We first performed a series of experiments to comprehensively examine bone mass, bone resorption, bone formation, bone cell changes and bone remodeling by microCT (μCT), bone histology and dynamic histomorphometric analysis. Adult mice with Malat1 deficiency (Malat1^-/- on C57BL/6 background) do not show growth retardation or macroscopic differences (Figure 1—figure supplement 1A), but exhibit significantly reduced bone mass compared with wild type littermate controls (WT; Figure 1A). μCT analysis showed markedly decreased trabecular bone volume (BV/TV), number (Tb.N.), bone mineral density (BMD) and connectivity density (Conn-Dens.), and increased trabecular spacing (Tb. Sp) in both male and female Malat1^-/- mice (Figure 1B). Cortical bone appears normal (Figure 1—figure supplement 1B). Osteoclastic bone resorption was significantly enhanced in Malat1^-/- mice indicated by the elevated numbers and surfaces of osteoclasts (Figure 1C and D). However, osteoblastic bone formation was not accordingly enhanced but instead was dramatically suppressed by Malat1 deficiency (Figure 1E–H). Bone dynamic histomorphometric analysis by calcein double labeling showed that Malat1 absence notably inhibited both mineral apposition rate (MAR) and bone formation rate (BFR/BS) in Malat1^-/- mice (Figure 1E and F). Furthermore, osteoblast parameters, such as osteoblast surfaces and numbers, as well as osteoid formed beneath osteoblasts were significantly reduced in Malat1^-/- mice (Figure 1G and H). The serum osteoblastic bone formation marker P1NP was decreased, while osteoclastic bone resorption marker TRAP was increased, in Malat1^-/- mice (Figure 1I). These results indicate that the lack of Malat1 suppresses osteogenesis and bone formation in mice. Moreover, Malat1 deficiency uncouples osteoclastic bone resorption and osteoblastic bone formation, leading to markedly reduced bone mass. Our data thus identify Malat1 as a novel bone remodeling regulator in bone homeostasis.

Next, we examined the role of Malat1 in osteoblastic bone formation. We crossed Malat1^flox/flox mice with the mice expressing Cre under the control of Osteocalcin (Ocn) promoter to generate Malat1 conditional KO mice specifically in osteoblasts (Malat1^flox/floxOcnCre(+); hereafter referred to as Malat1 cKO^Ocn). Malat1 deficiency in osteoblasts significantly decreased trabecular bone volume (BV/TV), number (Tb.N.), thickness (Tb. Th), bone mineral density (BMD) and connectivity density (Conn-Dens.), and increased trabecular spacing (Tb. Sp) in Malat1 cKO^Ocn mice (Figure 2A and B). There are no obvious changes in cortical bone phenotype (Figure 2—figure supplement 1). Furthermore, mineral apposition rate (MAR) and bone formation rate (BFR/BS) were both lower in Malat1 cKO^Ocn mice than the controls (Figure 2C). In parallel, Malat1 deficiency in osteoblasts led to decreased osteoblast numbers and surfaces in vivo (Figure 2D). The serum osteoblastic bone formation marker P1NP was decreased in Malat1 cKO^Ocn mice (Figure 2E). These results indicate that Malat1 cKO^Ocn mice exhibit osteoporotic phenotype with reduced bone formation, which is consistent with Malat1^-/- mice. Therefore, Malat1 is a cell-intrinsic osteogenic regulator that promotes osteoblastic bone formation.

Given these findings, we sought to investigate the mechanisms underlying the regulation of osteoblastic bone formation by Malat1. β-catenin is a central transcriptional factor in canonical Wnt signaling pathway, and plays an important role in positively regulating osteoblast differentiation and function (Zhong et al., 2014; Chen and Long, 2013; Holmen et al., 2005; Kramer et al., 2010; Wang et al., 2014; Monroe et al., 2012). Upon stimulation, most notably from canonical Wnt ligands, β-catenin is stabilized and translocates into the nucleus, where it interacts with coactivators to activate target gene transcription. Previous reports observed a link between Malat1 and β-catenin signaling pathway in cancers Li et al., 2019; Zhang et al., 2018, but the underlying molecular mechanisms in terms of how Malat1 interacts with β-catenin and regulates its nuclear retention and transcriptional activity are unclear. In this study, we performed both Chromatin isolation by RNA purification (ChIRP) assay (Figure 3A, B, Figure 3—figure supplement 1) and RNA immunoprecipitation (RIP) assay (Figure 3C) to determine the interaction between Malat1 and β-catenin. The results obtained by these two approaches clearly show that Malat1 binds to β-catenin in osteoblasts (Figure 3A–C). Next, we asked whether Malat1 regulates β-catenin nuclear translocation in response to Wnt3a. We did not find that Malat1 deficiency significantly affects nuclear localization of β-catenin stimulated by Wnt3a (Figure 3D, Figure 3—figure supplement 2). We then performed Luciferase assay to examine whether Malat1 modulates the transcriptional activity of β-catenin. The results showed that Malat1 deficiency significantly reduced the transcriptional activity of β-catenin in response to Wnt3a stimulation (Figure 3E). In line with this, the expression levels of β-catenin target genes, such as Axin2, Ccnd1, Lef1 and Myc, were substantially lower in Malat1^-/- cells than WT controls (Figure 3F). Our findings indicate that Malat1 is a key regulator of Wnt/β-catenin signaling pathway that is important for osteoblasts. Since Malat1 is a nuclear lncRNA, these data also suggest that Malat1 acts as a scaffold to tether β-catenin in nuclei to implement its positive regulation of β-catenin activity.

