The human bloodstream is a highly protected niche, and so to establish an infection in this environment the bacteria must evade many aspects of host immunity, such as the bacterial membrane damaging antimicrobial peptides (AMP) and host defence fatty acids (HDFAs) found in serum^{9–12,19–22}. To examine the level of variability that exists in serum-susceptibility in natural populations of S. aureus, we exposed 300 clinical isolates to pooled human serum and quantified the proportion of each culture that survived. These 300 isolates represent the two major clones, as defined by multi-locus sequence typing: clonal complex 22 (CC22) and clonal complex 30 (CC30), that are responsible for the majority of MRSA cases in the UK and Ireland¹⁴. This collection is a unique resource as each strain has been sequenced, extensively phenotyped, and we have clinical metadata for many of the patients the bacteria were isolated from¹⁴. We found there to be similar levels of variability in the ability of the bacteria to survive exposure to human serum across the two CCs, both with a >10³ fold difference between the most and least susceptible isolate with respect to the number of bacteria that survived (Fig. 1a & b).

As the genome sequence for each of the 300 clinical S. aureus isolates was available we performed a GWAS (genome wide association study) to identify polymorphic loci or single nucleotide polymorphisms (SNPs) that associated with the level of susceptibility of isolates to serum. For this, the data from the two distinct clones were analysed independently, with population structure within the clones being accounted for (Fig. 1c & d, Tables 1a & 1b). We applied both uncorrected and corrected (for multiple comparisons) significance thresholds to this analysis, as our previous work has demonstrated that the stringency of multiple correction approaches increases the likelihood of type II errors (i.e. false negative results). For the CC22 collection 12 loci were associated with serum survival and for the CC30s there were 32 associated loci (Fig. 1c & d, Tables 1a & 1b).

Of the 44 loci associated with serum survival, there were transposon mutants available for 32 in the Nebraska library²³. To functionally verify our GWAS findings, each of these mutants were tested for their ability to survive exposure to human serum. We found seven mutants were significantly affected in this ability, and this effect was complemented by expressing the inactivated gene in trans (Fig. 2). The seven genes were tcaA, a gene associated with resistance to the antibiotic teicoplanin²⁴; tarK, a gene involved in wall teichoic acid (WTA) biosynthesis²⁵; gntR, which encodes gluconate kinase²⁶; ilvC, which encodes ketol-acid reductoisomerase²⁷; arsB, which is an efflux pump involved in arsenic resistance²⁸; yfhO, which is involved in the glycosylation of lipoteichoic acid²⁸; and pdhD, which encodes a lipoamide dehydrogenase³⁰.

The tcaA gene has previously been reported to be involved in conferring increased sensitivity to the antibiotic teicoplanin²⁴, and our findings suggest it also confers increased sensitivity to serum (Fig. 2a). To visualise the signal detected by the GWAS for this gene we have mapped the position of the clinical isolates with the tcaA SNPs onto a figure displaying the range of serum sensitivities of the collection (Fig. 3a). The majority of the isolates with the SNPs were less sensitive to serum, suggesting the SNPs negatively affects the activity of the protein. The most common SNP in the tcaA gene amongst the clinical isolates conferred a Phe (290) to Ser change in the protein sequence. Using AlphaFold³¹ we generated a structure for TcaA where it is predicted to be membrane bound with a single membrane spanning domain; to have a zinc finger presented intracellularly; with the majority of the protein including the Phe290 displayed extracellularly (Fig. 3b). Given that phenylalanines are frequently involved in protein-protein interactions³² we examined the effect this change has on the activity of TcaA by cloning the tcaA gene with this SNP into the complementing pRMC2 plasmid and comparing its ability to confer serum resistance relative to that of the tcaA gene without the SNP. The TcaA protein with Ser at position 290 instead of Phe were slightly more resistant to serum killing, but not as affected as when the entire protein was inactivated, suggesting this change has a subtle effect on the serum sensitising activity of the protein (Fig. 3c).

To examine whether the effect of TcaA on serum resistance was specific to the JE2 background we transduced the tcaA::tn mutation from JE2 into S. aureus strains SH1000 and Newman. Attempts were made to transduce this mutation into a clinical CC22 isolate, but this lineage was refractory to any of the available transducing phage^33,34. In all three backgrounds TcaA increased the sensitivity of the bacteria to serum (Fig. 4a) verifying that the effect was not limited to the JE2 background. To determine which aspects of human serum TcaA was conferring increased sensitivity to, we measured the relative ability of the wild type and mutant to survive exposure to some of the anti-bacterial factors found in serum: to the HDFA arachidonic acid, and to two AMPs: HNP-1 and LL37. The strains producing TcaA (i.e. the WT and complemented strain) were more sensitive to all three components of human serum (Fig. 4b-d). For the AMPs this sensitivity was significant after only 90 min exposure, whereas for arachidonic acid sensitivity was also evident after 90 minute, but was more prominent after overnight incubation.

