First, we examined the levels of ErbB4 protein and its phosphorylated form (p-ErbB4) in mouse OB after a reinforced go/no-go odor discrimination task. Over 3 days (200 trials each day), adult mice were first trained to discriminate between a pair of simple odors (water-rewarded isoamyl acetate and unrewarded heptanone) and then learned to discriminate complex chemical cues (60%/40% binary mixtures of these odors) (Figures 1A and 1B). A similar learning task without odor discrimination (go/go task) was performed in the control group (Figure 1A). As shown in Figures 1C and 1D, the level of p-ErbB4 in the go/no-go group was higher than that in the control group, suggesting a link between increased ErbB4 activity in the OB and olfactory discrimination ability.

Next, we evaluated the performance of ErbB4 knockout mice in the go/no-go task. ErbB4 protein was specifically deleted in the OB by delivery of adeno-associated virus recombinants expressing Cre recombinase and green fluorescence protein (GFP) (AAV-Cre-GFP) into both sides of the OB of neonatal mice carrying loxP-flanked ErbB4 alleles (Figure 1E and F). When learning to discriminate simple odor pairs (Figure 1G), both AAV-GFP and AAV-Cre-GFP mice reached an accuracy of above 90% within 3 days (∼ 600 trials), suggesting that ErbB4 deletion in the OB has no influence on learning and memory or the sense of smell. However, when distinguishing the 60/40% binary mixtures of these odors, the AAV-GFP group showed an accuracy above 80% after the 4-day training program (∼ 800 trials), but the AAV-Cre-GFP-injected mice showed a significant lower accuracy. This indicates that ErbB4 in the OB maintains the ability of mice to discriminate complex odors.

To further determine the role of OB ErbB4 in olfactory behaviors, we conducted a habituation/dishabituation test to assess the spontaneous behavioral responses of mice to repeatedly presented odors in the absence of any reward (Figure 1H). Both AAV-GFP mice and AAV-Cre-GFP mice habituated to four successive odor presentations with 2-min intertrial intervals: their behavioral responses to the same odor (isoamyl acetate) were progressively reduced. AAV-GFP mice rapidly dishabituated and increased their investigation time when a novel odor was presented (limonene, fifth trial), whereas AAV-Cre-GFP mice did not significantly alter their behavioral responses to the novel odor. Additionally, olfactory detection thresholds for isoamyl acetate and limonene were about 10^-5 in AAV-GFP mice, but 10^-4 in AAV-Cre-GFP mice (Figures 1I and 1J). In the habituation and dishabituation tasks, the two odors were used at levels far above the thresholds.

These results demonstrate that ErbB4 in the OB contributes to olfactory discrimination and dishabituation, but not to olfactory memory and habituation.

RNAscope analysis was performed to detect mRNA levels of ErbB4 in the OB of PV-Erbb4^+/+mice (generated by crossing PV-Cre mice with loxP-flanked Erbb4 mice). As shown in Figures 2A and 2D, ErbB4 mRNA was expressed in all five layers of the OB (green); ErbB4-expressing neurons accounted for 58.0%, 44.4%, 71.9%, 69.8%, and 71.2% of the total cells (DAPI, blue) in the GL, EPL, MCL, IPL, and GCL. PV interneurons (red) in the OB were mainly distributed in the EPL and IPL layers (Figure 2A); in these layers, ErbB4 tended to be located within PV interneurons (yellow) (Figures 2A-2C). Of the PV interneurons in the EPL and IPL, 69.4% and 100% expressed ErbB4, respectively (Figure 2E). Overall, ErbB4 expression in PV interneurons is highest within the IPL and lower within the EPL.

To further ascertain ErbB4 mRNA expression in individual PV interneurons, we conducted patch-clamp electrophysiology followed by single-cell analysis of reverse transcription-polymerase chain reaction (RT-PCR). For this experiment, we used slices from mice in which ErbB4 was specifically knocked out in PV interneurons (PV-Cre mice crossed with loxP-flanked Erbb4 mice; PV-Erbb4^−/−) and their control littermates (PV-Erbb4^+/+). In addition to their morphology, size, and location, MCs were characterized electrophysiologically as having low-frequency spike discharges (<100 Hz), whereas PV interneurons were identified by their high-frequency spike discharges (>100 Hz) (Figure 2F). The cytosolic contents from identified MCs and PV neurons were then subjected to RT-PCR, showing that ErbB4 mRNA was only present in PV interneurons from PV-Erbb4^+/+ OB, but not in any of the MCs or PV interneurons from PV-Erbb4^−/− OB (Figure 2G).

