH synthesis by 7EP treatment did not end in an all-or-none fashion (<xref ref-type="fig" rid="fig3">Figure 3F</xref>). Development up through dorsal closure was unaffected, regardless of time of 7EP treatment, resorption of the extraembryonic fluid was suppressed by treatment up until about 8 d, and hatching was blocked until about 9 d AEL. This progressive loss of the effectiveness of suppressing JH biosynthesis suggests that JH does not provide a phasic signal, but rather acts tonically through the end of embryogenesis to support terminal differentiation and hatching.</p><p><xref ref-type="fig" rid="fig4">Figure 4A</xref> shows that the timing of JHm application was essential for rescuing the developmental block imposed by 7EP. Embryos given 7EP on 3.5 d AEL were then treated with JHm (1 ng of pyriproxyfen) at various days thereafter, and their subsequent time of fluid resorption and hatching determined. The embryos of the group treated on 6.5 d AEL were prior to definitive dorsal closure, and all failed to complete this process. Day 7.5 AEL is about the midpoint for embryos undergoing definitive dorsal closure (<xref ref-type="fig" rid="fig1">Figure 1</xref>) and half of the treated group failed to complete dorsal closure while the remainder subsequently resorbed their extraembryonic fluid and hatched. Essentially all the 7EP-treated embryos given JHm on 8.5 d and 9.5 d AEL also showed fluid resorption and hatching. Importantly, the time of fluid resorption and hatching was time-locked to the time of JHm treatment (<xref ref-type="fig" rid="fig4">Figure 4A and B</xref>). The 7.5 d AEL group hatched a day earlier than untreated controls, the 8.5 d group hatched the same day as controls, and the 9.5 d group hatched one day later.</p><fig id="fig4" position="float"><label>Figure 4.</label><caption><title>Time-course of the rescue of 7EP-imposed developmental arrest by treatment with JHm.</title><p>(<bold>A</bold>) Groups of about 20 embryos were treated with cyclohexane (controls) or 1 µg 7EP at d3.5 AEL and then monitored daily for the time of reabsorption of the extraembryonic fluid and hatching. The vertical dashed lines indicate the 50% time for these two developmental events in the control group. Replicate groups were also given JHm (1 ng pyriproxyfen) at the indicated times and their development followed to hatching. (<bold>B</bold>) Summary of the timing of resorption of the extraembryonic fluid (EEF, white bars) and of hatching (black bars) for 7EP-treated embryos, whose development was rescued by JHm treatment at the indicated times.</p><p><supplementary-material id="fig4sdata1"><label>Figure 4—source data 1.</label><caption><title>The progression of embryonic development of embryos treated with solvent or 7-ethoxyprecocene (7EP) at 3.5 days of development.</title><p>Developmental rescue was attempted by subsequent treatment with a juvenile hormone mimic (pyriproxyfen) at the indicated developmental time thereafter. air: air appears between embryo and eggshell because of resorption of extraembryonic fluid; eye: appearance of eye pigment. Percent values are based on surviving embryos. *: these embryos blocked before dorsal closure because of the early timing of treatment with pyriproxyfen.</p></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-92643-fig4-data1-v1.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig4-v1.tif"/></fig><p>Manipulation of JH levels affected the production of <italic>Kr-h1</italic> transcripts. Suppression of JH production also blocked induction of <italic>Kr-h1</italic>, while application of JHm to blocked embryos reinstated elevated <italic>Kr-h1</italic> expression (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). Transcripts for <italic>Met</italic>, the JH receptor, show a mild down-regulation when JH III appears late in embryogenesis (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). This down-regulation was blunted by suppression of JH synthesis, but then enhanced by application of a JHm. Compared to their peak abundance at mid-embryogenesis, levels of <italic>myo</italic> transcripts were quite low going into the terminal stages of embryogenesis (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). These levels were largely unaffected by late manipulations of JH (<xref ref-type="fig" rid="fig3">Figure 3B</xref>).</p></sec><sec id="s2-4"><title>Effects of early treatment with juvenile hormone</title><p><xref ref-type="bibr" rid="bib88">Rohdendorf and Sehnal, 1973</xref> first showed that treating <italic>Thermobia</italic> embryos with natural JHs and a wide array of synthetic analogs produced a range of embryonic deformities. We initially tested the effectiveness of JH III and its precursor, methyl farnesoate (MF), as well as three commonly used JH mimics, methoprene, hydroprene, and pyriproxyfen (<xref ref-type="bibr" rid="bib36">Goodman and Cusson, 2012</xref>). When applied at 3 d AEL, all produced a full range of embryonic abnormalities, depending on dosage (data not shown). Between the naturally occurring compounds, JH III was about eightfold more potent than MF, with an ED<sub>50</sub> for topical application of 60 ng/egg while MF had an ED<sub>50</sub> of 480 ng/egg. The synthetic JH mimics were about 100 times more potent than JH III. We used pyriproxyfen (referred to as JHm) for all the following studies. The JH receptor has a higher affinity for pyriproxyfen than for JH III or methoprene (<xref ref-type="bibr" rid="bib22">Charles et al., 2011</xref>; <xref ref-type="bibr" rid="bib48">Jindra et al., 2015</xref>).</p><p><xref ref-type="fig" rid="fig5">Figure 5</xref> examines the response of embryos to treatment with different doses of JHm at 1.5 d AEL, when the forming germ band is first evident at the posterior pole of the egg. Embryos were then dissected and scored at 4.5d AEL, about a day after the normal completion of katatrepsis. Embryos treated with the highest doses of JHm (1–10 ng/egg) always formed a complete segmented germ band, with its appendage buds. However, the embryos retained a S-shaped posture and stayed at the posterior pole of the egg. They remained open dorsally from the head to the end of the abdomen and subsequent growth was suppressed. The cells of the amnion did not extend to enclose the yolk and these embryos often later sunk back into the yolk. Despite their early arrest, though, they secreted a cuticle over their ventral epidermis (chitin staining in <xref ref-type="fig" rid="fig5">Figure 5B</xref>).</p><fig id="fig5" position="float"><label>Figure 5.</label><caption><title>The response of <italic>Thermobia</italic> embryos to various doses of the JH mimic pyriproxyfen.</title><p>(<bold>A</bold>) Cartoon showing the time of JHm treatment versus the time of dissection. (<bold>B</bold>) Lateral projections of confocal stacks showing the appearance of typical embryos three days after treatment with the indicated dosage of pyriproxyfen. Embryos were stained for DNA (magenta) and chitin (green). The embryos were dissected away from the yolk which caused disruption in the dorsal thoracic and head regions of some embryos. (<bold>C</bold>) Micrograph of an embryo arrested in mid-katatrepsis. During its envelopment of the yolk, the contraction of the amnion segregated the yolk (y) from the embryo which hangs in the ventral half of the egg. t: thorax, a: abdomen.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig5-v1.tif"/></fig><p>Embryos exposed to intermediate doses of JHm (0.3–0.03 ng pyriproxyfen) were able to subsequently ‘zip up’ the dorsal midline of their abdomen, which pushed the end of the abdomen ventrally and forward, causing the embryo to assume a ‘comma’ shape just prior to the start of katatrepsis. Subsequent morphogenesis of the head and thorax, though, was suppressed. Chitin-rich cuticle covered the abdomen and the ventral epidermis of the head and thorax. In many cases, the amnion failed to subsequently spread dorsally to enclose the yolk. Sometimes the amnion enclosed the yolk, but the lateral margins of the embryo were not pulled with it so that the yolk ended up as a rounded dorsal lobe with the embryo hanging ventrally in a fluid-filled space (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). Embryos treated with lowest doses of JHm (0.01–0.001 ng pyriproxyfen) underwent normal katatrepsis and their amnion spread to cover the yolk to establish provisional dorsal closure.</p><p>The terminal phenotypes of embryos also varied with the time of JHm treatment (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). Application to eggs within 12 hr of oviposition was problematic because the cyclohexane-treated controls also showed significant lethality. With older embryos, though, treatment with the solvent alone did not interfere with subsequent development. <xref ref-type="fig" rid="fig6">Figure 6B</xref> tracks the development of groups of embryos treated with 1 ng pyriproxyfen at various days of embryogenesis and shows that the ability to complete successive ‘milestones’ of development depended on the time of JHm treatment. These developmental milestones lost sensitivity to JHm in the order in which they normally appeared, but the latency between loss of sensitivity and occurrence of the respective event varied (<xref ref-type="fig" rid="fig6">Figure 6C</xref>). For example, katatrepsis was blocked by JHm until shortly before the process began, but the ability to suppress production of the eye screening pigment, by contrast, was lost 2 days before the pigment normally appeared. In <italic>Thermobia</italic>, as in other insects (<xref ref-type="bibr" rid="bib34">Friedrich, 2006</xref>), the eye primordium makes ommatidia progressively starting at its posterior border. The eye primordium is early in this process at 3.5d AEL, with only the most posterior ommatidia being determined (<xref ref-type="fig" rid="fig6">Figure 6D</xref>). Embryos treated at this time subsequently showed screening pigment only in this posterior part of the eye associated with a few proto-ommatidial clusters (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). When JH application was delayed by 1 day, the full primordium had been determined by the time of treatment and a full eye was formed with all its ommatidial clusters (<xref ref-type="fig" rid="fig6">Figure 6F</xref>). Thus, JH does not block pigment formation per se, but rather it blocks the prior determination of the cell type that will make the pigment. Once determined, these cells subsequently produce pigment regardless of the presence or absence of JH. In the production of the much larger eye of embryos of the locust, <italic>Schistocerca gregaria,</italic> early exposure to JHm similarly arrested the progression of the eye morphogenetic furrow. It also caused the premature maturation of the ommatidia cell types posterior to the furrow (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>).</p><fig-group><fig id="fig6" position="float"><label>Figure 6.</label><caption><title>The response of <italic>Thermobia</italic> embryos to 1 ng JHm given at different times through embryogenesis.</title><p>(<bold>A</bold>) Examples of the terminal phenotypes of embryos resulting from JHm treatment at the indicated times [days after egg laying (AEL)]. Yolk was dissected away from the first three embryos. The remaining embryos had undergone provisional dorsal closure with the amnion enclosing the yolk mass. (<bold>B</bold>) Graph showing when each developmental ‘milestone’ was no longer suppressed by JHm treatment. (<bold>C</bold>) Comparison of when developmental milestones were no longer suppressed by JHm (based on <xref ref-type="fig" rid="fig1">Figure 1B</xref>) versus their normal time of occurrence. Red triangle in micrograph shows first appearance of eye pigment. (<bold>D</bold>) Confocal image of actin staining showing the state of patterning of the eye primordium at katatrepsis. The morphogenetic furrow (mf) had just started and had organized only the first few posterior ommatidia. (<bold>E, F</bold>). Lateral confocal and pseudo transmitted light images of the eye region of 7.5 d embryos that had been treated with JHm at (<bold>E</bold>) 3.5 d or (<bold>F</bold>) 4.5 d AEL. In (<bold>E</bold>) eye patterning arrested early resulting in only 3–4 proto-ommatidial clusters forming in the posterior margin of the eye primordium. In (<bold>F</bold>) the entire eye primordium was patterned. Yellow dots identify the center of each forming ommatidium. The insets below show various Z depths of the boxed cluster in the merged image, with ‘0 μ’ being at the surface. Nuclei of identifiable ommatidial cell types can only be recognized in (<bold>F</bold>). c: quartet of crystalline cone cells, p: crescent-shaped nuclei of the paired cells that secrete the cuticular lens.</p><p><supplementary-material id="fig6sdata1"><label>Figure 6—source data 1.</label><caption><title>The relationship of the time of treatment with a JH mimic (1 ng pyriproxyfen) to when embryonic development subsequently stalled.</title><p>EEF: extraembryonic fluid; pre-dorsal closure was evident by dorsal closure to the neck region, but the posterior head capsule had not fully formed.</p></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-92643-fig6-data1-v1.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig6-v1.tif"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><label>Figure 6—figure supplement 1.</label><caption><title>Confocal images showing the effects of treatment of day 1 <italic>Schistocerca gregaria</italic> embryos with a JHm (pyriproxyfen) versus cyclohexane (control).</title><p>Confocal images show eye primordia of embryos stained with fluorescent phalloidin at various times in development showing the progression of ommatidia formation in the wake of the morphogenetic furrow (white arrow). By 50% of embryogenesis the furrow and posterior margin are no longer in the same plane of focus because of the pronounced curvature of the eye; the image has been shifted to accommodate the rows of posterior ommatidia missing from the image. The morphogenetic furrow arrests by 45% in the JHm treated embryos and the posterior rows of ommatidia show autofluorescence due to the premature appearance of screening pigment around each ommatidium. Bottom: at 45% of embryogenesis, premature pigment expression (yellow triangle) is evident in the eye of the JHm treated embryo but not in the control. an: antenna, e: eye, la: labrum, m: mandible. Red dashed line is the posterior border of the developing eye.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig6-figsupp1-v1.tif"/></fig></fig-group><p>Exogenous JHm no longer arrested subsequent development if given after about 6 d AEL (<xref ref-type="fig" rid="fig6">Figure 6B and C</xref>). This time is just before definitive dorsal closure and subsequent appearance of endogenous JH. Shortly after katatrepsis the amnion encloses the yolk at provisional dorsal closure and these amnion cells are gradually replaced by the sides of the embryo until the latter fully enclose the yolk about 3.5 days later. JHm treatment at any time in this interval arrested further replacement. Without successful dorsal closure, the terminal events of fluid resorption and hatching did not occur. The last two events require JH but only after dorsal closure has been completed (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p><p>The effect JH on embryonic growth was assessed by treating embryos with JHm at 1.5 d AEL and then using phosphohistone H3 (pHH3; <xref ref-type="bibr" rid="bib43">Hendzel et al., 1997</xref>) expression to measure the mitotic activity in limb buds (<xref ref-type="fig" rid="fig7">Figure 7A and B</xref>). At 2.5 d AEL the limb buds of control and treated embryos were of similar size and showed similar levels of pHH3 expression (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). All control embryos completed katatrepsis. Their numbers of pHH3 positive cells peaked between 4.5 d and 5.5 d AEL, when their limbs had achieved their full length, and then declined. JHm-treated embryos, by contrast, varied in whether they completed katatrepsis. At 3.5 d AEL, most of the JHm-treated embryos showed numbers of pHH3 + cells like those seen in controls, although two showed a marked reduction. By 4.5 d AEL, all JHm-treated embryos showed a mitotic frequency that was only 10–15% of that of controls (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). Mitosis in their limbs remained low through subsequent development.</p><fig id="fig7" position="float"><label>Figure 7.</label><caption><title>Effects of early JHm treatment on growth and patterning of the limbs.</title><p>(<bold>A</bold>). Z-stack projections showing the lateral view of embryos that were treated with either cyclohexane (Control) or 1 ng of pyriproxyfen in cyclohexane (JHm) on d1.5 AEL and then dissected and stained on the indicated developmental days. Propidium iodide (PI) (magenta) shows nuclei and anti-phosphohistone H3 (pHH3; green) shows dividing cells. The JHm series follows a subset of embryos that did not undergo katatrepsis (bottom) and a subset that did (middle). (<bold>B</bold>). Summary of the number of pHH3-positive cells in the developing limb buds of JHm and solvent-treated embryos through time. Each dot records the average number of pHH3-positive cells /limb from a single embryo. (<bold>C</bold>). Projected Z-stack through the limb of a JHm-treated embryos that did not undergo katatrepsis. The leg produced a robust cuticle (green; gray scale image) but then started necrosis as illustrated by the highly condensed PI-positive bodies (yellow triangles) in the distal leg. (<bold>D</bold>). The time course of necrosis in the limbs of control and JHm-treated embryos. Necrosis was pronounced in embryos that failed katatrepsis (<bold>F</bold>) but rather mild in those that completed katatrepsis (<bold>K</bold>). (<bold>E</bold>). Levels of hormone-related transcripts in embryos treated at 2.5 d AEL with solvent alone (blue bars) or JHm (1 ng pyriproxyfen; pink) and then examined over the following two days. The expression is related to that on the day of treatment (2.5 d; grey) which was set as 1. <italic>Kruppel homolog 1</italic> (<italic>Kr-h1</italic>), <italic>Methoprene tolerant</italic> (<italic>Met</italic>), <italic>myoglianin</italic> (<italic>myo</italic>). Significant differences determined by t-test: *=p &lt; 0.05; **=p &lt; 0.01; ***=p &lt; 0.001. Numbers above columns indicate fold upregulation (upward arrow) or downregulation (downward arrow) relative to cyclohexane control. Each based on three biological replicates. (<bold>F</bold>). Confocal images showing Distal-less (Dll) immunostaining at various times after treatment of embryos at 2 d AEL with solvent (<bold>C</bold>) or JHm. Embryos are shown from ventral view at 22 hr post-treatment, and then from lateral view thereafter. t: first thoracic leg.</p><p><supplementary-material id="fig7sdata1"><label>Figure 7—source data 1.</label><caption><title>The effects of early treatment with a JH mimic (1 ng pyriproxyfen) on the subsequent proliferative activity in the embryonic limb buds indicated by the number of limb cells expressing phosphohistone H3 (pPH3).</title><p>N is the number of embryos scored for each treatment.</p></caption><media mimetype="application" mime-subtype="docx" xlink:href="elife-92643-fig7-data1-v1.docx"/></supplementary-material></p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig7-v1.tif"/></fig><p>As summarized in <xref ref-type="fig" rid="fig7">Figure 7C and D</xref>, early JHm treatment sometimes evoked necrosis in the growing limb buds. Necrotic bodies, consisting of highly compacted DNA, were rarely seen in controls at 4.5 d and 5.5 d AEL. JHm-treated embryos that completed katatrepsis also showed few, if any, necrotic bodies, but those that arrested before or during katatrepsis exhibited moderate to heavy necrosis (<xref ref-type="fig" rid="fig7">Figure 7D</xref>). In the most severe cases, the limb degenerated. Limb loss in such embryos was often stochastic, that is<italic>,</italic> in a given embryo some limbs were lost while others were maintained in a reduced state. We saw no segmental pattern as to which limbs were maintained and which were lost.</p><p>The treatment at 2.5 d AEL with JHm also affected the expression of <italic>Kr-h1, Met</italic>, and <italic>myo</italic> (<xref ref-type="fig" rid="fig7">Figure 7E</xref>). As expected from their postembryonic relationship in other insects (<xref ref-type="bibr" rid="bib48">Jindra et al., 2015</xref>), exposure to JHm-induced strong <italic>Kr-h1</italic> expression and suppressed <italic>Met</italic> transcripts. For embryonic <italic>myo</italic>, transcript levels are highest (<xref ref-type="fig" rid="fig2">Figure 2C</xref>) during the time of peak proliferation as assessed by mitotic activity in the limb buds (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). JHm treatment at 2.5d AEL resulted in a small depression of <italic>myo</italic> transcripts at 3.5 d AEL, but severely suppressed transcript levels by 4.5 d AEL (<xref ref-type="fig" rid="fig7">Figure 7E</xref>). These effect of early JHm treatment on <italic>myo</italic> expression paralleled its effect on mitotic activity in the limb bud (<xref ref-type="fig" rid="fig7">Figure 7B</xref>).</p><p>Early treatment with JHm also interrupted the proximal-distal patterning of the limb. Limb bud formation requires the expression of <italic>distal-less</italic> (<italic>dll</italic>) at the tip of the growing bud (<xref ref-type="bibr" rid="bib23">Cohen and Jürgens, 1989</xref>; <xref ref-type="bibr" rid="bib79">Panganiban and Rubenstein, 2002</xref>). Up through the entry into katatrepsis, the growing limb buds of JHm-treated and control embryos showed similar expression of Dll (<xref ref-type="fig" rid="fig5">Figure 5F</xref>). As leg development progresses, recruitment of additional proximal-distal patterning genes resolves Dll expression into a ‘sock and band’ pattern (e.g. <xref ref-type="bibr" rid="bib4">Angelini and Kaufman, 2005</xref>; <xref ref-type="bibr" rid="bib89">Schaeper et al., 2013</xref>) as intermediate leg regions become specified. The JHm-treated embryos in <xref ref-type="fig" rid="fig7">Figure 7F</xref> were ones that did not complete katatrepsis and they did not further refine their Dll expression. Dll immunostaining was eventually lost and their limbs degenerated. The JHm-treated embryos that completed katatrepsis, by contrast, maintained legs that were shortened but subdivided into coxa, femur, tibia, <italic>etc</italic>. We assume that the latter embryos had progressed far enough through their proximal-distal patterning program before the JHm-induced arrest to produce a stable leg that then maintained its integrity. An earlier arrest of the leg patterning program, however, appears to be insufficient to maintain the limb.</p></sec><sec id="s2-5"><title>The effects of JHm on cellular differentiation</title><p>While early JHm treatment suppressed growth, patterning, and cell determination, it also induced premature cellular differentiation as illustrated by forming muscles (<xref ref-type="fig" rid="fig8">Figure 8</xref>). In control embryos (<xref ref-type="fig" rid="fig8">Figure 8C</xref>), longitudinal muscle fibers become evident on 4.5 d AEL as thin bands of tissue that show weak, uniform staining for actin (as revealed by binding of fluorescent-phalloidin). The growing muscles increase in width over the next two days and their actin staining concentrates at the intersegmental boundaries where the developing muscle fibers attach to tendon cells. The appearance of myofibrils with their repeating sarcomeres becomes evident by 7.5 d AEL, but such embryos, dissected from the eggshells, showed neither spontaneous nor induced movements. By a day later, the embryos often showed weak, spontaneous movements when removed from the egg and their muscles have well-developed striations (<xref ref-type="fig" rid="fig8">Figure 8C</xref>, 8.5d). Embryos treated with JHm at 1.5 d AEL, by contrast, showed accelerated muscle differentiation (<xref ref-type="fig" rid="fig8">Figure 8D and E</xref>). These embryos formed myofibrils by 4.5 d AEL regardless of whether or not the embryo completed katatrepsis (<xref ref-type="fig" rid="fig8">Figure 8D and E</xref>). Those that completed katatrepsis showed subsequent muscle growth, whereas those that failed katatrepsis showed little further growth.</p><fig id="fig8" position="float"><label>Figure 8.</label><caption><title>The effects of JHm in inducing early differentiation of <italic>Thermobia</italic> embryos.</title><p>(<bold>A</bold>) Schematic showing the time of treatment with solvent or 1 ng pyriproxyfen (JHm) at 1.5 d AEL and the subsequent times of dissection and staining of the embryos. (<bold>B</bold>) Quantitation of the effects of JHm treatment on the appearance of striated myofibrils in the developing embryonic muscles. Myofibrils normally appear around the time of definitive dorsal closure, but JHm treatment at 1.5 d AEL advances their appearance by three days. Numbers are embryos examined per point. (<bold>C–E</bold>). Confocal optical sections showing F-actin staining in developing longitudinal muscles of control (<bold>C</bold>) and JHm-treated (<bold>D, E</bold>) embryos that were examined at the indicated days AEL. Yellow triangles indicate striations of the myofibrils. Insets show low power views of embryos with the magnified region boxed. green: F-actin shown by phalloidin binding, red: propidium iodide. JHm-treated examples are embryos that underwent katatrepsis (<bold>D</bold>) and ones that failed to complete katatrepsis (<bold>E</bold>).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig8-v1.tif"/></fig><p>Early JHm treatment also affected cuticle production. In <italic>Thermobia</italic>, the epicuticle layer of the E1 cuticle is secreted after germ band formation but prior to the start of katatrepsis (<xref ref-type="fig" rid="fig1">Figure 1</xref>; <xref ref-type="bibr" rid="bib55">Konopová and Zrzavý, 2005</xref>). A fibrous procuticle is deposited after katatrepsis and covers the embryo through its period of rapid growth and dorsal closure. Chitin staining, using Calcofluor White (<xref ref-type="bibr" rid="bib38">Harrington and Hageage, 2003</xref>), showed no chitin in the E1 epicuticle (as expected; <xref ref-type="fig" rid="fig9">Figure 9A</xref>, 3.5 d AEL), and only faint chitin staining of the procuticle (<xref ref-type="fig" rid="fig9">Figure 9A</xref>, 4.5–7.5 d AEL), indicating that the latter is relatively poor in chitin fibers. Strong chitin staining comes with the deposition of the E2 procuticle on 8.5 d AEL. The latter shows a lamellar ultrastructure (<xref ref-type="bibr" rid="bib54">Klag, 1978</xref>; <xref ref-type="bibr" rid="bib55">Konopová and Zrzavý, 2005</xref>), which arises from the helical deposition of chitin fibers as seen in typical insect procuticles (<xref ref-type="bibr" rid="bib71">Neville, 1975</xref>; <xref ref-type="bibr" rid="bib105">Vincent, 1980</xref>). Like controls, embryos treated with JHm at 1.5 d had no chitin in their E1 epicuticle (<xref ref-type="fig" rid="fig9">Figure 9B</xref>, 3.5 d AEL) but their E1 procuticle (<xref ref-type="fig" rid="fig9">Figure 9B</xref>, 4.5 d AEL) showed enhanced chitin staining. These JHm-treated embryos deposited their E2 cuticle at least a day early (<xref ref-type="fig" rid="fig9">Figure 9B</xref>, 7.5 d AEL).</p><fig id="fig9" position="float"><label>Figure 9.