Although none of the individual antibacterial components of serum tested here are involved in S. aureus cell clumping, it is a possibility that some of the effects seen in serum is as a result of this activity, artificially amplifying the effect. To examine this the wild type and tcaA mutant were visually examined by microscopy in both PBS and serum where no differences in clumping was observed (Supplementary Fig. 1). Of the other GWAS identified genes, the ilvC mutant was less sensitive to arachidonic acid, the yfhO mutant was more resistant to HNP-1 and LL-37, while the tarK, gntK, arsB and phdD mutants were all more sensitive to HNP-1 and LL37 when compared to the JE2 wild type strain (Supplementary Fig. 2).

The antibacterial properties of HDFAs and AMPs share some common features in that they both penetrate through the cell wall and attack the bacterial membrane^{9–12,19–22}. AMPs are positively charged molecules that rely on the relatively negative charge across the bacterial cell envelope to penetrate, and thus resistance is frequently acquired by changing the charge across the cell wall such that the AMPs are repelled^20,21. Less is known about how HDFAs penetrate the cell wall; however, resistance is associated with changes in the abundance of wall teichoic acids (WTA) in the bacterial cell walls²². WTA are hydrophilic and when present in the cell wall they are believed to be protective by interfering with the penetration of the hydrophobic HDFAs through to the bacterial membrane²². It has also been shown that when the ligation of WTA to the cell wall is affected, such that they are instead released into the environment, this also decreases the sensitivity of the bacteria to HDFAs¹¹. With distinct modes of action and means of accessing their target, it is intriguing to consider how TcaA may be contributing to increasing the sensitivity of S. aureus to both these types of anti-bacterial molecules.

To examine whether the TcaA associated increase in sensitivity to arachidonic acid is a result of an increase in the abundance of WTA in the bacterial cell we extracted and quantified WTA from the wild type and tcaA mutant, where we found that the cell wall of the wild type had significantly more WTA when compared to the tcaA mutant cell extract (Fig. 5a & b; densitometric analysis of triplicate extractions can be seen in Supp. Fig. 3). We next quantified WTA in the bacterial supernatant, as recent work on a S. aureus lcpA mutant demonstrated that another WTA related means of altering sensitivity to arachidonic acid is to release the WTA the bacteria surface¹¹. We found significantly less WTA in the extract of the TcaA producing wild type strain compared to that of the tcaA mutant (Fig. 5a; densitometric analysis of triplicate extractions can be seen in Supp. Fig. 3), which could explain the observed difference in sensitivity to HDFAs. It was unclear from the previous work on LcpA how the released WTA by the lcpA mutant affects arachidonic acid sensitivity, and here we demonstrate that this mutant, like the tcaA mutant, is also less sensitive to human serum (Fig. 5d). One hypothesis is that the WTA can either sequester or inactivate HDFAs in the environment surrounding the bacteria, thereby neutralising them. To test this, we harvested the supernatant of the wild type JE2, the JE2 tcaA mutant, and the JE2 lcpA mutant from overnight growth. These supernatants were used to supplement fresh broth (at 10%) into which the wild type JE2 strain was inoculated. In the absence of any arachidonic acid JE2 grew equally well regardless of the supernatant supplement (Fig. 5e). However, in the presence of the supernatant of both the tcaA and lcpA mutant (both of which contain an abundance of released WTA), JE2 was able to grow in the presence of arachidonic acid; whereas when the JE2 supernatant was used as the supplement the bacteria were unable to grow (Fig. 5e). To further verify that soluble WTA can neutralise arachidonic we performed WTA extractions from an isogenic wild type and mutant of the S. aureus strain LAC where the mutant has had the tarO gene deleted and consequently does not produce any WTA (Fig. 5e). The incorporation of the wild type LAC WTA extract to broth at 2% created an environment in which JE2 could grow in the presence of arachidonic acid, whereas the equivalent WTA extract of the tarO mutant, which contains no WTA, did not (Fig. 6e). Together these data demonstrate that WTA in the environment can neutralise arachidonic acid, and this provides a likely explanation for the increased sensitivity to HDFAs associated with TcaA production.

In additional to being hydrophilic, WTA is also predominantly negatively charged²⁵. Given that a change in charge across the bacterial cell wall is frequently associated with resistance to AMPs^19–21, and that the wild type strain has more WTA in its cell wall, this may explain the increased AMP sensitivity of the TcaA producing strain. To examine this, we incubated the bacteria with cytochrome C, which is positively charged and through its electrostatic-related ability binds to the bacterial cells, providing a measure of the charge across bacterial cell walls. Using this we found that the wild type strain bound significantly more cytochrome C and is therefore more negatively charged than the tcaA mutant, which explains the increase in AMP sensitivity we have found associated with TcaA production (Fig. 5e). Together these results explain how TcaA production affects the sensitivity of S. aureus to both HDFAs and AMPs. By retaining WTA within the cell wall, there is less released to sequester or inactivate the fatty acids from the environment, and due to their negative charge, increased amounts of WTA in the cell wall affects the charge across the cell wall and results in increased electrostatic attraction of the positively charged AMPs.