Next, ErbB4 proteins were detected by immunofluorescence and western blot analysis. Within the EPL of PV-Erbb4^+/+ mice, ErbB4 immunoreactivity was present in PV interneurons; this was not observed in the EPL of PV-Erbb4^−/−mice (Figure 2H). Western blots showed that the level of ErbB4 protein was largely reduced, but not abolished, in the OB, prefrontal cortex, and hippocampus of PV-Erbb4^−/− mice compared with their control littermates (Figures 2I and 2J). This suggests that ErbB4 is largely expressed in OB PV interneurons. Interestingly, ErbB4 deletion in the OB occurred at least two weeks prior to that in the prefrontal cortex and hippocampus (Figures 2I and 2J). Nissl staining showed that the overall lamina structures of the OB were not affected in PV-Erbb4^−/−mice (Figure supplement 1).

The above results demonstrate strong expression of ErbB4 in PV fast-spiking interneurons within the EPL and IPL layers of the OB.

To determine the contribution of ErbB4 expressed in PV interneurons to olfactory behaviors, we conducted reinforced go/no-go tests of olfactory discrimination in PV-Erbb4^+/+ and PV-Erbb4^−/−mice. Both groups learned to distinguish simple odor pairs with an accuracy of more than 90% within 600 trials (Figure 3A); for the difficult odor pairs, PV-Erbb4^−/− mice exhibited significantly lower accuracy than their control littermates (Figure 3A). During habituation/dishabituation tasks, both groups of mice habituated to the successive presentation of a familiar odor (isoamyl acetate, fourth trial) (Figure 3B); when a novel odor (limonene, fifth trial) was presented, PV-Erbb4^−/− mice did not increase their investigation time, unlike their control littermates (Figure 3B). Similarly, when the presentation of the odors was reversed, the PV-Erbb4^−/−group showed impaired dishabituation but the PV-Erbb4^+/+ group did not (Figure 3C). The olfactory detection thresholds for isoamyl acetate and limonene were slightly higher in PV-Erbb4^−/−mice than in PV-Erbb4^+/+ mice (Figures 3D and 3E). We also tested mice with the buried food test, which depends on the animal’s natural tendency to utilize olfactory cues for foraging, to confirm whether the mice could smell volatile odors. As shown in Figure 3F, both PV-Erbb4^+/+ and PV-Erbb4^−/− mice found the buried pellets rapidly over three consecutive testing days. On trial day 4, they also easily located the pellet within a similar timeframe when the food pellet was made visible by placing it on the surface, suggesting that selective deletion of ErbB4 in PV interneurons does not alter the ability of mice to detect and locate odorous sources.

These findings reveal that ErbB4 signaling in PV interneurons serves as an essential regulator of olfactory discrimination and dishabituation behaviors.