As osteoclast formation is significantly increased in Malat1^-/- mice, we examined whether this osteoclast change is due to an intrinsic role of Malat1 in these cells. We first investigated in vitro osteoclast differentiation using bone marrow derived macrophages (BMMs) as osteoclast precursors. Surprisingly, there is no significant difference in osteoclast differentiation and mineral resorption between WT and Malat1^-/- BMM cultures (Figure 4A and B), which is inconsistent with the in vivo data (Figure 1C). Moreover, the expression of osteoclastogenic transcription factors and osteoclast marker genes was similar between WT and Malat1^-/- cultures (Figure 4C and D). We also generated Malat1^flox/flox Lyz2Cre(+) (Malat1 cKO^Lyz2) mice, a myeloid lineage osteoclast specific Malat1 conditional KO mouse line. The deletion efficiency of Malat1 in the Lyz2-Cre mice is very high (>90%) (Figure 4E). However, there is no significant difference in bone mass between Malat1 cKO^Lyz2 mice and their littermate control Lyz2Cre(+) mice (Figure 4F and G). These results demonstrate that Malat1 expressed in osteoclastic lineage cells does not affect osteoclastogenesis. Therefore, Malat1 inhibits osteoclastogenesis in a non-autonomous manner in vivo.

It is intriguing how Malat1 regulates osteoclastogenesis. We first looked at osteoclast phenotype in Malat1 cKO^Ocn mice, and found that Malat1 deletion in osteoblasts significantly enhanced osteoclast numbers and surfaces in vivo (Figure 5A). The serum osteoclastic bone resorption marker TRAP was increased in Malat1 cKO^Ocn mice (Figure 5B). This finding indicates that Malat1 affects osteoclast formation through crosstalk between osteoblasts and osteoclasts. To further explore the underlying mechanisms of this crosstalk, we took advantage of a well-established co-culture system (Zhao et al., 2009) with primary osteoblasts in a transwell and bone marrow cells on the bottom of the dish. RANKL and M-CSF secreted by osteoblasts induced osteoclast differentiation on the bottom (Figure 5C). Interestingly, we found that more osteoclasts formed in the co-cultures with Malat1^-/- osteoblasts than WT osteoblasts (Figure 5C). The results of this co-culture system recapitulate the in vivo enhanced osteoclast phenotype, and indicates that certain soluble factors secreted from osteoblasts are highly likely involved in the Malat1 regulation of osteoclastogenesis. Since we found that Malat1 binds to β-catenin to regulate its target genes, we primarily searched β-catenin target genes that function as secreted factors. Osteoprotegerin (OPG), encoded by Tnfrsf11b, is a β-catenin target (Boyce et al., 2005; Glass et al., 2005). OPG is a secreted factor that acts as a RANKL decoy receptor to block RANKL activity, thereby suppressing osteoclast formation and bone resorption (Simonet et al., 1997). We found that OPG expression was markedly lower in the Malat1^-/- osteoblasts than the WT control cells (Figure 5D). RANKL-OPG axis is a typical bone remodeling mediator through impacting osteoclastogenesis, and RANKL/OPG ratio is usually an indicator for osteoclastogenic/bone resorption potential and status (Boyce and Xing, 2008). Our results showed that OPG but not RANKL was down-regulated in Malat1^-/- osteoblasts, leading to a higher RANKL/OPG ratio in Malat1^-/- osteoblasts than WT controls (Figure 5E and F). The elevated RANKL/OPG ratio in Malat1^-/- osteoblasts favors enhanced osteoclastogenesis, which is aligned with the enhanced osteoclast formation and decreased bone mass in Malat1^-/- mice. We next examined the OPG expression in vivo. Recent literature demonstrates that locally produced OPG in bone, but not the serum OPG, is a critical inhibitor of osteoclast formation and bone resorption (Tsukasaki et al., 2020). Indeed, the OPG level in serum in Malat1^-/- mice is similar to that in WT controls (Figure 5G). However, OPG level in bone marrow was drastically decreased in Malat1^-/- mice compared to WT mice (Figure 5H). We further tested the importance of the decreased OPG level in the Malat1 regulation of osteoclasts. We applied two well-established ex vivo culture systems to closely recapitulate in vivo conditions. In the whole bone marrow cultures with M-CSF and RANKL (Figure 5I), Malat1 deletion in Malat1^-/- bone marrow enabled more osteoclastogenesis than WT bone marrow, which is consistent with the in vivo findings. When recombinant OPG was added to the bone marrow cultures, the osteoclast formation in both WT and Malat1^-/- cultures was inhibited as expected, but the osteoclast formation in Malat1^-/- bone marrow with additional OPG became similar to that in the WT control cultures without additional OPG (Figure 5I column 1 vs 4). In another co-culture system (Figure 5J), WT or Malat1^-/- osteoblasts were co-cultured with WT bone marrow in the presence of 1,25(OH)₂-vitD3 and PGE2. The RANKL secreted from osteoblasts induces osteoclast formation in this co-culture system. Furthermore, because these cultures included the same WT bone marrow cells but different osteoblasts from WT or Malat1^-/- mice, the results directly reflected osteoblastic Malat1 effects on osteoclast formation. In this co-culture system, we observed a similar phenotype as that in Figure 5I. Extra OPG can lead to osteoclast formation in Malat1^-/- osteoblasts and WT bone marrow cocultures comparable to that in WT osteoblasts and WT bone marrow cocultures without extra OPG (Figure 5J column 1 vs 4). These results collectively support that the decreased OPG level in Malat1-deficient osteoblasts plays a significant role in the excessive osteoclast formation in Malat1^-/- mice (Figure 1C and D) and Malat1 cKO^Ocn mice (Figure 5A), as illustrated in Figure 7.