As mentioned previously, an additional interesting feature of the TcaA protein is that is has also been associated with changing the sensitivity of the bacteria to the antibiotic teicoplanin, although this has been reported to vary between strains^24,35. To examine this for our strains we compared the ability of our three pairs of wild type and tcaA mutants (in strains JE2, Newman and SH1000) to grow in the minimum inhibitory concentration of teicoplanin for each wild type strain (Supp. Table 2), where TcaA production resulted in increased sensitivity to this antibiotic across all three strains (Fig. 6a). Minimum inhibitory concentrations (MICs) for teicoplanin have also been determined for these, where in each case the production of TcaA halves the MIC of the antibiotic (Supp. Table 2). To examine whether the clinical isolates with the SNPs in the tcaA gene associated with increased serum resistance also had altered teicoplanin sensitivity, we compared the ability of 12 clinical isolates containing the GWAS identified tcaA SNPs to grow in teicoplanin to that of 12 isolates from the same collection with the wild type gene sequence, i.e., without the polymorphism. The isolates with the polymorphism in the tcaA gene were on average less sensitive to teicoplanin (Fig. 6b). Using the pRMC2 complementing plasmid expressing either the wild type or SNP (conferring the Phe290-Ser substitution) containing tcaA gene, we demonstrated that this mutation significantly reduces the ability of the protein to sensitize the bacteria to serum (Fig. 6c), confirming that this mutation negatively affects the activity of the TcaA protein.

As TcaA has been shown to be upregulated when exposed to teicoplanin^24,35, we examined whether serum would also induce its expression. The wild type JE2 strain was exposed to either sub-inhibitory (2.5% serum and 0.5μg/ml teicoplanin) or inhibitory (10% serum and 10μg/ml teicoplanin) concentrations of either serum or teicoplanin for 20 mins, total RNA was extracted and the transcription of the tcaA gene quantified by qRT-PCR. For both serum and teicoplanin, induction of expression of the tcaA gene was concentration dependent (Fig. 6d). Given the association of WTA abundance in the cell wall with tcaA expression described above (Fig. 5a-c) we next examined whether serum induced expression of tcaA would also result in an increase in abundance of WTA in the bacteria cell wall. Both the wild type and tcaA mutant were exposed to inhibitory concentrations of human serum for 90 mins and the WTA extracted from the cell walls, where serum exposure resulted in an increase in WTA for the wild type strain but not the tcaA mutant (Fig. 6e; densitometric analysis of triplicate extractions can be found in Supp Fig. 3). To examine whether serum induced increased expression of tcaA would affect sensitivity to teicoplanin, we exposed the wild type bacteria to a sub-inhibitory concentrations of serum (2.5%) and then incubated these overnight in a subinhibitory concentration of teicoplanin (0.5μg/ml). Pre-exposure to serum induced increased sensitivity to teicoplanin suggesting that induction of tcaA expression by the initial serum exposure was sufficient to induce cross-sensitivity to the antibiotic (Fig. 6f).

To verify this induction effect was not specific to the JE2 lineage a tcaA::gfp reporter plasmid was constructed and electroporated into JE2, SH1000, Newman and a clinical CC22 isolate EMRSA15. In each background serum, arachidonic acid and LL37 had a dose dependent effect on tcaA expression with the exception of LL37 and the EMRSA15 strain (Supplementary. Fig. 4). These findings suggest that upon entry into the bloodstream and exposure to many of the antibacterial components of serum, expression of the tcaA gene is induced and this sensitizes S. aureus to killing by these components of serum.

The inactivation of tcaA alters the antibiotic resistance profile of S. aureus. There is emerging evidence that WTA play a role in cell division and peptidoglycan biosynthesis³⁶. In support of this, it has been reported that a tarO mutant, devoid of WTA, confers sensitization to β-lactam antibiotics due to mislocalization of the PBPs³⁷. As the target for teicoplanin is peptidoglycan, more specifically the terminal D-Ala-D-Ala residue of lipid II, we hypothesised that the increased ligation of WTA into the cell wall of the TcaA producing strain may affect peptidoglycan biosynthesis and assembly, and that this may be responsible for the change in sensitivity to teicoplanin. To test this further, we compared the sensitivity of the wild type and mutant to a range of peptidoglycan attacking antibiotics, where we found the TcaA producing wild type strain to be more sensitive to vancomycin, dalbavancin and oritavancin, all alternative members of the glycopeptide class of antibiotic, and ramoplanin, a glycolipodepsipeptide antibiotic (Supp. Fig. 5). However, TcaA production conferred decreased sensitivity to oxacillin, a β-lactam antibiotic that targets penicillin binding protein 2 and moenomycin a phosphoglycolipid antibiotic that inhibits the transglycosylase PBP enzymes and prevents the formation of peptidoglycan polymers (Supp. Fig. 5). This suggests that TcaA production affects the overall composition and structure of peptidoglycan in the wildtype strain.