To investigate whether ErbB4 in PV interneurons modulates the activity of M/TCs, we recorded extracellular single-unit spontaneous and odor-evoked activity from M/TCs in the OB via tetrodes implanted in awake, head-fixed PV-Erbb4^-/- and PV-Erbb4^+/+mice (Figure 4A). Single units were identified by principal-component analysis scan clustering of the spikes. Both excitatory (upper) and inhibitory (lower) responses were observed upon odor presentation from an odor delivery system (Figures 4B and 4C). Figure 4D shows the heat maps of odor-evoked firing rates of 240 M/TCs in PV-Erbb4^+/+ mice (left) and 232 M/TCs in PV-Erbb4^−/− mice (right). As shown in Figure 4E, spontaneous firing in M/TCs was similar in PV-Erbb4^+/+ and PV-Erbb4^−/− mice. However, odor-evoked firing of M/TCs was reduced by ErbB4 deletion in PV interneurons. Both the absolute value of odor-evoked changes and the normalized signal-to-noise ratio (SNR) were lower in PV-Erbb4^−/− mice than PV-Erbb4^+/+ mice. We next analyzed the differences in neurons with excitatory responses, inhibitory responses, and no responses to odor presentation in PV-Erbb4^+/+ and PV-Erbb4^−/− mice. Figure 4F and 4G show the changes in firing for excitatory responses during odor presentation. Compared with the PV-Erbb4^+/+ group, M/TCs in PV-Erbb4^−/− mice had significantly higher spontaneous firing. The odor-evoked firing rate was not changed by ErbB4 deletion in PV interneurons. The odor-evoked change in mean firing rate (ΔMFR), SNR, and normalized SNR were all decreased in PV-Erbb4^−/− mice. Figures 4H and 4I showed the changes in firing for inhibitory responses during odor presentation. Compared with the PV-Erbb4^+/+ group, M/TCs in PV-Erbb4^−/−mice had significantly lower spontaneous firing rates. The odor-evoked firing rate of M/TCs was also decreased by ErbB4 deletion in PV interneurons.

Interestingly, the odor-evoked ΔMFR also showed a significant decrement in PV-Erbb4^−/− mice. Although the SNR was decreased, the normalized SNR was increased in PV-Erbb4^−/− mice. Figures 4J and 4K show the changes in firing for cells classes as having no response during odor presentation. Spontaneous firing in M/TCs was higher in PV-Erbb4^−/− mice than in PV-Erbb4^+/+ mice. The odor-evoked firing rate of M/TCs was also increased by ErbB4 deletion in PV interneurons. The absolute value of odor-evoked changes (ΔMFR) and normalized SNR were not changed in PV-Erbb4^−/−mice compared with PV-Erbb4^+/+ mice. These results show that odor-evoked excitatory and inhibitory responses were both compromised in PV-Erbb4^−/− mice. In other words, the absolute change in firing rate (ΔMFR) was reduced after ErbB4 ablation in PV interneurons regardless of the direction of the odor-evoked change. Furthermore, the distribution of types of odor-evoked responses was significantly altered in PV-Erbb4^−/− mice compared with PV-Erbb4^+/+ mice (Figure 4L), suggesting compromised odor detection.

These results demonstrate that ErbB4 signaling in PV interneurons contributes to response intensity in M/TCs.

Next, we investigated whether ErbB4 deletion in PV interneurons affects OB LFP oscillations. Raw LFP signals were divided into different frequency bands: theta (2 to 12 Hz), beta (15 to 35 Hz), low gamma (36 to 65 Hz), and high gamma (66 to 95 Hz) (Figure 5A). For all frequency bands of the ongoing baseline LFP, the power was higher in PV-Erbb4^−/− mice than in PV-Erbb4^+/+ mice (Figures 5B-5I). These results suggest that ErbB4 in PV interneurons controls the spontaneous ongoing network oscillations in the OB.

To further evaluate the physiological role of PV interneuron ErbB4 in the regulation of the OB output, we recorded spontaneous and evoked excitatory firing rates from principle MCs (the output cells) in OB slices. Cell-attached recordings showed that the frequency of MC spontaneous action potentials (sAPs) was dramatically enhanced in PV-Erbb4^−/− mice compared with PV-Erbb4^+/+ mice (Figures 6A and 6B).

Furthermore, the frequency of evoked action potentials (eAPs) was also higher in PV-Erbb4^−/− mice (Figures 6A and 6B). However, the ratio of eAP to sAP firing (i.e., the signal-to-noise ratio, SNR) was significantly lower in PV-Erbb4^−/− mice (Figures 6A and 6B). More importantly, the SNR in response to stimuli at various intensities was lower in PV-Erbb4^−/− mice than in their control littermates (Figures 6C and 6D), even though the overall current-evoked activity was elevated in PV-Erbb4^−/− mice compared with their control littermates (Figures 6E and 6F).

These data indicate an involvement of PV interneuron ErbB4 in OB odor information processing.