As OPG is a key osteoclastic inhibitor, we asked whether other cells, in addition to osteoblasts, in bone marrow could also produce OPG, which we have established is regulated by Malat1. We analyzed a bone scRNAseq dataset (GSE128423) (Baryawno et al., 2019). Except for osteoblasts as expected, we surprisingly found that chondrocytes express a high level of OPG in the analyzed cells from bone (Figure 6A-D, Figure 6—figure supplement 1). We then isolated primary chondrocytes from mouse knees, which highly express chondrocyte marker genes, such as Sox9, Acan, and Col2a1 (Figure 6E, Figure 6—figure supplement 2B). These cells were also Alcian blue positive (Figure 6—figure supplement 2A). We confirmed OPG expression in chondrocytes isolated from mice (Figure 6G). Moreover, OPG expression level in Malat1^-/- chondrocytes was approximately 50% less compared to that in WT cells (Figure 6F and G). RANKL (encoded by Tnfsf11) is nearly undetectable in chondrocytes (Figure 6F). The chondrocyte marker genes, including Sox9, Acan and Col2a1, were not affected by Malat1 (Figure 6E). These data show that chondrocytes are an important cellular source of OPG highly expressed in bone, which is critically regulated by Malat1.

We next examined whether Malat1 also modulates β-catenin activity in chondrocytes. In addition to OPG, we observed that the expression of other β-catenin target genes, such as Tcf7, Lef1, and Jag1, was approximately 50% lower in Malat1^-/- chondrocytes than that in WT cells (Figure 6H). This suggests that, similar to osteoblasts, Malat1 positively regulates β-catenin activity in chondrocytes. The decreased expression of Jagged1 in Malat1^-/- chondrocytes drew our attention, as Jagged1 is not only a Notch ligand (Kopan and Ilagan, 2009) but also an inhibitor of osteoclastogenesis (Bai et al., 2008; Zhao, 2017). Following this observation, we evaluated the protein expression levels of Jagged1, and found that Malat1 deficiency drastically decreased Jagged1 protein expression in chondrocytes (Figure 6I). These results collectively indicate that the decreased OPG and Jagged1 production in Malat1^-/- chondrocytes also contributes to the enhanced osteoclast formation and low bone mass in Malat1^-/- mice. Thus, Malat1 links the activities of chondrocytes and osteoclasts through β-catenin-OPG/Jagged1 axis (Figure 7).

We next examined whether Malat1 impacts osteogenesis in pathological conditions. In a femoral midshaft fracture model (Xu et al., 2018), we found that Malat1 deficiency in both Malat1^-/- mice and Malat1 cKO^Ocn mice significantly disturbed the bone regeneration at 21 days post-fracture, indicated by significantly decreased bone mass in the newly formed callus (Figure 8). These results indicate that Malat1 in osteoblasts plays an important role in enhancing bone regeneration in fracture healing.

Malat1^-/- (Nakagawa et al., 2012) and Malat1^flox/flox mice (Eißmann et al., 2012) were described previously. Sex- and age-matched Malat1^-/- mice and their littermates WT (Malat1^+/+) mice were used for experiments. We generated mice with osteoblast-specific deletion of Malat1 by crossing Malat1^flox/flox mice with osteocalcin cre mice (The Jackson Laboratory, Stock No: 019509). Sex- and age-matched Malat1^flox/flox;Ocn-Cre mice (referred to as Malat1 cKO^Ocn) and their littermates Malat1^flox/flox mice as the controls (referred to as the Malat1^f/f) were used for experiments. We generated mice with myeloid/macrophage-specific deletion of Malat1 by crossing the Malat1^flox/flox mice with Lyz2 Cre mice (The Jackson Laboratory, Stock No: 004781). Sex- and age-matched Malat1^flox/flox;Lyz2-Cre mice (referred to as the Malat1 cKO^Lyz2 mice) and their littermates with Malat1^+/+; Lyz2 cre (+) genotype as WT controls (hereafter referred to as Control) were used for experiments.

After sacrifice, the bones were fixed by 4% formaldehyde and subjected to μCT analysis, sectioning, TRAP staining and histological analysis. µCT analysis of femoral trabecular bones and cortical midshaft was conducted to evaluate bone volume and 3D bone architecture using a Scanco µCT-35 scanner (SCANCO Medical) according to the manufacturer’s instructions and the American Society of Bone and Mineral Research (ASBMR) guidelines (Bouxsein et al., 2010).