To examine whether the crosslinking of peptidoglycan is affected by TcaA production, we tested the susceptibility of the wild type and tcaA mutant to lysostaphin, which is a glycylglycine endopeptidase capable of cleaving the pentaglycine crosslinks of peptidoglycan³⁸. We found that lysostaphin cleaved the cell wall of the wild type strain more slowly than for the tcaA mutant (Fig. 7a). We next performed a triton X100 induced autolysis assay where the wild type exhibited a slower rate of autolysis compared to the mutant, suggesting that the cell wall is stronger when TcaA is produced (Fig. 7b). Together these data suggest that the integrity of the peptidoglycan, in particular its crosslinking, is significantly altered when TcaA is produced. This provides a likely explanation for why the mutant is more resistant to teicoplanin, reduced crosslinking in the cell wall increases the number of off target D-ala D-ala which teicoplanin will bind to instead of reaching lipid II in the membrane and causing disruption to this. With changes to the quantity and composition of WTA and peptidoglycan associated with TcaA production, we sought to visualise the cell wall using transmission electron microscopy. We observed a clear difference in the density and structure of the outer layer of the bacterial cell wall between the wild type and tcaA mutant, confirming a role for TcaA in the structural integrity of the S. aureus cell wall (Fig. 7c, additional images in Supp. Fig. 6)).

Our data shows that expression of tcaA is induced upon exposure to serum, that this can sensitize the bacteria to serum killing but also increase the abundance of WTA in the cell envelope. From a pathogenicity perspective these activities would appear to be in conflict, with one making it less likely for a bacterium to cause bacteraemia (increased serum sensitivity) and the other making it more likely for a bacterium to cause bacteraemia (increased WTA in the cell envelope^39,40). To understand this apparent dichotomy we first examined whether TcaA production only affected survival in serum, whereas in whole blood where other components of the human immune system may be present (e.g. complement, antibodies and phagocytes) that this effect may be lost. Using human blood from three donors, we demonstrated that TcaA production increase the sensitivity of the bacteria to whole blood killing (Supp. Fig. 7). We next interrogated our human clinical data, where in addition to the 300 bacteraemia strains that form the basis of this study we have an additional 176 S. aureus isolates, which has allowed us to include more genetic diversity to this analysis (i.e. from CC22 (n=138), CC30 (n=162), ST8 (n=132) and ST93 (n=44)). The source of these isolates was also available to us (i.e. bacteraemia (n=341), SSTI (n=80) or carriage (n=55)), as well as their genome sequences (Supplementary Table 1). We examined the distribution of nonsynonymous mutations in the tcaA gene across these, where it was present in 6% of the bacteraemia isolates compared with only 1.5% of non-bacteraemia isolates (n= 21/341 and 2/135 respectively; p = 0.03, in a Fisher’s Exact test). However, when we examined the 30-day mortality rates for the 113 bacteraemia patients for whom we had this clinical data, the mortality rate of the proportion of patients infected with a S. aureus strain with the wild type tcaA gene was significantly higher compared to those infected with a mutated tcaA gene (Fig. 8a & b) (2-tailed chi squared test: p = 0.03). So, although the incidence of mutations in tcaA appear to be relatively rare, that isolates with variant tcaA genes are enriched amongst those causing bacteraemia suggests that a functional TcaA may limit the propensity of S. aureus to cause a bloodstream infection, such that it acts as a selective force for mutants of this gene. However, once the bacteraemia has become established, TcaA positively contributes to the infection process, likely due to the increased abundance of WTA in the cell envelope, and the greater structural integrity of the cell wall.

To experimentally test these human findings we utilised a mouse model of bacteraemia where the tail vein of C57/Bl6 mice are inoculated with 2 x 10⁷ colony forming units (CFU) of bacteria to establish a bloodstream infection, where they seed from there into organs such as the liver spleen and kidneys. We performed mixed infections, where the wild type and mutant bacteria had to compete during the development of the infection within the mouse. The mice were infected with equal quantities of both bacteria and the change in ratio of the bacteria in the mouse blood, liver, spleen and kidney recorded after 48hr, which allowed the relative virulence ratio (RVR) of each bacterium to be calculated⁴¹. The RVR of the TcaA producing wild type strain was significantly higher than that of the mutant at a systemic level (Fig. 8c). As such, while the TcaA associated self-sensitization of the bacteria was not evident here, possibly due to the size of the inoculum level needed, once an infection has become established, TcaA contributes positively to disease severity as demonstrated by the wild type strain outcompeting the tcaA mutant.