</label><caption><title>Effects of 1 ng pyriproxyfen (JHm) on the production of E1 and E2 cuticles.</title><p>(<bold>A, B</bold>) Projected confocal Z-stacks of embryos treated with solvent (Control) or JHm at 1.5 d AEL and showing chitin staining of the developing legs at various times thereafter. The insets are propidium iodide (PI) staining of the same stack to show the form of the limbs on each day. In both groups no chitin was evident at 3.5 d AEL, when only epicuticle is present (dots are due to surface debris). In control embryos, the procuticle of the first embryonic cuticle (EC1) (starting at 4.5 d AEL) stains weakly for chitin, while the second embryonic cuticle (EC2) shows strong chitin staining (8.5d). JHm-treated embryos show enhanced chitin staining of their EC1 and they produce their EC2 a day early as demonstrated by the presence of cuticular hairs (white triangles). All cuticle images were made with the same laser power and gain. (<bold>C</bold>) Lateral view of a 5.5 d embryo that failed to undergo katatrepsis after JHm treatment at 1.5 d AEL. The E1 cuticle covering its ventral surface shows enhanced chitin staining. The arrow shows the plane of the transverse image on the right; the ventromedial region of the embryo is still invaginated into the yolk. PI: propidium iodide staining. Dotted line is the midline. (<bold>D, E</bold>) Projected confocal Z-stacks of 10 d AEL embryos showing the E2 cuticle produced by controls (<bold>D</bold>) or by embryos treated with JHm at 4.5 d AEL. The cuticle of the control embryo (<bold>D</bold>) has a pebbly surface sculpturing, an egg tooth (blue triangle) but lacks cuticular eye lenses (red triangle). The JHm-treated embryo produced a cuticle typical of later stages. It is smooth, lacks an egg tooth, and has formed thickened, but abnormal, cuticular lenses (red triangle). md: mandible.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig9-v1.tif"/></fig><p>The JHm-treated embryos depicted in <xref ref-type="fig" rid="fig9">Figure 9B</xref> were ones that completed katatrepsis. <xref ref-type="fig" rid="fig9">Figure 9C</xref> shows a treated embryo that failed to undergo katatrepsis, but it still secreted an E1 cuticle along its ventral surface. This cuticle also had enhanced chitin staining. The chitin-rich E1 cuticle produced in the presence of JHm is more rigid than the normal E1 cuticle. Indeed, control embryos proceeding into katatrepsis are quite delicate and easily disrupted during egg dissections, but JH-treated embryos of the same age are much more resistant to mechanical damage. As discussed below, the rigidity of the modified E1 cuticle may interfere with these embryos undergoing subsequent growth and changes in form.</p><p>JHm treatment before deposition of the E2 cuticle also changed the nature of this cuticle. As seen in <xref ref-type="fig" rid="fig9">Figure 9D</xref>, the E2 (=J1) cuticle has pebbly surface sculpturing, an egg tooth, and lacks cuticular lenses for its ommatidia. JHm treatment at 4.5 d AEL, though, redirects the epidermis to make a cuticle more like that of the J2 stage. The cuticle lacks the egg tooth and surface pebbling characteristic of the E2 stage but attempts to form J2-like cuticular lenses (<xref ref-type="fig" rid="fig9">Figure 9E</xref>). Thus, as in embryos of locusts (<xref ref-type="bibr" rid="bib97">Truman and Riddiford, 1999</xref>) and crickets (<xref ref-type="bibr" rid="bib29">Erezyilmaz et al., 2004</xref>), the presence of JH at the outset of the E2 molt causes the embryo to skip ahead to make cuticle characteristic of the next instar.</p><p>Overall, then, embryonic development of <italic>Thermobia</italic> becomes sensitive to exogenous JH around the time that the E1 cuticle is being produced. JH treatment suppresses subsequent morphogenesis and cell determination but promotes developmental programs characteristic of the late phases of embryogenesis.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><sec id="s3-1"><title>The role of JH in embryogenesis of <italic>Thermobia domestica</italic></title><p>JH appears in <italic>Thermobia</italic> embryos after definitive dorsal closure (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). At this point the embryo has completely enclosed the yolk mass and its final size is set. Morphogenetic growth is completed, the E2 cuticle that will be covering the hatchling is being induced, and developmental programs have shifted to tissue differentiation and terminal maturation. These latter processes are JH dependent (<xref ref-type="fig" rid="fig10">Figure 10A</xref>) and do not occur if JH is absent (<xref ref-type="fig" rid="fig3">Figures 3</xref> and <xref ref-type="fig" rid="fig4">4</xref>).</p><fig id="fig10" position="float"><label>Figure 10.</label><caption><title>Comparison of responses of short germ band embryos to JH.</title><p>(<bold>A</bold>) Summary of the developmental responses of <italic>Thermobia domestica</italic> embryos to JH. Exogenous JH has little or no developmental effect up through germ band formation. Embryonic development is then altered by JH treatment starting just before deposition of the first embryonic (<bold>E1</bold>) cuticle, but endogenous JH does not appear until around definitive dorsal closure, when it is needed for terminal differentiation. (<bold>B, C</bold>) Photomicrographs of embryos of <italic>Thermobia</italic> (<bold>B</bold>) and of <italic>Schistocerca gregaria</italic> (<bold>C</bold>) comparing the size and morphology of a control embryo at definitive dorsal closure with a clutch mate that had been treated with JHm the day after oviposition (+JH). (<bold>D, E</bold>) Schematic summary of embryonic development of <italic>Thermobia</italic> (<bold>D</bold>) and <italic>Schistocerca</italic> (<bold>E</bold>) comparing the time of ecdysteroid surges and the onset of JH sensitivity with the time course of embryogenesis. The black bar shows the time of progressive patterning of the eye primordium. Eye patterning begins <bold>before</bold> <italic>Schistocerca</italic> embryos become sensitive to JH, but <bold>after</bold> <italic>Thermobia</italic> embryos become JH sensitive. Consequently, treatment with JHm (red) a day after oviposition results in <italic>Schistocerca</italic> embryos with tiny eyes but <italic>Thermobia</italic> embryos lack eyes all together. The times of ecdysteroids in the locust are based on data from <italic>Locusta migratoria</italic> (<xref ref-type="bibr" rid="bib58">Lagueux et al., 1979</xref>).</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig10-v1.tif"/></fig><p>While loss-of-function experiments, which remove JH, produce one type of abnormal development, gain-of-function experiments, involving the providing of JH when it should be absent, produce a different, but complementary, range of abnormalities. As originally reported by <xref ref-type="bibr" rid="bib88">Rohdendorf and Sehnal, 1973</xref>, JHm treatment of <italic>Thermobia</italic> embryos results in a diversity of arrested phenotypes that ranged down to minute embryos that lacked limbs and eyes (as in <xref ref-type="fig" rid="fig10">Figure 10B</xref>). The alteration of development by JHm treatment was first evident when the embryo was producing its E1 procuticle. For the developing limb bud, premature exposure to JHm inhibited cell division (<xref ref-type="fig" rid="fig7">Figure 7A and B</xref>) and arrested proximal-distal patterning (<xref ref-type="fig" rid="fig7">Figure 7F</xref>). If arrest was early enough in the patterning process, the limb bud was not stable and began degeneration despite having deposited a modified E1 cuticle (<xref ref-type="fig" rid="fig7">Figure 7C</xref>). The effects of premature JH exposure were well illustrated for the eye (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). JH had to be absent during the time when the morphogenetic furrow was moving over the eye primordium (<xref ref-type="fig" rid="fig6">Figure 6D–F</xref>). Premature exposure to JHm stopped furrow movement; the cells behind the furrow maintained their determination and made ommatidia cell types, but those in front of the furrow remained undetermined. As summarized in <xref ref-type="fig" rid="fig6">Figure 6C</xref>, then, many tissues and cell types are determined during the period from the segmented germ band to definitive dorsal closure, and exposure to JHm during this period generated a diversity of phenotypes that reflected the state of embryogenesis when the JHm was applied. Some tissues, like the eye could survive an arrest in early patterning and simply made a small, partial eye (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). Other tissues like the leg bud, though, were apparently unstable if patterning was arrested too early and subsequently degenerated.</p><p>Importantly, premature exposure to JH does not just simply arrest development. Rather, it shifts cells into differentiative programs characteristic of late embryogenesis. Such a shift to later developmental programs by JHm is evident in <italic>Thermobia</italic> in the precocious appearance of myofibrils in developing muscle (<xref ref-type="fig" rid="fig8">Figure 8D and E</xref>), and in the production of late cuticle types by the epidermis (<xref ref-type="fig" rid="fig9">Figure 9B</xref>). Similarly, for eye development in <italic>Schistocerca</italic>, early treatment of embryos with JHm not only arrests the subsequent progression of the morphogenetic furrow but causes the ommatidia in the wake of the furrow to undergo premature pigment deposition (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>).</p><p>As summarized in <xref ref-type="fig" rid="fig10">Figure 10A</xref>, <italic>Thermobia</italic> embryos show three distinct phases with regards to JH. The initial JH-insensitive phase extends through the formation of the segmented germ band and limb buds. Then follows a JH-sensitive phase when the embryo is responsive to treatment with JH or its mimics. The onset of JH sensitivity correlates with the appearance of Met, and the application of JHm during this period induces transcription of <italic>Kr-h1</italic> (<xref ref-type="fig" rid="fig7">Figure 7E</xref>), the major JH response gene (<xref ref-type="bibr" rid="bib48">Jindra et al., 2015</xref>). The JH-dependent phase then corresponds with the appearance of endogenous JH around definitive dorsal closure. Morphogenetic growth is finished, and JH then supports the terminal differentiation of the determined tissues.</p><p>A systemic signal like JH that can switch the embryo from morphogenesis to terminal differentiation may be especially important for short germ band embryos. Eggs may vary in the amount of yolk that they possess (<xref ref-type="bibr" rid="bib33">Fox and Czesak, 2000</xref>; <xref ref-type="bibr" rid="bib109">Yanagi and Tuda, 2012</xref>). In such cases the embryo’s maximum size is established once the yolk has been fully internalized at definitive dorsal closure. A systemic signal, like JH, when dorsal closure has occurred might serve to coordinate a shift to terminal differentiation programs across the embryo.</p><p>The events responsible for the appearance of Met and of JH sensitivity in the segmented germ band are not known. The fact that the first JH-induced change seen in <italic>Thermobia</italic> embryos is the modification of the E1 molt is interesting considering the intimate relationship between JH and ecdysteroids during the postembryonic molts of hemi- and holometabolous insects (e.g. <xref ref-type="bibr" rid="bib85">Riddiford, 1976</xref>; <xref ref-type="bibr" rid="bib87">Riddiford, 2020</xref>). JH acts postembryonically to enforce <italic>status-quo</italic> molts, but there is no <italic>status-quo</italic> to maintain for the first embryonic molt. While the appearance of JH sensitivity coincides with the appearance of <italic>Met</italic> transcripts, the question is still why should the system be sensitive to JH days before the hormone appears? One possibility is that a component of the ecdysone response system is inherently sensitive to JH. An intriguing candidate for such a protein is Taiman. The <italic>taiman</italic> gene encodes a steroid hormone co-activator that mediates ecdysteroid activation (<xref ref-type="bibr" rid="bib69">Montell, 2001</xref>) and also serves as heterodimeric partner with Met to form the active JH receptor (<xref ref-type="bibr" rid="bib48">Jindra et al., 2015</xref>; <xref ref-type="bibr" rid="bib22">Charles et al., 2011</xref>). C-terminal exons of the <italic>taiman</italic> transcript are alternately spliced to form several isoforms in the mosquito, <italic>Aedes aegypti</italic> (<xref ref-type="bibr" rid="bib63">Liu et al., 2018</xref>), the flour beetle, <italic>Tribolium castaneum</italic>, and the cockroach, <italic>Blattella germanica</italic> (<xref ref-type="bibr" rid="bib64">Lozano et al., 2014</xref>). JH has been shown to control this splicing in both <italic>Aedes</italic> (<xref ref-type="bibr" rid="bib63">Liu et al., 2018</xref>) and <italic>Blattella</italic> (<xref ref-type="bibr" rid="bib64">Lozano et al., 2014</xref>). Interestingly, in mosquito reproduction, the <italic>taiman</italic> isoforms made in the absence of JH poorly support ecdysteroid-induced activation, while those made in the presence of JH mediate strong activation (<xref ref-type="bibr" rid="bib63">Liu et al., 2018</xref>). We speculate that if a similar relationship were to hold in <italic>Thermobia,</italic> then <italic>taiman</italic> isoforms made in the JH-free environment of the early embryo might support a rather weak ecdysteroid response resulting in the thin, extensible E1 cuticle. JHm exposure, though, would change the <italic>taiman</italic> isoforms perhaps supporting the production of a robust cuticle, more typical of later embryonic molts.</p><p>Although early JH exposure affects embryonic growth, tissue patterning, and cuticle types, we do not know how these effects are interrelated. Growth and morphogen signaling interact in complex ways during embryogenesis, with morphogen gradients directing growth, and growth altering morphogen landscapes (<xref ref-type="bibr" rid="bib91">Schwank and Basler, 2010</xref>; <xref ref-type="bibr" rid="bib26">Dekanty and Milán, 2011</xref>). Does JH suppress morphogen signaling and this, in turn, suppresses growth or, alternatively, does JH suppress growth which then arrests the progression of morphogen signaling? We find that JH suppresses transcript levels of the TGF-β family member, myoglianin (<xref ref-type="fig" rid="fig7">Figure 7E</xref>). In last stage <italic>Drosophila</italic> larvae, this circulating morphogen matches imaginal disc growth with that of the overall animal (<xref ref-type="bibr" rid="bib103">Upadhyay et al., 2020</xref>). We do not know how it functions in embryos, but it might serve a similar role in short germ band embryos to ensure that limb size is matched to overall embryo size. Whether JH suppression of myoglianin production inhibits embryonic growth or <italic>vice versa</italic> is unknown.</p><p>The fact that the rapidly growing embryo is covered by a cuticle presents another complication. The fibrous nature of the E1 cuticle (<xref ref-type="bibr" rid="bib55">Konopová and Zrzavý, 2005</xref>) likely allows it to stretch to accommodate epidermal proliferation and limb extension. The more robust, E1 cuticle produced after JH treatment (<xref ref-type="fig" rid="fig9">Figure 9B</xref>) resists extension and this inextensibility may mechanically hinder subsequent proliferation and growth of the JH-treated embryos.</p><p>JH also interferes with the morphogenetic movements of katatrepsis. These movements can be blocked by JH until shortly before they begin (<xref ref-type="fig" rid="fig6">Figure 6C</xref>) and we also find embryos that are blocked in mid-katatrepsis. JH could be inhibiting the contraction of the serosa or its modification of the E1 cuticle may prevent the embryos from passively responding to serosa contractions. We have observed cases in which the extraembryonic membranes have contracted but the miniature embryo has been pulled into the yolk rather than around the outside of the yolk mass (as in <xref ref-type="fig" rid="fig5">Figure 5C</xref>). Such cases suggest that a loss of embryo extensibility may be a major factor in their failure to undergo katatrepsis.</p></sec><sec id="s3-2"><title>Comparative aspects of JH effects on insect embryogenesis</title><p>Embryonic JH titers have been measured or estimated for a variety of hemimetabolous and holometabolous insects (see <xref ref-type="bibr" rid="bib12">Belles, 2020b</xref>). They have been directly determined for embryos of the cockroaches, <italic>Nauphoeta cinerea</italic> (<xref ref-type="bibr" rid="bib45">Imboden et al., 1978</xref>) and <italic>Blattella germanica</italic> (<xref ref-type="bibr" rid="bib65">Maestro et al., 2010</xref>), the locust, <italic>Locusta migratoria</italic> (<xref ref-type="bibr" rid="bib96">Temin et al., 1986</xref>), and the moth, <italic>Manduca sexta</italic>, (<xref ref-type="bibr" rid="bib13">Bergot et al., 1981a</xref>). Alternatively, the abundance of <italic>Kr-h1</italic> transcripts through embryogenesis has been used as a proxy for JH for embryos of the hemipterans <italic>Planococcus kraunhiae,</italic> (<xref ref-type="bibr" rid="bib104">Vea et al., 2016</xref>) and <italic>Pyrrhocoris apterus</italic> (<xref ref-type="bibr" rid="bib56">Konopova et al., 2011</xref>), the thrip, <italic>Frankliniella occidentalis</italic> (<xref ref-type="bibr" rid="bib68">Minakuchi et al., 2011</xref>), the moth <italic>Bombyx mori</italic> (<xref ref-type="bibr" rid="bib25">Daimon et al., 2015</xref>), and the fruit fly, <italic>Drosophila melanogaster</italic> (<xref ref-type="bibr" rid="bib9">Beck et al., 2004</xref>). All these insects show an embryonic JH titer like that seen in <italic>Thermobia</italic>: JH appears around definitive dorsal closure when the final size of the embryo has been established.</p><p>Consistent with its late appearance, the inhibition of JH production suppresses late embryonic development. Late arrests were seen in <italic>Thermobia</italic> (<xref ref-type="fig" rid="fig3">Figure 3</xref>), the stick insect, <italic>Clitumnus extradentatus</italic> (<xref ref-type="bibr" rid="bib20">Cavallin and Fournier, 1981</xref>), the grasshopper, <italic>Locusta migratoria</italic> (<xref ref-type="bibr" rid="bib1">Aboulafia-Baginsky et al., 1984</xref>), the cockroach <italic>Nauphoeta cinerea</italic> (<xref ref-type="bibr" rid="bib19">Brüning et al., 1985</xref>) and the milkweed bug, <italic>Oncopeltus fasciatus</italic> (<xref ref-type="bibr" rid="bib27">Dorn, 1982</xref>). In the latter two cases, late development was restored by treatment with JH or JH mimics. The use of maternal RNAi treatments to knock-down transcripts of components of the JH synthesis and response pathways in <italic>Blattella germanica</italic> (<xref ref-type="bibr" rid="bib31">Fernandez-Nicolas and Belles, 2017</xref>) also interfered with late embryonic development, although some early embryonic anomalies were also noted. The latter may be related to low levels of maternal transcripts that are loaded into the egg.</p><p>Amongst embryos from holometabolous orders, interference with JH production in the beetle <italic>Tribolium castaneum</italic> (<xref ref-type="bibr" rid="bib70">Naruse et al., 2020</xref>) also resulted in abnormal late development. In <italic>Bombyx,</italic> by contrast, the genetic suppression of JH production caused only a mild delay in terminal embryogenesis but suppressed hatching. When treated larvae are freed from their shells, though, they feed and progressed to the third instar where they then attempted metamorphosis (<xref ref-type="bibr" rid="bib25">Daimon et al., 2015</xref>). In <italic>Drosophila,</italic> the suppression of JH production had little effect on embryogenesis except causing abnormal migration of the primordial germ cells (<xref ref-type="bibr" rid="bib8">Barton et al., 2024</xref>). Overall, then, although JH appears during late embryogenesis in all insects, the importance of that JH for the completion of embryogenesis wanes in the holometabolous orders.</p><p>Embryos also vary in how they respond to early treatment with JH. The most severely affected embryos are those that undergo short germband development, such as embryos of <italic>Thermobia</italic> (<xref ref-type="bibr" rid="bib88">Rohdendorf and Sehnal, 1973</xref>; this paper), the locusts, <italic>Schistocerca</italic> and <italic>Locusta</italic> (<xref ref-type="bibr" rid="bib76">Novák, 1969</xref>; <xref ref-type="bibr" rid="bib97">Truman and Riddiford, 1999</xref>; <xref ref-type="bibr" rid="bib98">Truman and Riddiford, 2002</xref>) and the cricket <italic>Acheta</italic> (<xref ref-type="bibr" rid="bib29">Erezyilmaz et al., 2004</xref>). <xref ref-type="fig" rid="fig10">Figure 10B and C</xref> compares the morphology of normal <italic>Thermobia</italic> and <italic>Schistocerca</italic> embryos at dorsal closure with clutch-mates that were treated with JHm within a day after fertilization. In both cases katatrepsis was blocked and growth was severely retarded. The most severely affected <italic>Thermobia</italic> embryos lacked eyes and their limbs regressed, but the most affected <italic>Schistocerca</italic> embryos possessed small eyes and had stable, although deformed, limbs. We think that these species differences in the severity of JH suppression of embryogenesis are due to changes in the relationship of the embryonic timetable to the timing of ecdysteroid pulses that drive embryonic molts.</p><p>The impact of changing the time of the first embryonic molt relative to the embryogenesis timetable is illustrated for eye development in <xref ref-type="fig" rid="fig10">Figure 10D and E</xref>. In <italic>Thermobia,</italic> the eye primordium is patterned between about 30 to 45% of development as the morphogenetic furrow moves across it. JH treatment during that period arrests the furrow, thereby determining the size of the eye that subsequently forms (<xref ref-type="fig" rid="fig6">Figure 6D and E</xref>). The embryo, though, becomes sensitive to JH suppression when it is depositing the E1 cuticle. Since cuticle deposition begins before furrow movement, the early JH treatments can prevent furrow initiation and eye development altogether. Eye patterning in locusts, by contrast, is initiated at a similar developmental time but extends until dorsal closure to make the large eye of the grasshopper nymph (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). Ecdysteroids and production of the E1 cuticle occurs relatively later in locusts (<xref ref-type="bibr" rid="bib58">Lagueux et al., 1979</xref>), though, and the earliest rows of ommatidia have already been determined before the start of the E1 molt and the embryo becoming sensitive to JH. Consequently, JH-treated locust embryos always form an eye, although the size of that eye becomes progressively larger as JHm treatment is delayed. The difference in the extent of limb suppression in the two species also relates to how far development has progressed at the time that the embryos become responsive to JH: in <italic>Thermobia</italic> the legs are at an earlier stage of proximal-distal patterning as compared to those of <italic>Schistocerca</italic> (Truman and Riddiford, unpublished) and <italic>Acheta</italic> (<xref ref-type="bibr" rid="bib29">Erezyilmaz et al., 2004</xref>). With the earliest JH treatments, the limbs of <italic>Thermobia</italic> arrest too early to maintain a stable limb, whereas in <italic>Schistocerca</italic> and <italic>Acheta</italic> embryos, arrest occurs after the establishment of the leg segments of femur, tibia, <italic>etc</italic>. Although stunted and deformed, these JHm-exposed legs are stable.</p><p>JH exposure at mid-stage development alters the nature of the E2 cuticle deposited by embryos of <italic>Thermobia</italic> (<xref ref-type="fig" rid="fig9">Figure 9</xref>), <italic>Locusta</italic> (<xref ref-type="bibr" rid="bib97">Truman and Riddiford, 1999</xref>) and <italic>Acheta</italic> (<xref ref-type="bibr" rid="bib29">Erezyilmaz et al., 2004</xref>). In locusts and crickets, the induced cuticle has the features of the first nymphal (=E3) cuticle, rather than bearing the hatching specializations of the E2 (=Pronymphal) cuticle. Similarly, in <italic>Thermobia,</italic> the E2 (=J1) cuticle produced under the influence of JH has the features of the J2 cuticle and lacks the egg tooth and surface sculpturing that are features of the E2 cuticle (<xref ref-type="fig" rid="fig9">Figure 9D and E</xref>). The similarity in the effects of JH on E2 cuticle production in <italic>Thermobia</italic> and in polyneopteron hemimetabolous insects (locusts and crickets) suggests that their last common ancestor would have responded to JH exposure in a similar way. Hence, the ancestral effects of JH on molting were in evoking <italic>progressive</italic> molts to the final juvenile condition. The function of JH in maintaining <italic>status quo</italic> molts came later, when this hormone began being used during postembryonic molts.</p><p>Insects that show intermediate germ band development such as the linden bug, <italic>Pyrrhocoris apterus,</italic> devote more of the blastoderm to the production of the germband than do the short germband forms (<xref ref-type="bibr" rid="bib2">Anderson, 1972a</xref>). Premature exposure to JH also suppresses katatrepsis and dorsal closure but their growth suppression is not as severe as seen in <italic>Thermobia</italic> and locusts (<xref ref-type="bibr" rid="bib28">Enslee and Riddiford, 1977</xref>), likely because the embryos are relatively larger when they become responsive to JH. JHm treatment also causes an advancement in embryo pigmentation in <italic>Pyrrhocoris</italic> (<xref ref-type="bibr" rid="bib28">Enslee and Riddiford, 1977</xref>).</p><p>Embryos of holometabolous insects typically show either intermediate or long germband development (<xref ref-type="bibr" rid="bib3">Anderson, 1972b</xref>) and they are the least affected by exposure to exogenous JH. These embryos form their germband in its ‘appropriate’ position with its head directed to the anterior pole of the egg and, hence, does not show the movements of katatrepsis (<xref ref-type="bibr" rid="bib3">Anderson, 1972b</xref>). The elongated embryos of the Lepidoptera, though, show an unrelated set of movements around dorsal closure (<xref ref-type="bibr" rid="bib42">Heming, 2003</xref>; <xref ref-type="bibr" rid="bib3">Anderson, 1972b</xref>) to reposition the embryo so that its dorsal surface is against the shell. Lepidopteran embryos enclose only part of the yolk at dorsal closure and subsequently consume the remainder of the yolk before hatching. JH treatment to embryos of the giant silk moth, <italic>Hyalophora cecropia,</italic> and the sphinx moth, <italic>Manduca sexta</italic> (<xref ref-type="bibr" rid="bib84">Riddiford and Williams, 1967</xref>; L.M.Riddiford, unpublished) blocks the repositioning of the embryo and its ventral surface remains against the shell. Although there is physical distortion caused by their ventral-out position, these embryos finish their development in a relatively normal manner. These embryos, though, can neither consume the extraembryonic yolk nor hatch.