For dynamic histomorphometric measures of bone formation (Deng et al., 2020), calcein (25 mg/kg, Sigma) was injected into mice intraperitoneally at 5 and 2 days before sacrifice to obtain double labeling of newly formed bones. The non-decalcified tibia bones were embedded in methyl methacrylate. 5 mm thick sections were sliced using a microtome (Leica RM2255, Leica Microsystems, Germany). For static histomorphometric measures of osteoblast parameters, non-decalcified sections of the tibiae were stained using toluidine blue or Masson-Goldner staining kit (MilliporeSigma). The Osteomeasure software was used for bone histomorphometry using standard procedures according to the program’s instruction.

All mice were housed in a 12 hr:12 hr light/dark cycle with food and water ad libitum. All animal procedures were performed according to the approved protocol (2016–0001 and 0004) by the Institutional Animal Care and Use Committee (IACUC) of Hospital for Special Surgery and Weill Cornell Medical College.

Bone fracture was performed as described previously with slight modifications (Xu et al., 2018). 13-week-old mice were anesthetized with 2.5% isoflurane via inhalation. The mice received meloxicam (subcutaneous injection, 2 mg/kg) and buprenorphine (subcutaneous injection, 0.5 mg/kg) as analgesia prior to surgery. The surgical site was shaved and sterilized using iodine and 70% ethanol. An incision was made over the anterolateral femur. 0.1 ml bupivacaine (5 mg/ml) was injected into the tissue adjacent to the incision line. A 25-gauge needle was inserted into the femoral canal through the patellar groove. The mid-diaphysis of the femur was transected using dental drill with a burr (19007–05, Fine science tools). The needle was then trimmed from the distal end to prevent it from projecting into the femoral joint space. The left part of the needle remained in femur to stabilize the fracture. The muscle was repositioned over the injury site and stitched using absorbable sutures. The skin was closed with wound clips, which were removed 2 weeks post-surgery. Animals were administered 0.5 mg/kg buprenorphine every 12 hours and 2.0 mg/kg meloxicam every 24 hr subcutaneously for analgesia up to 3 days after the surgery. Mice were sacrificed 21 days post-fracture. Hematoxylin and eosin (HE) staining of the bone samples were performed. BV/TV of the callus was analyzed using μCT and Osteomeasure on the tissue slices. All surgical procedures were performed according to the approved protocol (2016–0001/4) by the Institutional Animal Care and Use Committee (IACUC) of Hospital for Special Surgery and Weill Cornell Medical College.

Murine M-CSF (Cat# 315–02), recombinant human sRANK Ligand (Cat# 310–01), recombinant human OPG (Cat# 450–14) and murine Wnt3a (Cat# 315–20) were purchased from PeproTech. Leukocyte Acid Phosphatase (TRAP) Kit (Cat# 387 A) and Mouse Osteoprotegerin ELISA Kit (Cat# RAB0493) were obtained from MilliporeSigma. The plasmid of M50 Super 8 x TOPFlash (Cat# 12456) was purchased from Addgene. pRL-Tk control plasmid (Cat# E2241) was purchased from Promega. Fetal Bovine Serum (FBS, Cat #S11550) was obtained from Atlanta Biologicals. β-glycerophosphate disodium salt hydrate (Cat# G9422), L-ascorbic acid (Cat# A4544), prostaglandin E2 (PGE2) (Cat# P0409) and 1α,25-Dihydroxyvitamin D3 (VitD3) (Cat# D1530) were obtained from MilliporeSigma.

For osteoclastogenesis, bone marrow cells were obtained from age and sex-matched WT and Malat1^-/- littermates and cultured in αMEM supplemented with 10% FBS and 2.4  mM glutamine (25030081, Thermo Fisher Scientific) and 1% Penicillin–Streptomycin along with CMG14–12 supernatant (Xia et al., 2022), serving as the condition medium (CM) which contained a concentration equivalent to 20  ng/ml of rM-CSF and was utilized as the M-CSF source. After 3-day culture, the cells were washed in 1 x PBS and the attached cells were scraped, and seeded into plates at a density of 4.5 × 10⁴ /cm² with CM. Next day, the cells were induced for osteoclastogenesis with 40 ng/ml RANKL and CM for the indicated days shown in figures. Multi-nucleated osteoclasts were stained using Leukocyte Acid Phosphatase (TRAP) Kit (Cat# 387 A, MilliporeSigma) according to the manufacturer’s instructions.

Primary osteoblastic cells were isolated from the calvaria of new-born (0-3d) mice by enzymatic digestion in 10% FBS αMEM with 0.1% collagenase (LS004177, Worthington) and 0.2% dispase (17105041, Thermo Fisher Scientific) as described (Deng et al., 2020). The cells were used immediately or cultured to expand for 6 days for experiments indicated in relevant figures.