A list of the genetically amenable bacterial strains and mutants can be found in Table 3, and the clinical strains are listed in Supplementary Table 1. All strains were cultured in Tryptic soy broth (TSB) for 18 h at 37°C with shaking. Nebraska transposon mutant library (NTML)²³ mutants were selected for using erythromycin (5 μg/ml). For the complemented pRMC2⁴⁵ strains, chloramphenicol (10 μg/ml) and anhydrous tetracycline (200 ng/ul) were added to the media where indicated.

Normal human serum was prepared from blood obtained from 8 healthy volunteers using Serum CAT tubes (BD). Blood was allowed to clot for 30 mins at room temperature followed by 1h incubation on ice. Serum was extracted following two rounds of centrifugation at 700 x g at 4°C for 10 min. Serum from individual donors were pooled, aliquoted and immediately stored at −80°C. The bacteria were grown overnight, and their density normalised to an OD_600nm of 0.1 and 20 μl used to incubate in 180 μl 10% pooled human serum (diluted in PBS) for 90 min at 37°C with shaking. Serial dilutions were plated on tryptic soy agar (TSA) to determine CFUs. The same number of bacterial cells inoculated into PBS, diluted, and plated acted as a control. Survival was determined as the percentage of CFU in serum relative to the PBS control. Relative survival was determined through normalisation to JE2, which is presented ats 100% in the graphs. The survival of each bacterial isolate was measures in triplicate and the mean of these datal presented here.

Genome-wide association mapping was conducted using a generalized linear model, with capsule production as the quantitative response variable. We accounted for bacterial population substructure by adding to the regression model the first two component from a principal component decomposition of SNP data for each set of clinical samples (CC22 and CC30). The first two components accounted for 32% and 40% of the total variance for CC22 and CC30, respectively. In both cases, three distinct clusters were identified. We further considered a third model where we used cluster membership as covariates in our regression model, where clusters were defined using K-means clustering analysis (setting K=3); this, however, yielded identical results to the one based on PCA components. In total, 2066 (CC22) and 3189 (CC30) unique SNPs were analysed, the majority of which were subsequently filtered out for exhibiting a minor allele frequency (maf) of <0.03, reducing the data to 378 and 1124 SNPs, respectively. The P-values reported in Tables 1a and b are not corrected for multiple comparison, however the Sidak method was used to correct for multiple comparisons and both significance thresholds are indicated in the Manhattan plots.

Wildtype genes were amplified by PCR from JE2 genomic DNA using the primers shown in table 4 and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2⁴⁵ using KpnI and SacI restriction sites and T4 DNA ligase (NEB). This was transformed into RN4220 and eventually into the respective NTML mutants through electroporation.

Site directed mutagenesis was used to mutate the WT tcaA gene (Phe290) to the SNP tcaA (Ser290). Primers (5” ttttcaagttTcaaaacgtatggtc 3”, 5” atacgttttgaAacttgaaaatgcc 3”) were designed to have a complementary overlap of 21 nucleotides at the 5’ end, with the nucleotide to be mutated at the centre of the overlap (the primers had non complementary regions at the 3’ end to facilitate annealing on the template). The ptcaA template was diluted to 33 ng/μl, and 1ul was amplified using these primers and Phusion DNA polymerase. The PCR product was subsequently checked by agarose gel electrophoresis and was treated with 1 μl of DpnI directly in the PCR mix for 1 h at 37°C. Then 1 μl of the mixture was used to transform One Shot™ Mach1™ T1 (ThermoFisher) competent cells by heat shock then into RN4220 and finally tcaA::tn by electroporation.

The tcaA bursa aurealis transposon was phage transduced using the S. aureus phage Φ11⁵¹. The phage lysate of the donor strain (tcaA::tn) was prepared as follows: The donor strain was grown overnight in TSB for 18 h at 37°C with shaking. Two hundred microlitres of overnight culture was added to 25 ml of TSB containing 250 μl 1M MgSO₄, 250 μl 1M CaCl₂, 100 μl of Φ11 and left at 37°C with shaking until complete lysis was observed. The culture was subsequently pelleted at 12000 x g for 3 min. The supernatant containing the lytic phage was filtered sterilised and stored at 4°C. Next, recipient strains (Newman and SH1000) were grown overnight in 20 ml of LK broth (1% Tryptone 0.5% Yeast Extract, 0.7% KCl) and pelleted at 2500 x g for 10 min. The supernatant was removed, and the pellets resuspended in 1 ml of fresh LK broth. Two reactions were then set up, one containing phage and one as a non-phage control. To the tube containing the phage add: 250 μl of the recipient strain (SH1000 or Newman), 250 μl of phage lysate and 750 μl of LK broth containing 10 mM CaCl₂. To the tube containing the non-phage control add: 250 μl of the recipient strain (SH1000 or Newman) and 1 ml od LK broth containing 10 mM CaCl₂. Both reactions were incubated for 25 min at 37°C without shaking followed by 15 min at 37°C with shaking. Five hundred microlitres of ice cold 20 mM sodium citrate was added followed by centrifugation at 10000 x g for 10 min. Pellets were resuspended in 500 μl of 20 mM sodium citrate and incubated on ice for 2 h. One hundred microlitres of culture was plated out on TSA containing 5 μg ml^-1 erythromycin to select for the transposon. For the SH1000 phage transduction 100 μl was also plated out on oxacillin TSA plates as an added control to ensure there was no contamination of the phage lysate with JE2 tcaA::tn.