To investigate the neural mechanisms underlying the observed hyperexcitability in PV-Erbb4^−/−mouse MCs, we tested whether the effect of ErbB4 deletion in PV interneurons could be occluded by GABAergic blockage. Bicuculline (10 μM), a selective GABA_A receptor antagonist, elevated sAP firing in MCs from PV-Erbb4^+/+ mice but did not further increase MC hyperexcitability in PV-Erbb4^−/−mice (Figures 7A and 7B). Bicuculline also reduced the eAP:sAP ratio in PV-Erbb4^+/+MCs but not in PV-Erbb4^−/− MCs (Figure 7A and 7B). These data indicate that the hyperexcitability in PV-Erbb4^−/− MCs depends on GABAergic downregulation. To further dissect the role of GABAergic transmission in MC hyperexcitability in PV-Erbb4^−/−mice, we recorded GABA_A receptor-mediated miniature inhibitory postsynaptic currents (mIPSCs) from MCs in whole-cell mode. As shown in Figures 7C and 7D, the mIPSC frequency, but not the amplitude, were significantly reduced in PV-Erbb4^−/− mice, suggesting a presynaptic impairment of inhibitory transmission.

By contrast, neither the frequency nor the amplitude of glutamatergic receptor-mediated miniature excitatory postsynaptic currents (mEPSCs) were altered in PV-Erbb4^−/−mice compared with their control littermates (Figures 7E and 7F). These results suggest that ErbB4 in PV interneurons regulates olfactory information output by maintenance of GABAergic inputs to MCs in the OB.

We next examined the influence of specific PV-ErbB4 knock-out on recurrent inhibition of MCs. The prolonged hyperpolarization after AP firing that results from recurrent inhibition was recorded in the whole-cell patch-clamping configuration. Although the strength of recurrent inhibition is reported to depend on MC firing rates (Margrie et al., 2001), neither the amplitude nor the decay times of recurrent inhibitory postsynaptic potentials (IPSPs) showed significant alteration with the increment in AP frequency in PV-Erbb4^−/− mice (Figures 8A and 8B). One possible explanation is that the loss of ErbB4 in PV interneurons severely impedes recurrent IPSPs. To test this hypothesis, we recorded recurrent IPSPs after a given frequency of APs in PV-Erbb4^−/− mice. As shown in Figure 8C, a current injection of 80 pA in PV-Erbb4^−/− mice elicited approximately the same firing rate as a current injection of 100 pA in PV-Erbb4^+/+ mice. Remarkably, both the amplitude and the decay time constant of the subsequent recurrent IPSP were reduced in PV-Erbb4^−/− mice (Figure 8D). Thus, ErbB4 ablation in PV interneurons weakens recurrent inhibition evoked by the same MC firing intensity.

In addition, we attempted to isolate the broader lateral inhibition between MCs and detect the effect of PV interneuron ErbB4 ablation on it. The recorded MC corresponding to the target glomerulus was identified visually by Alexa 488 dye in the whole-cell patch pipette, as described previously (Hu et al., 2017). A stimulating electrode was then placed into the glomerulus located 3–4 glomeruli (∼ 400 μm) caudally from the target glomerulus. Before recording, we sectioned through the glomerular layer (GL) and GC layer (GCL) between the sites of conditioning stimulation and the target glomerulus to eliminate interglomerular and GC-mediated lateral inhibition (Figure 8E). As shown in Figures 8F and 8G, a burst of conditioning stimuli (40 pulses at 100 Hz) caused a reduction in the MC firing rate in PV-Erbb4^+/+ mice, but not in PV-Erbb4^−/− mice. When we also cut through the EPL, this broader lateral inhibition was totally abolished in PV-Erbb4^+/+mice (Figures 8H-8J), indicating that the broader lateral inhibition was mediated by ErbB4-expressing PV interneurons.

The above data reveal an important contribution of PV interneuron ErbB4 to inhibitory circuit plasticity in the OB.