For the co-cultures of primary osteoblasts and bone marrow cells in transwell plates, primary calvarial osteoblasts isolated from WT and Malat1^-/- newborn mice were seeded in the upper chamber (2×10⁴ cells/96-well) in αMEM medium with 10% FBS. After primary osteoblasts reached 60–70% confluence, bone marrow cells harvested from the femur and tibia of 6-week-old mice were plated to the bottom chamber (1×10⁶ cells/24-well), together with 1 μM Prostaglandin E2 (PGE2) (P0409, MilliporeSigma) and 10 nM 1α,25-Dihydroxyvitamin D3 (VitD3) (D1530, MilliporeSigma). Culture media were exchanged every two days for 12 days. TRAP staining was performed and multinucleated osteoclasts were counted.

For the direct co-cultures of primary osteoblasts and bone marrow cells, primary osteoblasts isolated from WT and Malat1^-/- newborn mice were seeded in 48-well plates at a density of 2×10⁴ cells/well in αMEM supplemented with 10% FBS. After osteoblasts reached 60–70% confluence, murine bone marrow cells isolated from the femur and tibia of 6-week-old mice were plated at a density of 2×10⁵ cells/well on the top the osteoblasts in the presence of 1 μM PGE2 and 10 nM VitD3. Culture media were exchanged every two days. On the sixth day, TRAP staining was performed and multinucleated osteoclasts were counted.

Preparation and culture of primary mouse chondrocytes were performed as previously described with slight modification (Gosset et al., 2008). In brief, femoral condyles and tibial plateau were carefully dissected from 5-day-old WT and Malat1^-/- mice. Soft tissues were removed under a microscope. After washing with PBS for two times, the femoral condyles and tibial plateau were first digested in digestion buffer (αMEM containing 10% FBS, 1 mg/ml collagenase II, and 2 mg/ml Dispase I) in 37  °C incubator for 45 min. Then, the femoral condyles and tibial plateau were transferred to fresh digestion buffer and digested overnight in 37  °C incubator. The next day, the isolated chondrocytes were filtered through a 70 μm cell strainer and spun down at 1600 rpm for 5 min. The chondrocytes were directly used for RNA extraction, seeded for Alican blue staining (A5268, MilliporeSigma) in 24-well plates, or for immunofluorescence staining of Aggrecan (A8536, ABclonal) in 96-well plates.

MC3T3-E1 osteoblasts were purchased from ATCC and cultured in αMEM with 10% FBS and 1% Penicillin–Streptomycin (15140122, Thermo Fisher Scientific). MC3T3-E1 cell line has been authenticated by STR profiling and tested negative for mycoplasma.

The L Wnt-3A (CRL-2647, ATCC) cells and the control L cell line (CRL-2648, ATCC) were generously gifted by Dr. Joe Zhou (Weill Cornell Medicine). We followed ATCC handling information to maintain and culture the cells. Briefly, the cells were maintained in DMEM medium supplemented with 10% FBS, 1% Penicillin–Streptomycin and 0.4 mg/ml G-418. To produce the Wnt3a conditioned medium (Wnt3a CM) and control medium (L CM), the cultured cells (80–90% confluence) from one 10 cm dish were split at a 1:10 ratio and seeded into 10 cm tissue culture dishes. After an initial 4-day culture (approximately to confluency) in DMEM medium containing 10% FBS and 1% Penicillin–Streptomycin, the first batch of medium was harvested. Subsequently, 10 ml of fresh medium was added, and the cells were cultured for another 3 days to collect the second batch of conditioned medium. The two batches of conditioned media were combined at a 1:1 ratio, filtered using a 0.22 μm filter, and stored at –80 ºC. Wnt3a activity was confirmed by nuclear translocation of β-catenin.

Primary osteoblasts or chondrocytes were seeded into 96-well plates at a density of 1×10⁴ cells/well. Primary osteoblasts were serum starved for 16 hr, followed by treatment with 50% L- or 50% Wnt3a CM for 1 hr. After washing with PBS, the cells were fixed with 4% paraformaldehyde in PBS for 20 min at room temperature, permeabilized with 0.5% Triton X-100 in PBS for 15 min at room temperature, and blocked for 1 hr with 1% BSA in PBS (blocking buffer). The cells were then incubated with primary antibodies that were diluted in blocking buffer for overnight at 4 °C. After washing three times with PBS, the cells were incubated with secondary antibodies for 1 hr at room temperature. After three times of washing with PBS, the cells were mounted with the ProLong Gold Antifade Mountant with DAPI (P36941, ThermoFisher Scientific). A Zeiss microscope was used to take images. Primary antibodies include anti-β-catenin antibody (8480 s, Cell Signaling Technology, 1:100) and anti-Aggrecan (A8536, ABclonal, 1:100) in this study. The goat anti-Rabbit Alexa Fluor 488 (A-11008, ThermoFisher Scientific, diluted at 1:500 with blocking buffer) was used as the secondary antibody for these primary antibodies.

Total cellular extracts were obtained using lysis buffer containing 150  mM Tris-HCl (pH 6.8), 6% SDS, 30% glycerol, and 0.03% Bromophenol Blue, with 10% 2-Mercaptoethanol added immediately before harvesting cells. Cell lysates were fractionated on 7.5% SDS-PAGE, transferred to Immobilon-P membranes (0.45 µm, Millipore), and incubated with specific antibodies. Western Lightning Plus-ECL (PerkinElmer) was used for detection. β-catenin antibody (9562, 1:1000) and Jag1 antibody (70109, 1:1000) were obtained from Cell Signaling Technology. Nfatc1 antibody (556602, 1:1000) was obtained from BD Biosciences; Blimp1 (sc-47732, 1:1000), c-Fos (sc-52, 1:1000), OPG/Osteoprotegerin (sc-390518, 1:1000) and p38α (sc-535, 1:3000) antibodies were purchased from Santa Cruz Biotechnology.