To determine the relative inhibition of growth of the wild type and tcaA mutant by antibiotics a broth microdilution method was used⁵². Briefly, overnight cultures were normalised to an OD_600nm of 0.1 in cation adjusted Mueller Hinton broth (MHB++) and 20 μl of resultant suspension used to inoculate 180 ul of fresh MHB++ containing a 1:2 dilution series of either arachidonic acid or teicoplanin (Sigma). The ability of the bacteria to survive the antibiotics was determined by quantifying bacterial growth (OD_600nm) using a CLARIOstar plate reader (BMG Labtech). For Fig. 2b 0.5μg/ml teicoplanin was used for the clinical CC22 isolates and for Fig. 2d: 1μg/ml was used for the JE2 pair, 2 μg/ml for the Newman pair and 4 μg/ml for the SH1000 pair.

Antimicrobial peptide susceptibility Human neutrophil defensin-1 (hNP-1) (AnaSpec Incorporated, California, USA) and LL-37 (Sigma) susceptibility assays were performed as described previously⁵³. Briefly, overnight cultures were normalised to an OD_600nm of 0.1 and incubated with 5 μg/mL of hNP-1 or LL-37 for 2 h at 37 °C. Serial dilutions were plated on tryptic soy agar (TSA) to determine CFUs. The same number of bacterial cells inoculated into PBS, diluted, and plated acted as a control. Survival was determined as the percentage of CFU on exposure to either LL-37 or HNP-1 relative to the PBS control. Relative survival was determined through normalisation to JE2.

Overnight cultures were back diluted to an OD_600nm of 0.05 in 50 ml of fresh TSB and grown to an OD_600nm of 2. Two hundred micro litres of either PBS, 25% serum (final concentration 2.5%, sub-inhibitory), 5 μg/ml teicoplanin (final concentration 0.5 μg/ml, sub-inhibitory), 100% serum (final concentration 10%, inhibitory), or 100 μg/ml teicoplanin (final concentration 10 μg/ml, inhibitory) was added to 1.8 ml of bacterial culture and incubated for 20 min. RNA was extracted by Quick-RNA Fungal/Bacterial Miniprep Kit (Zymo Research) according to the manufacturer’s instructions. RNA integrity was checked by running 5 μl aliquot of the RNA on a 1% agarose gel and observing the intensity of the ribosomal RNA (rRNA). RNA samples were treated by TURBO™ DNase (Invitrogen) to eliminate any genomic DNA contamination. To verify that the samples were free from any DNA contamination, RNA samples were subjected to RT-qPCR alongside a no template control and 2.5 ng of a known JE2 genomic DNA and threshold rates compared.

To quantify the expression of the tcaA RT-qPCR was performed using the housekeeping gyrB gene as a control. Complementary DNA (cDNA) was generated from mRNA using qScript^® cDNA Synthesis Kit (Quantabio). Following the manufacturers protocol the cDNA was used as a template for the RT-qPCR reaction. Primers used were as follows gyrB FW 5’ ggtgactgcattagatgtaaac 3’, gyrB RV 5’ ctgcttctaaaccttctaatacttgtatttg 3’, tcaA FW 5’ tagtttgcgcttcaggtg 3’, tcaA RV 5’ tgtggacataaatttgatagtcgtc 3’. The RT-qPCR reaction was performed as follows: 10 μl 2x KAPA SYBR Mix, 1 μl of 10 μM forward primer, 1 μl of 10 μM reverse primer, 5 μl cDNA and RNase-free water up to a total of 20 μl volume. The RT-qPCR was performed on a Mic qPCR cycler (bio molecular systems) and the cycling conditions consisted of an initial denaturation step of 95°C for 2 min, followed by 40 cycles of two step cycling: 95°C 15 s, 60°C 1 min. RT-qPCR was carried out in technical triplicate for each sample and 3 biological repeats. The ratio of tcaA to gyrB transcript number was calculated using the using the 2^-(ΔΔCt) method⁵⁴.