Finally, we evaluated the contribution of PV-ErbB4 in the OB to olfactory behaviors. ErbB4 expression in PV interneurons in the OB was reduced after loxP-flanked Erbb4 mice were stereotactically injected in the OB with AAV-PV-Cre-GFP recombinants, but not when they were injected with the control AAV-PV-GFP group (Figures 9A and 9B). ErbB4 reduction in OB PV interneurons impaired behavioral discrimination of complex odor mixtures in the reinforced go/no-go task (Figure 9C). Spontaneous dishabituation responses were also impaired in AAV-PV-Cre-GFP mice compared with the control AAV-PV-GFP group (Figures 9D and 9E). Olfactory detection thresholds for isoamyl acetate and limonene showed a slight increase in AAV-PV-Cre-GFP mice compared with AAV-PV-GFP mice (Figures 9F and 9G).

Thus, ErbB4 signaling in PV interneurons in the OB is required for olfactory discrimination and dishabituation in mice.

Rabbit polyclonal anti-ErbB4 antibody (sc-283, 1:2000, or 1:1000 for blotting, 1:100 for staining) was purchased from Santa Cruz, mouse monoclonal anti-PV antibody (P3088, 1:7000 for staining) was purchased from Sigma, anti-β-actin antibody (4970, 1:5000 for blotting) was purchased from Cell Signaling Technology, goat anti-rabbit IgG conjugated with Alexa Fluor 488 (A11089, 1:400 for staining) and goat anti-mouse IgG conjugated with Alexa Fluor 594 (A11037, 1:400 for staining) were purchased from Invitrogen. The Na⁺ channel blocker tetrodotoxin (TTX, 1069) was purchased from Tocris and GABA_A receptor antagonist (+)-bicuculline (ALX-550-515) from Enzo. Other chemicals were sourced from Merck Sigma–Aldrich. ErbB4 conditional knockout mice (PV-Erbb4^−/−) were generated by crossing PV-Cre mice with loxP-flanked Erbb4 mice (Garcia-Rivello et al., 2005; Wen et al., 2010; Xu et al., 2022). Mice were housed under a 12-h light/dark cycle and had ad libitum access to water and food except for during the behavioral tests. All experiments were done with both sexes of mice. All experimental procedures were conducted in accordance with the guidelines described in the revised Regulations for the Administration of Affairs Concerning Experimental Animals (2011) in China and approved by the local Institutional Animal Care and Use Committee.

Tissues were homogenized in the homogenization buffer containing 50 mM Mops (pH 7.4), 320 mM sucrose, 100 mM KCl, 0.5 mM MgCl₂, 0.2 mM dithiothreitol, and phosphatase and protease inhibitors (20 mM sodium pyrophosphate, 20 mM β-glycerophosphate, 50 mM NaF, 1 mM each of EDTA and EGTA, sodium orthovanadate, p-nitrophenyl phosphate, PMSF and benzamidine, and 5 μg/ml each of aprotinin, leupeptin, and pepstatin A). Homogenates (40 μg of protein) were resolved by 7.5% SDS/PAGE and transferred to nitrocellulose membranes (Millipore), which were blocked with 3% bovine serum albumin (BSA) in Washing buffer (100 mM NaCl, 0.1% Tween-100, 10 mM Tris, pH 7.5). Membranes were incubated overnight with the primary antibody in 1% BSA then probed with the secondary antibody for 1h. Signals were visualized with Immobilon Western Chemiluminescent HRP Substrate. Immunobloting quantification was performed in ImageJ (NIH).

Virus injections were performed as previously described (Kato et al., 2013). Neonatal loxP-flanked ErbB4 mice (0–3 days old) were cryo-anesthetized in an ice-cold chamber and head-fixed in a stereotaxic device (RWD68513, RWD Life Science). Virus (AAV-Cre-GFP [55764361#] and AAV-GFP [55764363#] were from Obio Technology; AAV-PV-Cre-GFP [PT-0275] and AAV-Cre-GFP [PT-0154] were from BrainVTA) was delivered with titer 10¹² genome copies per milliliter. The injection coordinates were as follows (anteroposterior, mediolateral, and dorsoventral relative to the intersection of the midline and the inferior cerebral vein, in mm): (+0.2, ±0.3, − 0.9/0.7), (+0.2, ±0.6, −0.9/0.7), (+0.5, ±0.3, −0.7/0.5) and (+0.5, ±0.6, −0.7/0.5). Virus (20 nl per site) were injected with a speed of 23 nl/s through a glass pipette. Behavioral tests were performed 10 weeks after virus injections.