</p><p>Long germband embryos, as seen in Diptera and Hymenoptera, are least affected by JHm treatment. As best characterized in <italic>Drosophila</italic> (<xref ref-type="bibr" rid="bib24">Cohen, 1993</xref>), almost all the blastoderm is devoted to making the germband, and the body axis is established simultaneously along its length, with organ primordia established soon thereafter. Compared to their development in short germband embryos, the embryonic primordia for structures like the eyes (<xref ref-type="bibr" rid="bib34">Friedrich, 2006</xref>) and legs (<xref ref-type="bibr" rid="bib95">Tanaka and Truman, 2007</xref>) only undergo early phases of their patterning, with the patterned portion forming the larval structure, and the remainder set aside as a dormant primordium. In the epidermis of <italic>Drosophila,</italic> most of these persisting embryonic primordia are sequestered as invaginated imaginal discs and contribute nothing to the larval body. In species with less derived development, the imaginal primordia are embedded within the larval epidermis and help in making the larval structure. Compared to their short germband relatives, the primordia of long germband embryos may show modest or little growth to establish the appendage of the hatchling. This de-emphasis on proliferative growth removes the feature that was most sensitive to exogenous JH suppression in short germband embryos. Of course, as covered in the next section, this phase of proliferative morphogenesis has been translocated from the embryo to the last larval instar in holometabolous insects and its JH sensitivity may have been carried with it.</p></sec><sec id="s3-3"><title>Relevance of the embryonic effects of JH in <italic>Thermobia</italic> to its postembryonic effects in hemimetabolous and holometabolous insects</title><p>Although insects show similar titers of JH during embryogenesis, they differ in their pattern of JH production during postembryonic life (<xref ref-type="fig" rid="fig11">Figure 11A</xref>). The only information for ametabolous insects is for <italic>Thermobia domestica</italic>. Direct hormone measurements (<xref ref-type="fig" rid="fig2">Figure 2A</xref>), and <italic>Kr-h1</italic> transcript levels (<xref ref-type="bibr" rid="bib32">Fernandez-Nicolas et al., 2023</xref>) indicate that JH levels are low at hatching and remain low throughout juvenile growth and into the adult. In hemimetabolous insects, by contrast, JH titer measurements or <italic>Kr-h1</italic> expression data are available for examples of paleopteran (mayflies; <xref ref-type="bibr" rid="bib52">Kamsoi et al., 2021</xref>), polyneopteran (including grasshoppers and cockroaches: <xref ref-type="bibr" rid="bib96">Temin et al., 1986</xref>; <xref ref-type="bibr" rid="bib59">Lanzrein et al., 1985</xref>; <xref ref-type="bibr" rid="bib65">Maestro et al., 2010</xref>) and paraneopteran orders (heteropteran, <xref ref-type="bibr" rid="bib56">Konopova et al., 2011</xref>). High levels of JH are present through the penultimate nymphal instar but then disappear in the last nymphal stage. This decline in JH is both necessary and sufficient for metamorphosis to the adult. In the Holometabola, JH levels are high through the penultimate larval stage but then decline early in the last larval stage, as the larva becomes committed to metamorphosis. After pupal commitment, JH transiently returns during the prepupal period. This reappearance of JH is needed by some tissues to prevent their premature ‘jump’ to the adult stage (<xref ref-type="bibr" rid="bib108">Williams, 1961</xref>). JH must then be removed from the system to allow the transition of the pupa into the adult.</p><fig id="fig11" position="float"><label>Figure 11.</label><caption><title>Phylogenetic shifts in JH production during embryonic and postembryonic development in insects.</title><p>(<bold>A</bold>) Depiction of JH titers in ametabolous, hemimetabolous, and holometabolous insects. Titers are based on direct measurements or are estimated from <italic>Kr-h1</italic> expression. The ametabolous order, Zygentoma, provides the only data for an ametabolous insect, <italic>Thermobia</italic> (<xref ref-type="fig" rid="fig2">Figure 2A</xref>; <xref ref-type="bibr" rid="bib32">Fernandez-Nicolas et al., 2023</xref>). Palaeopteran postembryonic data from the mayfly, <italic>Cloeon dipterum</italic> (<xref ref-type="bibr" rid="bib52">Kamsoi et al., 2021</xref>). Polyneopteran titers based on locusts (<xref ref-type="bibr" rid="bib96">Temin et al., 1986</xref>; <xref ref-type="bibr" rid="bib97">Truman and Riddiford, 1999</xref>) and <italic>Blattella</italic> (<xref ref-type="bibr" rid="bib65">Maestro et al., 2010</xref>). Paraneopteran from <italic>Pyrrhocoris</italic> (<xref ref-type="bibr" rid="bib56">Konopova et al., 2011</xref>) and Holometabolous for <italic>Manduca</italic> (<xref ref-type="bibr" rid="bib13">Bergot et al., 1981a</xref>; <xref ref-type="bibr" rid="bib16">Borst et al., 1987</xref>; <xref ref-type="bibr" rid="bib30">Fain and Riddiford, 1975</xref>). (<bold>B</bold>) A scenario for the role of postembryonic JH in the evolution of the wing pad. In the ametabolous condition, as typified by <italic>Thermobia</italic>, the major phase of body morphogenesis (M) is confined to mid-embryogenesis, followed by the appearance of JH which supports differentiation (D). In archaic winged insects a new, postembryonic phase of morphogenesis supports wing formation in the young juvenile. The small wings then undergo positive allometric growth until they are large enough to support flight of the older juveniles and the adults. The postembryonic, reappearance of JH during wing morphogenesis redirected development to make the wing pad. This compromise developmental program is then maintained until the end of juvenile growth when the disappearance of JH allows wing differentiation.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig11-v1.tif"/></fig><p>As discussed above, the similarity of the effects of JH in embryos of <italic>Thermobia</italic> and of polyneopteran hemimetabolous insects argue that JH had the ability to suppress morphogenesis and promote terminal differentiation in the last common ancestor before these groups diverged about 400 mya. How, then, do these ancestral, embryonic actions of JH relate to its modern function of regulating metamorphosis, and what were the selective pressures that moved JH into the postembryonic realm?</p><p>The embryonic actions of JH are compared with its postembryonic actions in <xref ref-type="fig" rid="fig12">Figure 12</xref>. In the ancestral condition, JH can act in the embryo to suppress morphogenesis and promote differentiation, but, since it normally appears after morphogenesis and tissue patterning are complete, its main embryonic function is to support terminal differentiation. In <italic>Thermobia,</italic> JH levels are then quite low in the juvenile (<xref ref-type="fig" rid="fig2">Figure 2A</xref>; <xref ref-type="bibr" rid="bib32">Fernandez-Nicolas et al., 2023</xref>), indicating that JH is not needed to maintain the juvenile form. <xref ref-type="bibr" rid="bib107">Watson, 1967</xref> showed that the appearance of scales in its J4 stage is suppressed by JH application, but we have not been able to induce premature scale formation in the J3 stage by treatment of the J1 and J2 stages with 7EP (Truman and Riddiford, unpublished). We do not think that the appearance of scales is <italic>caused</italic> by a modulation in the low postembryonic JH levels. Rather, the ability of JH to suppress scale morphogenesis in the juvenile is likely an extension of its morphostatic actions that were evident in the embryo.</p><fig id="fig12" position="float"><label>Figure 12.</label><caption><title>Comparison of the developmental effects of JH in <italic>Thermobia</italic> with its postembryonic actions in hemimetabolous and holometabolous insects.</title><p>(<bold>A</bold>) As summarized in <xref ref-type="fig" rid="fig10">Figure 10</xref>, early <italic>Thermobia</italic> embryogenesis is JH insensitive, but JH sensitivity is acquired just prior to katatrepsis and the production of the first embryonic cuticle. JH appears after definitive dorsal closure and is required for the terminal differentiation of the juvenile. Once the juvenile form is established, JH is not then needed for its maintenance. (<bold>B</bold>) The early nymphal instars of hemimetabolous insects are also JH independent. Morphogenesis, associated with wing development, begins around the third nymphal stage and is correlated with the appearance of JH dependence. JH allows wing pad (WP) growth but suppresses its morphogenesis until the disappearance of JH ushers in the JH-free period which allows wing morphogenesis and differentiation. (<bold>C</bold>). The function of JH in holometabolous larvae is like that seen in nymphs except that imaginal primordia (like the leg primordia [LP]) are widely spread through the larval body and involve almost all of the adult organs. The imaginal primordia and the larval cells differ in their JH requirements during the prepupal period (see text). The pupal-adult transition then requires the absence of JH. CW: critical weight checkpoint; W: wandering stage; double crosshatch: period of new cuticle production preceding each ecdysis.</p></caption><graphic mimetype="image" mime-subtype="tiff" xlink:href="elife-92643-fig12-v1.tif"/></fig><p>Unlike the juveniles of <italic>Thermobia</italic>, the nymphs and larvae of hemi- and holometabolous insects have long been known to need JH to maintain their respective states. However, more recent studies involving the loss of JH or JH function in the silkworm, <italic>Bombyx mori</italic> (<xref ref-type="bibr" rid="bib25">Daimon et al., 2015</xref>), and the bug <italic>Pyrrhocoris apterus</italic> (<xref ref-type="bibr" rid="bib92">Smykal et al., 2014</xref>) show that the early juvenile instars are maintained regardless of the presence or absence of JH or its main effector, Kr-h1. The juveniles shift from a JH-independent to a JH-dependent state around their 3d instar. After this point, JH is needed to suppress their entry into metamorphosis (e.g. <xref ref-type="bibr" rid="bib92">Smykal et al., 2014</xref>; <xref ref-type="bibr" rid="bib21">Chafino et al., 2019</xref>). Although likely associated with growth (<xref ref-type="bibr" rid="bib92">Smykal et al., 2014</xref>), the factors that cause metamorphic competence are unknown.</p><p>Nymphs and larvae differ from juveniles of <italic>Thermobia</italic> in that they have a second round of morphogenesis during their postembryonic growth (<xref ref-type="fig" rid="fig12">Figure 12B and C</xref>). However, the primordia that undergo postembryonic morphogenesis are typically dormant at hatching and need a period of growth before they start developing. In true bugs, like <italic>Pyrrhocoris,</italic> for example, wing pads only appear at the start of the 3rd nymphal stage (<xref ref-type="bibr" rid="bib92">Smykal et al., 2014</xref>). Likewise in holometabolous larvae, such as the butterfly, <italic>Pieris rapae</italic>, cells of the wing primordia are evident at hatching but are still attached to larval cuticle. As the larva feeds and grows, the cells of the primordium increase in size, detach from the cuticle, form an invaginated sac, and finally start dividing during the molt to the third larval stage (<xref ref-type="bibr" rid="bib67">Mercer, 1900</xref>; see review in <xref ref-type="bibr" rid="bib94">Svácha, 1992</xref>). How growth may cause the activation of dormant primordia has been examined for the eye-antenna (<xref ref-type="bibr" rid="bib53">Kenyon et al., 2003</xref>) and the wing-notum discs (<xref ref-type="bibr" rid="bib81">Rafel and Milán, 2008</xref>) of <italic>Drosophila</italic>. These discs are dormant at hatching because of opposing actions of short-range morphogens at the two edges of their respective discs. The inhibition imposed by these morphogens prevents the subsequent regionalization of these discs into eye <italic>versus</italic> antenna and wing <italic>versus</italic> notum domains, respectively. As the hatchling feeds and grows, the increase in disc cell size eventually moves the edges of the discs out of the zone of inhibition, thereby allowing the start of cell division and patterning (<xref ref-type="bibr" rid="bib53">Kenyon et al., 2003</xref>; <xref ref-type="bibr" rid="bib81">Rafel and Milán, 2008</xref>). Similar growth dependent changes in local morphogen signaling likely also control the initiation of wing pad formation in hemimetabolous nymphs. Whether the developing wing pads and other imaginal primordia are sources of the competence signals, though, is not known. However, once these tissues acquire metamorphic competence, JH is needed to delay its realization until nymphal/larval growth is over (<xref ref-type="bibr" rid="bib92">Smykal et al., 2014</xref>).</p><p>The appearance of high levels of JH during postembryonic life likely occurred after the invention of wings and powered flight (<xref ref-type="fig" rid="fig10">Figure 10B</xref>). Fossil series of juvenile archaic flying insects, such as the Megasecoptera, show that the thorax of young juveniles bore small, articulated wings, although the latter were too small for flight (<xref ref-type="bibr" rid="bib57">Kukalova-Peck, 1978</xref>; <xref ref-type="bibr" rid="bib39">Haug et al., 2016</xref>). Through successive instars, the small wings showed positive allometric growth until they became large enough to support flight in the late juvenile and the adult stages. These insects, though, were still considered ametabolous because there was not an abrupt morphological change going from the juvenile to the adult (<xref ref-type="bibr" rid="bib57">Kukalova-Peck, 1978</xref>). Wing development was subsequently modified so wing primordia appeared as immobile wing pads appressed to the body rather than as lateral, moveable winglets. As a wing pad, developing tissues were protected during juvenile growth and they deferred their morphogenesis and differentiation into wings until juvenile growth was finished. This wing pad is a feature of all extant hemimetabolous insects.</p><p>We assume that, like <italic>Thermobia</italic>, the ametabolous archaic winged insects produced little or no JH through juvenile life (<xref ref-type="fig" rid="fig11">Figure 11B</xref>). The change to making a wing pad, rather than a wing, may have occurred by bringing JH into the postembryonic realm at the time when wing morphogenesis was starting. While agents that drive morphogenesis and differentiation were separated in time during embryogenesis, their co-occurrence during wing formation may have forced a developmental compromise. The influence of local morphogens on the wing pad is evident in their cells remaining diploid, undergoing progressive patterning, and showing positive allometric growth, but under the influence of JH the wing pad cells remain undetermined, they make nymphal cuticle, and their growth depends on nutrient input. In modern insects, this compromise condition is tonically mainatined by JH. If JH or its effector Kr-h1 are removed, then the wing pad rapidly undergoes morphogenesis and differentiation into a wing (e.g. <xref ref-type="bibr" rid="bib56">Konopova et al., 2011</xref>). Once wing pad formation established the need for JH in the postembryonic domain, JH was likely adopted by other systems, such as those regulating cuticle type, to control other phenotypic differences between the nymph and the adult.</p><p>Holometabolous larvae similarly use JH to suppress wing morphogenesis during larval growth (<xref ref-type="fig" rid="fig12">Figure 12C</xref>), but, in addition, they have scattered imaginal primordia that are embedded in larval organs or are early invaginated discs. The morphogenesis of these imaginal primordia is also suppressed by JH. When JH finally disappears at the critical weight checkpoint (<xref ref-type="bibr" rid="bib72">Nijhout and Williams, 1974</xref>; <xref ref-type="bibr" rid="bib74">Nijhout, 1994</xref>), the primordia embark on their program of morphogenetic growth that is independent of nutrient input (<xref ref-type="bibr" rid="bib99">Truman et al., 2006</xref>).</p><p>The transformation of the larva into the adult requires two molts, with the nonfeeding pupal stage interposed in between. In terms of their JH requirements, the transition from the pupa to the adult is like that from the last stage nymph to the adult. They both occur in a JH-free environment, and exposure to JH at the outset of the molt redirects development to make another pupal or nymphal stage, respectively. The transition from the larva to the pupa, though, is unusual in that JH returns during the prepupal period (<xref ref-type="fig" rid="fig11">Figure 11A</xref>). As depicted in <xref ref-type="fig" rid="fig12">Figure 12C</xref>, this JH is especially important for the tissues that come from the imaginal primordia. For regular larval tissues, the commitment from the larval program to the pupal program is caused by the small ecdysteroid peak that evokes wandering and, thereafter, JH cannot stop their pupal differentiation (<xref ref-type="bibr" rid="bib85">Riddiford, 1976</xref>). The imaginal primordia, by contrast, have an earlier commitment to pupal differentiation at the critical weight checkpoint. In a species- and tissue-specific fashion, these imaginal primordia may fail to undergo normal pupal differentiation if JH is absent during the prepupal period (<xref ref-type="bibr" rid="bib108">Williams, 1961</xref>; <xref ref-type="bibr" rid="bib86">Riddiford et al., 2010</xref>). This requirement of some imaginal primordia for JH for their proper pupal differentiation is reminiscent of the requirement by embryonic primordia of basal insects for JH to complete their nymphal differentiation. It is important, though, that the outcome of the lack of JH differs in the two cases: its lack in the embryo results in suppression of juvenile/nymphal differentiation, whereas its lack in the prepupa results in an ‘overshoot’ to the adult stage. We do not know enough about either of these phenomena, though, to reconcile these differences.</p><p>The above discussion proposes an inherent antagonism between JH and morphogen signaling. This antagonism has been assumed based on phenotypic effects such as JH stopping eye primordium patterning in embryos (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>) or in premetamorphic larvae (<xref ref-type="bibr" rid="bib75">Nijhout and Kremen, 1998</xref>). To date, though, the only morphogen that has been directly tied to JH is the circulating morphogen, myoglianin. A major source of myoglianin in larvae is muscle and it provides a proxy for body size, to inform the insects that sufficient growth has occurred to permit metamorphosis (<xref ref-type="bibr" rid="bib40">He et al., 2020</xref>). Studies on the cricket, <italic>Gryllus bimaculatus</italic> (<xref ref-type="bibr" rid="bib46">Ishimaru et al., 2016</xref>) and on <italic>Blattella</italic> (<xref ref-type="bibr" rid="bib51">Kamsoi and Belles, 2019</xref>) show that myoglianin acts on the corpora allata to suppress JH production, thereby allowing imaginal primordia to switch to morphogenetic growth. Late in larval life in <italic>Drosophila</italic>, systemic myoglianin also provides information to coordinate imaginal disc growth to overall body size (<xref ref-type="bibr" rid="bib103">Upadhyay et al., 2020</xref>). In <italic>Thermobia</italic> embryos, we find that levels of JH and myoglianin are also related, but the relationship is reversed, with myoglianin appearing first, during the period of morphogenetic growth, and early application of JH able to suppress this appearance. We have no experimental data on the function of myoglianin in <italic>Thermobia</italic> embryos, but in a short germband insect where yolk content might be variable, it may be important to have a circulating morphogen to match appendage size to body size. Although the inhibitory relationships between myoglianin and JH are in opposite directions in the embryo versus in the juvenile, an interaction of the two signaling systems appears to extend deep into insect evolution.</p></sec><sec id="s3-4"><title>Conclusions</title><p>The ancestral developmental role for JH appears to have been in the embryo where it functioned to promote terminal tissue differentiation. JH also had powerful morphostatic activity, but this activity was not evident during normal development because JH appeared late in embryogenesis after morphogenesis had essentially finished. These embryonic actions of JH, though, preadapted it to become the consummate <italic>status quo</italic> hormone in the postembryonic realm. Once <italic>Thermobia</italic> embryos have hatched, they do not need JH to maintain their juvenile condition. The same is true of nymphs and larvae until around the time that dormant primordia initiate their morphogenetic growth. Once these primordia acquire competent to begin programs of morphogenesis, the morphostatic actions of JH maintain them in an immature condition. The removal of JH is needed for these primordia to achieve their developmental potential.</p><p>JH signaling and action extend back into the Crustacea where its immediate precursor, methyl farnesoate (MF), is involved in reproductive control (<xref ref-type="bibr" rid="bib16">Borst et al., 1987</xref>). MF also affects crustacean development, but these effects are subtle and diverse (<xref ref-type="bibr" rid="bib61">Laufer and Biggers, 2001</xref>) and difficult to compare with JH effects in <italic>Thermobia</italic> at this time. An involvement of farnesol derivatives in growth and differentiation may extend beyond the pancrustacea. In the yeast <italic>Candida albicans</italic>, secreted farnesoic acid acts as a ‘quorum sensing signal’ that controls the transition from a budding form to a hyphal form (<xref ref-type="bibr" rid="bib44">Hornby et al., 2001</xref>; <xref ref-type="bibr" rid="bib77">Oh et al., 2001</xref>). Amongst animals, the genes for the enzymes to synthesize farnesoic acid are widely found throughout invertebrate phyla (<xref ref-type="bibr" rid="bib93">So et al., 2022</xref>). In mammals, farnesol stimulates differentiation in epidermal keratinocytes (<xref ref-type="bibr" rid="bib37">Hanley et al., 2000</xref>) and it also suppresses xenograft-based tumor growth in mice (<xref ref-type="bibr" rid="bib62">Lee et al., 2015</xref>). Indeed, farnesol-based molecules may have an ancient involvement in switching cells between developmental states and this capacity may have been exploited by the insects to provide the hormonal system that regulates their metamorphosis.</p></sec></sec><sec id="s4" sec-type="methods"><title>Methods</title><p>Information on specialized reagents is summarized in <xref ref-type="table" rid="table1">Table 1</xref>.</p><table-wrap id="table1" position="float"><label>Table 1.</label><caption><title>Specialized animals and reagents.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">Reagent / animal</th><th align="left" valign="bottom">Source</th><th align="left" valign="bottom">Catalog number</th></tr></thead><tbody><tr><td align="left" valign="bottom">Thermobia domestica</td><td align="left" valign="bottom">30+year laboratory colony</td><td align="left" valign="bottom">est. from wild caught</td></tr><tr><td align="left" valign="bottom">pyriproxyfen</td><td align="left" valign="bottom">Sumitomo Co</td><td align="left" valign="bottom">#95737-68-1</td></tr><tr><td align="left" valign="bottom">7 ethoxyprecocene</td><td align="left" valign="bottom">Sigma Aldrich</td><td align="left" valign="bottom">#65383-73-5</td></tr><tr><td align="left" valign="bottom">DAPI</td><td align="left" valign="bottom">Sigma Aldrich</td><td align="left" valign="bottom">#28718-90-3</td></tr><tr><td align="left" valign="bottom">Calcofluor White</td><td align="left" valign="bottom">Sigma Aldrich</td><td align="left" valign="bottom">#4193-55-9</td></tr><tr><td align="left" valign="bottom">Propidium Iodide</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="left" valign="bottom">#440301000</td></tr><tr><td align="left" valign="bottom">Oregon Green phalloidin</td><td align="left" valign="bottom">Thermo Fisher Scientific</td><td align="left" valign="bottom">#O7466</td></tr><tr><td align="left" valign="bottom">rabbit anti-distal-less</td><td align="left" valign="bottom">gift from Grace Panganiban</td><td align="left" valign="bottom"/></tr><tr><td align="left" valign="bottom">rabbit anti P-HistoneH3 (ser 10)</td><td align="left" valign="bottom">EDM Millipore</td><td align="left" valign="bottom">#06–570</td></tr><tr><td align="left" valign="bottom">Normal Donkey Serum</td><td align="left" valign="bottom">Jackson ImmunoResearch</td><td align="left" valign="bottom">#017-000-121</td></tr><tr><td align="left" valign="bottom">AF488 Donkey anti-rabbit IgG</td><td align="left" valign="bottom">Jackson ImmunoResearch</td><td align="left" valign="bottom">#711-545-152</td></tr><tr><td align="left" valign="bottom">AF594 Donkey anti-rabbit IgG</td><td align="left" valign="bottom">Jackson ImmunoResearch</td><td align="left" valign="bottom">#711-585-152</td></tr><tr><td align="left" valign="bottom">DPX mountant</td><td align="left" valign="bottom">Electron Microscopy Sciences</td><td align="left" valign="bottom"># 13512</td></tr></tbody></table></table-wrap><sec id="s4-1"><title>Animals</title><p>The firebrats, <italic>Thermobia domestica</italic>, were reared at 37 °C in small, covered polyethylene boxes. Layers of corrugated filter paper provided surfaces for the insects to move on and hide. The insects were fed dry Gerber’s baby rice cereal and a few pellets of dry cat food. Water was available in cotton-plugged vials. The incubator was kept above 70% relative humidity with a saturated KCl solution.</p><p>Cotton balls were placed between the filter paper sheets for oviposition. For timed egg collections, the cotton balls were replaced morning and evening to achieve 12 hr egg collections, and each was stored in a covered petri dish at 37 °C until needed. The age of the embryos was referenced to the midpoint of the collection period.</p></sec><sec id="s4-2"><title>Juvenile hormone titers</title><p>Timed egg collections were extracted based on the method of <xref ref-type="bibr" rid="bib14">Bergot et al., 1981b</xref> as modified by Lacy Barton and Justina Sanny (personal communication) and by LMR. Briefly, 200 eggs were homogenized in 350 µl acetonitrile containing 31.25 pg deuterated JH III (JHD3) in a silanized 2 ml Snap-It vial (Thermo-Fisher) on ice using a Benchmark D1000 homogenizer (Benchmark Scientific, New York), then capped and spun at 5000 × <italic>g</italic> for 15 min at 4 °C. The supernatant was transferred to a new silanized vial. The pellet was resuspended in 250 µl acetonitrile containing 31.25 pg JHD3 III, spun at 5000 × <italic>g</italic> for 15 min, then the two supernatants combined. The combined supernatants were extracted with two volumes n-pentane and 4 volumes of 4% NaCl, then spun at 2000 × <italic>g</italic> for 20 min at 4 °C. The organic phases and aqueous phase were put into separate silanized vials, and the aqueous phase re-extracted with a half volume of n-pentane and spun 20 min at 4 °C. The resultant organic phase was combined with the original organic phases which was then washed with an equal volume of 4% NaCl, and centrifuged at 2000 × <italic>g</italic> for 20 min at 4 °C. The organic phase was then transferred to a new silanized vial, the solvent gently blown off under a stream of nitrogen, and the residue resuspended in 200 µl acetonitrile. The residue and two 150 µl rinses of the vial were loaded onto a Sep-Pak C18 column (3 cc; Waters Corp., Milford, MA, USA). The purified extract was eluted from the column with 2 ml acetonitrile and frozen at –20 °C until analysis by the liquid chromatography-tandem mass spectrometry method of <xref ref-type="bibr" rid="bib82">Ramirez et al., 2020</xref>.