Crude WTA from murein sacculi was extracted for analysis by PAGE using adaptations of a previously described methodology^55,56. Overnight cultures were washed once in buffer 1 (50 mM MES, pH 6.5) followed by centrifugation at 5,000 g. Cells were resuspended in buffer 2 (4% [wt/vol] SDS, 50 mM MES, pH 6.5) and boiled for 1 h. Sacculi were centrifuged at 5,000g and washed once in buffer 1, once in buffer 2, once in buffer 3 (2% NaCl, 50 mM MES, pH 6.5), once more in buffer 1 and finally resuspended in digestion buffer (20 mM Tris-HCl pH 8.0, 0.5% [w/v] SDS). To the digestion buffer suspension, 10 μl of proteinase K solution (2 mg/ml) was added and incubated on a heat block 50°C for 4 h at 1,400 rpm. Sacculi were centrifuged at 16,000 g and washed once in buffer 3, followed by 3 washes in dH₂O to removed SDS. Sacculi were responded in 0.1M NaOH and incubated for 16 h at room temperature at 1,400 rpm. Following the incubation, the sacculi were centrifuged at 16,000g, leaving the teichoic acids in the supernatant. 250 μl of 1 M Tris-HCL pH 6.8 was added to neutralise the NaOH and stored at −20°C.

WTA was also precipitated from the supernatant of overnight culture by adding 3 volumes of 95% ethanol and incubation at 4°C for 2 h. Precipitated material was separated by centrifugation at 16,000 g for 15 min, washed once in 70% ethanol and resuspended in 100 mM Tris-HCL (pH 7.5) containing 5 mM CaCl₂, 25 mM MgCl₂, DNase (10 μg/ml) and RNase (50 μg/ml) and incubated for 3 h at 37°C. The enzymes were heat inactivated at 95°C for 3 min. The supernatant WTA preparations were similarly stored at −20°C before being analysed by PAGE.

WTA preparations were separated on tricine polyacrylamide gels using a BioRad tetra cell according to a previously described method⁵⁶. The gels were separated at 4°C using a constant amperage of 40 mA under constant stirring until the dye front reached the bottom. Gels were washed 3 times in MilliQ H₂O followed by staining in 1 mg/ml Alcian blue overnight. Gels were subsequently destained in in MilliQ H₂O, until the WTA became visible and finally imaged.

Overnight cultures of JE2, tcaA, and lcpA mutants were pelleted, and the supernatant saved. Growth inhibition assays were subsequently performed by adding 20 μl of OD_600nm 0.1 bacterial suspension to 180 μl 10% overnight supernatant diluted in fresh MHB++ containing doubling concentrations of arachidonic acid (Sigma). Purified WTA extracts were also added to the growth media at a final concentration of 2%. The ability of the bacteria to survive the arachidonic acid was determined by quantifying bacterial growth (OD_600nm) following 24 h at 37°C using a CLARIOstar plate reader (BMG Labtech).

A cytochrome c binding assay was used to measure the relative surface charge of the bacteria⁵⁷. Briefly, overnight cultures were normalized to an OD_600nm of 8. The bacterial suspensions were washed twice in MOPS buffer (20 mM pH 7.0) and finally resuspended in 200 μl of MOPS buffer. Samples were then combined with 50 μl of cytochrome C (equine heart Sigma, 2.5 mg/ml in MOPS buffer) and incubated for 10 min at room temperature. Finally, samples were pelleted (16,000 × g for 1 min) and 200 μl of supernatant read for absorbance at Abs_530nm using a SUNRISE Tecan microplate reader.

A tcaA promoter-gfp fusion (pSB2019:tcaA) was constructed to determine expression of tcaA in response to several antimicrobial components of serum. A region of 289 bp upstream of the tcaA gene⁵⁸ was amplified by PCR from JE2 genomic DNA using the primers tcaA_promoter FW 5’-atatgaattcagtattagaagtcatcaatca −3’ and tcaA_promoter RV 5’-atatccccgggtttcacctcaattctgttcct-3’. The pSB2019 vector was prepared by digesting pSB2031⁵⁹ from a previous study with EcoRI and SmaI to remove the RNAIII P3 promoter. The tcaA promoter region was also digested with EcoRI and SmaI and ligated into pSB2019 using T4 DNA ligase (NEB). This was transformed into DC10B³⁴, a strain of E. coli which mimics the adenine methylation profile of some S. aureus clonal complexes (including CC8 and CC22). The plasmid was then extracted and transformed into final strains via electroporation.

S. aureus strains carrying the pSB2019:tcaA plasmid were grown overnight in TSB with 10ug/ml chloramphenicol. Each strain was then normalized to an OD_600nm of 0.05 in fresh TSB and subcultured to an OD_600nm of 0.5-0.6. Cultures were washed in PBS and concentrated to an OD_600nm of 1 in PBS. 100 ul of bacteria was combined with 100 ul of the appropriate antimicrobial compound (arachidonic acid or LL-37) in a black 96-well plate. GFP Fluorescence (485_nm excitation/520_nm emission/1000 gain) was measured in a PHERAstar FSX plate reader (BMG Labtech) over 2.5 h (readings every 30 min with 200 rpm shaking).