Behavioral analysis was carried out by investigators unaware of the genotypes of the experimental animals, to ensure that the study was blinded.

To examine the expression of the ErbB4 gene, RNAscope was performed using an RNAscope Fluorescent Multiplex Kit (Advanced Cell Diagnostics, ACDBio) per manufacturer’s recommendations. Briefly, the OB was cut into 20-µm coronal sections. Sections were serially thaw-mounted onto 20 slides (Fisherbrand) through the entire OB and then air-dried for 1 h at room temperature prior to storage at −80°C. RNAscope probes were obtained from ACDBio for ErbB4 (Cat #318721) and PV (Cat #421931-C2). Sections were counterstained for the nuclear marker DAPI (Abcam, Cat #104139).

Mice (4 weeks old) were perfused transcardially with 4% paraformaldehyde. Dissected brains were postfixed overnight and dehydrated in 30% sucrose for 24 h at 4°C, then the OBs were cut into 40-μm-thick sections horizontally on a vibratome (Leica). OB sections were processed for double immunofluorescence in 0.1 M PBS (pH 7.4) as follows: three washes in 0.1 M PBS, 10 min each; blocking in 0.1 M PBS containing 10% normal goat serum, 1% BSA, and 0.25% Triton X-100 overnight at 4°C; primary antibody incubation for 40 h at 4°C in blocking solution; three washes; secondary antibody for 90 min at room temperature in blocking solution; three washes; rinsing with PBS and mounting with a mounting medium (Vectashield, Vector Laboratories). Immunoreactivity was imaged by Alexa 488- and Alexa 594-conjugated goat anti-mouse IgG. Sections were analyzed with a confocal microscope (Zeiss L710) at 20×and 60×magnification. Cresyl violet staining was carried out as described previously. The OCT-embedded OBs were cut into 20-µm sections. OB sections were stained with 0.1% cresyl violet for 35 min, dehydrated with ascending grades of alcohol, then cleared with xylene, mounted, and observed under an Olympus microscope.

Acute OB slices were prepared as described previously (Hu et al., 2021; Hu et al., 2017). In brief, animals were heavily anesthetized with ketamine/xylazine (140/20 mg/kg, intraperitoneally) and decapitated, then the OB was quickly removed and immersed in ice-cold and oxygenated (95% O₂/5% CO₂) ACSF containing (in mM: 124 NaCl, 3 KCl, 2 CaCl₂ 1.3 MgCl₂, 25 NaHCO₃, 1.25 NaH₂PO₄, and 10 glucose). Horizontal slices (300 μm) were cut with a VT1000s vibratome (Leica), recovered at 37°C for 30 min and then maintained at 25°C.

OB slices were transferred to the recording chamber, which was warmed to 33°C and superfused with oxygenated ACSF (2 mL/min). Neurons were visualized with infrared optics using an upright microscope equipped with a 60×water-immersion lens (BX51WI, Olympus) and an infrared-sensitive CCD camera. MCs and PV interneurons were identified by their fluorescence, morphology, size, location, and electrophysiological characterization.

For cell-attached mode, recording pipettes with resistances of 6–8 MΩ were pulled from borosilicate glass capillaries (P97, Sutter Instrument Co) and filled with ACSF. To record olfactory-nerve-evoked responses, monophasic square pulses (200 μs) with an intensity of 0.2 mA or gradual increasing intensities of 0.1, 0.15, 0.2, 0.25, and 0.3 mA were delivered through a concentric electrode that was placed on the outermost layer of the OB, near the recorded MC. The frequency of firing was defined as number of action potentials/time window. A 5-s window prior to olfactory-nerve stimulation was used to assess the spontaneous firing rate, and the first 1-s window after stimulation of the olfactory nerve was used to assess the evoked response. The signal-to-noise ratio (SNR) was defined as the ratio of evoked responses to spontaneous firing in the 5 s prior to olfactory nerve stimulation.