The cultured primary osteoblastic cells were subjected to serum starvation in αMEM with 2% FBS for 16 hr. Subsequently, the cells were treated with either 50% L- or 50% Wnt3a conditioned medium (CM) for 1 hr. The cells were collected and lysed with Buffer A (10 mM Hepes PH7.9, 1.5 mM MgCl₂, 10 mM KCl) supplemented with fresh protease inhibitor cocktail (11836170001, MilliporeSigma). After incubation on ice for 15 min, 0.2 % NP-40 was added. The mixture was vortexed and incubated on ice for 2 min. The cellular lysate was then centrifuged at 10,000 × g for 3 min at 4 ºC. The supernatant was used as cytoplasmic fraction. The nuclei pellets were washed two times using 1 ml of Buffer A. After the second wash, the buffer was completely removed. The nuclei pellet was then lysed using Buffer C (20 mM Hepes pH7.9, 1.5 mM MgCl₂, 420 mM NaCl, 0.2 mM EDTA, 25% Glycerol) with fresh protease inhibitor cocktail for 30 mins on ice, vortexing every 5 min. The nuclear lysate was centrifuged at 12,000 x g at 4 °C for 15 min, and the supernatant was collected as the nuclear extract. GAPDH (sc-25778) and TBP1(sc-204) were purchased from Santa Cruz Biotechnology and used as the cytoplasmic and nuclear markers, respectively. β-catenin antibody (9562, 1:1000) was obtained from Cell Signaling Technology.

DNA-free RNAs were isolated from cells with the RNeasy MiniKit (74104, QIAGEN) with DNase treatment, and total RNA was reverse-transcribed with random hexamers using the RevertAid RT Kit (K1691, Thermo Fisher Scientific) according to the manufacturer’s instructions. Real-time PCR was done in triplicate with the QuantStudio 5 Real-time PCR system (A28138, Applied Biosystems) and Fast SYBR Green Master Mix (4385612, Thermo Fisher Scientific) with 500  nM primers. mRNA amounts were normalized relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. The mouse primers for real-time PCR were as follows: Gapdh: 5’-ATCAAGAAGGTGGTGAAGCA-3’ and 5’-AGACAACCTGGTCCTCAGTGT-3’; Tnfrsf11b: 5’-CGGAAACAGAGAAGCCACGCAA-3′ and 5’-CTGTCCACCAAAACACTCAGCC-3′; Tnfsf11: 5’-CAGCATCGCTCTGTTCCTGTA-3′ and 5’-CTGCGTTTTCATGGAGTCTCA-3′; Axin2: 5’-ATGCAAAAGCCACCCAAAGG-3′ and 5’-TGCATTCCGTTTTGGCAAGG-3′; Ccnd1: 5’-GCGTACCCTGACACCAATCTC-3′ and 5’-CTCCTCTTCGCACTTCTGCTC-3′; Lef1: 5’-TGTTTATCCCATCACGGGTGG-3′ and 5’-CATGGAAGTGTCGCCTGACAG-3′; c-myc: 5’-CAGCGACTCTGAAGAAGAGCA-3′ and 5’-TTGTGCTGGTGAGTGGAGAC-3′; Jag1: 5’- TGCCTGCCGAACCCCTGTCATAAT-3’ and 5’- CCGATACCAGTTGTCTCCGTCCAC-3’; Tcf7: AACTGGCCCGCAAGGAAAG and CTCCGGGTAAGTACCGAATGC;Nfatc1: 5′-CCCGTCACATTCTGGTCCAT-3′ and 5′-CAAGTAACCGTGTAGCTCCACAA-3′; Acp5: 5′-ACGGCTACTTGCGGTTTC-3′ and 5′-TCCTTGGGAGGCTGGTC-3′; Ctsk: 5′-AAGATATTGGTGGCTTTGG-3′ and 5′-ATCGCTGCGTCCCTCT-3′; Dc-stamp: 5′-TTTGCCGCTGTGGACTATCTGC-3′ and 5′-AGACGTGGTTTAGGAATGCAGCTC-3′; Blimp1: 5’-TTCTTGTGTGGTATTGTCGGGACTT-3′ and 5’-TTGGGGACACTCTTTGGGTAGAGTT-3′; Atp6v0d2: 5’-GAAGCTGTCAACATTGCAGA-3′ and 5’-TCACCGTGATCCTTGCAGAAT-3′; Malat1: 5’-AGCAGGCATTGTGGAGAGGA-3′ and 5’-ATGTTGCCGACCTCAAGGAA-3′; Col2a1: CGATCACAGAAGACCTCCCG and GCGGTTGGAAAGTGTTTGGG; Sox9: AAGCTCTGGAGGCTGCTGAACGAG and CGGCCTCCGCTTGTCCGTTCT; Acan: GGTCACTGTTACCGCCACTT and CCCCTTCGATAGTCCTGTCA.