Overnight cultures were back diluted to an OD_600nm of 0.05 in 20 mL of fresh TSB and grown to an OD_600nm 0.5-0.7. Cultures were normalised to give 1 ml of OD_600nm 0.6. Lysostaphin was subsequently added to give a final concentration of 0.5 μg/mL. 200 μL of each strain was then added to a 96-well plate and incubated for 3 h at 37°C in a CLARIOstar plate reader. OD_600nm readings were taken every 10 min (500 rpm shaking before readings). Values were blank corrected according to 200 μL of PBS. The PBP4::tn mutant was included as a control.

Overnight cultures were back diluted to an OD_600nm of 0.05 in 20 mL of fresh TSB and grown to an OD_600nm 0.5-0.7. Cells were washed once in ice cold water (13,000 rpm 1 min) and resuspended in autolysis buffer (water containing 0.1% Triton X-100) to give an OD_600nm of 1. 200 μL of each strain was then added to a 96-well plate alongside 200 μL of strains resuspended in water as a negative control and 200 ul of water as a blank. The atl::tn strain was used as a positive control. Strains were grown for 6 h at 37°C in a CLARIOstar plate reader. OD_600nm readings were taken every 30 min (500 rpm shaking before readings). The rate of autolysis was calculated as follows; (ODt0-ODtn/ODt0).

S. aureus strains JE2 and the TcaA mutant were pelleted in microfuge tubes and fixed by resuspending in 2.5% glutaraldehyde in cacodylate buffer (pH 7.3) kept at fridge temperatures until fixation was complete and then stored in the fridge. Pellets were resuspended in a BSA/glutaraldehyde gel at 10-20°C which sets after the cells were recentrifuged into a pellet. The pellets were postfixed with osmium ferrocyanide/osmium tetroxide mix in cacodylate buffer, en bloc stained with uranyl acetate (2%) and Walton’s lead aspartate solutions, prior to dehydration in ethanol and infiltration with propylene oxide and Epon resin mix. Embedded blocks were polymerised for 24-48 hours at 60°C. Sections (70nm) were cut on a Leica UC7 ultramicrotome and imaged using a FEI Tecnai T12 microscope.

For survival studies, C57/Bl6 mice were injected with 5X10⁷ CFU of JE2 or tcaA::tn via the tail vein. Mice were culled at specific time points post challenge and blood collected by cardiac puncture. Blood was diluted in sterile PBS and plated on TSA to determine CFU/ml. For the mixed infection bacteriemia model, female, 7-8 week-old, C57BL/6NCrl mice (Charles River Laboratories) were used. Bacteria were prepared as described previously⁶⁰. Briefly, 1:100 dilutions of overnight bacterial cultures were grown to mid-log phase (~2h) in TSB with shaking at 180 r.p.m. at 37 °C. Bacteria were then harvested, washed with PBS and adjusted spectrophotometrically at OD_600nm to obtain the desired bacterial concentration of ~4.8 × 10⁸ CFU/mL. A 50:50 mixture of JE2 and tcaA::tn were made and 100 μl was injected intravenously via the tail vein. The final CFU for each strain per mouse was ~2.4 × 10⁷ CFU. After 48 hours, terminal cardiac bleeds were performed on anesthetized mice and whole blood was transferred into heparin tubes (Sarstedt) and mixed to prevent coagulation. Mice were then euthanized by CO₂ inhalation. Organ homogenates of spleens, livers and kidneys were performed as previously described⁶¹ and serial dilutions of each sample were plated onto TSA plates with and without erythromycin (5 μg/ml) for bacterial enumeration. The CFU of JE2 was calculated by subtracting CFU on TSA with erythromycin (tcaA::tn only) from CFU on TSA plates (JE2 and tcaA::tn).

C57/Bl6 mice were bred in-house in Trinity College Dublin and C57BL/6NCrl mice were purchased from Charles River Laboratories. Mice were housed under specific pathogen-free conditions at the Trinity College Dublin Comparative Medicines unit and maintained under pathogen-free conditions in an Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC)-accredited animal facility in NIAID, NIH, respectively. All mice were female and used at 6–8 weeks. All animal experiments were conducted in accordance with the recommendations and guidelines of the health product regulatory authority (HPRA), the competent authority in Ireland and in accordance with protocols approved by Trinity College Dublin Animal Research Ethics Committee and according to the regulations of NIAID’s Division of Intramural Research Animal Care and Use Committee (DIR ACUC), animal study proposal LB1E. For the human serum collection, all healthy volunteers provided written informed consent and all methods and experimental protocols were carried out in accordance with the recommendations of the University of Bath, Research Ethics Approval Committee for Health. The present study was approved by the University of Bath, Research Ethics Approval Committee for Health [reference: EP 18/19 108].

Paired two-tailed student t-test or One-way ANOVA (GraphPad Prism v9.0) were used to analyse the observed differences between experimental results. A p-value <0.05 was considered statistically significant.