</p></sec><sec id="s4-3"><title>Ecdysteroid titers</title><p>Ecdysteroid concentrations in timed egg collections were measured using the 20-Hydroxyecdysone (20E) Enzyme Immunoassay (EIA) kit (Cayman Chemical Company, Ann Arbor, MI) based on the method developed by <xref ref-type="bibr" rid="bib80">Porcheron et al., 1989</xref>. Staged <italic>Thermobia</italic> embryos (200 per sample) were homogenized in 250 µls ice cold 75% aqueous methanol as outlined in <xref ref-type="bibr" rid="bib66">Margam et al., 2006</xref>. Homogenized samples were centrifuged for 15 min at 13,000 × <italic>g</italic> and 4 °C. Supernatants were transferred to 1.5 ml microcentrifuge tubes on ice. Pellets were resuspended in 250 µls 75% aqueous methanol, vortexed, placed on ice for 30 min, then centrifuged as before, and the supernatants pooled. One quarter of the volume was dried down under nitrogen, stored desiccated at –20 °C. It was resuspended in EIA buffer and diluted 1/100 just before assay. Following the kit instructions, the EIA was performed in a 96-well microtiter plate and is based on the competition between 20E (in standard or sample) and acetylcholinesterase-labeled 20E for the ecdysteroid antiserum that has been bound to the IGG-coated well plates. The plate was incubated with gyration overnight at 4 °C, then washed five times with EIA buffer. The enzymatic substrate for acetylcholinesterase and chromogen, which form a yellow compound that absorbs between 405–414 nm, was then added to each well and incubated at room temperature with gyration for 60 min. The intensity of the color is inversely proportional to the amount of ecdysteroid present as determined by spectrophotometry on a μQuant Microplate Spectrophotometer plate reader at 410 nm (BioTek Instruments, Vermont). The kit solutions were resuspended in UltraPure water (Cayman Chemical). The readings were compared to a standard curve derived from serial dilutions of the 20E standard and quality control provided by the kit.</p></sec><sec id="s4-4"><title>Bioactive compounds</title><p>Pyriproxyfen (Sumitomo Co.) and 7-ethoxyprecocene (Sigma Aldrich) were dissolved in cyclohexane (HPLC grade, Sigma Aldrich) and stored at –20 °C. Using a 10 µl Hamilton syringe, 0.2 µl of hormone solution or of cyclohexane was applied with a repeating dispenser to staged eggs on double-stick tape.</p></sec><sec id="s4-5"><title>RNA analysis</title><p>Collections of timed embryos were placed in a 0.5 ml Eppendorf tube to which 150 µl Trizol (Ambion) was added. The tube was vortexed, briefly spun, then frozen in liquid nitrogen. Total RNA was isolated using TRIzol (Invitrogen), treated with TURBO DNase (Invitrogen) and purified with RNA Clean &amp; Concentrator (Zymo Research). cDNA was prepared from 2 µg of the RNA using oligo-dT primer and SuperScript IV First-Strand Synthesis System (Invitrogen). PCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad); each 20 μl reaction contained 100 ng cDNA and forward and reverse primers, each primer at a final concentration of 500 nM. Reactions were run in the CFX Connect Real-Time PCR Detection System (Bio-Rad) and normalized expression was calculated using the associated software according to comparative Ct method (<xref ref-type="bibr" rid="bib90">Schmittgen and Livak, 2008</xref>). The expression levels of each target gene were normalized against expression levels of the ribosomal protein 49 (rp49). Primers were designed using Primer3Plus (<xref ref-type="bibr" rid="bib101">Untergasser et al., 2012</xref>) on the gene sequences that were derived from NCBI: Met and Kr-h1 were isolated by BK previously (<xref ref-type="bibr" rid="bib56">Konopova et al., 2011</xref>), myo was found in the TSA database by blast search using <italic>Drosophila</italic> myo as a query and the amplicon sequence was also checked in the Thermobia genome (<xref ref-type="bibr" rid="bib18">Brand et al., 2018</xref>) to check for nucleotide mismatches (sites of polymorphism). The accession numbers and primer sequences are in <xref ref-type="table" rid="table2">Table 2</xref>. Melting curves were examined after each run and for each pair of primers several finished runs were visualized on a 2% agarose gel; only a single product was detected.</p><table-wrap id="table2" position="float"><label>Table 2.</label><caption><title>Primers used for real-time PCR.</title></caption><table frame="hsides" rules="groups"><thead><tr><th align="left" valign="bottom">gene</th><th align="left" valign="bottom">sequence accession number (NCBI)</th><th align="left" valign="bottom">forward primer (5'–3')</th><th align="left" valign="bottom">reverse primer (5'–3')</th></tr></thead><tbody><tr><td align="left" valign="bottom">Met</td><td align="left" valign="bottom">JN416986.1</td><td align="left" valign="bottom"><named-content content-type="sequence">TACTCCATCCACACAGTCAAGG</named-content></td><td align="left" valign="bottom"><named-content content-type="sequence">TTCCGTGATTCGACGATCTCTC</named-content></td></tr><tr><td align="left" valign="bottom">Kr-h1</td><td align="left" valign="bottom">JN416989.1</td><td align="left" valign="bottom"><named-content content-type="sequence">ACTCCGTCGAATGGTACTAGTG</named-content></td><td align="left" valign="bottom"><named-content content-type="sequence">GTTCTTGCATGGGAGGAAACTG</named-content></td></tr><tr><td align="left" valign="bottom">myo</td><td align="left" valign="bottom">GASN02042720.1</td><td align="left" valign="bottom"><named-content content-type="sequence">TTCAACAAGCAAGCCCACAAG</named-content></td><td align="left" valign="bottom"><named-content content-type="sequence">ACACCGATCCACTACCATTCC</named-content></td></tr><tr><td align="left" valign="bottom">rp49</td><td align="left" valign="bottom">AB689035.1</td><td align="left" valign="bottom"><named-content content-type="sequence">CTAAAGAGGAACTGGCGCAAAC</named-content></td><td align="left" valign="bottom"><named-content content-type="sequence">GTTTAGTCTTCTTGGCGCTTCC</named-content></td></tr></tbody></table></table-wrap><p>On selected samples including young embryos, old embryos, and juveniles we checked which of the possible reference genes would give the most consistent expression levels: we tested rp49 (also known as Ribosome protein L32), Elongation factor-1α, Actin 5 C (β-actin), α− Tub84B (α-tubulin). rp49 appeared most suitable. This choice agrees with other studies in <italic>Thermobia</italic> (<xref ref-type="bibr" rid="bib6">Bai et al., 2020</xref>; <xref ref-type="bibr" rid="bib32">Fernandez-Nicolas et al., 2023</xref>).</p></sec><sec id="s4-6"><title>Immunocytochemistry</title><p>Embryos were dissected and fixed in 3.9% formaldehyde (Thermo Fisher Scientific) in phosphate-buffered saline (PBS; Fisher Scientific) for 30–60 min, then rinsed three times in PBS with1% Triton X100 (PBS-TX; Thermo Fisher Scientific). They were then incubated with agitation in PBS-TX with various combinations of stains for 1–2 days at 4 °C. Tissue stains were propidium iodide (Thermo Fisher Scientific, 1:1000 dilution of 1 mg/ml stock) or DAPI (Thermo Fisher Scientific, 1:1000 dilution of 1 mg/ml stock) for DNA, Alexa-488 conjugated phalloidin (Thermo Fisher Scientific, 1:100 dilution of 200 units/ml stock in methanol) for actin, and Calcofluor White (Sigma Chemical) for cuticle. Stained tissues were repeatedly rinsed, mounted on poly-L-lysine (Sigma-Aldrich) coated coverslips, dehydrated through a graded ethanol series, cleared through three changes of xylene, and mounted in DPX (Sigma-Aldrich).</p><p>A rabbit antibody against phosphohistone H3 (#06–570: anti phosphor-Histone H3 (ser 10); EDM Millipore, Darmstadt, Germany) was used at a 1:1000 dilution to identify mitotic cells. Tissue was preblocked in 2% normal donkey serum (Jackson Immunoresearch Laboratories, West Grove, PA, USA) for 15–30 min, then incubated with the primary antibody over two to three nights. Following five to six rinses in PBS-TX, tissues were incubated with a secondary antibody along with a variety of stains. Secondary antibodies were various Alexa Fluor 488-, 594-, or 647-conjugated donkey antisera raised against rabbit IgG fractions and used at 1:500 (Jackson Immunoresearch Laboratories, West Grove, PA, USA). Selection of the secondary depended on the combination of stains that were used. After staining, tissues were mounted, dehydrated, cleared and mounted as described above. The preparations were imaged on a Zeiss 800 confocal microscope and processed with ImageJ software (<ext-link ext-link-type="uri" xlink:href="http://imagej.nih.gov/ij/">http://imagej.nih.gov/ij/</ext-link>).</p></sec></sec></body><back><sec sec-type="additional-information" id="s5"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="COI-statement" id="conf1"><p>No competing interests declared</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>Conceptualization, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review and editing</p></fn><fn fn-type="con" id="con2"><p>Conceptualization, Methodology, Writing – review and editing</p></fn><fn fn-type="con" id="con3"><p>Formal analysis, Investigation, Methodology, Writing – review and editing</p></fn><fn fn-type="con" id="con4"><p>Formal analysis, Investigation, Methodology, Writing – review and editing</p></fn><fn fn-type="con" id="con5"><p>Formal analysis, Investigation, Methodology, Writing – review and editing</p></fn><fn fn-type="con" id="con6"><p>Formal analysis, Investigation, Methodology</p></fn></fn-group></sec><sec sec-type="supplementary-material" id="s6"><title>Additional files</title><supplementary-material id="mdar"><label>MDAR checklist</label><media xlink:href="elife-92643-mdarchecklist1-v1.docx" mimetype="application" mime-subtype="docx"/></supplementary-material></sec><sec sec-type="data-availability" id="s7"><title>Data availability</title><p>All data generated or analysed during this study are included in the manuscript and supporting files. Source data are provided for Figures 1, 2, 4, 6, and 7. Figure 1—source data 1 provides data used to generate the figure. Figure 2—source data 1 gives data used to juvenile hormone titer during embryogenesis (Figure 2A). Figure 2—source data 2 gives assay data used to generate ecdysteroid levels during embryogenesis. Figure 4—source data 1 provides assay data that determined the effectiveness of precocene amd JHm treatment during embryogenesis. Figure 6—source data 1 provides data showing the subsequent development after treatment with JHm at various times of embryogenesis. Figure 7—source data 1 provides the quantiattive data of pHH3 labeled cells in developing limbs after treatment with JHm at different developmental times.</p></sec><ack id="ack"><title>Acknowledgements</title><p>We thank Helen Chea who generated the early pilot data on JH effects on <italic>Thermobia</italic> embryos during a Research Apprenticeship Course at Friday Harbor Laboratories in 2003. The unpublished studies on <italic>Schistocerca</italic> were carried out while JWT and LMR were on sabbatical leave in the lab of Prof. Michael Akam at the University of Cambridge. The research was supported by a NIH-NIAID R21 award (R21AI167849) to FGN, and project grant 22–21244 S from the Czech Science Foundation, Czech Republic to MN. JWT and LMR were supported by a gift to UW from the Howard Hughes Medical Institute.</p></ack><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aboulafia-Baginsky</surname><given-names>N</given-names></name><name><surname>Pener</surname><given-names>MP</given-names></name><name><surname>Staal</surname><given-names>GB</given-names></name></person-group><year iso-8601-date="1984">1984</year><article-title>Chemical allatectomy of late Locusta embryos by a synthetic precocene and its effect on hopper morphogenesis</article-title><source>Journal of Insect Physiology</source><volume>30</volume><fpage>839</fpage><lpage>852</lpage><pub-id pub-id-type="doi">10.1016/0022-1910(84)90057-X</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Anderson</surname><given-names>DT</given-names></name></person-group><year iso-8601-date="1972">1972a</year><chapter-title>Development of Hemimetabolous insects</chapter-title><person-group person-group-type="editor"><name><surname>Counce</surname><given-names>SJ</given-names></name><name><surname>Waddington</surname><given-names>CH</given-names></name></person-group><source>Developmental Systems: Insects</source><publisher-loc>London</publisher-loc><publisher-name>Academic Press</publisher-name><fpage>95</fpage><lpage>163</lpage></element-citation></ref><ref id="bib3"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Anderson</surname><given-names>DT</given-names></name></person-group><year iso-8601-date="1972">1972b</year><chapter-title>Development of Holometabolous insects</chapter-title><person-group person-group-type="editor"><name><surname>Counce</surname><given-names>SJ</given-names></name><name><surname>Waddington</surname><given-names>CH</given-names></name></person-group><source>Developmental Systems: Insects</source><publisher-loc>London</publisher-loc><publisher-name>Academic Press</publisher-name><fpage>164</fpage><lpage>242</lpage></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Angelini</surname><given-names>DR</given-names></name><name><surname>Kaufman</surname><given-names>TC</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Insect appendages and comparative ontogenetics</article-title><source>Developmental Biology</source><volume>286</volume><fpage>57</fpage><lpage>77</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2005.07.006</pub-id><pub-id pub-id-type="pmid">16112665</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Awasaki</surname><given-names>T</given-names></name><name><surname>Huang</surname><given-names>Y</given-names></name><name><surname>O’Connor</surname><given-names>MB</given-names></name><name><surname>Lee</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Glia instruct developmental neuronal remodeling through TGF-β signaling</article-title><source>Nature Neuroscience</source><volume>14</volume><fpage>821</fpage><lpage>823</lpage><pub-id pub-id-type="doi">10.1038/nn.2833</pub-id><pub-id pub-id-type="pmid">21685919</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bai</surname><given-names>Y</given-names></name><name><surname>Lv</surname><given-names>YN</given-names></name><name><surname>Zeng</surname><given-names>M</given-names></name><name><surname>Jia</surname><given-names>PY</given-names></name><name><surname>Lu</surname><given-names>HN</given-names></name><name><surname>Zhu</surname><given-names>YB</given-names></name><name><surname>Li</surname><given-names>S</given-names></name><name><surname>Cui</surname><given-names>YY</given-names></name><name><surname>Luan</surname><given-names>YX</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Selection of Reference Genes for Normalization of Gene Expression in Thermobia domestica (Insecta: Zygentoma: Lepismatidae)</article-title><source>Genes</source><volume>12</volume><elocation-id>21</elocation-id><pub-id pub-id-type="doi">10.3390/genes12010021</pub-id><pub-id pub-id-type="pmid">33375665</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Baker</surname><given-names>FC</given-names></name><name><surname>Lanzrein</surname><given-names>B</given-names></name><name><surname>Miller</surname><given-names>CA</given-names></name><name><surname>Tsai</surname><given-names>LW</given-names></name><name><surname>Jamieson</surname><given-names>GC</given-names></name><name><surname>Schooley</surname><given-names>DA</given-names></name></person-group><year iso-8601-date="1984">1984</year><article-title>Detection of only JH III in several life-stages of Nauphoeta cinerea and Thermobia domestica</article-title><source>Life Sciences</source><volume>35</volume><fpage>1553</fpage><lpage>1560</lpage><pub-id pub-id-type="doi">10.1016/0024-3205(84)90353-9</pub-id><pub-id pub-id-type="pmid">6482671</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barton</surname><given-names>LJ</given-names></name><name><surname>Sanny</surname><given-names>J</given-names></name><name><surname>Packard Dawson</surname><given-names>E</given-names></name><name><surname>Nouzova</surname><given-names>M</given-names></name><name><surname>Noriega</surname><given-names>FG</given-names></name><name><surname>Stadtfeld</surname><given-names>M</given-names></name><name><surname>Lehmann</surname><given-names>R</given-names></name></person-group><year iso-8601-date="2024">2024</year><article-title>Juvenile hormones direct primordial germ cell migration to the embryonic gonad</article-title><source>Current Biology</source><volume>34</volume><fpage>505</fpage><lpage>518</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2023.12.033</pub-id><pub-id pub-id-type="pmid">38215744</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Beck</surname><given-names>Y</given-names></name><name><surname>Pecasse</surname><given-names>F</given-names></name><name><surname>Richards</surname><given-names>G</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Krüppel-homolog is essential for the coordination of regulatory gene hierarchies in early <italic>Drosophila</italic> development</article-title><source>Developmental Biology</source><volume>268</volume><fpage>64</fpage><lpage>75</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2003.12.017</pub-id><pub-id pub-id-type="pmid">15031105</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Belles</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>The innovation of the final moult and the origin of insect metamorphosis</article-title><source>Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences</source><volume>374</volume><elocation-id>20180415</elocation-id><pub-id pub-id-type="doi">10.1098/rstb.2018.0415</pub-id><pub-id pub-id-type="pmid">31438822</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Belles</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2020">2020a</year><article-title>Krüppel homolog 1 and E93: The doorkeeper and the key to insect metamorphosis</article-title><source>Archives of Insect Biochemistry and Physiology</source><volume>103</volume><elocation-id>e21609</elocation-id><pub-id pub-id-type="doi">10.1002/arch.21609</pub-id><pub-id pub-id-type="pmid">31385626</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Belles</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2020">2020b</year><source>Insect Metamorphosis: From Natural History to Regulation of Development and Evolution</source><publisher-loc>London</publisher-loc><publisher-name>Academic Press</publisher-name></element-citation></ref><ref id="bib13"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Bergot</surname><given-names>BJ</given-names></name><name><surname>Baker</surname><given-names>FC</given-names></name><name><surname>Cerf</surname><given-names>DC</given-names></name><name><surname>Jamieson</surname><given-names>G</given-names></name><name><surname>Schooley</surname><given-names>DA</given-names></name></person-group><year iso-8601-date="1981">1981a</year><chapter-title>Qualitative and quantitative aspects of juvenile hormone titers in developing embryos of several insect species: discovery of a new JH-like substance extracted from eggs of <italic>Manduca Sexta</italic></chapter-title><person-group person-group-type="editor"><name><surname>Pratt</surname><given-names>GE</given-names></name><name><surname>Brooks</surname><given-names>GT</given-names></name></person-group><source>Juvenile Hormone Biochemistry. Action, Agonism, and Antagonism</source><publisher-loc>North Holland, Amsterdam</publisher-loc><publisher-name>Elsevier</publisher-name><fpage>33</fpage><lpage>45</lpage></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bergot</surname><given-names>BJ</given-names></name><name><surname>Ratcliff</surname><given-names>M</given-names></name><name><surname>Schooley</surname><given-names>DA</given-names></name></person-group><year iso-8601-date="1981">1981b</year><article-title>Method for quantitative determination of the four known juvenile hormones in insect tissue using gas chromatography—mass spectroscopy</article-title><source>Journal of Chromatography A</source><volume>204</volume><fpage>231</fpage><lpage>244</lpage><pub-id pub-id-type="doi">10.1016/S0021-9673(00)81664-7</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bitsch</surname><given-names>C</given-names></name><name><surname>Baehr</surname><given-names>JCl</given-names></name><name><surname>Bitsch</surname><given-names>J</given-names></name></person-group><year iso-8601-date="1985">1985</year><article-title>Juvenile hormones inThermobia domestica females: Identification and quantification during biological cycles and after precocene application</article-title><source>Experientia</source><volume>41</volume><fpage>409</fpage><lpage>410</lpage><pub-id pub-id-type="doi">10.1007/BF02004532</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Borst</surname><given-names>DW</given-names></name><name><surname>Laufer</surname><given-names>H</given-names></name><name><surname>Landau</surname><given-names>M</given-names></name><name><surname>Chang</surname><given-names>ES</given-names></name><name><surname>Hertz</surname><given-names>WA</given-names></name><name><surname>Baker</surname><given-names>FC</given-names></name><name><surname>Schooley</surname><given-names>DA</given-names></name></person-group><year iso-8601-date="1987">1987</year><article-title>Methyl farnesoate and its role in crustacean reproduction and development</article-title><source>Insect Biochemistry</source><volume>17</volume><fpage>1123</fpage><lpage>1127</lpage><pub-id pub-id-type="doi">10.1016/0020-1790(87)90133-8</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bowers</surname><given-names>WS</given-names></name><name><surname>Martinez-Pardo</surname><given-names>R</given-names></name></person-group><year iso-8601-date="1977">1977</year><article-title>Antiallatotropins: inhibition of corpus allatum development</article-title><source>Science</source><volume>197</volume><fpage>1369</fpage><lpage>1371</lpage><pub-id pub-id-type="doi">10.1126/science.197.4311.1369</pub-id><pub-id pub-id-type="pmid">17747008</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brand</surname><given-names>P</given-names></name><name><surname>Robertson</surname><given-names>HM</given-names></name><name><surname>Lin</surname><given-names>W</given-names></name><name><surname>Pothula</surname><given-names>R</given-names></name><name><surname>Klingeman</surname><given-names>WE</given-names></name><name><surname>Jurat-Fuentes</surname><given-names>JL</given-names></name><name><surname>Johnson</surname><given-names>BR</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>The origin of the odorant receptor gene family in insects</article-title><source>eLife</source><volume>7</volume><elocation-id>e38340</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.38340</pub-id><pub-id pub-id-type="pmid">30063003</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brüning</surname><given-names>E</given-names></name><name><surname>Saxer</surname><given-names>A</given-names></name><name><surname>Lanzrein</surname><given-names>B</given-names></name></person-group><year iso-8601-date="1985">1985</year><article-title>Methyl farnesoate and juvenile hormone III in normal and precocene treated embryos of the ovoviviparous cockroach <italic>Nauphoeta cinerea</italic></article-title><source>International Journal of Invertebrate Reproduction and Development</source><volume>12</volume><fpage>29</fpage><lpage>44</lpage><pub-id pub-id-type="doi">10.1080/01688170.1985.10510155</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cavallin</surname><given-names>M</given-names></name><name><surname>Fournier</surname><given-names>B</given-names></name></person-group><year iso-8601-date="1981">1981</year><article-title>Characteristics of development and variations in ecdysteroid levels in Clitumnus embryos deprived of their cephalic endocrine glands</article-title><source>Journal of Insect Physiology</source><volume>27</volume><fpage>527</fpage><lpage>534</lpage><pub-id pub-id-type="doi">10.1016/0022-1910(81)90040-8</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chafino</surname><given-names>S</given-names></name><name><surname>Ureña</surname><given-names>E</given-names></name><name><surname>Casanova</surname><given-names>J</given-names></name><name><surname>Casacuberta</surname><given-names>E</given-names></name><name><surname>Franch-Marro</surname><given-names>X</given-names></name><name><surname>Martín</surname><given-names>D</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Upregulation of E93 Gene Expression Acts as the Trigger for Metamorphosis Independently of the Threshold Size in the Beetle Tribolium castaneum</article-title><source>Cell Reports</source><volume>27</volume><fpage>1039</fpage><lpage>1049</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2019.03.094</pub-id><pub-id pub-id-type="pmid">31018122</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Charles</surname><given-names>JP</given-names></name><name><surname>Iwema</surname><given-names>T</given-names></name><name><surname>Epa</surname><given-names>VC</given-names></name><name><surname>Takaki</surname><given-names>K</given-names></name><name><surname>Rynes</surname><given-names>J</given-names></name><name><surname>Jindra</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Ligand-binding properties of a juvenile hormone receptor, Methoprene-tolerant</article-title><source>PNAS</source><volume>108</volume><fpage>21128</fpage><lpage>21133</lpage><pub-id pub-id-type="doi">10.1073/pnas.1116123109</pub-id><pub-id pub-id-type="pmid">22167806</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cohen</surname><given-names>SM</given-names></name><name><surname>Jürgens</surname><given-names>G</given-names></name></person-group><year iso-8601-date="1989">1989</year><article-title>Proximal-distal pattern formation in <italic>Drosophila</italic>: cell autonomous requirement for Distal-less gene activity in limb development</article-title><source>The EMBO Journal</source><volume>8</volume><fpage>2045</fpage><lpage>2055</lpage><pub-id pub-id-type="doi">10.1002/j.1460-2075.1989.tb03613.x</pub-id><pub-id pub-id-type="pmid">16453891</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Cohen</surname><given-names>SM</given-names></name></person-group><year iso-8601-date="1993">1993</year><chapter-title>Imaginal disc development</chapter-title><person-group person-group-type="editor"><name><surname>Bate</surname><given-names>M</given-names></name><name><surname>Martinez-Arias</surname><given-names>A</given-names></name></person-group><source>The Development of Drosophila melanogaster</source><publisher-loc>Plainview</publisher-loc><publisher-name>Cold Spring Harbor Laboratory Press</publisher-name><fpage>747</fpage><lpage>841</lpage></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Daimon</surname><given-names>T</given-names></name><name><surname>Uchibori</surname><given-names>M</given-names></name><name><surname>Nakao</surname><given-names>H</given-names></name><name><surname>Sezutsu</surname><given-names>H</given-names></name><name><surname>Shinoda</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Knockout silkworms reveal a dispensable role for juvenile hormones in holometabolous life cycle</article-title><source>PNAS</source><volume>112</volume><fpage>E4226</fpage><lpage>E4235</lpage><pub-id pub-id-type="doi">10.1073/pnas.1506645112</pub-id><pub-id pub-id-type="pmid">26195792</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dekanty</surname><given-names>A</given-names></name><name><surname>Milán</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>The interplay between morphogens and tissue growth</article-title><source>EMBO Reports</source><volume>12</volume><fpage>1003</fpage><lpage>1010</lpage><pub-id pub-id-type="doi">10.1038/embor.2011.172</pub-id><pub-id pub-id-type="pmid">21886183</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dorn</surname><given-names>A</given-names></name></person-group><year iso-8601-date="1982">1982</year><article-title>Precocene-induced effects and possible role of juvenile hormone during embryogenesis of the milkweed bug <italic>Oncopeltus fasciatus</italic></article-title><source>General and Comparative Endocrinology</source><volume>46</volume><fpage>42</fpage><lpage>52</lpage><pub-id pub-id-type="doi">10.1016/0016-6480(82)90161-7</pub-id><pub-id pub-id-type="pmid">7060934</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Enslee</surname><given-names>EC</given-names></name><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="1977">1977</year><article-title>Morphological effects of juvenile hormone mimics on embryonic development in the bug,Pyrrhocoris apterus</article-title><source>Wilhelm Roux’s Archives of Developmental Biology</source><volume>181</volume><fpage>163</fpage><lpage>181</lpage><pub-id pub-id-type="doi">10.1007/BF00848440</pub-id><pub-id pub-id-type="pmid">28304913</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Erezyilmaz</surname><given-names>DF</given-names></name><name><surname>Riddiford</surname><given-names>LM</given-names></name><name><surname>Truman</surname><given-names>JW</given-names></name></person-group><year iso-8601-date="2004">2004</year><article-title>Juvenile hormone acts at embryonic molts and induces the nymphal cuticle in the direct-developing cricket</article-title><source>Development Genes and Evolution</source><volume>214</volume><fpage>313</fpage><lpage>323</lpage><pub-id pub-id-type="doi">10.1007/s00427-004-0408-2</pub-id><pub-id pub-id-type="pmid">15170568</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fain</surname><given-names>MJ</given-names></name><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="1975">1975</year><article-title>Juvenile hormone titers in the hemolymph during late larval development of the tobacco hornworm, Manduca sexta (L.)