Thirty million MC3T3-E1 cells were collected, centrifuged, and washed with PBS. The cells were then spun down at 800 x g for 4 min at room temperature. The cell pellet was resuspended in 1% formaldehyde in PBS (28906, Thermo Fisher Scientific) and crosslinked for 10 min at room temperature on an end-to-end rotator. 1.25 M glycine at 1/10 volume of 1% formaldehyde solution was used to quench the cross-linking reaction at room temperature for 5 min. The cells were spun down at 2000 x g for 5 min and the pellet was washed with chilled PBS once, followed by centrifugation at 2000 x g for 5 min. The cell pellets were resuspended in 1.1 ml immunoprecipitation (IP) lysis buffer (50 mM HEPES at pH 7.5, 0.4 M NaCl, 1 mM EDTA, 1 mM DTT, 0.5% Triton X-100, 10% glycerol) containing 1 mM PMSF (78830, MilliporeSigma), protease inhibitor cocktail, and RNase inhibitor (100 U/ml Superase-in, AM2694, Thermo Fisher Scientific). The cell lysate was then sonicated using the Bioruptor Pico sonication device (Diagenode, NJ, USA) until the liquid became clear (sonication cycle: 30 s ON, 30 s OFF). The lysates were centrifuged for 10 min at 14,000 x g at room temperature. 50 μl of the supernatant was used as the input control. The remaining supernatant was precleared using protein A/G agarose (sc-2003, Santa Cruz Biotechnology). The precleared cell lysate was split into two tubes evenly and incubated with 5 μg of β-catenin antibody (9562, Cell signaling technology) or normal rabbit IgG (2729 S, Cell signaling technology) at 4 °C overnight with rotation. 30 μl of washed protein A/G beads were then added into each sample and incubated at 4 °C for 1 h with rotation. The beads were washed with 900 μl of IP lysis buffer for 3 min/each time for five times and collected by centrifugation for 3 min at 400 x g at room temperature. After the last wash, 100 μl of RIP buffer (50 mM HEPES at pH 7.5, 0.1 M NaCl, 5 mM EDTA, 10 mM DTT, 0.5% Triton X-100, 10% glycerol, 1% SDS) with 1 μl RNase inhibitor was added to each sample. 50 μl of RIP buffer was added to the input control sample. All samples were incubated at 70 °C for 1 hr to reverse crosslinking. 100 μl of supernatant were then collected by spinning down the beads at 400 x g for 1 min at room temperature. The supernatant was used for RNA extraction using the RNeasy Mini Kit (QIAGEN) with DNase I treatment. RNA was eluted using 12 μl RNase-free H2O and reversed to complementary DNA using One-step cDNA synthesis kit (Thermo Fisher, Revert Aid RT kit, k1691). The qPCR was then performed using Malat1 primers.

Chromatin Isolation by RNA Purification (ChIRP) was performed as described previously with slight modifications (Chu et al., 2012). We designed and synthesized an antisense oligonucleotide probe of murine Malat1. The design was based on the high sequence homology to a human MALAT1 probe’s sequence (West et al., 2014; Figure 3—figure supplement 1). The murine Malat1 probe’s sequence is 5'-GTCTTTCCTGCCTTAAAGTTAATTTCG/iSp18//3’-BiotinTEG (INTEGRATED DNA Technologies). We also synthesized a GFP probe (sequence: 5' TATCACCTTCAAACTTGACTTC/ iSp18-3'-Biotin TEG) as the negative control. 30 million MC3T3-E1 cells were collected, washed in PBS and centrifuged at 800xg for 4 min at room temperature. The cell pellet was resuspended in 4% formaldehyde in PBS and crosslinked for 30 min at room temperature on an end-to-end rotator. 1.25 M glycine at 1/10 volume of 4% formaldehyde solution was used to quench the crosslinking reaction at room temperature for 5 min. After washing with chilled PBS once, the cells were resuspended in 1 ml lysis buffer (50 mM Tris-Cl pH 7.0, 10 mM EDTA, 1% SDS) supplement with 1 mM PMSF, protease inhibitors, and RNase inhibitor. The cell lysate was sonicated using the Bioruptor until the lysate became clear (sonication cycle: 30 s ON, 30 s OFF). The lysate was centrifuged for 10 min at 14,000 x g at 4 °C. The sonicated lysate was then precleared with magnetic streptavidin beads (65001, Thermo Fisher Scientific) at 37 °C for 30 min with slow rotation. 2% volume of pre-cleared lysate was saved for the input. The remaining lysate was split into two new tubes evenly and incubated with 100 pmol of the Malat1 probe or the negative control probe in the hybridization buffer (750 mM NaCl, 1% SDS, 50 mM Tris-Cl pH 7.0, 1 mM EDTA, 15% formamide containing 1 mM PMSF, protease inhibitor cocktail (11836170001, MilliporeSigma), and RNase inhibitor (100 U/ml Superase-in, AM2694, Thermo Fisher Scientific)) at 37 °C for overnight with slow rotation. Magnetic streptavidin beads were then added to the samples and incubated at 37 °C for 30 min with slow rotation. DynaMag-15 magnetic strip was used to separate beads from the liquids. After 5 times of washing using the wash buffer (2 x NaCl and Sodium citrate (SSC, 15557044, Thermo Fisher Scientific), 0.5% SDS) with PMSF and proteinase inhibitor cocktail, the beads were isolated. The bound proteins were eluted by boiling the beads in 30 μl of 3 x blue juice buffer (150  mM Tris-HCl (pH 6.8), 6% SDS, 30% glycerol, and 0.03% Bromophenol Blue, with fresh 10% 2-Mercaptoethanol) and subjected to immunoblot analysis.