To record whole-cell action potentials and mEPSCs, pipettes were filled with a solution containing 140 mM K-methylsulfate, 4 mM NaCl, 10 mM HEPES, 0.2 mM EGTA, 4 mM MgATP, 0.3 mM Na₃GTP, and 10 mM phosphocreatine (pH was adjusted to 7.4 with KOH). MCs were held at −65 mV in the presence of 20 µM bicuculline and 1 μM TTX during recording of mEPSC.

To isolate mIPSCs, MCs were held at −65 mV in the presence of 50 µM AP5, 20 µM NBQX and 1 μM TTX with a CsCl-base intracellular solution containing (mM): 135 CsCl, 10 HEPES, 0.2 EGTA, 2 Na₂ATP, 0.3 Na₃GTP, and 10 glucose. Miniature events in a 5-min recording period were analyzed in Mini Analysis software (Synaptosoft, ver. 6.07).

Lateral inhibition recordings were obtained according to procedures described previously (Arevian et al., 2008; Hu et al., 2017; Whitesell et al., 2013). Briefly, a concentric bipolar stimulating electrode was placed into the caudal glomerulus located 3–4 glomeruli (∼400 μm) caudally from the one correlated with the recorded MC. The intensity of the stimulation was moderate (100 μA) to avoid stimulating the glomerulus of the recorded MC, which would invariably evoke excitatory postsynaptic potentials (EPSPs). Pulses of 200-μs duration were delivered at 100 Hz and synchronized with the recording by a Master-8 stimulator (AMPI). Alexa 488 dye (100 μM) was added to the intracellular solution to visualize cell morphology. Signals were acquired with a MultiClamp 700B amplifier (Molecular Devices), filtered at 2 kHz, and sampled at 10 kHz with a Digidata 1440A interface (Molecular Devices) and Clampex 10.2 software (Molecular Devices). Data were accepted when the series resistance stayed within 15% of the initial value. The spontaneous and miniature events in a 5-min recording period were analyzed in Mini Analysis software (Synaptosoft, ver. 6.07).

At the end of the recording session, gentle suction was applied to aspirate the cytoplasm into the pipette while maintaining a tight seal. After complete incorporation of the soma, the pipette was carefully removed from the neuron to perform an outside-out patch recording, then quickly removed from the bath. The harvested contents were expelled into a PCR tube. RT was performed in a final volume of 20 μl using a QuantiTect Reverse Transcription Kit (205311, Qiagen). Next, outer and nested primer sets were used for two consecutive rounds of PCR, as described previously (Vullhorst et al., 2009). For the first round of PCR, all targets were amplified simultaneously using outer primer pairs for PV and ErbB4 (first set PCR primer sequences: GCCTGAAGAAAAAGAACCCG and AATCTTGCCGTCCCCATCCT for PV, CCAGCCCAGCGCTTCTCAGTCAG and GTATTTCGGTCAGGTTCTTTAATCC for ErbB4, 20 pmol of each) in a final volume of 100 μl for 21 cycles. Each cycle comprised a 94°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 30 s. For the second round of PCR, PV and ErbB4 were separately reamplified using specific nested primer sets for 35 cycles of PCR, as described above, with 2 μl of the first PCR product as template (second primer sequences: CGGATGAGGTGAAGAAGGTGT and TCCCCATCCTTGTCTCCAGC for PV, CTGACCTGGAACAGCAGTACCGA and AGGCATAGCGATCTTCATATAGT for ErbB4). Products were assayed on 2% agarose gels stained with Gel Red, with dl1000 as a molecular weight marker.

After being deeply anesthetized, mice were secured in a stereotaxic frame (RWD Instruments, Shenzhen, China). The fur on the surface of the scalp from the midpoint between the ears to the midline of the orbits was removed. For spike and LFP recording, tetrodes (single-wire diameter, item no. PF000591, RO-800, 0.0005”/12.7 μm, coating 1/4 hard PAC, Sandvik) were implanted into the hole drilled above the OB (4.28 mm anterior from bregma, 1.0 mm lateral from the midline). The tetrodes were lowered into the brain after the dura mater was punctured. Each tetrode was connected to a 16-channel electrode interface board (EIB-16, Neuralynx). Signals were sent to a headstage and amplified by a 16-channel amplifier (Plexon DigiAmp) and monitored in real time to ensure optimal placement within the ventral MC layer. A stainless-steel screw was inserted into the parietal bone (1 mm posterior to bregma and 1 mm from the midline) and connected to the ground as the reference electrode. Finally, a custom-designed aluminum head plate was sealed to the skull surface with dental cement to enable head fixation during recordings. Mice were returned to their home cages to recover for at least a week.