</article-title><source>The Biological Bulletin</source><volume>149</volume><fpage>506</fpage><lpage>521</lpage><pub-id pub-id-type="doi">10.2307/1540383</pub-id><pub-id pub-id-type="pmid">1203335</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernandez-Nicolas</surname><given-names>A</given-names></name><name><surname>Belles</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>Juvenile hormone signaling in short germ-band hemimetabolan embryos</article-title><source>Development</source><volume>144</volume><fpage>4637</fpage><lpage>4644</lpage><pub-id pub-id-type="doi">10.1242/dev.152827</pub-id><pub-id pub-id-type="pmid">29122840</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fernandez-Nicolas</surname><given-names>A</given-names></name><name><surname>Machaj</surname><given-names>G</given-names></name><name><surname>Ventos-Alfonso</surname><given-names>A</given-names></name><name><surname>Pagone</surname><given-names>V</given-names></name><name><surname>Minemura</surname><given-names>T</given-names></name><name><surname>Ohde</surname><given-names>T</given-names></name><name><surname>Daimon</surname><given-names>T</given-names></name><name><surname>Ylla</surname><given-names>G</given-names></name><name><surname>Belles</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2023">2023</year><article-title>Reduction of embryonic <italic>E93</italic> expression as a hypothetical driver of the evolution of insect metamorphosis</article-title><source>PNAS</source><volume>120</volume><elocation-id>e2216640120</elocation-id><pub-id pub-id-type="doi">10.1073/pnas.2216640120</pub-id><pub-id pub-id-type="pmid">36745781</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fox</surname><given-names>CW</given-names></name><name><surname>Czesak</surname><given-names>ME</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Evolutionary ecology of progeny size in arthropods</article-title><source>Annual Review of Entomology</source><volume>45</volume><fpage>341</fpage><lpage>369</lpage><pub-id pub-id-type="doi">10.1146/annurev.ento.45.1.341</pub-id><pub-id pub-id-type="pmid">10761581</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Friedrich</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Continuity versus split and reconstitution: exploring the molecular developmental corollaries of insect eye primordium evolution</article-title><source>Developmental Biology</source><volume>299</volume><fpage>310</fpage><lpage>329</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2006.08.027</pub-id><pub-id pub-id-type="pmid">16973149</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Goodman</surname><given-names>WG</given-names></name><name><surname>Granger</surname><given-names>NA</given-names></name></person-group><year iso-8601-date="2005">2005</year><chapter-title>The juvenile hormones</chapter-title><person-group person-group-type="editor"><name><surname>Gilbert</surname><given-names>LI</given-names></name><name><surname>Iatrou</surname><given-names>K</given-names></name><name><surname>Gill</surname><given-names>SS</given-names></name></person-group><source>Comprehensive Molecular Insect Science</source><publisher-loc>Amsterdam</publisher-loc><publisher-name>Elsevier Press</publisher-name><fpage>319</fpage><lpage>408</lpage><pub-id pub-id-type="doi">10.1016/B0-44-451924-6/00039-9</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Goodman</surname><given-names>WG</given-names></name><name><surname>Cusson</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2012">2012</year><chapter-title>The juvenile hormones</chapter-title><person-group person-group-type="editor"><name><surname>Gilbert</surname><given-names>LI</given-names></name></person-group><source>Insect Endocrinology</source><publisher-loc>Amsterdam</publisher-loc><publisher-name>Elsevier</publisher-name><fpage>310</fpage><lpage>365</lpage><pub-id pub-id-type="doi">10.1016/B978-0-12-384749-2.10008-1</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hanley</surname><given-names>K</given-names></name><name><surname>Kömüves</surname><given-names>LG</given-names></name><name><surname>Ng</surname><given-names>DC</given-names></name><name><surname>Schoonjans</surname><given-names>K</given-names></name><name><surname>He</surname><given-names>SS</given-names></name><name><surname>Lau</surname><given-names>P</given-names></name><name><surname>Bikle</surname><given-names>DD</given-names></name><name><surname>Williams</surname><given-names>ML</given-names></name><name><surname>Elias</surname><given-names>PM</given-names></name><name><surname>Auwerx</surname><given-names>J</given-names></name><name><surname>Feingold</surname><given-names>KR</given-names></name></person-group><year iso-8601-date="2000">2000</year><article-title>Farnesol stimulates differentiation in epidermal keratinocytes via PPARalpha</article-title><source>The Journal of Biological Chemistry</source><volume>275</volume><fpage>11484</fpage><lpage>11491</lpage><pub-id pub-id-type="doi">10.1074/jbc.275.15.11484</pub-id><pub-id pub-id-type="pmid">10753967</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Harrington</surname><given-names>BJ</given-names></name><name><surname>Hageage</surname><given-names>GJ</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Calcofluor White: A Review of its Uses and Applications in Clinical Mycology and Parasitology</article-title><source>Laboratory Medicine</source><volume>34</volume><fpage>361</fpage><lpage>367</lpage><pub-id pub-id-type="doi">10.1309/EPH2TDT8335GH0R3</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Haug</surname><given-names>JT</given-names></name><name><surname>Haug</surname><given-names>C</given-names></name><name><surname>Garwood</surname><given-names>RJ</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Evolution of insect wings and development - new details from Palaeozoic nymphs</article-title><source>Biological Reviews of the Cambridge Philosophical Society</source><volume>91</volume><fpage>53</fpage><lpage>69</lpage><pub-id pub-id-type="doi">10.1111/brv.12159</pub-id><pub-id pub-id-type="pmid">25400084</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>He</surname><given-names>LL</given-names></name><name><surname>Shin</surname><given-names>SH</given-names></name><name><surname>Wang</surname><given-names>Z</given-names></name><name><surname>Yuan</surname><given-names>I</given-names></name><name><surname>Weschler</surname><given-names>R</given-names></name><name><surname>Chiou</surname><given-names>A</given-names></name><name><surname>Koyama</surname><given-names>T</given-names></name><name><surname>Nijhout</surname><given-names>HF</given-names></name><name><surname>Suzuki</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Mechanism of threshold size assessment: Metamorphosis is triggered by the TGF-beta/Activin ligand Myoglianin</article-title><source>Insect Biochemistry and Molecular Biology</source><volume>126</volume><elocation-id>103452</elocation-id><pub-id pub-id-type="doi">10.1016/j.ibmb.2020.103452</pub-id><pub-id pub-id-type="pmid">32822817</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>He</surname><given-names>Q</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Kr-h1, a Cornerstone Gene in Insect Life History</article-title><source>Frontiers in Physiology</source><volume>13</volume><elocation-id>905441</elocation-id><pub-id pub-id-type="doi">10.3389/fphys.2022.905441</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Heming</surname><given-names>BS</given-names></name></person-group><year iso-8601-date="2003">2003</year><source>Insect Development and Evolution</source><publisher-loc>Ithaca</publisher-loc><publisher-name>Cornell University Press</publisher-name><pub-id pub-id-type="doi">10.7591/9781501720758</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hendzel</surname><given-names>MJ</given-names></name><name><surname>Wei</surname><given-names>Y</given-names></name><name><surname>Mancini</surname><given-names>MA</given-names></name><name><surname>Van Hooser</surname><given-names>A</given-names></name><name><surname>Ranalli</surname><given-names>T</given-names></name><name><surname>Brinkley</surname><given-names>BR</given-names></name><name><surname>Bazett-Jones</surname><given-names>DP</given-names></name><name><surname>Allis</surname><given-names>CD</given-names></name></person-group><year iso-8601-date="1997">1997</year><article-title>Mitosis-specific phosphorylation of histone H3 initiates primarily within pericentromeric heterochromatin during G2 and spreads in an ordered fashion coincident with mitotic chromosome condensation</article-title><source>Chromosoma</source><volume>106</volume><fpage>348</fpage><lpage>360</lpage><pub-id pub-id-type="doi">10.1007/s004120050256</pub-id><pub-id pub-id-type="pmid">9362543</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hornby</surname><given-names>JM</given-names></name><name><surname>Jensen</surname><given-names>EC</given-names></name><name><surname>Lisec</surname><given-names>AD</given-names></name><name><surname>Tasto</surname><given-names>JJ</given-names></name><name><surname>Jahnke</surname><given-names>B</given-names></name><name><surname>Shoemaker</surname><given-names>R</given-names></name><name><surname>Dussault</surname><given-names>P</given-names></name><name><surname>Nickerson</surname><given-names>KW</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Quorum sensing in the dimorphic fungus Candida albicans is mediated by farnesol</article-title><source>Applied and Environmental Microbiology</source><volume>67</volume><fpage>2982</fpage><lpage>2992</lpage><pub-id pub-id-type="doi">10.1128/AEM.67.7.2982-2992.2001</pub-id><pub-id pub-id-type="pmid">11425711</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Imboden</surname><given-names>H</given-names></name><name><surname>Lanzrein</surname><given-names>B</given-names></name><name><surname>Delbecque</surname><given-names>JP</given-names></name><name><surname>Lüscher</surname><given-names>M</given-names></name></person-group><year iso-8601-date="1978">1978</year><article-title>Ecdysteroids and juvenile hormone during embryogenesis in the ovoviviparous cockroach Nauphoeta cinerea</article-title><source>General and Comparative Endocrinology</source><volume>36</volume><fpage>628</fpage><lpage>635</lpage><pub-id pub-id-type="doi">10.1016/0016-6480(78)90104-1</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ishimaru</surname><given-names>Y</given-names></name><name><surname>Tomonari</surname><given-names>S</given-names></name><name><surname>Matsuoka</surname><given-names>Y</given-names></name><name><surname>Watanabe</surname><given-names>T</given-names></name><name><surname>Miyawaki</surname><given-names>K</given-names></name><name><surname>Bando</surname><given-names>T</given-names></name><name><surname>Tomioka</surname><given-names>K</given-names></name><name><surname>Ohuchi</surname><given-names>H</given-names></name><name><surname>Noji</surname><given-names>S</given-names></name><name><surname>Mito</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>TGF-β signaling in insects regulates metamorphosis via juvenile hormone biosynthesis</article-title><source>PNAS</source><volume>113</volume><fpage>5634</fpage><lpage>5639</lpage><pub-id pub-id-type="doi">10.1073/pnas.1600612113</pub-id><pub-id pub-id-type="pmid">27140602</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jindra</surname><given-names>M</given-names></name><name><surname>Palli</surname><given-names>SR</given-names></name><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>The juvenile hormone signaling pathway in insect development</article-title><source>Annual Review of Entomology</source><volume>58</volume><fpage>181</fpage><lpage>204</lpage><pub-id pub-id-type="doi">10.1146/annurev-ento-120811-153700</pub-id><pub-id pub-id-type="pmid">22994547</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jindra</surname><given-names>M</given-names></name><name><surname>Bellés</surname><given-names>X</given-names></name><name><surname>Shinoda</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Molecular basis of juvenile hormone signaling</article-title><source>Current Opinion in Insect Science</source><volume>11</volume><fpage>39</fpage><lpage>46</lpage><pub-id pub-id-type="doi">10.1016/j.cois.2015.08.004</pub-id><pub-id pub-id-type="pmid">28285758</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jindra</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Where did the pupa come from? The timing of juvenile hormone signalling supports homology between stages of hemimetabolous and holometabolous insects</article-title><source>Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences</source><volume>374</volume><elocation-id>20190064</elocation-id><pub-id pub-id-type="doi">10.1098/rstb.2019.0064</pub-id><pub-id pub-id-type="pmid">31438814</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Jura</surname><given-names>C</given-names></name></person-group><year iso-8601-date="1972">1972</year><chapter-title>Development of Apterygote insects</chapter-title><person-group person-group-type="editor"><name><surname>Counce</surname><given-names>SJ</given-names></name><name><surname>Waddington</surname><given-names>CH</given-names></name></person-group><source>Developmental Systems: Insects</source><publisher-loc>London</publisher-loc><publisher-name>Academic Press</publisher-name><fpage>49</fpage><lpage>94</lpage></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kamsoi</surname><given-names>O</given-names></name><name><surname>Belles</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>Myoglianin triggers the premetamorphosis stage in hemimetabolan insects</article-title><source>FASEB Journal</source><volume>33</volume><fpage>3659</fpage><lpage>3669</lpage><pub-id pub-id-type="doi">10.1096/fj.201801511R</pub-id><pub-id pub-id-type="pmid">30481489</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kamsoi</surname><given-names>O</given-names></name><name><surname>Ventos-Alfonso</surname><given-names>A</given-names></name><name><surname>Casares</surname><given-names>F</given-names></name><name><surname>Almudi</surname><given-names>I</given-names></name><name><surname>Belles</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2021">2021</year><article-title>Regulation of metamorphosis in neopteran insects is conserved in the paleopteran <italic>Cloeon dipterum</italic> (Ephemeroptera)</article-title><source>PNAS</source><volume>118</volume><elocation-id>e2105272118</elocation-id><pub-id pub-id-type="doi">10.1073/pnas.2105272118</pub-id><pub-id pub-id-type="pmid">34417295</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kenyon</surname><given-names>KL</given-names></name><name><surname>Ranade</surname><given-names>SS</given-names></name><name><surname>Curtiss</surname><given-names>J</given-names></name><name><surname>Mlodzik</surname><given-names>M</given-names></name><name><surname>Pignoni</surname><given-names>F</given-names></name></person-group><year iso-8601-date="2003">2003</year><article-title>Coordinating proliferation and tissue specification to promote regional identity in the <italic>Drosophila</italic> head</article-title><source>Developmental Cell</source><volume>5</volume><fpage>403</fpage><lpage>414</lpage><pub-id pub-id-type="doi">10.1016/s1534-5807(03)00243-0</pub-id><pub-id pub-id-type="pmid">12967560</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Klag</surname><given-names>J</given-names></name></person-group><year iso-8601-date="1978">1978</year><article-title>Differentiation of ectodermal cells and cuticle formation during embryogenesis of the firebrat, <italic>Thermobia domestica</italic> (Packard) (Thysanura)</article-title><source>Acta Biologica Cracoviensia Series: Zoologia</source><volume>21</volume><fpage>45</fpage><lpage>55</lpage></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Konopová</surname><given-names>B</given-names></name><name><surname>Zrzavý</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Ultrastructure, development, and homology of insect embryonic cuticles</article-title><source>Journal of Morphology</source><volume>264</volume><fpage>339</fpage><lpage>362</lpage><pub-id pub-id-type="doi">10.1002/jmor.10338</pub-id><pub-id pub-id-type="pmid">15838850</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Konopova</surname><given-names>B</given-names></name><name><surname>Smykal</surname><given-names>V</given-names></name><name><surname>Jindra</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Common and distinct roles of juvenile hormone signaling genes in metamorphosis of holometabolous and hemimetabolous insects</article-title><source>PLOS ONE</source><volume>6</volume><elocation-id>e28728</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0028728</pub-id><pub-id pub-id-type="pmid">22174880</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kukalova-Peck</surname><given-names>J</given-names></name></person-group><year iso-8601-date="1978">1978</year><article-title>Origin and evolution of insect wings and their relation to metamorphosis, as documented by the fossil record</article-title><source>Journal of Morphology</source><volume>156</volume><fpage>53</fpage><lpage>125</lpage><pub-id pub-id-type="doi">10.1002/jmor.1051560104</pub-id><pub-id pub-id-type="pmid">30231597</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lagueux</surname><given-names>M</given-names></name><name><surname>Hetru</surname><given-names>C</given-names></name><name><surname>Goltzene</surname><given-names>F</given-names></name><name><surname>Kappler</surname><given-names>C</given-names></name><name><surname>Hoffmann</surname><given-names>JA</given-names></name></person-group><year iso-8601-date="1979">1979</year><article-title>Ecdysone titre and metabolism in relation to cuticulogenesis in embryos of Locusta migratoria</article-title><source>Journal of Insect Physiology</source><volume>25</volume><fpage>709</fpage><lpage>723</lpage><pub-id pub-id-type="doi">10.1016/0022-1910(77)90116-0</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lanzrein</surname><given-names>B</given-names></name><name><surname>Gentinetta</surname><given-names>V</given-names></name><name><surname>Abegglen</surname><given-names>H</given-names></name><name><surname>Baker</surname><given-names>FC</given-names></name><name><surname>Miller</surname><given-names>CA</given-names></name><name><surname>Schooley</surname><given-names>DA</given-names></name></person-group><year iso-8601-date="1985">1985</year><article-title>Titers of ecdysone, 20-hydroxyecdysone and juvenile hormone III throughout the life cycle of a hemimetabolous insect, the ovoviviparous cockroachNauphoeta cinerea</article-title><source>Experientia</source><volume>41</volume><fpage>913</fpage><lpage>917</lpage><pub-id pub-id-type="doi">10.1007/BF01970010</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Laufer</surname><given-names>H</given-names></name><name><surname>Biggers</surname><given-names>WJ</given-names></name><name><surname>Ahl</surname><given-names>JSB</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Stimulation of ovarian maturation in the crayfish Procambarus clarkii by methyl farnesoate</article-title><source>General and Comparative Endocrinology</source><volume>111</volume><fpage>113</fpage><lpage>118</lpage><pub-id pub-id-type="doi">10.1006/gcen.1998.7109</pub-id><pub-id pub-id-type="pmid">9679083</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Laufer</surname><given-names>H</given-names></name><name><surname>Biggers</surname><given-names>WJ</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Unifying Concepts Learned from Methyl Farnesoate for Invertebrate Reproduction and Post-Embryonic Development</article-title><source>American Zoologist</source><volume>41</volume><fpage>442</fpage><lpage>457</lpage><pub-id pub-id-type="doi">10.1093/icb/41.3.442</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname><given-names>JH</given-names></name><name><surname>Kim</surname><given-names>C</given-names></name><name><surname>Kim</surname><given-names>SH</given-names></name><name><surname>Sethi</surname><given-names>G</given-names></name><name><surname>Ahn</surname><given-names>KS</given-names></name></person-group><year iso-8601-date="2015">2015</year><article-title>Farnesol inhibits tumor growth and enhances the anticancer effects of bortezomib in multiple myeloma xenograft mouse model through the modulation of STAT3 signaling pathway</article-title><source>Cancer Letters</source><volume>360</volume><fpage>280</fpage><lpage>293</lpage><pub-id pub-id-type="doi">10.1016/j.canlet.2015.02.024</pub-id><pub-id pub-id-type="pmid">25697480</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>P</given-names></name><name><surname>Fu</surname><given-names>X</given-names></name><name><surname>Zhu</surname><given-names>J</given-names></name></person-group><year iso-8601-date="2018">2018</year><article-title>Juvenile hormone-regulated alternative splicing of the <italic>taiman</italic> gene primes the ecdysteroid response in adult mosquitoes</article-title><source>PNAS</source><volume>115</volume><fpage>E7738</fpage><lpage>E7747</lpage><pub-id pub-id-type="doi">10.1073/pnas.1808146115</pub-id><pub-id pub-id-type="pmid">30061397</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lozano</surname><given-names>J</given-names></name><name><surname>Kayukawa</surname><given-names>T</given-names></name><name><surname>Shinoda</surname><given-names>T</given-names></name><name><surname>Belles</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>A role for Taiman in insect metamorphosis</article-title><source>PLOS Genetics</source><volume>10</volume><elocation-id>e1004769</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pgen.1004769</pub-id><pub-id pub-id-type="pmid">25356827</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maestro</surname><given-names>JL</given-names></name><name><surname>Pascual</surname><given-names>N</given-names></name><name><surname>Treiblmayr</surname><given-names>K</given-names></name><name><surname>Lozano</surname><given-names>J</given-names></name><name><surname>Bellés</surname><given-names>X</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Juvenile hormone and allatostatins in the German cockroach embryo</article-title><source>Insect Biochemistry and Molecular Biology</source><volume>40</volume><fpage>660</fpage><lpage>665</lpage><pub-id pub-id-type="doi">10.1016/j.ibmb.2010.06.006</pub-id><pub-id pub-id-type="pmid">20542115</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Margam</surname><given-names>VM</given-names></name><name><surname>Gelman</surname><given-names>DB</given-names></name><name><surname>Palli</surname><given-names>SR</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Ecdysteroid titers and developmental expression of ecdysteroid-regulated genes during metamorphosis of the yellow fever mosquito, Aedes aegypti (Diptera: Culicidae)</article-title><source>Journal of Insect Physiology</source><volume>52</volume><fpage>558</fpage><lpage>568</lpage><pub-id pub-id-type="doi">10.1016/j.jinsphys.2006.02.003</pub-id><pub-id pub-id-type="pmid">16580015</pub-id></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mercer</surname><given-names>WF</given-names></name></person-group><year iso-8601-date="1900">1900</year><article-title>The development of wings in the Lepidoptera</article-title><source>Journal of the New York Entomological Society</source><volume>8</volume><fpage>1</fpage><lpage>20</lpage></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Minakuchi</surname><given-names>C</given-names></name><name><surname>Tanaka</surname><given-names>M</given-names></name><name><surname>Miura</surname><given-names>K</given-names></name><name><surname>Tanaka</surname><given-names>T</given-names></name></person-group><year iso-8601-date="2011">2011</year><article-title>Developmental profile and hormonal regulation of the transcription factors broad and Krüppel homolog 1 in hemimetabolous thrips</article-title><source>Insect Biochemistry and Molecular Biology</source><volume>41</volume><fpage>125</fpage><lpage>134</lpage><pub-id pub-id-type="doi">10.1016/j.ibmb.2010.11.004</pub-id><pub-id pub-id-type="pmid">21111817</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Montell</surname><given-names>DJ</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Command and control: regulatory pathways controlling invasive behavior of the border cells</article-title><source>Mechanisms of Development</source><volume>105</volume><fpage>19</fpage><lpage>25</lpage><pub-id pub-id-type="doi">10.1016/s0925-4773(01)00393-8</pub-id><pub-id