3.5x10⁴ of primary calvarial osteoblasts were plated in 48-well plates. Next day, 480 ng of the M50 Super 8 x TOPFlash plasmid (12456, Addgene) and 20 ng of pRL-Tk control plasmid (E2241, Promega) were transfected per well using Lipofectamine 3000 (L3000001, Invitrogen) according to the manufacturer’s instructions. After 24 hr transfection, the culture medium was replaced with fresh αMEM medium supplemented with 10%FBS. 48 hr post transfection, the cells were serum starved for 1 hr and then treated with 20% L- or 20% Wnt3a CM for 16 hr. Firefly and Renilla luciferase activities were measured using a Dual-Luciferase Reporter Assay system (E1910, Promega) on a Gen5 Microplate Reader (BioTek) according to the manufacturer’s instructions. Firefly luciferase activity was normalized to Renilla luciferase activity.

Single cell RNAseq datasets for bone (GSM3674239, GSM3674240, GSM3674241, GSM3674242) and bone marrow (GSM3674243, GSM3674244, GSM3674246) were downloaded from GSE128423 (Baryawno et al., 2019). Seurat package (Stuart et al., 2019) was applied for downstream analysis. Briefly, genes expressed in fewer than 3 cells and cells with less than 500 genes were filtered out. Cells with over 10% mitochondrial reads and exceeding 6000 nFeature_RNA were excluded. After NormalizeData, the top 5000 variable genes were selected based on dispersion method using FindVariableGenes function of Seurat package. Subsequently, data scaling was performed using the ScaleData function. All datasets were integrated based on the identified anchors. The first 30 principal components for both UMAP (Uniform Manifold Approximation and Projection) and the subsequent application of a graph-based clustering approach were used, with resolution at 0.1. The Clustree function was executed to understand how the structure of clusters changes across different resolutions. The FindAllMarkers function was utilized with parameters set to prioritizing positive markers expressed in at least 10% of cells within a cluster and exhibiting a log-fold change threshold of 0.25. The following gene markers were also included for cluster annotation: Acan, Col2a1 and Sox9 for chondrocytes Baryawno et al., 2019; Acta2, Myh11 and Mcam for pericytes Baryawno et al., 2019; Adipoq, Lepr, Cxcl12, Cebpa, Kitl, and Lpl for Adipoq-lineage progenitors Inoue et al., 2023; Prrx1, Col1a1, Ibsp, and Bglap for osteoblast lineage Inoue et al., 2023; Pecam1 and Cdh5 for endothelial cells Inoue et al., 2023; Cd19 for B cells Inoue et al., 2023; S100a8 for neutrophils Inoue et al., 2023; Mpz, Mbp, and Plp1 for Schwann cells Direder et al., 2022; Gypa, Alas2, Snca, Hbb-bs, Hbb-bt, Car1, Car2, Klf1, Gata1, and Gata2 for Erythroid cells Herkt et al., 2018; Locascio et al., 2015; Jain et al., 2022; Paul et al., 2015; Pf4, Itga2b,and Fli1 for Megakaryocytes Paul et al., 2015; Cd68, Lyz2, Ly6c2, and Sell for Monocyte-Macrophage lineage Inoue et al., 2023; Ito et al., 2021. We utilized Seurat’s FeaturePlot to visualize gene expression in individual cells. DotPlot was employed to illustrate the percentage of cells in a cluster expressing a specific gene and to visualize the average scaled expression level of each gene. The distribution of normalized gene expression levels across all cells in each cluster was visualized using VlnPlot function in Seurat. R version 4.3.2 and Seurat 5.0.1 were used in the study.

Bone marrow from 12-week-old WT and Malat1^-/- littermate mice was harvested from the femur and tibia (with both ends cut open) by flash centrifugation. The cell pellets were resuspended in 0.2 ml of chilled PBS containing protease inhibitor cocktail (11836170001, MilliporeSigma) and incubated on ice for 30 min. The suspension was centrifuged at 1500 rpm for 15 min at 4 °C and the supernatant was collected for immunoblot analysis.

Mouse serum OPG, P1NP and TRAP were measured using Mouse Osteoprotegerin ELISA Kit (MilliporeSigma), P1NP and TRAP ELISA kits (MyBioSource), respectively, according to the manufacturer’s instruction.

Statistical analysis was performed using Graphpad Prism software. Two-tailed Student’s t test was applied when there were only two groups of samples. In the case of more than two groups of samples, one-way ANOVA will be used with one condition, and two-way ANOVA was used with more than one condition. ANOVA analysis was followed by post hoc Bonferroni’s correction for multiple comparisons. p < 0.05 was taken as statistically significant. Data are presented as the mean  ± SD as indicated in the figure legends.