Recordings began at least one week after electrode implantation. Mice were head-fixed with two horizontal bars fixed to the headplate by two screws and were able to walk on an air-supported floating polystyrene foam ball (Thinkerbiotech, Nanjing, China). For spike recordings, the signals from the tetrodes were filtered at 300–5000 Hz and sampled at 40 kHz. Odor stimulus event markers were recorded alongside the spike recording. For local field potential (LFP) recordings, the signals were amplified by 2000×gain, bandpass filtered at 0.1–300 Hz, and sampled at 1 kHz (Plexon DigiAmp).

A standardized panel of eight odors (isoamyl acetate, 2-heptanone, phenyl acetate, benzaldehyde, dimethylbutyric acid, n-heptane acid, n-pentanol, and 2-pentanone, purchased form Sinopharm Chemical Reagent) were presented by an odor delivery system (Thinkerbiotech). All odors were dissolved at 1% (v/v) dilution in mineral oil. During odor stimulation, a stream of charcoal-filtered air flowed over the oil at a total flow rate of 1 L/min and the vapour-phase concentration was further diluted to 1/20 by the carrier airflow. The mice were first anesthetized with isoflurane for about 20 s and then rapidly transferred to the polystyrene foam ball. Before the start of in vivo electrophysiological recordings, mice were allowed 10 min to acclimate to the fixation and recover from the isoflurane. Odor presentation was controlled by the odor delivery system coupled to a solenoid valve driven by a digital-to-analog converter.

Each odor was presented for 2 s and the inter-trial interval was about 24 s.

Spikes were identified and sorted from the raw data in Offline Sorter V4 software (Plexon). Spikes were detected and sorted when they had an amplitude larger than five times the standard deviation of the noise. Principal component analysis of the data was performed to separate different units. When <0.75% of the inter-spike intervals were <1 ms, a unit was classified as a single unit. Data from 4 s before until 6 s after the onset of the odor stimulation event were extracted, and the spike firing rate was averaged within 100-ms bins to generate a peristimulus time histogram (PSTH). The spontaneous firing rate and the odor-evoked firing rate were calculated by averaging the spikes recorded during the periods 4–2 s before odor stimulation and 2 s after the start of odor stimulation, respectively. To determine whether the odor evoked a significant response, we used a Wilcoxon signed-rank test to compare the spontaneous (baseline) firing rate with the odor-evoked firing rate across all trials for each unit–odor pair. The particular unit–odor pair was defined as nonresponsive if the P value was >0.05. Conversely, if the P value was <0.05 the unit–odor pair was defined as responsive. The unit–odor pairs were further categorized as showing an excitatory response (if the odor-evoked firing rate was greater than the spontaneous firing rate) or an inhibitory response (if the odor-evoked firing rate was lower than the spontaneous firing rate). Subtracting the baseline firing rate from the odor-evoked firing rate yielded the Δ mean firing rate (MFR). The normalized signal-to-noise ratio (SNR) was defined as follows: normalized SNR = | (odor-evoked firing rate/the baseline firing rate) −1|.

LFP signals were analyzed with a Matlab script and divided into different frequency bands: theta (2 to 12 Hz), beta (15 to 35 Hz), low gamma (36 to 65 Hz), and high gamma (66 to 95 Hz). The spectral power of each frequency resolution was calculated over 4-s window. The spectral power of all frequencies within the bandwidth was averaged.

Data are presented as the mean ±standard error of the mean (SEM). Unpaired or paired t tests were used to compare data from two groups. A Chi-square test was used for comparison of two constituent ratios. One or two-way ANOVAs were used to for comparisons between more than two groups (western blots, behavioral and electrophysiological studies). All tests were two-sided and considered to be statistically significant when P < 0.05. Statistical analyses were performed in GraphPad Prism.