pub-id-type="pmid">11429278</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Naruse</surname><given-names>S</given-names></name><name><surname>Washidu</surname><given-names>Y</given-names></name><name><surname>Miura</surname><given-names>K</given-names></name><name><surname>Shinoda</surname><given-names>T</given-names></name><name><surname>Minakuchi</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Methoprene-tolerant is essential for embryonic development of the red flour beetle Tribolium castaneum</article-title><source>Journal of Insect Physiology</source><volume>121</volume><elocation-id>104017</elocation-id><pub-id pub-id-type="doi">10.1016/j.jinsphys.2020.104017</pub-id><pub-id pub-id-type="pmid">31972216</pub-id></element-citation></ref><ref id="bib71"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Neville</surname><given-names>AC</given-names></name></person-group><year iso-8601-date="1975">1975</year><source>Biology of Arthropod Cuticle</source><publisher-loc>Berlin, Heidelberg</publisher-loc><publisher-name>Springer-Verlag</publisher-name><pub-id pub-id-type="doi">10.1007/978-3-642-80910-1</pub-id></element-citation></ref><ref id="bib72"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nijhout</surname><given-names>HF</given-names></name><name><surname>Williams</surname><given-names>CM</given-names></name></person-group><year iso-8601-date="1974">1974</year><article-title>Control of moulting and metamorphosis in the tobacco hornworm, Manduca sexta (L.): cessation of juvenile hormone secretion as a trigger for pupation</article-title><source>The Journal of Experimental Biology</source><volume>61</volume><fpage>493</fpage><lpage>501</lpage><pub-id pub-id-type="doi">10.1242/jeb.61.2.493</pub-id><pub-id pub-id-type="pmid">4443741</pub-id></element-citation></ref><ref id="bib73"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nijhout</surname><given-names>HF</given-names></name><name><surname>Wheeler</surname><given-names>DE</given-names></name></person-group><year iso-8601-date="1982">1982</year><article-title>Juvenile Hormone and the Physiological Basis of Insect Polymorphisms</article-title><source>The Quarterly Review of Biology</source><volume>57</volume><fpage>109</fpage><lpage>133</lpage><pub-id pub-id-type="doi">10.1086/412671</pub-id></element-citation></ref><ref id="bib74"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Nijhout</surname><given-names>HF</given-names></name></person-group><year iso-8601-date="1994">1994</year><source>Insect Hormones</source><publisher-loc>Princeton</publisher-loc><publisher-name>Princeton University Press</publisher-name><pub-id pub-id-type="doi">10.1515/9780691225111</pub-id></element-citation></ref><ref id="bib75"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nijhout</surname><given-names>HF</given-names></name><name><surname>Kremen</surname><given-names>C</given-names></name></person-group><year iso-8601-date="1998">1998</year><article-title>Control of pupal commitment in the imaginal disks of Precis coenia (Lepidoptera: Nymphalidae)</article-title><source>Journal of Insect Physiology</source><volume>44</volume><fpage>287</fpage><lpage>296</lpage><pub-id pub-id-type="doi">10.1016/s0022-1910(97)00121-2</pub-id><pub-id pub-id-type="pmid">12769963</pub-id></element-citation></ref><ref id="bib76"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Novák</surname><given-names>VJ</given-names></name></person-group><year iso-8601-date="1969">1969</year><article-title>Morphogenetic analysis of the effects of juvenile hormone analogues and other morphogenetically active substances on embryos of Schistocerca gregaria (Forskål)</article-title><source>Journal of Embryology and Experimental Morphology</source><volume>21</volume><fpage>1</fpage><lpage>21</lpage><pub-id pub-id-type="pmid">5765790</pub-id></element-citation></ref><ref id="bib77"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oh</surname><given-names>KB</given-names></name><name><surname>Miyazawa</surname><given-names>H</given-names></name><name><surname>Naito</surname><given-names>T</given-names></name><name><surname>Matsuoka</surname><given-names>H</given-names></name></person-group><year iso-8601-date="2001">2001</year><article-title>Purification and characterization of an autoregulatory substance capable of regulating the morphological transition in Candida albicans</article-title><source>PNAS</source><volume>98</volume><fpage>4664</fpage><lpage>4668</lpage><pub-id pub-id-type="doi">10.1073/pnas.071404698</pub-id><pub-id pub-id-type="pmid">11274356</pub-id></element-citation></ref><ref id="bib78"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Panfilio</surname><given-names>KA</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Extraembryonic development in insects and the acrobatics of blastokinesis</article-title><source>Developmental Biology</source><volume>313</volume><fpage>471</fpage><lpage>491</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2007.11.004</pub-id><pub-id pub-id-type="pmid">18082679</pub-id></element-citation></ref><ref id="bib79"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Panganiban</surname><given-names>G</given-names></name><name><surname>Rubenstein</surname><given-names>JLR</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Developmental functions of the Distal-less/Dlx homeobox genes</article-title><source>Development</source><volume>129</volume><fpage>4371</fpage><lpage>4386</lpage><pub-id pub-id-type="doi">10.1242/dev.129.19.4371</pub-id><pub-id pub-id-type="pmid">12223397</pub-id></element-citation></ref><ref id="bib80"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Porcheron</surname><given-names>P</given-names></name><name><surname>Moriniere</surname><given-names>M</given-names></name><name><surname>Grassi</surname><given-names>J</given-names></name><name><surname>Pradelles</surname><given-names>P</given-names></name></person-group><year iso-8601-date="1989">1989</year><article-title>Development of an enzyme immunoassay for ecdysteroids using acetylcholinesterase as label</article-title><source>Insect Biochemistry</source><volume>19</volume><fpage>117</fpage><lpage>122</lpage><pub-id pub-id-type="doi">10.1016/0020-1790(89)90081-4</pub-id></element-citation></ref><ref id="bib81"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rafel</surname><given-names>N</given-names></name><name><surname>Milán</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Notch signalling coordinates tissue growth and wing fate specification in <italic>Drosophila</italic></article-title><source>Development</source><volume>135</volume><fpage>3995</fpage><lpage>4001</lpage><pub-id pub-id-type="doi">10.1242/dev.027789</pub-id><pub-id pub-id-type="pmid">18987026</pub-id></element-citation></ref><ref id="bib82"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ramirez</surname><given-names>CE</given-names></name><name><surname>Nouzova</surname><given-names>M</given-names></name><name><surname>Michalkova</surname><given-names>V</given-names></name><name><surname>Fernandez-Lima</surname><given-names>F</given-names></name><name><surname>Noriega</surname><given-names>FG</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Common structural features facilitate the simultaneous identification and quantification of the five most common juvenile hormones by liquid chromatography-tandem mass spectrometry</article-title><source>Insect Biochemistry and Molecular Biology</source><volume>116</volume><elocation-id>103287</elocation-id><pub-id pub-id-type="doi">10.1016/j.ibmb.2019.103287</pub-id><pub-id pub-id-type="pmid">31760138</pub-id></element-citation></ref><ref id="bib83"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Regier</surname><given-names>JC</given-names></name><name><surname>Shultz</surname><given-names>JW</given-names></name><name><surname>Kambic</surname><given-names>RE</given-names></name></person-group><year iso-8601-date="2005">2005</year><article-title>Pancrustacean phylogeny: hexapods are terrestrial crustaceans and maxillopods are not monophyletic</article-title><source>Proceedings. Biological Sciences</source><volume>272</volume><fpage>395</fpage><lpage>401</lpage><pub-id pub-id-type="doi">10.1098/rspb.2004.2917</pub-id><pub-id pub-id-type="pmid">15734694</pub-id></element-citation></ref><ref id="bib84"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Riddiford</surname><given-names>LM</given-names></name><name><surname>Williams</surname><given-names>CM</given-names></name></person-group><year iso-8601-date="1967">1967</year><article-title>The effects of juvenile hormone analogues on the embryonic development of silkworms</article-title><source>PNAS</source><volume>57</volume><fpage>595</fpage><lpage>601</lpage><pub-id pub-id-type="doi">10.1073/pnas.57.3.595</pub-id><pub-id pub-id-type="pmid">16591505</pub-id></element-citation></ref><ref id="bib85"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="1976">1976</year><article-title>Hormonal control of insect epidermal cell commitment in vitro</article-title><source>Nature</source><volume>259</volume><fpage>115</fpage><lpage>117</lpage><pub-id pub-id-type="doi">10.1038/259115a0</pub-id><pub-id pub-id-type="pmid">1246347</pub-id></element-citation></ref><ref id="bib86"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Riddiford</surname><given-names>LM</given-names></name><name><surname>Truman</surname><given-names>JW</given-names></name><name><surname>Mirth</surname><given-names>CK</given-names></name><name><surname>Shen</surname><given-names>Y-C</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>A role for juvenile hormone in the prepupal development of <italic>Drosophila melanogaster</italic></article-title><source>Development</source><volume>137</volume><fpage>1117</fpage><lpage>1126</lpage><pub-id pub-id-type="doi">10.1242/dev.037218</pub-id><pub-id pub-id-type="pmid">20181742</pub-id></element-citation></ref><ref id="bib87"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Rhodnius, Golden Oil, and Met: A History of Juvenile Hormone Research</article-title><source>Frontiers in Cell and Developmental Biology</source><volume>8</volume><elocation-id>679</elocation-id><pub-id pub-id-type="doi">10.3389/fcell.2020.00679</pub-id></element-citation></ref><ref id="bib88"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rohdendorf</surname><given-names>EB</given-names></name><name><surname>Sehnal</surname><given-names>F</given-names></name></person-group><year iso-8601-date="1973">1973</year><article-title>Inhibition of reproduction and embryogenesis in the firebrat, Thermobia domestica, by juvenile hormone analogues</article-title><source>Journal of Insect Physiology</source><volume>19</volume><fpage>37</fpage><lpage>56</lpage><pub-id pub-id-type="doi">10.1016/0022-1910(73)90220-5</pub-id></element-citation></ref><ref id="bib89"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schaeper</surname><given-names>ND</given-names></name><name><surname>Wimmer</surname><given-names>EA</given-names></name><name><surname>Prpic</surname><given-names>NM</given-names></name></person-group><year iso-8601-date="2013">2013</year><article-title>Appendage patterning in the primitively wingless hexapods Thermobia domestica (Zygentoma: Lepismatidae) and Folsomia candida (Collembola: Isotomidae)</article-title><source>Development Genes and Evolution</source><volume>223</volume><fpage>341</fpage><lpage>350</lpage><pub-id pub-id-type="doi">10.1007/s00427-013-0449-5</pub-id><pub-id pub-id-type="pmid">23873479</pub-id></element-citation></ref><ref id="bib90"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schmittgen</surname><given-names>TD</given-names></name><name><surname>Livak</surname><given-names>KJ</given-names></name></person-group><year iso-8601-date="2008">2008</year><article-title>Analyzing real-time PCR data by the comparative C(T) method</article-title><source>Nature Protocols</source><volume>3</volume><fpage>1101</fpage><lpage>1108</lpage><pub-id pub-id-type="doi">10.1038/nprot.2008.73</pub-id><pub-id pub-id-type="pmid">18546601</pub-id></element-citation></ref><ref id="bib91"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schwank</surname><given-names>G</given-names></name><name><surname>Basler</surname><given-names>K</given-names></name></person-group><year iso-8601-date="2010">2010</year><article-title>Regulation of organ growth by morphogen gradients</article-title><source>Cold Spring Harbor Perspectives in Biology</source><volume>2</volume><elocation-id>a001669</elocation-id><pub-id pub-id-type="doi">10.1101/cshperspect.a001669</pub-id><pub-id pub-id-type="pmid">20182606</pub-id></element-citation></ref><ref id="bib92"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smykal</surname><given-names>V</given-names></name><name><surname>Daimon</surname><given-names>T</given-names></name><name><surname>Kayukawa</surname><given-names>T</given-names></name><name><surname>Takaki</surname><given-names>K</given-names></name><name><surname>Shinoda</surname><given-names>T</given-names></name><name><surname>Jindra</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2014">2014</year><article-title>Importance of juvenile hormone signaling arises with competence of insect larvae to metamorphose</article-title><source>Developmental Biology</source><volume>390</volume><fpage>221</fpage><lpage>230</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2014.03.006</pub-id><pub-id pub-id-type="pmid">24662045</pub-id></element-citation></ref><ref id="bib93"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>So</surname><given-names>WL</given-names></name><name><surname>Kai</surname><given-names>Z</given-names></name><name><surname>Qu</surname><given-names>Z</given-names></name><name><surname>Bendena</surname><given-names>WG</given-names></name><name><surname>Hui</surname><given-names>JHL</given-names></name></person-group><year iso-8601-date="2022">2022</year><article-title>Rethinking Sesquiterpenoids: A Widespread Hormone in Animals</article-title><source>International Journal of Molecular Sciences</source><volume>23</volume><elocation-id>5998</elocation-id><pub-id pub-id-type="doi">10.3390/ijms23115998</pub-id><pub-id pub-id-type="pmid">35682678</pub-id></element-citation></ref><ref id="bib94"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Svácha</surname><given-names>P</given-names></name></person-group><year iso-8601-date="1992">1992</year><article-title>What are and what are not imaginal discs: reevaluation of some basic concepts (Insecta, Holometabola)</article-title><source>Developmental Biology</source><volume>154</volume><fpage>101</fpage><lpage>117</lpage><pub-id pub-id-type="doi">10.1016/0012-1606(92)90052-i</pub-id><pub-id pub-id-type="pmid">1426619</pub-id></element-citation></ref><ref id="bib95"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tanaka</surname><given-names>K</given-names></name><name><surname>Truman</surname><given-names>JW</given-names></name></person-group><year iso-8601-date="2007">2007</year><article-title>Molecular patterning mechanism underlying metamorphosis of the thoracic leg in Manduca sexta</article-title><source>Developmental Biology</source><volume>305</volume><fpage>539</fpage><lpage>550</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2007.02.042</pub-id><pub-id pub-id-type="pmid">17418115</pub-id></element-citation></ref><ref id="bib96"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Temin</surname><given-names>G</given-names></name><name><surname>Zander</surname><given-names>M</given-names></name><name><surname>Roussel</surname><given-names>JP</given-names></name></person-group><year iso-8601-date="1986">1986</year><article-title>Physico-chemical (GC-MS) measurements of juvenile hormone III titres during embryogenesis of <italic>Locusta migratoria</italic></article-title><source>International Journal of Invertebrate Reproduction and Development</source><volume>9</volume><fpage>105</fpage><lpage>112</lpage><pub-id pub-id-type="doi">10.1080/01688170.1986.10510184</pub-id></element-citation></ref><ref id="bib97"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Truman</surname><given-names>JW</given-names></name><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="1999">1999</year><article-title>The origins of insect metamorphosis</article-title><source>Nature</source><volume>401</volume><fpage>447</fpage><lpage>452</lpage><pub-id pub-id-type="doi">10.1038/46737</pub-id><pub-id pub-id-type="pmid">10519548</pub-id></element-citation></ref><ref id="bib98"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Truman</surname><given-names>JW</given-names></name><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="2002">2002</year><article-title>Endocrine insights into the evolution of metamorphosis in insects</article-title><source>Annual Review of Entomology</source><volume>47</volume><fpage>467</fpage><lpage>500</lpage><pub-id pub-id-type="doi">10.1146/annurev.ento.47.091201.145230</pub-id><pub-id pub-id-type="pmid">11729082</pub-id></element-citation></ref><ref id="bib99"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Truman</surname><given-names>JW</given-names></name><name><surname>Hiruma</surname><given-names>K</given-names></name><name><surname>Allee</surname><given-names>JP</given-names></name><name><surname>Macwhinnie</surname><given-names>SGB</given-names></name><name><surname>Champlin</surname><given-names>DT</given-names></name><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="2006">2006</year><article-title>Juvenile hormone is required to couple imaginal disc formation with nutrition in insects</article-title><source>Science</source><volume>312</volume><fpage>1385</fpage><lpage>1388</lpage><pub-id pub-id-type="doi">10.1126/science.1123652</pub-id><pub-id pub-id-type="pmid">16741122</pub-id></element-citation></ref><ref id="bib100"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Truman</surname><given-names>JW</given-names></name><name><surname>Riddiford</surname><given-names>LM</given-names></name></person-group><year iso-8601-date="2019">2019</year><article-title>The evolution of insect metamorphosis: a developmental and endocrine view</article-title><source>Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences</source><volume>374</volume><elocation-id>20190070</elocation-id><pub-id pub-id-type="doi">10.1098/rstb.2019.0070</pub-id><pub-id pub-id-type="pmid">31438820</pub-id></element-citation></ref><ref id="bib101"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Untergasser</surname><given-names>A</given-names></name><name><surname>Cutcutache</surname><given-names>I</given-names></name><name><surname>Koressaar</surname><given-names>T</given-names></name><name><surname>Ye</surname><given-names>J</given-names></name><name><surname>Faircloth</surname><given-names>BC</given-names></name><name><surname>Remm</surname><given-names>M</given-names></name><name><surname>Rozen</surname><given-names>SG</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Primer3—new capabilities and interfaces</article-title><source>Nucleic Acids Research</source><volume>40</volume><elocation-id>e115</elocation-id><pub-id pub-id-type="doi">10.1093/nar/gks596</pub-id></element-citation></ref><ref id="bib102"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Upadhyay</surname><given-names>A</given-names></name><name><surname>Moss-Taylor</surname><given-names>L</given-names></name><name><surname>Kim</surname><given-names>MJ</given-names></name><name><surname>Ghosh</surname><given-names>AC</given-names></name><name><surname>O’Connor</surname><given-names>MB</given-names></name></person-group><year iso-8601-date="2017">2017</year><article-title>TGF-β family signaling in <italic>Drosophila</italic></article-title><source>Cold Spr. Harb. Perspect. Biol</source><volume>9</volume><elocation-id>a022152</elocation-id><pub-id pub-id-type="doi">10.1101/cshperspect.a022152</pub-id></element-citation></ref><ref id="bib103"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Upadhyay</surname><given-names>A</given-names></name><name><surname>Peterson</surname><given-names>AJ</given-names></name><name><surname>Kim</surname><given-names>MJ</given-names></name><name><surname>O’Connor</surname><given-names>MB</given-names></name></person-group><year iso-8601-date="2020">2020</year><article-title>Muscle-derived Myoglianin regulates <italic>Drosophila</italic> imaginal disc growth</article-title><source>eLife</source><volume>9</volume><elocation-id>e51710</elocation-id><pub-id pub-id-type="doi">10.7554/eLife.51710</pub-id></element-citation></ref><ref id="bib104"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vea</surname><given-names>IM</given-names></name><name><surname>Tanaka</surname><given-names>S</given-names></name><name><surname>Shiotsuki</surname><given-names>T</given-names></name><name><surname>Jouraku</surname><given-names>A</given-names></name><name><surname>Tanaka</surname><given-names>T</given-names></name><name><surname>Minakuchi</surname><given-names>C</given-names></name></person-group><year iso-8601-date="2016">2016</year><article-title>Differential Juvenile Hormone Variations in Scale Insect Extreme Sexual Dimorphism</article-title><source>PLOS ONE</source><volume>11</volume><elocation-id>e0149459</elocation-id><pub-id pub-id-type="doi">10.1371/journal.pone.0149459</pub-id><pub-id pub-id-type="pmid">26894583</pub-id></element-citation></ref><ref id="bib105"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vincent</surname><given-names>JF</given-names></name></person-group><year iso-8601-date="1980">1980</year><article-title>Insect cuticle: a paradigm for natural composites</article-title><source>Symposia of the Society for Experimental Biology</source><volume>34</volume><fpage>183</fpage><lpage>210</lpage><pub-id pub-id-type="pmid">7020143</pub-id></element-citation></ref><ref id="bib106"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>von Reumont</surname><given-names>BM</given-names></name><name><surname>Jenner</surname><given-names>RA</given-names></name><name><surname>Wills</surname><given-names>MA</given-names></name><name><surname>Dell’Ampio</surname><given-names>E</given-names></name><name><surname>Pass</surname><given-names>G</given-names></name><name><surname>Ebersberger</surname><given-names>I</given-names></name><name><surname>Meyer</surname><given-names>B</given-names></name><name><surname>Koenemann</surname><given-names>S</given-names></name><name><surname>Iliffe</surname><given-names>TM</given-names></name><name><surname>Stamatakis</surname><given-names>A</given-names></name><name><surname>Niehuis</surname><given-names>O</given-names></name><name><surname>Meusemann</surname><given-names>K</given-names></name><name><surname>Misof</surname><given-names>B</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Pancrustacean Phylogeny in the Light of New Phylogenomic Data: Support for Remipedia as the Possible Sister Group of Hexapoda</article-title><source>Molecular Biology and Evolution</source><volume>29</volume><fpage>1031</fpage><lpage>1045</lpage><pub-id pub-id-type="doi">10.1093/molbev/msr270</pub-id></element-citation></ref><ref id="bib107"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Watson</surname><given-names>JAL</given-names></name></person-group><year iso-8601-date="1967">1967</year><article-title>The growth and activity of the corpora allata in the larval firebrat, thermobia domestIca (packard) (thysanura, lepismatidae)</article-title><source>The Biological Bulletin</source><volume>132</volume><fpage>277</fpage><lpage>291</lpage><pub-id pub-id-type="doi">10.2307/1539895</pub-id><pub-id pub-id-type="pmid">29332439</pub-id></element-citation></ref><ref id="bib108"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Williams</surname><given-names>CM</given-names></name></person-group><year iso-8601-date="1961">1961</year><article-title>The juvenile hormone. II. Its role in the endocrine control of molting, pupation, and adult development in the cecropia silkworm</article-title><source>The Biological Bulletin</source><volume>121</volume><fpage>572</fpage><lpage>585</lpage><pub-id pub-id-type="doi">10.2307/1539456</pub-id></element-citation></ref><ref id="bib109"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yanagi</surname><given-names>SI</given-names></name><name><surname>Tuda</surname><given-names>M</given-names></name></person-group><year iso-8601-date="2012">2012</year><article-title>Female size constrains egg size via the influence of reproductive organ size and resource storage in the seed beetle Callosobruchus chinensis</article-title><source>Journal of Insect Physiology</source><volume>58</volume><fpage>1432</fpage><lpage>1437</lpage><pub-id pub-id-type="doi">10.1016/j.jinsphys.2012.08.007</pub-id><pub-id pub-id-type="pmid">23000737</pub-id></element-citation></ref></ref-list></back><sub-article article-type="editor-report" id="sa0"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92643.3.sa0</article-id><title-group><article-title>eLife assessment</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Chipman</surname><given-names>Ariel D</given-names></name><role specific-use="editor">Reviewing Editor</role><aff><institution>The Hebrew University of Jerusalem</institution><country>Israel</country></aff></contrib></contrib-group><kwd-group kwd-group-type="evidence-strength"><kwd>Convincing</kwd></kwd-group><kwd-group kwd-group-type="claim-importance"><kwd>Important</kwd></kwd-group></front-stub><body><p>This <bold>important</bold> study presents findings regarding the role of Juvenile Hormone in development and cell differentiation in the ametabolous insect Thermobia domestica, providing an in-depth analysis of JH's roles in a member of this basally branching group. The evidence supporting the claims of the authors is <bold>convincing</bold>, drawing on a broad range of approaches and variety of experimental techniques. While the interpretation of this work in the wider context - its relevance for the evolution of metamorphosis - is in some places somewhat speculative, the work will be of interest to evolutionary developmental biologists studying the evolution of metamorphosis, and the evolution of insects in general.</p></body></sub-article><sub-article article-type="referee-report" id="sa1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92643.3.sa1</article-id><title-group><article-title>Reviewer #1 (Public Review):</article-title></title-group><contrib-group><contrib contrib-type="author"><anonymous/><role specific-use="referee">Reviewer</role></contrib></contrib-group></front-stub><body><p>Summary:</p><p>This paper provides strong evidence for the roles of JH in an ametabolous insect species. In particular, it demonstrates that:</p><p>• JH shifts embryogenesis from a growth mode to a differentiation mode and is responsible for terminal differentiation during embryogenesis. This, and other JH roles, are first suggested as correlations, based on the timing of JH peaks, but then experimentally demonstrated using JH antagonists and rescue thereof with JH mimic. This is a robust approach and the experimental results are very convincing.</p><p>• JH redirects ecdysone-induced molting to direct formation of a more mature cuticle</p><p>• Kr-h1 is downstream of JH in Thermobia, as it is in other insects, and is a likely mediator of many JH effects</p><p>• The results support the proposed model that an ancestral role of JH in promoting and maintaining differentiation was coopted during insect radiations to drive the evolution of metamorphosis. However, alternate evolutionary scenarios should also be considered.</p><p>Strengths:</p><p>Overall, this is a beautiful, in-depth student. The paper is well-written and clear. The background places the work in a broad context and shows its importance in understanding fundamental questions about insect biology. The researchers are leaders in the field, and a strength of this manuscript is their use of a variety of different approaches (enzymatic assays, gene expression, agonists &amp; antagonists, analysis of morphology using different types of microscopy and detection, and more) to attack their research questions. The experimental data is clearly presented and carefully executed with appropriate controls and attention to detail. The 'multi-pronged' approach provides support for the conclusions from different angles, strengthening conclusions. In sum, the data presented are convincing and the conclusions about experimental outcomes are well-justified based on the results obtained.</p><p>Weaknesses:</p><p>This paper provides more detail than is likely needed for readers outside the field but also provides sufficient depth for those in the field. This is both a strength and a weakness. I would suggest the authors shorten some aspects of their text to make it more accessible to a broader audience. In particular, the discussion is very long and accompanied by two model figures. The discussion could be tightened up and much of the text used for a separate review article (perhaps along with Figure 11) that would bring more attention to the proposed evolution of JH roles.</p></body></sub-article><sub-article article-type="referee-report" id="sa2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92643.3.sa2</article-id><title-group><article-title>Reviewer #2 (Public Review):</article-title></title-group><contrib-group><contrib contrib-type="author"><anonymous/><role specific-use="referee">Reviewer</role></contrib></contrib-group></front-stub><body><p>The authors have studied in detail the embryogenesis of the ametabolan insect Thermobia domestica. They have also measured the levels of the two most important hormones in insect development: juvenile hormone (JH) and ecdysteroids. The work then focuses on JH, whose occurrence concentrates in the final part (between 70 and 100%) of embryo development. Then, the authors used a precocene compound (7-ethoxyprecocene, or 7EP) to destroy the JH producing tissues in the embryo of the firebrat T. domestica, which allowed to unveil that this hormone is critically involved in the last steps of embryogenesis. The 7EP-treated embryos failed to resorb the extraembryonic fluid and did not hatch. More detailed observations showed that processes like the maturational growth of the eye, the lengthening of the foregut and posterior displacement of the midgut, and the detachment of the E2 cuticle, were impaired after the 7EP treatment. Importantly, a treatment with a JH mimic subsequent to the 7EP treatment restored the correct maturation of both the eye and the gut. It is worth noting that the timing of JH mimic application was essential for correcting the defects triggered by the treatment with 7EP.</p><p>This is a relevant result in itself since the role of JH in insect embryogenesis is a controversial topic. It seems to have an important role in hemimetabolan embryogenesis, but not so much in holometabolans. Intriguingly, it appears important for hatching, an observation made in hemimetabolan and in holometabolan embryos. Knowing that this role was already present in ametabolans is relevant from an evolutionary point of view, and knowing exactly why embryos do not hatch in the absence of JH, is relevant from the point of view of developmental biology.</p><p>Then, the authors describe a series of experiments applying the JH mimic in early embryogenesis, before the natural peak of JH occurs, and its effects on embryo development. Observations were made under different doses of JHm, and under different temporal windows of treatment. Higher doses triggered more severe effects, as expected, and different windows of application produced different effects. The most used combination was 1 ng JHm applied 1.5 days AEL, checking the effects 3 days later. Of note, 1.5 days AEL is about 15% embryonic development, whereas the natural peak of JH occurs around 85% embryonic development. In general, the ectopic application of JHm triggered a diversity of effects, generally leading to an arrest of development. Intriguingly, however, a number of embryos treated with 1 ng of JHm at 1.5 days AEL showed a precocious formation of myofibrils in the longitudinal muscles. Also, a number of embryos treated in the same way showed enhanced chitin deposition in the E1 procuticle and showed an advancement of at least a day in the deposition of the E2 cuticle.</p><p>While the experiments and observations are done with great care and are very exhaustive, I am not sure that the results reveal genuine JH functions. The effects triggered by a significant pulse of ectopic JHm when the embryo is 15% of the development will depend on the context: the transcriptome existing at that time, especially the cocktail of transcription factors. This explains why different application times produce different effects. This also explains why the timing of JHm application was essential for correcting the effects of 7EP treatment. In this reasoning, we must consider that the context at 85% development, when the JH peaks in natural conditions and plays its genuine functions, must be very different from the context at 15% development, when the JHm was applied in most of the experiments. In summary, I believe that the observations after the application of JHm reveal effects of the ectopic JHm, but not necessarily functions of the JH. If so, then the subsequent inferences made from the premise that these ectopic treatments with JHm revealed JH functions are uncertain and should be interpreted with caution.</p><p>Those inferences affect not only the &quot;JH and the progressive nature of embryonic molts&quot; section, but also, the &quot;Modifications in JH function during the evolution of hemimetabolous and holometabolous life histories&quot; section, and the entire &quot;Discussion&quot;. In addition to inferences built on uncertain functions, the sections mentioned, especially the Discussion, I think suffer from too many poorly justified speculations. I love speculation in science, it is necessary and fruitful. But it must be practiced within limits of reasonableness, especially when expressed in a formal journal.</p><p>Finally, In the section &quot;Modifications in JH function during the evolution of hemimetabolous and holometabolous life&quot;, it is not clear the bridge that connects the observations on the embryo of Thermobia and the evolution of modified life cycles, hemimetabolan and holometabolan.</p></body></sub-article><sub-article article-type="referee-report" id="sa3"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92643.3.sa3</article-id><title-group><article-title>Reviewer #3 (Public Review):</article-title></title-group><contrib-group><contrib contrib-type="author"><anonymous/><role specific-use="referee">Reviewer</role></contrib></contrib-group></front-stub><body><p>Summary:</p><p>In this manuscript, the authors use inhibitors and mimetics of juvenile hormone (JH) to demonstrate that JH has a key role in late embryonic development in Thermobia, specifically in gut and eye development but also resorption of the extraembryonic fluid and hatching. They then exogenously apply JH early in development (when it is not normally present) to examine the biological effects of JH at these stages. This causes a plethora of defects including developmental arrest, deposition of chitin, limb development, and enhanced muscle differentiation. The authors interpret these early effects on development as JH being important for the shift from morphogenetic growth to differentiation - a role that they speculate may have facilitated the evolution of metamorphosis (hemi- and holo-metaboly). This paper will be of interest to insect evo-devo researchers, particularly those with interests in the evolution of metamorphosis.</p><p>Strengths:</p><p>The experiments are generally conducted very well with appropriate controls and the authors have included a very detailed analysis of the phenotypes.</p><p>The manuscript significantly advances our understanding of Thermobia development and the role of JH in Thermobia development.</p><p>The authors interpret this data to present some hypotheses regarding the role of JH in the evolution of metamorphosis, some aspects of which can be addressed by future studies.</p><p>Weaknesses:</p><p>The results are based on using inhibitors and mimetics of JH and there was no attempt to discern immediate effects of JH from downstream effects. The authors show, for instance, that the transcription of myoglianin is responsive to JH levels, it would have been interesting to see if any of the phenotypic effects are due to myoglianin upregulation/suppression (using RNAi for example). These kinds of experiments will be necessary to fully work out if and how the JH regulatory network has been co-opted into metamorphosis.</p><p>The results generally support the authors' conclusions. However, the discussion contains a lot of speculation and some far-reaching conclusions are made about the role of JH and how it became co-opted into controlling metamorphosis. There are some interesting hypotheses presented and the author's speculations are consistent with the data presented. However, it is difficult to make evolutionary inferences from a single data point as although Thermobia is a basally branching insect, the lineage giving rise to Thermobia diverged from the lineages giving rise to the holo- and hemimetabolous insects approx.. 400 mya and it is possible that the effects of JH seen in Thermobia reflect lineage-specific effects rather than the 'ancestral state'. The authors ignore the possibility that there has been substantial rewiring of the networks that are JH responsive across these 400 my. I would encourage the authors to temper some of the discussion of these hypotheses and include some of the limitations of their inferences regarding the role of JH in the evolution of metamorphosis in their discussion.</p></body></sub-article><sub-article article-type="author-comment" id="sa4"><front-stub><article-id pub-id-type="doi">10.7554/eLife.92643.3.sa4</article-id><title-group><article-title>Author response</article-title></title-group><contrib-group><contrib contrib-type="author"><name><surname>Truman</surname><given-names>James W</given-names></name><role specific-use="author">Author</role><aff><institution>University of Washington</institution><addr-line><named-content content-type="city">Friday Harbor</named-content></addr-line><country>United States</country></aff></contrib><contrib contrib-type="author"><name><surname>Riddiford</surname><given-names>Lynn M</given-names></name><role specific-use="author">Author</role><aff><institution>University of Washington</institution><addr-line><named-content content-type="city">Friday Harbor</named-content></addr-line><country>United States</country></aff></contrib><contrib contrib-type="author"><name><surname>Konopova</surname><given-names>Barbora</given-names></name><role specific-use="author">Author</role><aff><institution>University of South Bohemia in Ceske Budejovice</institution><addr-line><named-content content-type="city">Ceske Budejovice</named-content></addr-line><country>Czech Republic</country></aff></contrib><contrib contrib-type="author"><name><surname>Nouzova</surname><given-names>Marcela</given-names></name><role specific-use="author">Author</role><aff><institution>Biology Centre of Czech Academy of Sciences</institution><addr-line><named-content content-type="city">Ceske Budejovive</named-content></addr-line><country>Czech Republic</country></aff></contrib><contrib contrib-type="author"><name><surname>Noriega</surname><given-names>Fernando</given-names></name><role specific-use="author">Author</role><aff><institution>Florida International University</institution><addr-line><named-content content-type="city">Miami</named-content></addr-line><country>United States</country></aff></contrib><contrib contrib-type="author"><name><surname>Herko</surname><given-names>Michelle</given-names></name><role specific-use="author">Author</role><aff><institution>University of Washington</institution><addr-line><named-content content-type="city">Friday Harbor</named-content></addr-line><country>United States</country></aff></contrib></contrib-group></front-stub><body><p>The following is the authors’ response to the original reviews.</p><p>We appreciate the care and the detail shown by the Reviewers. Their comments have made our article more focused and more accessible to a general audience.</p><p>We would like to begin with a comment about the last sentence of the “eLife assessment”. The evolution of metamorphosis in insects was a major triumph in animal evolution that subsequently impacted almost every aspect of plant and animal evolution in the terrestrial and freshwater aquatic biospheres. Unlike the metamorphoses of most other groups, whose evolutions are lost in time, insect evolution arose relatively recently (~400 mya) and insect orders have branched off at various points in this evolution and have persisted to modern times. Although these “relic” groups also have undergone millions of years of evolution and specialization, they still provide us with windows into how this progression may have come about. The study of these groups provides a unique opportunity to explore the mechanisms that underlie major life history shifts and should be of interest to anyone interested in evolution – not just entomologists.</p><disp-quote content-type="editor-comment"><p><bold>Reviewer #1 (Public Review):</bold></p><p>Summary:</p><p>This paper provides strong evidence for the roles of JH in an ametabolous insect species. In particular, it demonstrates that:</p><p>• JH shifts embryogenesis from a growth mode to a differentiation mode and is responsible for terminal differentiation during embryogenesis. This, and other JH roles, are first suggested as correlations, based on the timing of JH peaks, but then experimentally demonstrated using JH antagonists and rescue thereof with JH mimic. This is a robust approach and the experimental results are very convincing.</p><p>• JH redirects ecdysone-induced molting to direct formation of a more mature cuticle</p><p>• Kr-h1 is downstream of JH in Thermobia, as it is in other insects, and is a likely mediator of many JH effects</p><p>• The results support the proposed model that an ancestral role of JH in promoting and maintaining differentiation was coopted during insect radiations to drive the evolution of metamorphosis. However, alternate evolutionary scenarios should also be considered.</p><p>Strengths:</p><p>Overall, this is a beautiful, in-depth student. The paper is well-written and clear. The background places the work in a broad context and shows its importance in understanding fundamental questions about insect biology. The researchers are leaders in the field, and a strength of this manuscript is their use of a variety of different approaches (enzymatic assays, gene expression, agonists &amp; antagonists, analysis of morphology using different types of microscopy and detection, and more) to attack their research questions. The experimental data is clearly presented and carefully executed with appropriate controls and attention to detail. The 'multi-pronged' approach provides support for the conclusions from different angles, strengthening conclusions. In sum, the data presented are convincing and the conclusions about experimental outcomes are well-justified based on the results obtained.</p><p>Weaknesses:</p><p>This paper provides more detail than is likely needed for readers outside the field but also provides sufficient depth for those in the field. This is both a strength and a weakness. I would suggest the authors shorten some aspects of their text to make it more accessible to a broader audience. In particular, the discussion is very long and accompanied by two model figures. The discussion could be tightened up and much of the text used for a separate review article (perhaps along with Figure 11) that would bring more attention to the proposed evolution of JH roles.</p></disp-quote><p>We appreciate the comments about the strengths and weaknesses of the paper. To deal with the weaknesses, we have condensed some of the Results to make them less cumbersome and the Discussion has been completely revised, keeping a sharp focus on the actions of JH in Thermobia embryos and how these actions relate to the status quo functions of JH in insects with metamorphosis. As part of the revision of the Discussion, we have replaced Figures 10 and 11.</p><disp-quote content-type="editor-comment"><p><bold>Reviewer #1 (Recommendations For The Authors):</bold></p><p>In keeping with my public review, this paper is very strong and I have very few suggestions for improvement. They are:</p><p>(1) Thermobia are extant insects and are not ancestral insects. It is likely that they retain features found in an insect ancestor. However, these insects have been evolving for a very long time, and for any one feature, many changes may have occurred, both gain and loss of gene function and morphology. Further, even for morphological features present in an extant species that are the same as an ancestor, genetic pathways regulating this feature may have changed over time (see for examples papers from the Haag and Pick labs). Although I realize this is a small, possibly almost semantic point, I feel it is important to be precise here. For example, in the title, &quot;before&quot; is speculative as there could have been a different role in the ancestor with the role in embryogenesis arising in lineages leading to Thermobia; similarly in the abstract, &quot;this ancestral role of JH' is an overstatement since we cannot actually measure the ancestral role.</p></disp-quote><p>Since the title has already been cited in a Perspectives review, we decided to keep the title as is.</p><disp-quote content-type="editor-comment"><p>(2) I don't understand the results in Met and myo in Fig. 3B. Perhaps include them in the explanation of Fig.3 and not after the description of Fig. 4 and explain them in more detail (or perhaps not include them at all?). I don't really understand the statistical analysis of these panels either.</p></disp-quote><p>We have revised the figure legends to explain the statistics.</p><disp-quote content-type="editor-comment"><p>(3) Another point regarding language - talking about the embryo being &quot;able&quot; to go through a developmental stage implies decision-making. I would suggest dropping that wording (e.g, in the description of Fig. 5C). Similarly, in explaining Fig. 6B, it would be more correct to say &quot;JH treatment no longer inhibited&quot; than as written &quot;could no longer inhibit&quot; (implying 'no matter how hard it tried, it still couldn't do it')</p></disp-quote><p>We have removed the “can’t” wording. Figure 6 has been revised</p><disp-quote content-type="editor-comment"><p><bold>Reviewer #2 (Public Review):</bold></p><p>The authors have studied in detail the embryogenesis of the ametabolan insect Thermobia domestica. They have also measured the levels of the two most important hormones in insect development: juvenile hormone (JH) and ecdysteroids. The work then focuses on JH, whose occurrence concentrates in the final part (between 70 and 100%) of embryo development. Then, the authors used a precocene compound (7-ethoxyprecocene, or 7EP) to destroy the JH producing tissues in the embryo of the firebrat T. domestica, which allowed to unveil that this hormone is critically involved in the last steps of embryogenesis. The 7EP-treated embryos failed to resorb the extraembryonic fluid and did not hatch. More detailed observations showed that processes like the maturational growth of the eye, the lengthening of the foregut and posterior displacement of the midgut, and the detachment of the E2 cuticle, were impaired after the 7EP treatment. Importantly, a treatment with a JH mimic subsequent to the 7EP treatment restored the correct maturation of both the eye and the gut. It is worth noting that the timing of JH mimic application was essential for correcting the defects triggered by the treatment with 7EP.</p><p>This is a relevant result in itself since the role of JH in insect embryogenesis is a controversial topic. It seems to have an important role in hemimetabolan embryogenesis, but not so much in holometabolans. Intriguingly, it appears important for hatching, an observation made in hemimetabolan and in holometabolan embryos. Knowing that this role was already present in ametabolans is relevant from an evolutionary point of view, and knowing exactly why embryos do not hatch in the absence of JH, is relevant from the point of view of developmental biology.</p></disp-quote><p>The unique and intriguing aspect of juvenile hormone is its status quo action in the control of metamorphosis. Our reason for dealing with an insect group that branched off from the line of insects that eventually evolved metamorphosis, was to gain insight into the ancestral functions of this hormone. Our data from Thermobia as well as that from grasshoppers and crickets indicate that the developmental actions of JH were originally confined to embryogenesis where it promoted the terminal differentiation of the embryo. Its actions in promoting differentiation also included suppressing morphogenesis. This latter function was not pronounced during embryogenesis because JH only appeared after morphogenesis was essentially completed. However, it was a preadaptation that proved useful in more derived insects that delayed aspects of morphogenesis into the postembryonic realm. JH was then used postembryonically to inhibit morphogenesis until late in juvenile growth when JH disappears, and this inhibition is released.</p><disp-quote content-type="editor-comment"><p>Then, the authors describe a series of experiments applying the JH mimic in early embryogenesis, before the natural peak of JH occurs, and its effects on embryo development. Observations were made under different doses of JHm, and under different temporal windows of treatment. Higher doses triggered more severe effects, as expected, and different windows of application produced different effects. The most used combination was 1 ng JHm applied 1.5 days AEL, checking the effects 3 days later. Of note, 1.5 days AEL is about 15% embryonic development, whereas the natural peak of JH occurs around 85% embryonic development. In general, the ectopic application of JHm triggered a diversity of effects, generally leading to an arrest of development. Intriguingly, however, a number of embryos treated with 1 ng of JHm at 1.5 days AEL showed a precocious formation of myofibrils in the longitudinal muscles. Also, a number of embryos treated in the same way showed enhanced chitin deposition in the E1 procuticle and showed an advancement of at least a day in the deposition of the E2 cuticle.</p><p>While the experiments and observations are done with great care and are very exhaustive, I am not sure that the results reveal genuine JH functions. The effects triggered by a significant pulse of ectopic JHm when the embryo is 15% of the development will depend on the context: the transcriptome existing at that time, especially the cocktail of transcription factors. This explains why different application times produce different effects. This also explains why the timing of JHm application was essential for correcting the effects of 7EP treatment. In this reasoning, we must consider that the context at 85% development, when the JH peaks in natural conditions and plays its genuine functions, must be very different from the context at 15% development, when the JHm was applied in most of the experiments. In summary, I believe that the observations after the application of JHm reveal effects of the ectopic JHm, but not necessarily functions of the JH. If so, then the subsequent inferences made from the premise that these ectopic treatments with JHm revealed JH functions are uncertain and should be interpreted with caution.</p></disp-quote><p>We disagree with the reviewer. An analogous situation would be in exploring gene function in which both gain-of-function and loss-of-function experiments often provide complementary insights into how a gene functions. We see JH effects only when its receptor, Met, is present and JH can induce its main effector protein, Kr-h1. The latter gives us confidence that we are looking at bona fide JH effects. We have also kept in mind, though, that the nature of the responding tissues is changing through time. Nevertheless, we see a consistent pattern of responses in the embryo and these can be related to its postembryonic effects in metamorphic insects.</p><disp-quote content-type="editor-comment"><p>Those inferences affect not only the &quot;JH and the progressive nature of embryonic molts&quot; section, but also, the &quot;Modifications in JH function during the evolution of hemimetabolous and holometabolous life histories&quot; section, and the entire &quot;Discussion&quot;. In addition to inferences built on uncertain functions, the sections mentioned, especially the Discussion, I think suffer from too many poorly justified speculations. I love speculation in science, it is necessary and fruitful. But it must be practiced within limits of reasonableness, especially when expressed in a formal journal.</p></disp-quote><p>We have tried to dial back the speculation.</p><disp-quote content-type="editor-comment"><p>Finally, In the section &quot;Modifications in JH function during the evolution of hemimetabolous and holometabolous life&quot;, it is not clear the bridge that connects the observations on the embryo of Thermobia and the evolution of modified life cycles, hemimetabolan and holometabolan.</p></disp-quote><p>Our Figure 12 should put this into perspective.</p><disp-quote content-type="editor-comment"><p><bold>Reviewer #2 (Recommendations For The Authors):</bold></p><p>Main points</p><p>(1) Please, reduce the level of overinterpretation of ectopic treatment experiments with JHm, since the resulting observations represent effects, but not necessarily functions of JH.</p></disp-quote><p>We have revised this section to indicate that the “effects” of ectopic treatments provide insights into the function of JH. Using a genetic analogy, both “loss-of-function” and “gain-of-function” experiments provide insights into a given gene. (see response to Public Comments)</p><disp-quote content-type="editor-comment"><p>(2) Especially in the sections &quot;JH and the progressive nature of embryonic molts&quot; and &quot;Modifications in JH function during the evolution of hemimetabolous and holometabolous life histories&quot;, and the entire &quot;Discussion&quot;, please keep the level of speculation within reasonable limits, avoiding especially the inference of conclusions on the basis of speculation, itself based on previous speculation.</p></disp-quote><p>We have toned down some of the speculation and provided reasons why it is worth suggesting.</p><disp-quote content-type="editor-comment"><p>(3) Please revisit the argued roles of myoglianin in the story, in light of its effects as an inhibitor of JH production, repressing the expression of JHAMT, as has been reliably demonstrated in hemimetabolan species (DOI: 10.1073/pnas.1600612113 and DOI: 10.1096/ fj.201801511R).</p></disp-quote><p>Our appreciation to the reviewer. We are more explicit about the relationship between JH and myo.</p><disp-quote content-type="editor-comment"><p>Minor points</p><p>(4) Please keep the consistency of the scientific binomial nomenclature for the species mentioned. For example, read &quot;Manduca sexta&quot; (in italics) at the first mention, and then &quot;M. sexta&quot; (in italics) in successive mentions (instead of reading &quot;Manduca&quot; on page 17, and then &quot;Manduca sexta&quot; on page 18, for example). The same for &quot;<italic>Drosophila</italic>&quot; (&quot;<italic>Drosophila melanogaster</italic>&quot; first, and then &quot;<italic>D. melanogaster</italic>&quot;), &quot;Thermobia&quot; (&quot;Thermobia domestica&quot; first, and then &quot;T. domestica&quot;), etc. In the figure legends, I recommend using the complete name: Thermobia domestica, in the main heading.</p></disp-quote><p>Where there is no possibility of confusion, we intend to use Thermobia, rather than T. domestica, etc. We think that it is easier for a non-specialist to read and it is commonly done in endocrine papers.</p><disp-quote content-type="editor-comment"><p>(5) There is no purpose in evolution and biological processes. Thus, I suggest avoiding expressions that have a teleological aftertaste. For example (capitals are mine), on p. 3 &quot;appears to have been extended into postembryonic life where it acts TO antagonize morphogenic and allow the maintenance of a juvenile state&quot;.</p></disp-quote><p>We have tried to avoid teleological wording.</p><disp-quote content-type="editor-comment"><p>(6) The title &quot;The embryonic role of juvenile hormone in the firebrat, Thermobia domestica, reveals its function before its involvement in metamorphosis&quot; contains a redundancy (&quot;role&quot; and &quot;function&quot;), and an apparent obviousness (&quot;before its involvement in metamorphosis&quot;). I suggest a more straightforward title. Something like &quot;Juvenile hormone plays developmental functions in the embryo of the firebrat Thermobia domestica, which predate its status quo action in metamorphosis&quot;.</p></disp-quote><p>As noted above, we are retaining the title since it has already been cited.</p><disp-quote content-type="editor-comment"><p>(7) Page 2. &quot;The transition from larva to adult then occurred through a transitional stage, the pupa, thereby providing the three-part life history diagnostic of the &quot;complete metamorphosis&quot; exhibited by holometabolous insects (reviews: Jindra, 2019; Truman &amp; Riddiford, 2002, 2019)&quot;. I suggest adding the reference ISBN: 9780128130209 9 7 8 - 0 - 1 2 - 8 1 3 0 2 0 - 9, as the most comprehensive and recent review on complete metamorphosis.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(8) Page 3. &quot;These severe developmental effects suggest that the developmental role of JH in insects was initially CONFINED to the embryonic domain&quot; (capitals are mine). This appears contradictory with the observations of Watson, 1967, on the relationships between the apparition of scales and JH, mentioned shortly before by the authors.</p></disp-quote><p>This is explained in the Discussion. Although JH can suppress scale appearance in the J4 stage, we have not been able to show that scales appearance is caused by changes in the juvenile JH titer.</p><disp-quote content-type="editor-comment"><p>(9) Page 4. &quot;we measured JH III levels during Thermobia embryogenesis at daily intervals starting at 5 d AEL&quot;. Why not before, like in the case of ecdysteroids? The authors might perhaps argue that the levels of Kr-h1 expression are consistently low from the very beginning, according to Fernandez-Nicolas et al, 2022 (reference cited later in the manuscript).</p><p>(10) Page 4. &quot;Ecdysteroid titers through embryogenesis and the early juvenile instars were measured using the enzyme immunoassay method (Porcheron et al., 1989) that is optimized for detecting 20-hydroxyecdysone (20E)&quot;. The antibody generated by Porcheron (and now sold by Cayman) recognizes ecdysone and 20-hydroxyecdysone alike. But that's not relevant here. I would refer to &quot;ecdysteroids&quot; when mentioning measurements. Also in figure 2B (and &quot;juvenile hormone III&quot; without the formula, in Panel A, for harmonization). And I would not expand on specifications, like those at the beginning of page 5, or towards the end of page</p></disp-quote><p>We thank the reviewer for this important correction.</p><disp-quote content-type="editor-comment"><p>(12) (&quot;the fact that we detected only a slight rise in ecdysteroids at this time (Fig 2B) is likely due to the assay that we used being designed to detect 20E rather than ecdysone&quot;).</p></disp-quote><p>Omitted.</p><disp-quote content-type="editor-comment"><p>(11) Page 5. &quot;Low levels of Kr-h1 transcripts were present at 12 hr after egg deposition, but then were not detected until about 6 d AEL when JH-III first appeared&quot;. There is a very precise Kr-h1 pattern in Fernandez-Nicolas et al. 2023 (reference mentioned later in the manuscript).</p><p>(12) Page 5. &quot;notably myoglianin (myo), have become prominent as agents that promote the competence and execution of metamorphosis in holometabolous and hemimetabolous insects (He et al., 2020; Awasaki et al., 2011)&quot;. See my note 3 above.</p></disp-quote><p>The myoglianin issue has been revised.</p><disp-quote content-type="editor-comment"><p>(13) Page 5. &quot;a drug that suppresses JH production&quot;. Rather, &quot;a drug that destroys the JH producing tissues&quot;. Why the way, do the authors know when the CA are formed in T. domestica embryo development?</p></disp-quote><p>We prefer to keep our original wording. There have been some cases in which precocene has blocked JH production but did not kill the CA cells. We do not have observations that show that 7EP kills the CA cells in Thermobia embryos.</p><disp-quote content-type="editor-comment"><p>(14) Page 5. &quot;subsequent treatment with a JHm&quot;. I would say here that the JHm is pyriproxyfen, not on page 6 or page 7. Thus, to be consistent, after the first mention of &quot;pyriproxyfen (JHm)&quot; on page 5, I'd consistently use the abbreviation &quot;JHm&quot;.</p><p>(15) Page 9. &quot;Limb loss in such embryos was often STOCHASTIC, i.e., in a given embryo some limbs were completely lost while others were maintained in a reduced state&quot; (capitals are mine). The meaning of &quot;stochastic&quot; is random, involving a random variable; it is a concept usually associated to probability theory and related fields. I suggest using the less specialized word &quot;variable&quot;, since to ascertain that the values are really stochastic would require specific mathematical approaches.</p></disp-quote><p>We are still using stochastic because the loss is random.</p><disp-quote content-type="editor-comment"><p>(16) Page 10. &quot;(9E). Indeed, the JH treatment redirects the molt to be more like that to the J2 stage, rather than to the E2 ( = J1) stage&quot;. Probably too assertive given the evidence available (see my points 1 and 2 above).</p></disp-quote><p>We do not see a problem with our conclusion. In response to the JHm treatment, the embryo produced a smooth, rather than a “pebbly” cuticle, failed to make the J1-specific egg tooth, and attempted to make cuticular lenses (a J2 feature). This ability of premature JH exposure to cause embryos to “skip” a stage is also seen in locusts (Truman &amp; Riddiford, 1999) and crickets (Erezyilmaz et al., 2004). The JHm treatment resulted in the production of smooth cuticle, lack of a hatching tooth, and an attempt to make cuticular lenses.</p><disp-quote content-type="editor-comment"><p>(17) Page 11. &quot;early JHM treatment&quot;, read &quot;early JHm treatment&quot;.</p></disp-quote><p>Corrected</p><disp-quote content-type="editor-comment"><p>(18) Page 11. &quot;likely. A target of JH, and likely Kr-h1, in Thermobia is myoglianin...&quot;. Please see my notes 1, 2, and especially 3, above.</p></disp-quote><p>This has been revised</p><disp-quote content-type="editor-comment"><p>(19) Page 13. &quot;the locust, Locusta americana (Aboulafia-Baginshy et al.,1984)&quot;. Please read &quot;the locust, Locusta migratoria (Aboulafia-Baginshy et al.,1984)&quot;.</p></disp-quote><p>Corrected</p><disp-quote content-type="editor-comment"><p>(20) Page 13 &quot;Acheta domesticus&quot; three times. The correct name now is &quot;Acheta domestica&quot;, after harmonizing the declension of the specific name with the generic one. See additionally my note 4 above.</p></disp-quote><p>Acheta domesticus has been used in hundreds (thousands?) of papers since it was originally named by Linnaeus. We will continue to use it.</p><disp-quote content-type="editor-comment"><p>(21) Page 15, &quot;(also called the vermiform larva (Bernays, 1971)) redirects embryonic development to form an embryo with proportions, cuticular pigmentation, cuticular sculpturing and bristles characteristic of a nymph, while pronymph modifications, such as the cuticular surface sculpturing (Bernays, 1971)&quot;. The reference &quot;Bernays, 1971&quot; is indeed &quot;Bergot et al., 1971&quot;.</p></disp-quote><p>There was a mistake in the references. The Bernays reference was omitted from the revised Discussion</p><disp-quote content-type="editor-comment"><p>(22) Page 16. &quot;Since JH also induces Kr-h1 in embryos of many insects, including Thermobia&quot;. I'm not sure that this has been studied in many insects. In any case, any reference would be useful.</p><p>(23) Page 17. &quot;Tribolium casteneum&quot;. Please read &quot;Tribolium castaneum&quot;.</p></disp-quote><p>Changed</p><disp-quote content-type="editor-comment"><p>(24) Page 17. &quot;...results in a permanent larva that continues to molt well after it has surpassed its critical weight (He et al., 2019)&quot;. The paper of He et al., 2019 is preceded by two key papers that previously demonstrate (and in hemimetabolan insects) that myoglianin is a determining factor in the preparation for metamorphosis: (DOI: 10.1073/pnas.1600612113 and DOI: 10.1096/ fj.201801511R). See my note 3 above.</p></disp-quote><p>Corrected in revision</p><disp-quote content-type="editor-comment"><p>(25) Page 18. &quot;These persisting embryonic primordia join the wing primordia in delaying their morphogenesis into postembryonic life&quot;. This reader does not understand this sentence.</p></disp-quote><p>Made clearer in the revision.</p><disp-quote content-type="editor-comment"><p>(26) Page 18. &quot;is first possible in the commercial silkworm (Daimon et al., 2015)&quot;. Please mention the scientific Latin name of the species, Bombyx mori.</p><p>(27) Page 19. &quot;The functioning of farnesol derivatives in growth versus differentiation control extends deep into the eukaryotes.../... this capacity was eventually exploited by the insects to provide the hormonal system that regulates their metamorphosis&quot;. This information appears quite out of place.</p></disp-quote><p>We have retained this point.</p><disp-quote content-type="editor-comment"><p>(28) Page 21. Heading &quot;Hormones&quot;. I suggest using the heading &quot;Bioactive compounds&quot;, as neither pyriproxyfen nor 7-ethoxyprecocene are hormones.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(29) Page 29, legend of figure 1. &quot;Photomicrographs&quot; is somewhat redundant. The technical word is &quot;micrographs&quot;. &quot;Thermobia domestica&quot; appears in the explanation of panel C, but this is not necessary, as the name appears in the main heading of the legend.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(30) Page 30, legend of figure 2. Panel B, see my comment 10 above. Why embryonic age is expressed in % embryo development in panel C (and in days in panels A and B)?</p></disp-quote><p>All have been converted to days AEL</p><disp-quote content-type="editor-comment"><p>(31) Page 35, legend of figure 5. &quot;Photomicrograph&quot; see my note 28 above.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(32) Page 40, figure 10. In panel A, the indication of the properties of JH is misleading. The arrow going to promoting differentiation and maturation is OK, but the repression sign that indicates suppression of morphogenetic growth and cell determination seems to suggest that JH has retroactive effects. In panel B, I suggest to label &quot;Flies&quot; instead of &quot;Higher Diptera&quot;, which is an old-fashioned term. In any case, see my general comments 1 and 2, above, about speculation.</p></disp-quote><p>Figure has been completely revised</p><disp-quote content-type="editor-comment"><p>(33) Figure 11. See my general comments 1 and 2, above, about speculation.</p></disp-quote><p>Figure has been revised</p><disp-quote content-type="editor-comment"><p><bold>Reviewer #3 (Public Review):</bold></p><p>Summary:</p><p>In this manuscript, the authors use inhibitors and mimetics of juvenile hormone (JH) to demonstrate that JH has a key role in late embryonic development in Thermobia, specifically in gut and eye development but also resorption of the extraembryonic fluid and hatching. They then exogenously apply JH early in development (when it is not normally present) to examine the biological effects of JH at these stages. This causes a plethora of defects including developmental arrest, deposition of chitin, limb development, and enhanced muscle differentiation. The authors interpret these early effects on development as JH being important for the shift from morphogenetic growth to differentiation - a role that they speculate may have facilitated the evolution of metamorphosis (hemi- and holo-metaboly). This paper will be of interest to insect evo-devo researchers, particularly those with interests in the evolution of metamorphosis.</p><p>Strengths:</p><p>The experiments are generally conducted very well with appropriate controls and the authors have included a very detailed analysis of the phenotypes.</p><p>The manuscript significantly advances our understanding of Thermobia development and the role of JH in Thermobia development.</p><p>The authors interpret this data to present some hypotheses regarding the role of JH in the evolution of metamorphosis, some aspects of which can be addressed by future studies.</p><p>Weaknesses:</p><p>The results are based on using inhibitors and mimetics of JH and there was no attempt to discern immediate effects of JH from downstream effects. The authors show, for instance, that the transcription of myoglianin is responsive to JH levels, it would have been interesting to see if any of the phenotypic effects are due to myoglianin upregulation/suppression (using RNAi for example). These kinds of experiments will be necessary to fully work out if and how the JH regulatory network has been co-opted into metamorphosis.</p></disp-quote><p>We agree completely and should be a feature of future work.</p><disp-quote content-type="editor-comment"><p>The results generally support the authors' conclusions. However, the discussion contains a lot of speculation and some far-reaching conclusions are made about the role of JH and how it became co-opted into controlling metamorphosis. There are some interesting hypotheses presented and the author's speculations are consistent with the data presented. However, it is difficult to make evolutionary inferences from a single data point as although Thermobia is a basally branching insect, the lineage giving rise to Thermobia diverged from the lineages giving rise to the holo- and hemimetabolous insects approx.. 400 mya and it is possible that the effects of JH seen in Thermobia reflect lineage-specific effects rather than the 'ancestral state'. The authors ignore the possibility that there has been substantial rewiring of the networks that are JH responsive across these 400 my. I would encourage the authors to temper some of the discussion of these hypotheses and include some of the limitations of their inferences regarding the role of JH in the evolution of metamorphosis in their discussion.</p></disp-quote><p>We have tried to be less all-encompassing in the Discussion. The strongest comparisons can be made between ametabolous and hemimetabolous insects and we have focused most of the Discussion on the role of JH in that transition. We still include some discussion of holometabolous insects because the ancestral embryonic functions of JH may be somehow related to the unusual reappearance of JH in the prepupal period. We have reduced this discussion to only a few sentences.</p><disp-quote content-type="editor-comment"><p><bold>Reviewer #3 (Recommendations For The Authors):</bold></p><p>(1) The overall manuscript is very long (especially the discussion), and the main messages of the manuscript get lost in some of the details. I would suggest that the authors move some of the results to the supplementary material (e.g. it might be possible to put a lot of the detail of Thermobia embryogenesis into the supplementary text if the authors feel it is appropriate). The discussion contains a lot of speculation and I suggest the authors make this more concise. One example: At the moment there is a large section on the modification in JH function during the evolution of holo and hemi-metabolous life history strategies. There are some interesting ideas in this section and the authors do a good job of integrating their findings with the literature - but I would encourage the authors to limit the bulk of their discussion to the specific things that their results demonstrate. E.g. The first half of p17 contains too much detail, and the focus should be on the relationship with Thermobia (as at the bottom of p17).</p></disp-quote><p>Section has been revised and is more focused</p><disp-quote content-type="editor-comment"><p>(2) I would also suggest a thorough proofread of the manuscript, I have highlighted some of the errors/points of confusion that I found in the list below - but this list is unlikely to be exhaustive.We appreciate catching the errors. Hopefully the final version is better proofed.</p><p>(3) It might be me, but I found the wording in the second half of the abstract a bit confusing. Particularly the statement about the redeployment of morphogen systems - could this be stated more clearly?</p></disp-quote><p>Abstract has been revised.</p><disp-quote content-type="editor-comment"><p>(4) Introduction</p><p>a. &quot;powered flight&quot; rather than 'power flight'</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>b. 'brought about a hemimetabolous lifecycle' implies causality which hasn't been shown and directionality to evolution - suggest 'facilitated the evolution of a hemi...&quot;. Similar comment for 'subsequent step to complete metamorphosis'.</p><p>c. Bottom of p2 - unclear whether you are referring to hemi- holo- or both</p><p>d. Suggest removing sentence beginning &quot;besides its effects...&quot; as the relevance of the role of JH in caste isn't clear.</p></disp-quote><p>Kept sentence but removed initial clause</p><disp-quote content-type="editor-comment"><p>e. State that Thermoia is a Zygentoma.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>f. Throughout - full species names on first usage only, T. domestica on subsequent usages.</p></disp-quote><p>We will continue to use genus names for the reason given above.</p><p>Gene names e.g. kr-h1 in italics.</p><disp-quote content-type="editor-comment"><p>g. 'antagonise morphogens&quot;? rather than 'antagonise morphoentic'.</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>(5) Results</p><p>a. Unclear why drawings are provided rather than embryonic images in Fig. 1A</p></disp-quote><p>We think that the points can be made better with diagrams.</p><disp-quote content-type="editor-comment"><p>b. Top of p4, is 'slot' the correct word?</p></disp-quote><p>Corrected</p><disp-quote content-type="editor-comment"><p>c. Unclear why the measurements of JHIII weren't measured before 5 days AEL, especially given that many of the manipulative experiments are at earlier time points than this. I appreciate that, based on kr-h1, levels that JHIII is also likely to be low.</p><p>d. Reference for the late embryonic peak of 20E being responsible for the J2 cuticle?</p></disp-quote><p>Clarified that this is an assumption</p><disp-quote content-type="editor-comment"><p>e. Clarify &quot;some endocrine related transcripts&quot; why were these ones in particular picked? Kr-h1 is a good transcriptional proxy for JH and Met is the JH-receptor, why myoglianin and not some of the other transcriptional proxies of neuroendocrine signalling?</p></disp-quote><p>Hopefully, the choice is clearer.</p><disp-quote content-type="editor-comment"><p>f. Fig 2C rather than % embryo development for the gene expression data please represent this in days (to be consistent with your other figures).</p></disp-quote><p>It is now consistent with other parts of figure.</p><disp-quote content-type="editor-comment"><p>g. In Fig. 3 the authors do t-tests, because there are three groups there needs to be some correction for multiple testing (e.g. Bonferroni) can the authors add this to the relevant methods section?</p></disp-quote><p>We think that pair-wise comparisons are appropriate.</p><disp-quote content-type="editor-comment"><p>h. Fig. 3 legend: you note that you treat stage 2 juveniles with 7EP - I couldn't tell what AEL this corresponded to.</p></disp-quote><p>This is after hatching so AEL does not apply.</p><disp-quote content-type="editor-comment"><p>i. Top of p7 'deformities' rather than 'derangements'?</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>j. Regarding the dosage effects of embryonic abnormalities - it would be good to include these in the supp material, as it convinces the reader that the effects you have seen aren't just due to toxicity.</p></disp-quote><p>It is not clear what the objection is.</p><disp-quote content-type="editor-comment"><p>k. Bottom of p7 'problematic' not 'problematical'</p></disp-quote><p>Done</p><disp-quote content-type="editor-comment"><p>l. P8 Why are the clusters of Its important? - provide a bit more interpretation for the reader here.</p></disp-quote><p>This is clear in the revised version.</p><disp-quote content-type="editor-comment"><p>m. P9 Why is the modulation of transcription of kr-h1, met, and myo important in this context</p></disp-quote><p>Explained</p><disp-quote content-type="editor-comment"><p>n. P9 'fig. 7F'? there is no Fig. 5F</p></disp-quote><p>Thanks for catching the typo.</p><disp-quote content-type="editor-comment"><p>o. Fig. 7B add to the legend which treatment the dark and light points correspond to.</p></disp-quote><p>We think it is obvious from the labeling on Fig 7B.</p><disp-quote content-type="editor-comment"><p>(6) Discussion:</p><p>a. What do we know about how terminal differentiation is controlled in non-insect arthropods? Most of the discussion is focused on insects (which makes sense as JH is an insect-specific molecule), but if the authors are arguing the ancestral role of JH it would be useful to know how their findings relate to non-insect arthropods.</p></disp-quote><p>We have not been able to find any information about systemic signals being involved in non-insect arthropods.</p><disp-quote content-type="editor-comment"><p>b. There is no Fig. 5E (are they referring to 7E?)</p></disp-quote><p>Yes, it should have been Fig. 7E.</p><disp-quote content-type="editor-comment"><p>c. Is myoglianin a direct target of JH in other species?</p></disp-quote><p>Other reports are in postembryonic stages and show that myoglianin suppresses JH production. Our paper is the first examination in embryos and we find that the opposite is true – i.e., that JH treatment suppresses myoglianin production. We suspect that these two signaling systems are mutually inhibitory. It would be interesting to see whether treatment of a post-critical weight larva with JH (which would induce a supernumerary larval molt) would also suppress myoglianin production (as we see in Thermobia embryos).</p><disp-quote content-type="editor-comment"><p>d. P12 What is the evidence that JH interacts with the first 20E peak to alter the embryonic cuticle?</p></disp-quote><p>We are not sure what the issue is. The experimental fact is that treatment with JH before the E1 ecdysteroid peak causes the production of an altered E1 cuticle. We are faced with the question of why is this molt sensitive to JH when the latter will not appear until 3 or 4 days later? A possible answer is that the ecdysone response pathway has a component that has inherent JH sensitivity. The mosquito data suggest that Taiman provides another link between JH and ecdysone action</p><disp-quote content-type="editor-comment"><p>e. Top of p13 - this paragraph can be cut down substantially. Although this is evidence that JH can alter ecdysteriods - it is in a species that is 400 my derived from the target species. Is it likely to be the exact same mechanism? I would encourage the authors to distil and retain the most important points.</p></disp-quote><p>This paragraph has been shortened and focused.</p><disp-quote content-type="editor-comment"><p>f. Bottom of p13 - what does this study add to this knowledge?</p></disp-quote><p>The response of Thermobia embryos to JH treatment is qualitatively the same as seen in other short germband embryos. This similarity supports the assumption that the same responses would have been seen in their last common ancestor.</p><disp-quote content-type="editor-comment"><p>g. P19 the last paragraph in the conclusions is really peripherally relevant to the paper and is a bit of a stretch, I would encourage the authors to leave this section out.</p></disp-quote><p>We agree that it is a stretch. JH and its precursor MF are the only sesquiterpene hormones. How did they come about to acquire this function? We think it is worth pointing out the farnesol metabolites have been associated with promoting differentiation in various eukaryotes. An ancient feature of these molecules in promoting (maintaining?) differentiation may have been exploited by the insects to develop a unique class of hormones. It is worth putting the idea out to be considered.</p><disp-quote content-type="editor-comment"><p>h. P19 &quot;conclusions&quot; rather than 'concluding speculations'.</p></disp-quote><p>Changed as suggested.</p><disp-quote content-type="editor-comment"><p>Methods:</p><p>It is standard practice to include at least two genes as reference genes for RT-qPCR analysis (<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/gb-2002-3-7-research0034">https://doi.org/10.1186/gb-2002-3-7-research0034</ext-link>, <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1373/clinchem.2008.112797">https://doi.org/10.1373/clinchem.2008.112797</ext-link>) If there are large-scale differences in the tissues being compared (e.g. as there are here during development) then more than two reference genes may be required and a reference gene study (such as <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390%2Fgenes12010021">https://doi.org/10.3390%2Fgenes12010021</ext-link>) is appropriate. Have the authors confirmed that rp49 is stably expressed during the stages of Thermobia development that they assay here?</p></disp-quote><p>We have explained our choice in the Methods.</p></body></sub-article></article>